Patent application title: Method of Diagnosis/Prognosis of Human Chronic Lymphocytic Leukemia Comprising the Profiling of Lpl/Adam Genes
Inventors:
Frederic Davi (Meudon, FR)
Guillaume Dighiero (Paris, FR)
Gerard Dumas (Juziers, FR)
Pablo Oppezo (Paris, FR)
Catherine Settegrana (Antony, FR)
Yuri Vasconcelos Pinheiro (Goiania-Goias, BR)
Assignees:
INSTITUT PASTEUR
Assistance Publique - Hopitaux De Paris
Centre National de la Recherche
IPC8 Class: AC12Q168FI
USPC Class:
435 6
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving nucleic acid
Publication date: 2008-10-23
Patent application number: 20080261212
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Method of Diagnosis/Prognosis of Human Chronic Lymphocytic Leukemia Comprising the Profiling of Lpl/Adam Genes
Inventors:
Frederic Davi
Guillaume Dighiero
Gerard Dumas
Pablo Oppezo
Catherine Settegrana
Yuri Vasconcelos Pinheiro
Agents:
OBLON, SPIVAK, MCCLELLAND MAIER & NEUSTADT, P.C.
Assignees:
INSTITUT PASTEUR
Origin: ALEXANDRIA, VA US
IPC8 Class: AC12Q168FI
USPC Class:
435 6
Abstract:
The present invention provides methods of diagnosis and prognosis of human
chronic lymphocytic leukemia (CLL) in a patient in need thereof and
methods to determine IgVH mutational status. The methods of the present
invention involve measuring the expression profile of two known genes:
LPL and ADAM29; and comparing the ratio of their expression to diagnose
the presence of CLL or to prognose the likelihood of developing CLL or
the symptoms consistent with CLL.Claims:
1. An in vitro method of identifying a subject with a significant
probability of having lymphocytic leukemia in a subject in need thereof,
comprising:determining the gene expression levels of LPL and ADAM29 in a
sample containing mRNA obtained from said subject; anddesignating said
subject as having a significant probability of having lymphocytic
leukemia if said determining evidences expression of at least one of LPL
and ADAM29 in said sample.
2. The method according to claim 1, further comprising, prior to said determining, extracting a specimen from said subject, wherein said specimen contains mRNA.
3. The method according to claim 2, wherein said specimen contains at least one biological material selected from the group consisting of peripheral mononuclear blood cells, a tissue containing B cells, and extracted B cells.
4. The method according to claim 3, wherein said specimen is a peripheral blood sample.
5. The method according to claim 1, wherein said subject is a human.
6. The method according to claim 1, wherein said determining is by an amplification method.
7. The method according to claim 6, wherein said amplification method is a PCR method and is selected from the group consisting of real-time PCR and multiplex PCR.
8. The method according to claim 1, further comprising classifying said lymphocytic leukemia as chronic lymphocytic leukemia by classifying the IgVH mutational status of said subject based on the expression ratio of LPL and ADAM29.
9. An in vitro method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia, comprisingdetermining the gene expression levels of LPL and ADAM29 in a peripheral blood sample obtained from said subject;evaluating the LPL/ADAM29 gene expression ratio; andclassifying the IgVH gene as:mutated if the LPL/ADAM29 ratio is less than one, orunmutated if the LPL/ADAM29 ratio is greater than or equal to one.
10. The method according to claim 9, wherein said determining is by an amplification method.
11. The method according to claim 10, wherein said amplification method is a PCR method and is selected from the group consisting of real-time PCR and multiplex PCR.
12. The method according to claim 9, further comprising validating the IgVH mutational status wherein said validating comprisesdetermining the percentage of CD3+ CD56+ cells present in a specimen obtained from said subject that are positive for ZAP-70 intracellular expression; andclassifying the IgVH gene sequence as:mutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is less than 20%, orunmutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is greater than or equal to 20%.
13. An in vitro method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia, comprisingperforming on a a sample containing mRNA from said subject, a competitive multiplex PCR assay in the presence of PCR primers for LPL and ADAM29, wherein said PCR primers are SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO:5, and SEQ ID NO:6,separating the PCR amplification product; andclassifying the IgVH mutational status by determining the relative intensities of the bands corresponding to 410 bp and 445 bp, wherein the 410 bp band corresponds to LPL and the 445 bp band corresponds to ADAM29; and whereinwhen the intensity of the band at 410 bp is greater than the intensity of the band at 445 bp or when there is only a single band at 410 bp then the IgVH mutational status is classified as being unmutated; andwhen the intensity of the band at 410 bp is less than the intensity of the band at 445 bp or when there is only a single band at 445 bp then the IgVH mutational status is classified as being mutated.
14. The method according to claim 13, wherein said sample contains at least one biological material selected from the group consisting of peripheral mononuclear blood cells, a tissue containing B cells, extracted B cells, and pre-extracted mRNA.
15. The method according to claim 13, wherein when the intensity of the band at 410 bp and the band at 445 bp are both present, said method further comprises validating the IgVH mutational status.
16. The method according to claim 15, wherein said validating comprisesdetermining the gene expression levels of LPL and ADAM29 in a sample containing mRNA from said subject;evaluating the LPL/ADAM29 gene expression ratio; andclassifying the IgVH gene as:mutated if the LPL/ADAM29 ratio is less than one, orunmutated if the LPL/ADAM29 ratio is greater than or equal to one
17. The method according to claim 16, further comprising, prior to said determining, obtaining a specimen from said subject, wherein said specimen contains mRNA.
18. The method according to claim 17, wherein said specimen contains at least one biological material selected from the group consisting of peripheral mononuclear blood cells, a tissue containing B cells, and extracted B cells.
19. The method according to claim 16, wherein said classifying is confirmed by a method comprisingdetermining the percentage of CD3+ CD56+ cells present in a specimen obtained from said subject that are positive for ZAP-70 intracellular expression; andclassifying the IgVH gene sequence as:mutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is less than 20%, orunmutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is greater than or equal to 20%.
20. An in vitro method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia, comprisingperforming on a sample containing mRNA from said subject, a competitive multiplex PCR assay in the presence of PCR primers for LPL and ADAM29, wherein said PCR primers are selected such that the size differences between the bands corresponding to LPL and ADAM29 are resolvable by electrophoresis,separating the PCR amplification product; andclassifying the IgVH mutational status by determining the relative intensities of the bands corresponding to LPL and ADAM29, whereinwhen the intensity of the band corresponding to LPL is greater than the intensity of the band corresponding to ADAM29 or when there is only a single band corresponding to LPL then the IgVH mutational status is classified as being unmutated; andwhen the intensity of the band corresponding to LPL is less than the intensity of the band corresponding to ADAM29 or when there is only a single band corresponding to ADAM29 then the IgVH mutational status is classified as being mutated.
21. The method according to claim 20, wherein said sample contains at least one biological material selected from the group consisting of peripheral mononuclear blood cells, a tissue containing B cells, extracted B cells, and pre-extracted mRNA.
22. The method according to claim 20, wherein when the intensity of the band at 410 bp and the band at 445 bp are both present, said method further comprises validating the IgVH mutational status.
23. The method according to claim 22, wherein said validating comprisesdetermining the gene expression levels of LPL and ADAM29 in a sample containing mRNA from said subject;evaluating the LPL/ADAM29 gene expression ratio; andclassifying the IgVH gene as:mutated if the LPL/ADAM29 ratio is less than one, orunmutated if the LPL/ADAM29 ratio is greater than or equal to one
24. The method according to claim 23, further comprising, prior to said determining, obtaining a specimen from said subject, wherein said specimen contains mRNA.
25. The method according to claim 24, wherein said specimen contains at least one biological material selected from the group consisting of peripheral mononuclear blood cells, a tissue containing B cells, and extracted B cells.
26. The method according to claim 23, wherein said classifying is confirmed by a method comprisingdetermining the percentage of CD3+ CD56+ cells present in a specimen obtained from said subject that are positive for ZAP-70 intracellular expression; andclassifying the IgVH gene sequence as:mutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is less than 20%, orunmutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is greater than or equal to 20%.
27. An in vitro method of distinguishing in a subject in need thereof between whether said subject has an aggressive form of chronic lymphocytic leukemia or an indolent form of chronic lymphocytic leukemia comprisingdetermining the gene expression levels of LPL and ADAM29 in a specimen obtained from said subject;designating the subject as having a significant probability of havingan aggressive form of chronic lymphocytic leukemia if the LPL gene is overexpressed; oran indolent form of chronic lymphocytic leukemia if the ADAM29 gene is overexpressed.
28. The method according to claim 27, wherein said specimen contains at least one biological material selected from the group consisting of peripheral mononuclear blood cells, a tissue containing B cells, and extracted B cells.
29. An in vitro method of identifying a subject suspected of having a lymphocytic leukemia in a subject in need thereof, comprising:determining the gene expression levels of LPL and ADAM29 in a sample obtained from said subject; andcomparing said expression to a standard expression level of said genes in a normal subject.
30. A method according to claim 29, wherein said gene expression level is determined by measuring mRNA, cDNA or protein expression level.
31. A method according to claim 29, wherein the lymphocytic leukemia is a chronic lymphocytic leukemia.
32. A kit for detecting lymphocytic leukemia in a subject suspected of having the same, comprising (a) primers that hybridize with the LPL gene, (b) primers that hybridize with the ADAM29 gene, (c) and at least one housekeeping gene.
33. The kit according to claim 32, wherein said components are individually packaged.
34. The kit according to claim 32, further comprising at least one component selected from the group consisting of primers specific for the housekeeping gene and reagents for amplification.
35. The kit according to claim 32, further comprising instructions for using of the components contained in the kit.
Description:
BACKGROUND OF THE INVENTION
[0001]1. Field of the Invention
[0002]The present invention provides methods of diagnosis and prognosis of human chronic lymphocytic leukemia (CLL) in a patient in need thereof. The methods of the present invention involve measuring the expression profile of two known genes: LPL and ADAM29; and determining the ratio of their expression to diagnose the presence of CLL or to prognose the likelihood of developing CLL, an aggressive or a stable form of the disease or the symptoms consistent with CLL.
[0003]2. Discussion of the Background
[0004]Chronic lymphocytic leukemia (CLL) displays a variable outcome. The classical Rai1 or Binet2 staging systems have allocated CLL cases into three major risk groups (low [stage 0 in Rai's and stage A in Binet's classification system], intermediate [stages I and II in Rai's and stage B in Binet's classification system], and high [stage III and IV in Rai's and stage C in Binet's classification system]), according to tumor burden and the presence of anemia and thrombocytopenia. These staging systems have provided a basis for therapeutic stratification. Asymptomatic patients with a low tumor burden (Binet stage A) do not benefit from treatment with chlorambucil. However, the disease in half of these patients will progress and both staging systems fail to initially identify such patients. The advent of new treatments such as purine analogues and monoclonal antibodies directed against CD20 and CD52 are able to induce complete remissions and may allow early treatment for asymptomatic patients whose disease is likely to progress.3 Accurate identification of these patients is therefore increasingly important.
[0005]Serologic markers such as lactic dehydrogenase, beta2-microglobulin4, soluble CD235 and thymidine kinase4, 6 are essentially indicators of disease activity and/or load, although some can anticipate disease progression7. Phenotypic expression of CD38 has been associated with aggressive diseases8, but the threshold level for positive cases, if it exists at all, remains a matter of debate.9-11 Genomic aberrations correlate well with either good (isolated 13q.sup.-) or poor (17p.sup.-; 11p.sup.-) prognosis in CLL10, 12, 13, though their occurrence as a second malignant hit cannot be definitely excluded.
[0006]The mutational status of immunoglobulin heavy chain variable (IgVH) genes has been considered as the best prognostic marker in CLL. In an initial study, the present inventors observed that at least half of CLL cases carried mutations using a cut-off of 98% germline homology.14 This was further confirmed by others,15 some of which also correlated the IgVH mutational status to clinical behavior.8, 16, 17 Mutated (MT) patients usually demonstrate a favorable evolution when compared to unmutated (UM) cases (≧98% germline homology), which are characterized by progressive disease, continuing treatment needs and a high proportion of CLL-related deaths. This analysis remains costly, time-consuming and inaccessible for most medical facilities. Consequently, the detection of appropriate, reliable surrogate markers for IgVH mutational status has retained worldwide attention.
[0007]CD38 was the first candidate proposed to replace IgVH sequencing,8 with positive and negative cases corresponding respectively to UM and MT patients, but finally demonstrated insufficient specificity (about 30% discordance for each group).11 In addition, its expression can vary during the course of disease.11 Surprisingly, recent reports indicated that ZAP-70 mRNA, normally expressed in T and NK lymphocytes, is also transcribed in CLL B-cells lacking IgVH mutations.18, 19 Two further series have confirmed these findings at the protein level,20, 21 suggesting a pivotal role for ZAP-70 in prediction of IgVH mutational status. There is however some controversy to whether ZAP-70 is really a good surrogate marker since two recent reports failed to demonstrate a significant concordance between its expression and the degree of somatic mutation in the IgVH genes.22, 23
[0008]Accordingly, there remains a critical need for a safe, inexpensive and accurate means to diagnose CLL and prognostic methods involving the same.
[0009]To address this need, in a study of gene expression profiling performed on 18 CLL cases, the present inventors identified a limited set of genes (n=85), which were expressed differentially between progressive UM and stable MT CLLs (Vasconcelos, et al., Leukemia, 2005, 11, 2002-5). These results were validated by real-time quantitative polymerase chain reaction (RQ-PCR) for 18 genes on the same cDNAs that were hybridized on the DNA chips. From these RQ-PCR experiments, 4 genes in addition to ZAP-70 appeared to provide a better segregation of the 2 groups of CLLs. They included the lipoprotein lipase (LPL) and spartin (SPG20) genes, whose expression was higher in UM patients, while a disintegrin and metalloproteinase 29 (ADAM29) and nuclear receptor-interacting protein 1 (NRIP1) genes were found at much higher levels in MT cases. These findings led the present inventors to investigate, in an independent and larger CLL series, which of these 4 genes (isolated or in combination) could represent the best surrogate marker for IgVH mutational status, and how they would compare to ZAP-70 protein expression.
SUMMARY OF THE INVENTION
[0010]It is an object of the present invention to provide a method of identifying a subject suspected of having a lymphocytic leukemia by determining the gene expression levels of LPL and ADAM29 in a sample obtained from a subject; and comparing the expression levels to a standard expression level of the corresponding genes in a normal subject. In this method, the gene expression level is determined by measuring mRNA, cDNA or protein expression level.
[0011]It is an object of the present invention to provide a in vitro method of identifying a subject with a significant probability of having lymphocytic leukemia in a subject in need thereof by determining the gene expression levels of LPL and ADAM29 in B cells and designating the subject as having a significant probability of having chronic lymphocytic leukemia when expression of at least one of LPL and ADAM29 is detected in said B cells. In this object and those that follow, B-cells may be obtained from any source that contains the same, including: peripheral mononuclear blood cells, tissues naturally bearing B-cells such as backbone, ganglions, spleen, mucosa, and skin, or tissues in which B-cells do not naturally reside, such as a tissue has been infiltrated by malignant (tumor) cells.
[0012]Further, the above object may be performed using a sample containing previously extracted mRNA (e.g., a mRNA bank), thereby obviating the need to obtain a cellular sample and, thus, an object of the present invention includes a method of identifying a subject with a significant probability of having chronic lymphocytic leukemia in a subject in need thereof by determining the gene expression levels of LPL and ADAM29 in a sample containing mRNA and designating the subject as having a significant probability of having chronic lymphocytic leukemia when expression of at least one of LPL and ADAM29 is detected in said sample.
[0013]It is another object of the present invention to provide an in vitro predictive method for determining the mutational status of the IgVH genes and classifying said IgVH mutational status of a subject by evaluating the LPL/ADAM29 gene expression ratio in a sample containing mRNA; and classifying the IgVH gene on the basis of this ratio. In this object of the present invention, the sample containing mRNA may be either cellular (e.g., a peripheral blood) or previously extracted (e.g., a mRNA bank).
[0014]It is another object of the present invention to validate the classification of the disease based on IgVH mutational status determined by the LPL/ADAM29 gene expression ratio by either: (a) direct sequencing of the IgVH genes, or (b) by determining the percentage of CD19+CD3- CD56- lymphoid cells present in a peripheral blood sample that are positive for ZAP-70 intracellular expression.
[0015]Yet another object of the present invention is to provide a method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia by performing a competitive multiplex PCR assay to determine the preferential expression of LPL and ADAM29.
[0016]Still another object of the present invention is to provide a prognostic method to determine event free survival of a subject having chronic lymphocytic leukemia.
[0017]The present invention provides a method of allowing accurate estimation of the prognosis in a patient having chronic lymphocytic leukemia, by designating the subject as having a significant probability of having an aggressive form of the disease if there is overexpression of the LPL gene or an indolent form of the disease if there is overexpression of ADAM29 gene.
[0018]The above objects highlight certain aspects of the invention. Additional objects, aspects and embodiments of the invention are found in the following detailed description of the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0019]A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following Figures in conjunction with the detailed description below.
[0020]FIG. 1. Flow cytometry analysis of ZAP-70 expression.
[0021](A) The lymphocyte population was first gated (region R1) on forward and side scatter histogram (left). The CLL cells (CD-19+) were then selected (gate R2), as well as the T cell (CD3+) and NK (CD-56+) populations (gate R3), as shown on right side histogram. (B) and (D) Biparametric plots of ZAP-70 or isotype-match control antibody (CD14) expression on different cell populations. The level of expression of ZAP-70 on T and NK cells (middle plots) served to determine a threshold, which was then used to quantify its expression on B cells (right plots). Left plots show the absence of fixation of the isotype-match control antibody on lymphocytes. (C) and (E) Monoparametric histograms of ZAP-70 or isotype-match control antibody (CD14) expression on different cell populations. The light and dark gray histograms correspond to B and NK cell staining respectively. The black overlaid histogram shows the absence of fixation of the isotype-match control antibody on lymphocytes. Expression of ZAP-70 on CD3+ CD56+ cells (M1) served to determine the percentage of CLL cells that were positive for ZAP-70. The percentage of B cells expressing ZAP-70 is indicated. (B) and (C) panels illustrate a ZAP-70 negative CLL case, while panels (D) and (E) show a ZAP-70 positive case. Abbreviations: B, B cell; T, T cell; NK, natural killer; IC, isotype-matched control.
[0022]FIG. 2. Correlations between LPL/ADAM29 ratio or ZAP-70 expression and the IgVH gene mutational status.
[0023]The threshold values calculated for the L/A ratio (=1) and ZAP-70 (20%) showing the best concordance rate with the IgVH mutational status, as determined by using Youden's index, are indicated by a horizontal line.
[0024]FIG. 3. Kaplan-Meier survival curves in CLL according to IgVH mutational status, L/A ratio or ZAP-70 expression.
[0025](A) Event-free survival probabilities for the total population. (B) Event free survival probabilities for stage A patients. (C) Overall survival probabilities for stage B and C patients.
[0026]FIG. 4. Multiplex PCR determination of LPL and ADAM29 expression.
[0027]LPL and ADAM29 transcripts were amplified simultaneously, the PCR products were then separated by electrophoresis on agarose gel and visualised under UV illumination after ethidium bromide staining. Amplification of the GAPDH gene from the same transcripts served as control of cDNA integrity. MWM indicates molecular weight marker, MT, mutated; UM, unmutated; B, purified B cells from a healthy individual; T, Jurkatt T-cell line.
DETAILED DESCRIPTION OF THE INVENTION
[0028]Unless specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled artisan in enzymology, biochemistry, cellular biology, molecular biology, and the medical sciences.
[0029]All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and are not intended to be limiting, unless otherwise specified.
[0030]The state of the oncological arts suggests that chronic lymphocytic leukemia (CLL) patients expressing mutated (MT) IgVH genes display good prognosis when compared to patients expressing unmutated (UM) IgVH genes. However, heretofore, it has been difficult and costly to extend this study to routine practice. As such, there is a strong need for surrogate markers to distinguish IgVH status and, thus, prognostic indicators for CLL patients.
[0031]ZAP-70 has been shown to be overexpressed in patients displaying UM IgVH genes. The speculation that ZAP-70 gene expression could differentiate MT from UM CLLs has emerged from microarray experiments,18, 19 and was further confirmed at the protein level by flow cytometry.20, 21 In the examples of the present invention, the present inventors evaluated ZAP-70 expression in CLL cases. The threshold value which best correlated with the IgVH mutational status was found to be 20%, similar to that described by Crespo et al.,20 but higher than that used by Orchard et al. (10%).21 Discordant results were obtained in 16% of patients, a rate slightly higher than that observed with the L/A ratio (10%; see below), and occurred more frequently among MT CLLs (10%) than UM CLLs (5%). This level of discordance was also higher than that reported by the 2 aforementioned studies (respectively 5.4% and 7.8%). Both reports identified ZAP-70 negative cases with UM IgVH genes, some of which had an apparently stable disease, similarly to the present inventors' findings. Conversely, Orchard et al. described ZAP-70 positive cases with MT IgVH genes, although all had a 96%-97% homology.21 In contrast 4 of the patients described below in this group expressed IgVH genes with less than 95% homology, with 3 of them having a stable disease. Therefore a clear dissociation between ZAP-70 expression and IgVH mutational status exists within a subset of patients, thus indicating that ZAP-70 alone is an insufficient surrogate marker for CLL prognosis.
[0032]The recent development of microarray technology has allowed the discovery of genes, which may have prognostic significance in human tumors. A gene expression profiling study in CLL led the present inventors to identify 4 genes that appeared to best segregate stable MT from progressive UM forms (Vasconcelos et al., Leukemia, 2005, 11, 2002-5). LPL and SPG20 were expressed preferentially UM CLL, while ADAM29 and NRIP1 had a predominant expression in MT CLL.
[0033]As described herein, the present inventors have monitored the expression levels of these genes on a large series of CLL patients and evaluated the correlation with the IgVH mutational status and clinical outcome. Both LPL and ADAM29 were found to correlate better with the IgVH mutational status than SPG20 and NRIP1. Even better results were obtained when combining LPL and ADAM29 by a simple ratio of their normalized expression values, reaching 90% concordance. The L/A ratio thus constitutes a suitable surrogate marker of the IgVH mutational status in CLL.
[0034]LPL is a heparin-releasable enzyme bound to glycosaminoglycan components of the capillary endothelium, and is particularly abundant in muscle, adipose tissue and macrophages. As used in the context of the present invention LPL is preferably the human sequence (gene=SEQ ID NO: 11; protein=SEQ ID NO: 12). LPL is also known to exist in the following organisms: Rattus noivegicus (UniGene Rn.3834; gene sequence=SEQ ID NO: 13; protein sequence=SEQ ID NO: 14), Mus musculus (UniGene Mm.1514; gene sequence=SEQ ID NO: 15; protein sequence=SEQ ID NO: 16), Gallus gallus (UniGene Gga.1152; gene sequence=SEQ ID NO: 17; protein sequence=SEQ ID NO: 18), Canis familiaris (UniGene Cfa.3489; gene sequence=SEQ ID NO: 19; protein sequence=SEQ ID NO: 20), Bos taurus (UniGene Bt.5387; gene sequence=SEQ ID NO: 21; protein sequence=SEQ ID NO: 22), and Caenorhabditis elegans (UniGene Cel.18189; gene sequence=SEQ ID NO: 23; protein sequence=SEQ ID NO: 24). With apolipoprotein CII, LPL mediates the hydrolysis of triacylglycerol component of circulating chylomicrons and very low-density lipoproteins. It plays a central role in lipid metabolism and transport.29, 30 Mutations in the LPL gene are frequently associated with dyslipidemia and atherosclerosis.29, 31 In line with the present inventors findings on normal cells, other investigators have failed to detect LPL expression in normal purified B and T lymphocytes.32 However, they found that it was expressed and secreted by NK cells, where it was shown to modulate their cytotoxic activity. Reasons for its high expression in UM CLL B-cells are unknown.
[0035]The ADAM29 gene encodes a member of the disintegrin and metalloprotease family of transmembrane proteins, which have been shown to mediate cell-cell and/or cell-matrix interactions as well as the proteolytic shedding of cell surface molecules.33, 34 In contrast to other ADAMs that are expressed in various tissues, ADAM29 transcripts are highly restricted to the testis.35 The origin of ADAM29 over-expression in MT CLL B cells remains speculative. As used in the context of the present invention ADAM29 is preferably the human sequence (gene=SEQ ID NO: 25; protein=SEQ ID NO: 26). ADAM29 is also known to exist in the following organisms: Mus musculus (UniGene Mm.67684; gene sequence=SEQ ID NO: 27; protein sequence=SEQ ID NO: 28).
[0036]The present invention also embraces the following LPL and ADAM29 gene sequences. [0037]LPL: Hs. 180878 (UniGene) NM 000237 (RefSeq) [0038]ADAM29: Hs.126838 (UniGene) and NM 014269 (RefSeq)=variant 1 NM 021780 (RefSeq)=variant 2 NM 021779 (RefSeq)=variant 3
[0039]Primers that may be used to amplify these sequences include:
TABLE-US-00001 LPL (CS)s CAGATGCCCTACAAAGTCTTCC (SEQ ID NO: 29) LPL (CS)as GCCACGGTGCCATACAGAGAAA (SEQ ID NO: 30) ADAM29 (CS)s GGCAACCCACCAATAACTAAAT (SEQ ID NO: 31) ADAM29 (CS)as TCCCACAGCGCTTCACATTAAA (SEQ ID NO: 32)
All three ADAM29 variants can be amplified by the aforementioned primers.
[0040]The fact that for these 2 genes: i) similar results were obtained on total CLL lymphocyte populations and from purified leukemic cells, and ii) their absence of detection or very low level in normal B cells, indicates that their expression could be tumor specific. Alternatively it might reflect a restricted expression in a minor B lymphoid subpopulation which is expanded in CLL. Therefore, contemplated by the present invention are methods in which a threshold B-cell expression level of the aforementioned genes can be determined for CLL positive diagnosis.
[0041]Accordingly, in an embodiment of the present invention is to provide an in vitro method of identifying a subject with a significant probability of having chronic lymphocytic leukemia in a subject in need thereof by:
[0042]obtaining a specimen from said subject, wherein said specimen comprises at least one of peripheral mononuclear blood cells (PBMC), tissue containing B-cells, and extracted B cells;
[0043]determining the gene expression levels of LPL and ADAM29 in said specimen;
[0044]designating said subject as having a significant probability of having chronic lymphocytic leukemia if said determining evidences expression of at least one of LPL and ADAM29 in said specimen.
[0045]In the embodiments of the present invention described herein, B-cells may be obtained from any source that contains the same, including: peripheral mononuclear blood cells, tissues naturally bearing B-cells such as backbone, ganglions, spleen, mucosa, and skin, or tissues in which B-cells do not naturally reside, such as a tissue has been infiltrated by malignant (tumor) cells.
[0046]Further, the above embodiment may be performed using a sample containing previously extracted mRNA (e.g., a mRNA bank), thereby obviating the need to obtain a cellular sample and, thus, an embodiment of the present invention includes an in vitro method of identifying a subject with a significant probability of having chronic lymphocytic leukemia in a subject in need thereof, by
[0047]obtaining a sample containing mRNA, wherein said sample contains at least one selected from the group consisting of extracted mRNA, peripheral mononuclear blood cells (PBMC), tissue containing B-cells, and extracted B cells;
[0048]determining the gene expression levels of LPL and ADAM29 in said sample;
[0049]designating said subject as having a significant probability of having chronic lymphocytic leukemia if said determining evidences expression of at least one of LPL and ADAM29 in said sample.
[0050]An advantage offered by the aforementioned embodiments is that the present invention may be utilized to detect leukemias in patients in which all the other common leukemia markers are "silent." In these particular cases, the ratio L/A will become the only available diagnostic method. As such, the present invention embraces a general diagnostic method comprising identifying a subject having a significant probability of having chronic lymphocytic leukemia comprising determining the L/A ratio in a sample obtained from said subject by the methods described herein.
[0051]As used herein, the term "significant probability" in the phrase "having a significant probability of having chronic lymphocytic leukemia" is defined as being greater 80%, preferably greater than 85%, more preferably greater than 90%, most preferably greater than 95% chance that said subject has CLL. As shown in the examples of the present specification, the LPL and ADAM29 gene expression levels of 134 subjects were evaluated: 127 pre-diagnosed as having CLL and 7 healthy subjects. Of these only one healthy patient exhibited any expression of LPL or ADAM29 in either PBMC or B cells (low levels of LPL in B cells), corresponding to no less than 85.7% accuracy in CLL diagnosis, and all pre-diagnosed CLL patients expressed LPL or ADAM29 in either PBMC or B cells, corresponding to an accuracy in the overall population of greater than 99%.
[0052]As used herein the phrase "aggressive form of chronic lymphocytic leukemia" means that subjects present, in addition to an abnormal hemogram, clinical symptoms such as an important tumor mass and/or cytopenia such as anemia or trombopenia.
[0053]As used herein the phrase "indolent form of chronic lymphocytic leukaemia" means that subjects present an anormal hemogram; however, do not present any clinical symptom normally associated with the disease. At this stage, the disease is only detectable by labs means.
[0054]As used herein, the phrase "subject in need thereof" is defined as a subject that is suspected of having CLL or has been independently (e.g., by conventional CLL diagnostic methods) diagnosed as suffering from CLL. Of course, it is contemplated that the present invention may be extended to routine preventative medical practices. For example, it is to be understood that the present invention may be used with "healthy" subjects as a part of a routine physical examination.
[0055]Further, as used in the context of the present invention, the term "subject" is defined as including any animal that expresses LPL and ADAM29. In a preferred embodiment the "subject" is a human. Further, it should be noted that the term "patient" is used herein interchangeably with the term "subject." In view of the fact that CLL has been found to occur in bovine, the present invention may find application in animals that possess both an LPL gene and an ADAM29 gene.
[0056]As used herein, the term "specimen" is defined as being any extracted biological material in which cellular material of blood is likely to be found. As used herein the term "sample" is defined as being any biological material naturally occurring or extracted in which cellular or genetic (i.e., mRNA) is contained. In an embodiment of the present invention, these terms refer to peripheral blood samples, tissue containing B cell, or extracted B cells. Within the context of the present invention, the specimen or sample may be used in a crude form, a preserved form (i.e., includes additional additives commonly added to preserve the integrity of the cellular material under environmental stress, such as freezing), a partially purified form, a purified form (e.g., isolated cellular material), or any other common preparatory form.
[0057]In the methods of the present invention, it is to be understood that any common (i.e., standard) method of acquiring biological specimens may be employed. These methods are readily appreciated by the skilled clinician and need not be described in great detail.
[0058]Within the context of the present invention, the gene (and/or protein) expression levels of the genes (and/or proteins) discussed herein is not particularly limited. Gene expression may be determined by any quantitative, semi-quantitative or qualitative method including PCR methods. Specific PCR methods that are suitable for use in the present invention include real-time PCR (RQ-PCR) multiplex-PCR and fluorescent MX-PCR. It is also understood that microarray techniques may be employed to provide quantitative values for gene expression. Protein expression is preferentially determined by flow cytometry.
[0059]Appropriate quantification methods requiring labelling of mRNA or DNA has been described in WO93/10257, U.S. Pat. No. 5,747,246, U.S. Pat. No. 5,955,262, and U.S. Pat. No. 5,876,928 (Kourilsky et al.), which are incorporated herein by reference. Protein quantification may be also accomplished by using directly or indirectly labelled polyclonal or monoclonal antibodies specifically directed against each of one expressed protein LPL or ADAM29.
[0060]Labelled proteins could be detected directly on cells either by cytometric techniques (cell-shorter techniques, cellular suspensions, etc.) or by histochemical techniques (fixed cells, solid or semi-solid tissues). Cells could be previously permeabilized to allow the introduction into the B-cell cytoplasma of the appropriate antibody. Also labelled proteins may be extracted outside the cells and analyzed by Western blot techniques, after migration of the cell extracts on Polyacrylamide gels (PAGE-SDS).
[0061]Further, the present invention also contemplates methods in which relative expression levels are determined for LPL and ADAM29. For example, to determine the LPL/ADAM29 ratio, it is possible to employ a simple electrophoretic technique in which PCR products are separated by electrophoreses and the relative intensities of the bands corresponding to LPL (approximately 410 bp for humans) and ADAM29 (approximately 445 bp for humans) is determined. Such a technique is readily amendable to RQ-PCR and multiplex PCR platforms.
[0062]However, as used in the present invention, the gene expression level of LPL and ADAM29 is preferably a normalized gene expression, which is preferably obtained by RQ-PCR (real-time polymerase chain reaction) using the Light Cycler System (Roche Molecular Biochemicals, Mannheim, Germany) and the SYBR Green I dye. As evidenced below under the heading "Quantitative RT-PCR" gene expression analyses was conducted for LPL, SPG20, ADAM29 and NRIP1; however, the technique described herein may be extended to gene expression of any gene of interest.
[0063]In a preferred embodiment, primers are designed to be specific for the gene of interest and RQ-PCR is performed with a predetermined quantity (e.g., 100-150 ng) of reverse transcribed total RNA (cDNA) for a time and under conditions suitable for amplifying the gene of interest from the reverse transcribed total RNA (cDNA). For example, the conditions may entail: 10 minutes at 95° C. for initial denaturation, then 40 cycles of 10 seconds at 95° C., 5 seconds at 62° C. and 17 seconds at 72° C. The specificity of the amplified products is then preferably verified by analysis of their respective melting curves.
[0064]By repeating the procedure in duplicate and by including the 5 points of the calibration curve and a no-template control in each PCR reaction, the results may be validated. Estimation of the quality of CDNA for each sample is preferably obtained by quantification of an endogenous reference. In one embodiment of the present invention, the endogenous reference is the glyceraldehyde-3-phosphate dehydrogenase (GAPDH). GAPDH gene has been used in the present invention as a housekeeping gene, but normalization may also be performed by using any other housekeeping gene. Examples of genes that are suitable for use as normalization genes in quantitative PCR techniques include, but are not limited to: [0065]18S rRNA (ARN ribosomal 18S) [0066]ABL (Abelson) [0067]PO (Acidic ribosomal protein) [0068]ACTB (Beta-actin) [0069]B2M (Beta-2-microglobulin) [0070]GUS (Beta-Glucuronidase) [0071]CYC (Cyclophilin) [0072]GAPDH (Glyceraldehyde 3 phosphate dehydrogenase) [0073]HPRT (Hypoxanthine phosphoribosyltransferase) [0074]PGK (Phosphoglycerokinase) [0075]PBGD (Porphobilinogen deaminase) [0076]PBGD2 (Porphobilinogen deaminase 2) [0077]TBP (transcription factor IID) [0078]TFRC (Transferrin receptor)
[0079]To this end, the artisan is referred to Beillard et al., Leukemia, 2003, 17, 2474-2486 (which is incorporated herein by reference), for information relevant to the use of the foregoing as normalization genes in quantitative PCR techniques.
[0080]Once the foregoing is complete, the gene copy number is preferably calculated using a standard curve generated from serially diluted (10-fold dilutions from 106 to 102 copies) plasmids containing the respective sequence verified insert (LPL, ADAM29, Housekeeping gene, etc.). Results are expressed as the ratio of mean of gene copy number/mean GAPDH copy number×100 (used herein as "normalized gene expression").
[0081]Accordingly, as used herein, when the term "gene expression level" preferably means that the expression level has been quantitatively determined and is normalized. To facilitate gene expression level determination, it is preferred that total cellular RNA is extracted from the sample from the subject under study and that the corresponding cDNA be synthesized to serve as a PCR template.
[0082]A microarray study by the present inventors showed overexpression of LPL and ADAM29 genes among UM and MT CLLs, respectively. The present inventors quantified expression of LPL and ADAM29 genes by RQ-PCR, and ZAP-70 protein by flow-cytometry in a cohort of 127 CLL patients, and evaluated the correlations with the IgVH mutational status and clinical outcome. Combining LPL and ADAM29 mRNA quantifications by a simple 1 to 1 ratio (L/A ratio) provided a 90% concordance rate with the IgVH mutational status. Simultaneous usage of the L/A ratio and ZAP-70 expression allowed an almost perfect (99%) assessment of the IgVH status in the 80% of patients with concordant results (L/A.sup.+, ZAP-70.sup.+ or L/A.sup.-, ZAP-70.sup.-). IgVH mutational status, ZAP-70 and the L/A ratio were predictive of event-free survival for the whole cohort and for stage A patients. In addition the L/A ratio was an independent pronostic factor for stage B and C patients.
[0083]Accordingly, in another embodiment of the present is to provide an in vitro method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia by,
[0084]after obtaining a sample containing mRNA from said subject (preferably a peripheral blood sample, a tissue sample, or extracted B cells from said subject or pre-extracted mRNA from said subject); said method comprises: [0085]determining the gene expression levels of LPL and ADAM29 in said sample; [0086]evaluating the LPL/ADAM29 gene expression ratio; and [0087]classifying the IgVH gene as: [0088]mutated if the LPL/ADAM29 ratio is less than one, or [0089]unmutated if the LPL/ADAM29 ratio is greater than or equal to one.
[0090]In this embodiment, the subject in need of classifying IgVH mutational status may be either a subject that has been diagnosed by conventional methods as having CLL or may be a subject that has been identified as having a significant probability of having CLL by the method described hereinabove.
[0091]If the L/A ratio or ZAP-70 (described in the art previously) would be used independently as surrogate marker of the mutational status, it may lead to an inappropriate classification of a small fraction of patients, which may be problematic in a risk-adapted therapeutic attitude. Therefore, in an embodiment of the present invention, the present inventors therefore combined both markers, which resulted in a much closer correlation with the IgVH mutational status.
[0092]To this end, the ZAP-70 expression level may be determined as described previously20, 21 or by the method detailed in the Examples of the present specification. The ZAP-70 expression level is then used in the context of the present invention to validate the IgVH mutational status classified by the L/A ratio. To this end, the validation method is conducted by: [0093]determining the percentage of CD3+ CD56+ cells present in a specimen from the subject classified by L/A ratio that are positive for ZAP-70 intracellular expression; and [0094]classifying the IgVH gene sequence as: [0095]mutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is less than 20%, or [0096]unmutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is greater than or equal to 20%.
[0097]In the Examples of the present specification, all but one of the 74 cases expressing concordant ZAP-70 and L/A ratio were correctly assigned to their mutational group. Conversely, in about 20% of cases, ZAP-70 and the L/A ratio gave discordant results. Therefore, combining ZAP-70 and L/A ratio quantification represents an alternative to sequencing the IgVH genes in about 80% of patients. The remaining cases would require sequence determination but the work load would then be considerably reduced.
[0098]In view of the foregoing, validation of the IgVH mutational status determined by L/A ratio and/or ZAP-70 expression can be enhanced by direct determination of the IgVH mutational status by standard sequencing protocols. Additionally, in the event that L/A ratio and ZAP-70 expression give rise to discordant results, it is preferred that the IgVH mutational status be directly determined by standard sequencing protocols. Therefore, the following general method is contemplated for direct determination of the IgVH mutational status by sequencing the IgVH genes: [0099]sequencing the IgVH genes; [0100]comparing the determined IgVH gene sequences to the closest germline counterpart; and [0101]classifying the IgVH gene sequences as: [0102]mutated if their homology determined by said comparing is less than 98%, or [0103]unmutated if their homology determined by said comparing is greater than or equal to 98%.
[0104]Furthermore the present inventors have developed a simple and inexpensive way to assess simultaneous expression of LPL and ADAM29 by a multiplex RT-PCR technique. Keeping in mind that some cases will appear as doublets (6% of cases) and so will not be informative, the simplicity of the assay should permit that it is performed in most laboratories. In the Examples of the present invention, the present inventors demonstrate that the L/A ratio was at least as performant as the IgVH mutational status in predicting clinical outcome. Thus, this simple determination of LPL and ADAM29 expression would be much more cost effective than Ig sequencing.
[0105]To this end, in an embodiment of the present invention, the electrophoretic classification method of IgVH mutational status of a subject having chronic lymphocytic leukemia is conducted by: [0106]after obtaining a sample containing mRNA (preferably a peripheral blood sample, a tissue sample, or extracted B cells from said subject or pre-extracted mRNA) from said subject; [0107]performing a competitive multiplex PCR assay in the presence of PCR primers for LPL and ADAM29, wherein said PCR primers are SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO:5, and SEQ ID NO:6, [0108]separating the PCR amplification product; and [0109]classifying the IgVH mutational status by determining the relative intensities of the bands corresponding to 410 bp and 445 bp, wherein the 410 bp band corresponds to LPL and the 445 bp band corresponds to ADAM29; and wherein [0110]when the intensity of the band at 410 bp is greater than the intensity of the band at 445 bp or when there is only a single band at 410 bp then the IgVH mutational status is classified as being unmutated; and [0111]when the intensity of the band at 410 bp is less than the intensity of the band at 445 bp or when there is only a single band at 445 bp then the IgVH mutational status is classified as being mutated.
[0112]In this embodiment, when a doublet (i.e., bands at 410 bp and 445 bp) is present or when the relative intensities of the band at 410 bp and the band at 445 bp are substantially similar, the present invention contemplates coupling the aforementioned method with direct IgVH mutational status classification by IgVH genes sequencing or quantitative L/A determination (with or without ZAP-70 expression analysis).
[0113]The foregoing describes a particular embodiment of the present invention. However, the described method may be performed by using other primers that have been selected for their hybridization to LPL or ADAM29 and, thus, the resultant band's size could be different. In this embodiment, the size of the appropriate primers could varied from 50 to 1000 bp, preferably 50 to 500 bp, more preferably, 75 to 205 bp, depending on the conditions of the hybridization (i.e., stringent conditions), temperature, number of cycles as well as the nature of the buffer. To this end and with the sequence of LPL and ADAM29 provided herein the artisan would be able to readily identify other suitable primers for both genes.
[0114]The terms "stringent conditions" or "stringent hybridization conditions" include reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
[0115]Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.
[0116]Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 138:267-284 (1984): Tm=81.5° C.+16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (2000).
[0117]In view of the foregoing, in another embodiment of the present invention, the electrophoretic classification method of IgVH mutational status of a subject having chronic lymphocytic leukemia is conducted by: [0118]after obtaining a sample containing mRNA (preferably a peripheral blood sample, a tissue sample, or extracted B cells from said subject or pre-extracted mRNA) from said subject; [0119]performing a competitive multiplex PCR assay in the presence of PCR primers for LPL and ADAM29, wherein said PCR primers are selected such that the size differences between the bands corresponding to LPL and ADAM29 are resolvable by electrophoresis, [0120]separating the PCR amplification product; and [0121]classifying the IgVH mutational status by determining the relative intensities of the bands corresponding to LPL and ADAM29, wherein [0122]when the intensity of the band corresponding to LPL is greater than the intensity of the band corresponding to ADAM29 or when there is only a single band corresponding to LPL then the IgVH mutational status is classified as being unmutated; and [0123]when the intensity of the band corresponding to LPL is less than the intensity of the band corresponding to ADAM29 or when there is only a single band corresponding to ADAM29 then the IgVH mutational status is classified as being mutated.
[0124]In addition to their value as surrogate markers, the present inventors evaluated the ability of the L/A ratio and ZAP-70 expression to predict clinical outcome. In univariate analysis, both parameters, as well as the IgVH mutational status, correlated with event free survival (EFS) in the whole population. In multivariate analysis, however, ZAP-70 was no longer selected. For stage A patients, these 3 biological parameters were predictive of EFS. This result is in keeping with Crespo et al.' series where ZAP-70 expression predicted survival only in stage A patients.20 When considering the stage B and C patients, the L/A ratio was the only parameter which correlated significantly with survival in univariate analysis. The IgVH UM status became a significant risk factor only after adjustment on sex and age in multivariate analysis. In contrast, ZAP-70 expression had no prognostic value in this group of patients. The availability of biological prognostic indicators such as the L/A ratio for stage B and C CLL cases may therefore be of great importance for future risk-adapted treatments.
[0125]Prognostics found by using L/A ratio is independent of the Classification of Stage A, B, C and D. L/A ratio is a best prognostic marker of CLL progression than previous stage classification. This conclusion derives from the observation of results shown in Table 8 below.
[0126]In yet another embodiment, the present invention provides a method of allowing accurate estimation of the prognosis in a patient having chronic lymphocytic leukemia, by designating the subject as having a significant probability of having an aggressive form of the disease if there is overexpression of the LPL gene or an indolent form of the disease if there is overexpression of ADAM29 gene.
[0127]To this end, the present invention provides an in vitro method of distinguishing in a subject in need thereof between whether said subject has an aggressive form of chronic lymphocytic leukemia or an indolent form of chronic lymphocytic leukemia comprising [0128]after obtaining a specimen from said subject; [0129]determining the gene expression levels of LPL and ADAM29 in said specimen; [0130]designating the subject as having a significant probability of having [0131]an aggressive form of chronic lymphocytic leukemia if the LPL gene is overexpressed; or [0132]an indolent form of chronic lymphocytic leukemia if the ADAM29 gene is overexpressed.
[0133]As used herein gene expression of LPL and/or ADAM29 is considered to be overexpressed when expression in the subject is compared to the expression level of the respective gene in a normal "healthy" person. For instance, the absence of LPL expression in normal subjects is well-known. In a preferred embodiment, overexpression is determined on the basis of comparison to a reference (i.e., household gene), for example GAPDH. Using GAPDH, overexpression is considered:
[0134]a ratio LPL/GAPDH>1.0 and
[0135]a ratio of ADAM29/GAPDH>2.8, more prefereably a ratio of ADAM29/GAPDH>3.0.
[0136]In summary, the present invention demonstrates that LPL and ADAM29 expression levels correlate with the mutational profile of IgVH genes as well, if not better, than ZAP-70, and is useful to classify the IgVH mutational status of a subject having CLL. Combination of the L/A ratio with ZAP-70 expression provides an accurate prediction of the IgVH mutational status in 80% of CLL cases, thus rendering sequencing unnecessary in these patients. In addition, the L/A ratio is a prognostic indicator which appears to outmatch ZAP-70 in terms of survival prediction for advanced CLL cases.
[0137]Also included within the scope of the present invention are kits suitable for detecting (as used herein "detecting" includes "diagnosing and/or prognosing") lymphocytic leukemia (preferably chronic lymphocytic leukemia). Preferably, such a kit would contain primers that hybridize to and/or facilitate amplification of the LPL and/or the ADAM29 genes, and at least one housekeeping gene. Needless-to-say, the present invention contemplates packaging of the present kit such that the primers for the LPL gene and the ADAM29 gene are in the same or different vial (or tube). Also, the housekeeping gene (see above) may admixed with either the LPL gene or the ADAM29 gene or may be in its own independent tube. Additional components that may also be contained in the kit (admixed with one or more of the other components or individually packaged) of the present invention include primers specific for the selected housekeeping gene and reagents (including dNTPs) for amplification. Further, it is to be understood that for each tube used the components therein may be in an aqueous, non-aqueous, dry or crystalline state, or may be admixed with a suitable pharmaceutically acceptable carrier. Wherein the components of the kit are present in a non-aqueous, dry, or crystalline state, it is preferred that the kit further contain an additional vial or tube that contains a suitable diluent, which will provide the user with the appropriate concentration of the components for use in the methods of the present invention. In a preferred embodiment, the kit will contain instructions for using of the components contained in the kit in the methods of the present invention, as included; such instructions can be in the form of printed, electronic, visual, and/or audio instructions.
[0138]The above written description of the invention provides a manner and process of making and using it such that any person skilled in this art is enabled to make and use the same, this enablement being provided in particular for the subject matter of the appended claims, which make up a part of the original description.
[0139]As used above, the phrases "selected from the group consisting of," "chosen from," and the like include mixtures of the specified materials.
[0140]Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and subranges within a numerical limit or range are specifically included as if explicitly written out.
[0141]The above description is presented to enable a person skilled in the art to make and use the invention, and is provided in the context of a particular application and its requirements. Various modifications to the preferred embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention. Thus, this invention is not intended to be limited to the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.
[0142]Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.
EXAMPLES
Materials and Methods
Patients and Samples
[0143]A multi-center retrospective study was undertaken on samples from 127 patients diagnosed between October 1979 and February 2003, and identified from the registries of the Pasteur Institute and Hopital Pitie-Salpetriere, Paris, France (n=92), and the University Hospital, Sao Paulo, Brazil (n=35). Inclusion criteria consisted of: 1) diagnosis of typical CLL based on morphologic and phenotypic analyses;24 2) availability of frozen samples; 3) previous determination of IgVH mutational status; and 4) patient's informed consent according to Brazilian and French regulations. This series included 87 stage A, 29 stage B and 11 stage C patients according to Binet's staging system2. Median follow-up time was 73 months for the whole series (range 1 to 291), while it was 87 months for stage A patients and 50 months for stages B and C. "Progression" was defined as change of clinical stage and/or need for treatment.
[0144]As described below, a series of surrogate marker candidates were assessed. Gene expression of LPL, SPG20, ADAM29 and NRIP1 were studied on a first set of 71 patients, including 45 stage A and 26 stage B and C, and compared to the IgVH mutational status taken as the gold standard (described herein below). Only markers showing appropriate test performances in comparison to IgVH mutational status were selected as potential prognosis markers and tested on an additional set of 56 patients.
[0145]Only peripheral blood samples were considered for analyses. For 113 patients the peripheral blood samples were acquired at the time of diagnosis. In 14 stage A cases with a very stable lymphocytosis over time, the samples were acquired after a defined time after diagnosis.
[0146]Mononuclear cells had been separated by Ficoll-Hypaque gradient centrifugation, and stored in liquid nitrogen. Upon thawing, cell viability was first assessed by trypan blue staining before further analysis. In five cases, B cell populations were purified by negative magnetic selection using anti-CD3, anti-CD14, anti-16 and anti-CD56 monoclonal antibodies (Dynal, Oslo, Norway). Final purity was evaluated by flow cytometry to be greater than 98%. Control samples from 7 healthy adult volunteers were obtained using the same procedures and included peripheral mononuclear blood cells (PBMC, n=4) and purified B cells (n=3). In addition the T-cell line Jurkatt was cultured in RPMI 1640 medium containing 10% fetal calf serum, 2 mM glutamine, 1% sodium pyruvate and penicillin-streptomycin.
IgVH Mutational Status
[0147]The IgVH gene sequences were determined as previously described.25 Briefly, amplification of Ig heavy chain variable regions by PCR was performed on DNA from leukemic cells with consensus primers for the VH framework region 1 and JH genes as previously described25 or following the BIOMED-2 protocols.26 Purified PCR products were sequenced either directly or after a cloning procedure using an automated DNA sequencer. Sequence data were analyzed using: (a) IgBLAST available through the website for the National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health (Bethesda, Md., USA) at http://www.ncbi.nlm.nih.gov/igblast, (b) V-BASE available through the website for the Centre for Protein Engineering, Medical Research Council, University of Cambridge (Cambridge, UK) at http://www.mrc-cpe.cam.ac.uk/vbase-ok.php?menu=901, and (c) ImMunoGeneTics database available through the website for the The International Immunogenetics Information System (IMGT, Montpellier, France) at http://imgt.cines.fr. IgVH sequences were considered as mutated if their homology with the closest germline counterpart was less than 98%.
RNA Isolation and cDNA Synthesis
[0148]Total cellular RNA was extracted using the RNeasy kit (Qiagen, Courtaboeuf, France) following supplier's instructions. The integrity of RNA was assessed by visualization of the 18S and 28S RNA species upon electrophoresis in agarose gel after ethidium bromide staining. First strand cDNA was synthesized from 2 μg of total RNA, using Superscript II reverse transcriptase (Invitrogen, Cergy-Pontoise, France) and oligodT or random hexamer primers.
Quantitative RT-PCR
[0149]For gene expression analyses of LPL, SPG20, ADAM29 and NRIP1, the present inventors performed RQ-PCR (real-time polymerase chain reaction) using the Light Cycler System (Roche Molecular Biochemicals, Mannheim, Germany) and the SYBR Green I dye. Primers used in this study (Table 1) were designed with the Gene Runner software (Hastings Software, Colorado, USA). RQ-PCR was performed using 100 ng of reversly transcribed total RNA (cDNA) with the following parameters: 10 minutes at 95° C. for initial denaturation, then 40 cycles of 10 seconds at 95° C., 5 seconds at 62° C. and 17 seconds at 72° C.
[0150]The specificity of the amplified products was verified by analysis of their respective melting curves as provided by the Light Cycler software. All reactions were performed in duplicate and each PCR run also included the 5 points of the calibration curve and a no-template control. Estimation of the quality of cDNA for each sample was performed by quantification of an endogenous reference, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The gene copy number was calculated with a standard curve generated from serially diluted (10-fold dilutions from 106 to 102 copies) plasmids containing the respective sequence (LPL, ADAM29 or Housekeeping gene) verified insert. Results were expressed as the ratio of mean of gene copy number/mean GAPDH copy number×100 (used herein as "normalized gene expression").
Multiplex RT-PCR
[0151]The present inventors also evaluated the relative expression of LPL and ADAM29 by multiplex RT-PCR, using the same primers than those for RQ-PCR (Table 1). Different concentrations of primers, MgCl2 and dNTP were first evaluated. Optimized PCR conditions were obtained with primers at the final concentrations of 0.5 μM for LPL and 0.25 μM for ADAM29, 1.5 mM MgCl2 and 200 μM dNTP. Amplifications were performed using 100 ng cDNA and included an initial denaturation step at 94° C. for 5 minutes, followed by 29 cycles of 30 seconds at 95° C., 20 seconds at 62° C. and 30 seconds at 72° C. Finally, the reaction was completed with a final elongation step at 72° C. for 5 minutes. PCR products were analyzed on ethidium bromide-stained 2% agarose gel electrophoresis, where they appeared as a 445 bp band for ADAM29 and a 410 bp band for LPL. Amplification of GAPDH was performed in parallel to ensure cDNA integrity.
[0152]Alternatively, primers can be fluorescent labeled primers and the resultant PCR products can be analyzed on polyacrylamide gel electrophoresis (GenScan). L/A ration can be determined by measuring and comparing the corresponding surfaces under the curves, after scan.
TABLE-US-00002 TABLE 1 Sequences of primers used in RQ-PCR and multiplex-PCR Primer Sequence (5' → 3') GAPDH forward GGTGCTGAGTATGTCGTGGA (SEQ ID NO:1) GAPDH reverse ATGCCAGTGAGCTTCCGTT (SEQ ID NO:2) LPL forward GGAATGTATGAGAGTTGGGTGC (SEQ ID NO:3) LPL reverse CAATGCTTCGACCAGGGGACC (SEQ ID NO:4) ADAM29 forward TCTTATGTGGGCTGGTGGATCC (SEQ ID NO:5) ADAM29 reverse GACCTAGATGATGAGCCACTGC (SEQ ID NO:6) SPG20 forward CTGAAATGTACTGCGGGAGCC (SEQ ID NO:7) SPG20 reverse CCAACTCACCCAGGAAGCACC (SEQ ID NO:8) NRIP1 forward GGATAGCACATTACTGGCCTCT (SEQ ID NO:9) NRIP1 reverse AGGTTTAGGTGAGGTGGCAGG (SEQ ID NO:10)
Multiparametric Flow Cytometry
[0153]Flow-cytometric analysis of ZAP-70 intracellular expression was performed using the method described by Crespo et al.20 with some minor modifications. Thawed mononuclear cells were fixed in 2% paraformaldehyde and were subsequently permeabilized by incubation with phosphate-buffered saline containing 0.1% saponin (Sigma, Saint-Quentin Favallier, France) and 0.5% bovine serum albumin.
[0154]One million cells were first incubated with 2.5 μg of anti-ZAP-70 antibody (clone 2F3.2, Upstate, Lake Placid, N.Y., USA), or irrelevant isotype-matched anti-CD14 monoclonal antibodies (DakoCytomation, Trappes, France). After washing, they were incubated with 1.5 μg of F(ab')2 fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse antibody (Immunotech, Marseille, France). Cells were then washed and incubated with phycoerythrin-cyanin 5 (PC5)-conjugated mouse anti-CD19 (Immunotech), allophycocyanin (APC)-conjugated mouse anti-CD3 and APC-conjugated mouse anti-CD56 (BD Biosciences, San Jose, Calif., USA).
[0155]Samples including at least 104 cells were further analysed with a flow cytometer (FACSCalibur, BD Biosciences) and the use of CellQuest Pro software (BD Biosciences). Lymphocyte cells were first selected on size structure characteristics, and then gated on B cells (CD19+, gate R2) and T and NK cells (CD3+ CD56+, gate R3). Biparametric dot plot graphs were obtained separately for cells that were stained for respectively CD3, CD56 and ZAP-70, or CD19 and ZAP-70, or CD3, CD56 and CD14 (negative control). In those plots as well as in monoparametric histograms, ZAP-70 expression on CD3+ CD56+ cells served to determine the percentage of CLL cells that were positive for ZAP-70.
Statistical Analyses
[0156]Expression levels of the 4 tested genes and of ZAP-70 protein were compared with the IgVH mutational status as a reference. Threshold values that could best discriminate MT from UM cases were first determined by plotting expression values against IgVH percentage of germline homology, and then further refined by calculating Youden's index27 and validity index (the percentage of correctly classified cases). Thereafter the performance indexes including sensitivity, specificity, positive and negative predictive values were determined.
[0157]Distributions of patients, according to Binet staging, sex and IgVH mutational status were compared using Chi square test. Median follow-up was calculated for each Binet stage group.
[0158]Since CLL-related deaths were mainly observed in stage B and C (only 4 cases in stage A), while disease progression was the most frequent event for stage A patients, the present inventors evaluated event-free survival, from diagnosis to date of disease progression or CLL-related death or last follow-up visit, for the whole cohort and stage A patients. Overall survival was calculated only for stage B and C patients. Survival analyses were performed using the Kaplan-Meier method. Statistical significance of associations between individual variables and survival was calculated by the log-rank test.
[0159]Univariate and multivariate regression analyses were done according to the Cox proportional hazards regression model. As the biological factors studied as potential surrogate markers of IgVH mutational status and prognostic indicators were by definition strongly correlated with IgVH mutational status, it was inappropriate to test them simultaneously by Cox regression. Consequently, two Cox regression analyses were performed: the first one testing IgVH mutational status, the second one testing the other selected factors, in both circumstances with adjustment on age, sex, and when appropriate Binet's staging. Variables with two-tailed P<0.05 were considered as significant. All analyses were done using SPSS Statistical Software, version 11.5 (Chicago, Ill., USA).
Results
Example 1
Patients' Characteristics
[0160]Table 2 summarizes the 127 patients' characteristics:
TABLE-US-00003 TABLE 2 Clinical and biological characteristics of patients Stages Stages Stage A Stage B Stage C B + C A + B + C No. Patients 87 29 11 40 127 Age, years* 63.0 58.0 59.0 58.5 61.0 Male sex 51 (59%) 24 (83%) 5 (45%) 29 (72%) 80 (63%) Lymphocyte count, × 109/L* 15.2 37.2 151.8 45.0 19.0 Hemoglobin, g/dL* 14.1 13.4 7.2 13.0 13.8 Platelets, × 109/L* 212.5 160.0 187.5 172.0 198.0 Lymphocyte doubling time >12 months 64 (84%) NA NA NA NA <12 months 12 (16%) NA NA NA NA IgVH genes UM 27 (31%) 17 (59%) 9 (82%) 26 (65%) 53 (42%) MT 60 (69%) 12 (41%) 2 (18%) 14 (35%) 74 (58%) ZAP-70 <20% 45 (65%) 7 (30%) 3 (33%) 10 (31%) 55 (54%) ≧20% 24 (35%) 16 (70%) 6 (67%) 22 (69%) 46 (46%) L/A ratio <1 56 (69%) 13 (46%) 2 (20%) 15 (39%) 71 (60%) ≧1 25 (31%) 15 (54%) 8 (80%) 23 (61%) 48 (40%) Progression 22 (25%) NA NA NA NA CLL-related death 4 (5%) 11 (38%) 6 (55%) 16 (40%) 20 (18%) *Median values UM indicates unmutated; MT, mutated; L/A, LPL/ADAM29; NA, not applicable.
[0161]Fifty three patients (42%) were allocated to the UM IgVH group while 74 displayed a MT IgVH profile. The MT and UM cases were heterogeneously distributed within Binet stages, since 69% of stage A patients displayed a MT IgVH profile, while 65% were UM among B and C cases (p<0.001). Sex distribution was also heterogeneous with a high proportion of male patients among UM cases (70%) and a slight female predominance (53%) in the MT group (p=0.05). Twenty disease-related deaths were recorded in these series, and 4 additional deaths, unrelated to CLL, occurred among stage A patients. Based on French Cooperative Group guidelines, almost all stage B and C patients received early treatment, whereas treatment was deferred for stage A patients until disease progression. This was the case for 22 stage A patients (25%), of whom 4 died.
Example 2
LPL and ADAM29 are Better Surrogate Markers for IgVH Mutational Status than SPG20 and NRIP1
[0162]LPL, SPG20, ADAM29 and NRIP1 were first evaluated in an initial series of 71 patients. The present inventors quantified the expression of these 4 genes on total lymphocytes, since preliminary experiments in five patients showed similar results as compared to purified leukemic cells (data not shown). For each gene, the present inventors determined which expression levels could best segregate UM from MT patients using Youden's and validity indexes. Results showed that overall LPL and ADAM29 performed better than SPG20 and NRIP1 to predict UM and MT IgVH profiles respectively (Table 3). The concordance rate was 83% for ADAM29, 77% for LPL, 65% for SPG20 and 45% for NRIP1.
TABLE-US-00004 TABLE 3 Correlation of gene expression with IgVH mutational status LPL/ Gene LPL ADAM29 SPG20 NRIP1 ADAM29 expression.sup..dagger-dbl. ≧1 <1 ≧3 <3 ≧3.5 <3.5 ≧4 <4 ≧1 <1 UM (n = 37) 30 7 8 29 21 13 17 16 32 5 MT (n = 34) 9 25 28 6 7 27 19 15 3 31 Sensitivity* 81% 82% 57% 56% 86% Specificity* 74% 78% 79% 43% 91% PPV* 77% 78% 75% 53% 91% NPV* 78% 83% 67% 52% 86% *These parameters were calculated in relation to unmutated IgVH genes for LPL, SPG20, and LPL/ADAM29, and to mutated IgVH genes for ADAM29 and NRIP1. .sup..dagger-dbl.Results were expressed as the ratio of mean of gene copy number/mean GAPDH copy number × 100 UM indicates unmutated; MT, mutated; PPV, positive predictive value; NPV, negative predictive value.
[0163]Next, the present inventors investigated whether a combination of the most discriminating parameters by a simple 1 to 1 LPL/ADAM29 (L/A) ratio could improve their individual predictive potential for mutational status. With a calculated threshold of 1, the L/A ratio displayed better sensitivity and specificity than each marker taken individually. Positive predictive value (PPV) was 91% for UM cases and negative predictive value (NPV) was 86% for MT patients, providing a better performance than each individual marker (Table 3). Thus the L/A ratio constituted the best marker reflecting the mutational status of IgVH genes in this cohort of 71 CLL patients, with a concordance rate of 89%.
Example 3
Reproducibility of LPL and ADAM29 Quantification
[0164]Since LPL and ADAM29 appeared to better reflect the IgVH mutational status, the present inventors evaluated the reproducibility of their quantification by RQ-PCR. This was done by comparing results obtained from replicate samples for 4 patients, 2 overexpressing LPL and 2 overexpressing ADAM29. For each patient, 4 replicates were analyzed during the same reaction run (intra-run variability), and this was repeated on 3 different days (inter-run variability). The overall variability of these 12 replicates is shown in Table 4. Of note, intra-run variability was always smaller than overall variability, with CV being less than 0.5% for LPL and less than 1.1% for ADAM29 (data not shown).
TABLE-US-00005 TABLE 4 Reproducibility of RQ-PCR LPL ADAM29 Patient Ct ± SD CV (%) Ct ± SD CV (%) CLL-73 23.54 ± 0.46 1.97 NA NA CLL-105 23.96 ± 0.38 1.59 NA NA CLL-67 NA NA 27.33 ± 1.18 4.31 CLL-101 NA NA 23.32 2.21 Ct indicates threshold cycle; SD, standard deviation; CV, coefficient of variation
Example 4
Expression of LPL and ADAM29 in Normal Cells
[0165]Although experiments on purified and unpurified CLL cells showed similar results, the present inventors wanted to evaluate a possible expression of LPL and ADAM29 genes in normal cells which might contaminate patient samples. ADAM29 was not detected in PBMC from 4 healthy individuals, nor in purified B cells from 3 additional healthy donors. Similar results were obtained with LPL except for 1 of the 3 purified B cell samples where it was present at low levels (data not shown). In addition the T-cell line Jurkatt failed to express any of these 2 genes. Thus, all or most of the LPL and ADAM29 transcripts that the present inventors measured in patients samples originated from leukemic cells and not from background normal mononuclear cells.
Example 5
L/A Ratio Predicts the IgVH Mutational Status at Least as Well as ZAP-70
[0166]Results obtained with the initial CLL series led us to compare LPL and ADAM29 mRNA to ZAP-70 protein expression in the entire cohort of 127 patients, which included the 71 patients studied initially and 56 additional cases. In this series, LPL and ADAM29 values were available for 119 patients, whereas ZAP-70 could be determined for 101 patients and all three parameters for 93 patients. Threshold values were determined and found to be identical to those of the first cohort. On this larger series, the L/A ratio once again provided a better concordance (90%) with IgVH mutational status than LPL (76%) or ADAM29 (82%) taken individually (Table 5).
[0167]ZAP-70 expression was measured by flow cytometry in leukemic B cells in comparison with that of the patients' T and NK cells (FIG. 1). A cut-off value at 20% positivity was found to provide the best correlation with IgVH genes (FIG. 2). Fifty patients (50%) had MT IgVH genes and were ZAP-70 negative while 35 displayed UM IgVH genes (35%) and were ZAP-70 positive. Concordance rate with IgVH mutational status was 84%, thus slightly lower than that obtained with the L/A ratio (Table 5, above).
TABLE-US-00006 TABLE 5 Correlation of LPL, ADAM29 gene expression and ZAP-70 protein expression with IgVH mutational status LPL/ Gene LPL ADAM29 ADAM29 ZAP-70 expression.sup..dagger-dbl. ≧1 <1 ≧3 <3 ≧1 <1 ≧20% <20% UM 41 9 9 41 43 7 35 5 MT 19 50 57 12 5 64 11 50 Sensitivity* 82% 82% 86% 87% Specificity* 72% 83% 93% 82% PPV* 68% 77% 90% 76% NPV* 85% 86% 90% 91% LPL and ADAM29 gene expression was quantified by RQ-PCR for 119 patients, while ZAP-70 protein expression was determined by flow cytometry for 101 cases. Abbreviations are explained in Table 3 .sup..dagger-dbl.Results were expressed as the ratio of mean of gene copy number/mean GAPDH copy number × 100; ZAP-70 is expressed as a percent positivity (see FIG. 2) *These parameters were calculated in relation to unmutated IgVH genes for LPL and LPL/ADAM29, and to mutated IgVH genes for ADAM29.
Example 6
Combination of ZAP-70 and L/A Ratio Determination Provides Almost Perfect Prediction of IgVH Mutational Status
[0168]The present inventors next examined the interest of combining ZAP-70 expression and the L/A ratio in the 93 patients for which all 3 parameters had been determined. Cases were scored as "positive" or "negative" for a given marker based on expression values above or below the thresholds. As depicted in Table 6, all double positive patients (ZAP-70.sup.+ L/A.sup.-; n=30) except one expressed UM IgVH genes, and all double negative cases (ZAP-70.sup.- L/A.sup.-; n=44) had MT IgVH genes. Although these clusters demonstrate a strong predictive power, with almost perfect (99%) accuracy, discordant profiles showing only one positive marker still accounted for 20% of CLL patients. They included 13 cases expressing a ZAP-70+L/A profile, whereas 6 patients were ZAP-70.sup.- L/A.sup.+. Of note, the mutational status of these 19 cases would have been predicted correctly more often by the L/A ratio alone (13 cases) than by ZAP-70 expression alone (6 cases). The characteristics of these patients are presented in Table 7.
TABLE-US-00007 TABLE 6 Groups of CLL patients according to L/A ratio and ZAP-70 expression ZAP-70.sup.+ ZAP-70.sup.L/A.sup.+ ZAP-70.sup.+ L/A.sup.- L/A.sup.+ ZAP-70.sup.- L/A.sup.UM (n = 37) 29 4 4 0 MT (n = 56) 1 9 2 44 Total (n = 93) 30 (32%) 13 (14%) 6 (6%) 44 (47%) Positivity or negativity for ZAP-70 refers to expression values ≧20% or <20% respectively. Positivity or negativity for L/A ratio refers to expression values ≧1 or <1 respectively. Abbreviations are explained in Table 2.
TABLE-US-00008 TABLE 7 Individual characteristics of the 19 patients presenting discordant results between the L/A ratio and ZAP-70 expression ZAP-70 IgVH Lymphocytes Follow-up Patient L/A (%) (% homology) Stage (×109/L) (months) Events UM#1 <1 59 1-69 (100) B 11 91 Treated UM#2 <1 73 3-9 (100) A 18.2 23 -- UM#3 <1 86 1-24 (99) B 31.5 91 Treated UM#4 <1 62 3-21 (98) B 7.8 22 Treated MT#1 <1 40 4-34 (93) A 11.6 251 -- MT#2 <1 62 3-7 (94) A 8.7 153 -- MT#3 <1 81 3-21 (94) B 8.3 100 Treated MT#4 <1 88 3-21 (97) A 45.4 83 Treated MT#5 <1 56 4-39 (96) A 11.8 144 -- MT#6 <1 23 3-23 (91) A 39.7 133 Treated MT#7 <1 82 3-13 (97) B 34.9 54 Treated MT#8 <1 79 3-64 (96) A 22.5 56 Treated MT#9 <1 31 1-2 (97) A 21.8 55 Progression UM#5 ≧1 4 3-74 (99) C 201.2 2 Dead UM#6 ≧1 7 3-21 (100) A 12.0 24 -- UM#7 ≧1 13 3-20 (99) A 22.0 14 -- UM#8 ≧1 7 4-39 (100) A 24.0 93 Dead* MT#10 ≧1 3 3-23 (95) B 74.6 15 Treated MT#11 ≧1 3 1-18 (88) A 9.6 102 -- *Death unrelated to CLL Abbreviations are explained in Table 2.
Example 7
The L/A Ratio is a Predictor of Survival in CLL
[0169]Median event free survival (EFS) for the entire cohort was 87 months in CLLs displaying UM IgVH genes as compared to 149 months in MT patients (P<0.0001). It was 84 months for patients with a L/A ratio above 1 and 88 months for patients expressing ZAP-70, while median EFS was not achieved for L/A.sup.- (P<0.0001) nor ZAP-70.sup.- patients (P=0.0001) (FIG. 3A). Multivariate Cox regression showed that, with adjustment on age and sex, UM IgVH and stage B or C were independently associated with disease progression or CLL-related death with hazard ratios of respectively 5.0 (p<0.0001) and 2.6 (p=0.01) (Table 8). Similarly, L/A ratio above 1 and stage B or C were independently and significantly associated with shorter EFS. ZAP-70, however, was not found to be an independent prognosis factor.
[0170]In stage A patients, an identical median EFS of 87 months was observed for patients with UM IgVH genes, L/A ratio above 1 and expressing ZAP-70, while it was not achieved for cases with MT IgVH genes, L/A ratio below 1, and ZAP-70 negative (all P<0.0001) (FIG. 3B). In multivariate Cox analyses, after adjustment on age and sex, both ZAP-70 and L/A ratio were independent significant prognostic factors. This was also true for the IgVH mutational status (Table 8).
[0171]The 40 stage B and C patients were analyzed together for evaluation of overall survival (OS) (FIG. 3C). There was a trend for longer OS in patients with MT than in those with UM IgVH genes (128 vs 79 months; P=0.067). The L/A ratio was predictive of survival since patients with a ratio above 1 had a median OS of 79 months, while it was not yet reached at time of analysis for those with a ratio below 1 (P=0.03). In contrast ZAP-70 did not correlate with survival in this group (100 vs 80 months; P=0.28). By multivariate Cox analysis, an L/A ratio below 1 was found as a significant prognostic factor, while ZAP-70 was not independently associated with survival. In a separate Cox analysis, IgVH mutational status became a significant prognosis factor, after adjustment on age and sex (Table 8).
TABLE-US-00009 TABLE 8 Prognostic factors for disease progression and CLL-related death in multivariate Cox regression Hazard ratio Factor (95% CI) P All stages, event free survival for all stages Model 1 including IgVH Age 1.1 (1.0-1.2) 0.20* Sex (male) 1.4 (1.0-2.0) 0.29 Binet's stage B/C 2.6 (1.8-3.7) 0.01 Unmutated IgVH 5.0 (3.4-7.2) <0.0001 Model 2 including L/A ratio.sup.† Age 1.1 (1.0-1.2) 0.50* Sex (male) 1.4 (1.2-2.7) 0.12 Binet's stage B/C 2.5 (1.7-3.7) 0.02 L/A ratio ≧ 1 5.6 (3.8-8.1) <0.0001 Event-free survival for Binet's stage A Model 1 including IgVH Age 1.0 (0.9-1.1) 0.86* Sex 1.6 (1.0-2.3) 0.28 Unmutated IgVH 5.7 (3.6-9.1) 0.0002 Model 2 including L/A ratio and ZAP-70 Age 0.9 (0.8-1.0) 0.29* Sex (male) 1.7 (1.0-2.7) 0.32 ZAP-70 (<20%) 4.2 (2.3-7.7) 0.02 L/A ratio ≧ 1 3.9 (2.1-7.2) 0.03 Overall survival for stages B and C Model 1 including IgVH Age 1.5 (1.2-1.8) 0.03* Sex (male) 1.0 (0.5-2.1) 0.99 Unmutated IgVH 7.2 (3.4-15.1) 0.01 Model 2 including L/A ratio.sup.† Age 1.6 (1.3-2.0) 0.05* Sex (male) 0.5 (0.3-1.3) 0.46 L/A ratio ≧ 1 6.8 (3.3-14.) 0.01 Multivariate analyses were done separately for IgVH or ZAP-70 and L/A ratio, due to the high concordance between the latter two parameters and the former. *P-value for trend test .sup.†ZAP-70 was not independently associated with disease progression or CLL-related death and was then eliminated in the final Cox model.
Example 8
Determination of the LPL and ADAM29 Gene Expression by a Simple Qualitative Multiplex PCR Assay
[0172]To simplify the assessment of LPL and ADAM29 gene expression, the present inventors developed a simple competitive multiplex PCR assay, where both genes were simultaneously amplified generating PCR products of different size (respectively 410 bp and 445 bp) (FIG. 4). This assay was then evaluated on 95 patients of our series. Experiments were performed in duplicate on separate PCR for 25 cases and showed a perfect reproductibility.
[0173]Using our defined PCR conditions, the results were unambiguous in 89 cases with production of a single band, or 2 bands but with one clearly more intense than the other. They correlated with the RQ-PCR results, since patients expressing LPL preferentially had a L/A ratio above 1, while those expressing ADAM29 predominantly had a L/A ratio below 1. PCR products of both sizes with roughly similar intensities were obtained for 6 patients (6%). In 5 of these 6 cases for whom the multiplex PCR was not conclusive, the L/A ratio values were in the range of 0.7-1.5. None of these genes were detected when tested on purified B cells for healthy individuals or the Jurkatt T-cell line (FIG. 4).
[0174]Numerous modifications and variations on the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the accompanying claims, the invention may be practiced otherwise than as specifically described herein.
REFERENCES
[0175]1. Rai K R, Sawitsky A, Cronkite E P, Chanana A D, Levy R N, Pastemack B S. Clinical staging of chronic lymphocytic leukemia. Blood. 1975; 46:219-234 [0176]2. Binet J L, Leporrier M, Dighiero G, et al. A clinical staging system for chronic lymphocytic leukemia: prognostic significance. Cancer. 1977; 40:855-864 [0177]3. Dighiero G, Maloum K, Desablens B, et al. Chlorambucil in indolent chronic lymphocytic leukemia. French Cooperative Group on Chronic Lymphocytic Leukemia [see comments]. N Engl J Med. 1998; 338:1506-1514 [0178]4. Hallek M, Langenmayer I, Nerl C, et al. Elevated thymidine kinase levels identify a subgroup at high risk of disease progression in early, nonsmoldering chronic lymphocytic leukemia. Blood. 1999; 98: 1732-1737 [0179]5. Sarfati M, Chevret S, Chastang C, et al. Pronostic importance of serum soluble CD23 level in chronic lymphocytic leukemia. Blood. 1996; 88:4259-4264 [0180]6. Magnac C, Porcher R, Davi F, et al. Predictive value of serum thymidine kinase level for Ig-V mutational status in B-CLL. Leukemia. 2003; 17:133-137 [0181]7. Montserrat E. Classical and new prognostic factors in chronic lymphocytic leukemia: where to now? Hematol J. 2002; 3:7-9 [0182]8. Damle R N, Wasil T, Fais F, et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia [see comments]. Blood. 1999; 94:1840-1847 [0183]9. Ghia P, Guida G, Stella S, et al. The pattern of CD38 expression defines a distinct subset of chronic lymphocytic leukemia (CLL) patients at risk of disease progression. Blood. 2002 [0184]10. Krober A, Seiler T, Benner A, et al. V(H) mutation status, CD38 expression level, genomic aberrations, and survival in chronic lymphocytic leukemia. Blood. 2002; 100:1410-1416 [0185]11. Hamblin T J, Orchard J A, Ibbotson R E, et al. CD38 expression and immunoglobulin variable region mutations are independent prognostic variables in chronic lymphocytic leukemia, but CD38 expression may vary during the course of the disease. Blood. 2002; 99:1023-1029 [0186]12. Dohner H, Stilgenbauer S, Benner A, et al. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med. 2000; 343:1910-1916. [0187]13. Oscier D G, Gardiner A C, Mould S J, et al. Multivariate analysis of prognostic factors in CLL: clinical stage, IGVH gene mutational status, and loss or mutation of the p53 gene are independent prognostic factors. Blood. 2002; 100:1 177-1184 [0188]14. Schroeder H W, Jr., Dighiero G. The pathogenesis of chronic lymphocytic leukemia: analysis of the antibody repertoire [see comments]. Immunology Today. 1994; 15:288-294 [0189]15. Fais F, Ghiotto F, Hashimoto S, et al. Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J Clin Invest. 1998; 102:1515-1525 [0190]16. Hamblin T J, Davis Z, Gardiner A, Oscier D G, Stevenson F K. Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia [see comments]. Blood. 1999; 94:1848-1854 [0191]17. Maloum K, Davi F, Merle-Beral H, et al. Expression of unmutated VH genes is a detrimental prognostic factor in chronic lymphocytic leukemia. Blood. 2000; 96:377-379. [0192]18. Rosenwald A, Alizadeh A A, Widhopf G, et al. Relation of gene expression phenotype to immunoglobulin mutation genotype in B cell chronic lymphocytic leukemia. J Exp Med. 2001; 194:1639-1647 [0193]19. Wiestner A, Rosenwald A, Barry T S, et al. ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile. Blood. 2003. 2003; 101:4944-4951 [0194]20. Crespo M, Bosch F, Villamor N, et al. ZAP-70 expression as a surrogate for immunoglobulin-variable-region mutations in chronic lymphocytic leukemia. N Engl J Med. 2003; 348:1764-1775 [0195]21. Orchard J A, Ibbotson R E, Davis Z, et al. ZAP-70 expression and prognosis in chronic lymphocytic leukaemia. Lancet. 2004; 363:105-111 [0196]22. O'Connor S, Starczynski J, Teasdale J, et al. Can Zap-70 protein expression in B-CLL as detected by immunohistochemistry predict VH mutation status? [abstract] Blood. 2003; 102:34a [0197]23. Pittner T, Tschumper R C, Kimlinger T, et al. Expression of ZAP-70 in both unmutated and mutated CLL B cells indicates lack of efficacy as a surrogate marker for immunoglobulin mutational status [abstract]. Blood. 2003; 102:34a [0198]24. Moreau E J, Matutes E, A'Hern RP, et al. Improvement of the chronic lymphocytic leukemia scoring system with the monoclonal antibody SN8 (CD79b). Am J Clin Pathol. 1997; 108:378-382 [0199]25. Pritsch O, Troussard X, Magnac C, et al. VH gene usage by family members affected with chronic lymphocytic leukaemia. Br J Haematol. 1999; 107:616-624. [0200]26. van Dongen J J, Langerak A W, Bruggemann M, et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia. 2003; 17:2257-2317 [0201]27. Youden W J. Index of rating diagnostic tests. Cancer. 1950; 3; 32-35 [0202]28. Vasconcelos Y, Davi F, Levy V, et al. Binet's staging system and VH genes are independent but complementary prognostic indicators in chronic lymphocytic leukemia. J Clin Oncol. 2003; 21:3928-3932 [0203]29. Mead J R, Irvine S A, Ramji D P. Lipoprotein lipase: structure, function, regulation, and role in disease. J Mol Med. 2002; 80:753-769 [0204]30. Preiss-Landl K, Zimmermann R, Hammerle G, Zechner R. Lipoprotein lipase: the regulation of tissue specific expression and its role in lipid and energy metabolism. Curr Opin Lipidol. 2002; 13:471-481 [0205]31. Murthy V, Julien P, Gagne C. Molecular pathobiology of the human lipoprotein gene. Pharmacol Ther. 1996; 70:101-135 [0206]32. de Sanctis J B, Blanca I, Radzioch D, Bianco N E. Lipoprotein lipase expression in natural killer cells and its role in their cytotoxic activity. Immunology. 1994; 83:232-239 [0207]33. Yamamoto S, Higuchi S, Yoshiyama K, et al. ADAM family proteins in the immune system. Immunol Today. 1999; 20:278-284 [0208]34. Primakoff P, Myles D G. The ADAM gene family: surface proteins with adhesion and protease activity. Trends Genet. 2000; 16:83-87 [0209]35. Cerretti D P, DuBose R F, Black R A, Nelson N. Isolation of two novel metalloproteinase-disintegrin (ADAM) cDNAs that show testis-specific gene expression. Biochem Biophys Res Commun. 1999; 263:810-815
Sequence CWU
1
32120DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 1ggtgctgagt atgtcgtgga
20219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2atgccagtga gcttccgtt
19322DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 3ggaatgtatg agagttgggt gc
22421DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 4caatgcttcg accaggggac c
21522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5tcttatgtgg gctggtggat cc
22622DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 6gacctagatg atgagccact gc
22721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7ctgaaatgta ctgcgggagc c
21821DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 8ccaactcacc caggaagcac c
21922DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9ggatagcaca ttactggcct ct
221021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10aggtttaggt gaggtggcag g
21111428DNAHomo sapiensCDS(1)..(1425) 11atg gag agc aaa gcc ctg ctc gtg
ctg act ctg gcc gtg tgg ctc cag 48Met Glu Ser Lys Ala Leu Leu Val
Leu Thr Leu Ala Val Trp Leu Gln1 5 10
15agt ctg acc gcc tcc cgc gga ggg gtg gcc gcc gcc gac caa aga
aga 96Ser Leu Thr Ala Ser Arg Gly Gly Val Ala Ala Ala Asp Gln Arg
Arg 20 25 30gat ttt atc gac
atc gaa agt aaa ttt gcc cta agg acc cct gaa gac 144Asp Phe Ile Asp
Ile Glu Ser Lys Phe Ala Leu Arg Thr Pro Glu Asp 35
40 45aca gct gag gac act tgc cac ctc att ccc gga gta
gca gag tcc gtg 192Thr Ala Glu Asp Thr Cys His Leu Ile Pro Gly Val
Ala Glu Ser Val 50 55 60gct acc tgt
cat ttc aat cac agc agc aaa acc ttc atg gtg atc cat 240Ala Thr Cys
His Phe Asn His Ser Ser Lys Thr Phe Met Val Ile His65 70
75 80ggc tgg acg gta aca gga atg tat
gag agt tgg gtg cca aaa ctt gtg 288Gly Trp Thr Val Thr Gly Met Tyr
Glu Ser Trp Val Pro Lys Leu Val 85 90
95gcc gcc ctg tac aag aga gaa cca gac tcc aat gtc att gtg
gtg gac 336Ala Ala Leu Tyr Lys Arg Glu Pro Asp Ser Asn Val Ile Val
Val Asp 100 105 110tgg ctg tca
cgg gct cag gag cat tac cca gtg tcc gcg ggc tac acc 384Trp Leu Ser
Arg Ala Gln Glu His Tyr Pro Val Ser Ala Gly Tyr Thr 115
120 125aaa ctg gtg gga cag gat gtg gcc cgg ttt atc
aac tgg atg gag gag 432Lys Leu Val Gly Gln Asp Val Ala Arg Phe Ile
Asn Trp Met Glu Glu 130 135 140gag ttt
aac tac cct ctg gac aat gtc cat ctc ttg gga tac agc ctt 480Glu Phe
Asn Tyr Pro Leu Asp Asn Val His Leu Leu Gly Tyr Ser Leu145
150 155 160gga gcc cat gct gct ggc att
gca gga agt ctg acc aat aag aaa gtc 528Gly Ala His Ala Ala Gly Ile
Ala Gly Ser Leu Thr Asn Lys Lys Val 165
170 175aac aga att act ggc ctc gat cca gct gga cct aac
ttt gag tat gca 576Asn Arg Ile Thr Gly Leu Asp Pro Ala Gly Pro Asn
Phe Glu Tyr Ala 180 185 190gaa
gcc ccg agt cgt ctt tct cct gat gat gca gat ttt gta gac gtc 624Glu
Ala Pro Ser Arg Leu Ser Pro Asp Asp Ala Asp Phe Val Asp Val 195
200 205tta cac aca ttc acc aga ggg tcc cct
ggt cga agc att gga atc cag 672Leu His Thr Phe Thr Arg Gly Ser Pro
Gly Arg Ser Ile Gly Ile Gln 210 215
220aaa cca gtt ggg cat gtt gac att tac ccg aat gga ggt act ttt cag
720Lys Pro Val Gly His Val Asp Ile Tyr Pro Asn Gly Gly Thr Phe Gln225
230 235 240cca gga tgt aac
att gga gaa gct atc cgc gtg att gca gag aga gga 768Pro Gly Cys Asn
Ile Gly Glu Ala Ile Arg Val Ile Ala Glu Arg Gly 245
250 255ctt gga gat gtg gac cag cta gtg aag tgc
tcc cac gag cgc tcc att 816Leu Gly Asp Val Asp Gln Leu Val Lys Cys
Ser His Glu Arg Ser Ile 260 265
270cat ctc ttc atc gac tct ctg ttg aat gaa gaa aat cca agt aag gcc
864His Leu Phe Ile Asp Ser Leu Leu Asn Glu Glu Asn Pro Ser Lys Ala
275 280 285tac agg tgc agt tcc aag gaa
gcc ttt gag aaa ggg ctc tgc ttg agt 912Tyr Arg Cys Ser Ser Lys Glu
Ala Phe Glu Lys Gly Leu Cys Leu Ser 290 295
300tgt aga aag aac cgc tgc aac aat ctg ggc tat gag atc agt aaa gtc
960Cys Arg Lys Asn Arg Cys Asn Asn Leu Gly Tyr Glu Ile Ser Lys Val305
310 315 320aga gcc aaa aga
agc agc aaa atg tac ctg aag act cgt tct cag atg 1008Arg Ala Lys Arg
Ser Ser Lys Met Tyr Leu Lys Thr Arg Ser Gln Met 325
330 335ccc tac aaa gtc ttc cat tac caa gta aag
att cat ttt tct ggg act 1056Pro Tyr Lys Val Phe His Tyr Gln Val Lys
Ile His Phe Ser Gly Thr 340 345
350gag agt gaa acc cat acc aat cag gcc ttt gag att tct ctg tat ggc
1104Glu Ser Glu Thr His Thr Asn Gln Ala Phe Glu Ile Ser Leu Tyr Gly
355 360 365acc gtg gcc gag agt gag aac
atc cca ttc act ctg cct gaa gtt tcc 1152Thr Val Ala Glu Ser Glu Asn
Ile Pro Phe Thr Leu Pro Glu Val Ser 370 375
380aca aat aag acc tac tcc ttc cta att tac aca gag gta gat att gga
1200Thr Asn Lys Thr Tyr Ser Phe Leu Ile Tyr Thr Glu Val Asp Ile Gly385
390 395 400gaa cta ctc atg
ttg aag ctc aaa tgg aag agt gat tca tac ttt agc 1248Glu Leu Leu Met
Leu Lys Leu Lys Trp Lys Ser Asp Ser Tyr Phe Ser 405
410 415tgg tca gac tgg tgg agc agt ccc ggc ttc
gcc att cag aag atc aga 1296Trp Ser Asp Trp Trp Ser Ser Pro Gly Phe
Ala Ile Gln Lys Ile Arg 420 425
430gta aaa gca gga gag act cag aaa aag gtg atc ttc tgt tct agg gag
1344Val Lys Ala Gly Glu Thr Gln Lys Lys Val Ile Phe Cys Ser Arg Glu
435 440 445aaa gtg tct cat ttg cag aaa
gga aag gca cct gcg gta ttt gtg aaa 1392Lys Val Ser His Leu Gln Lys
Gly Lys Ala Pro Ala Val Phe Val Lys 450 455
460tgc cat gac aag tct ctg aat aag aag tca ggc tag
1428Cys His Asp Lys Ser Leu Asn Lys Lys Ser Gly465 470
47512475PRTHomo sapiens 12Met Glu Ser Lys Ala Leu Leu Val
Leu Thr Leu Ala Val Trp Leu Gln1 5 10
15Ser Leu Thr Ala Ser Arg Gly Gly Val Ala Ala Ala Asp Gln
Arg Arg 20 25 30Asp Phe Ile
Asp Ile Glu Ser Lys Phe Ala Leu Arg Thr Pro Glu Asp 35
40 45Thr Ala Glu Asp Thr Cys His Leu Ile Pro Gly
Val Ala Glu Ser Val 50 55 60Ala Thr
Cys His Phe Asn His Ser Ser Lys Thr Phe Met Val Ile His65
70 75 80Gly Trp Thr Val Thr Gly Met
Tyr Glu Ser Trp Val Pro Lys Leu Val 85 90
95Ala Ala Leu Tyr Lys Arg Glu Pro Asp Ser Asn Val Ile
Val Val Asp 100 105 110Trp Leu
Ser Arg Ala Gln Glu His Tyr Pro Val Ser Ala Gly Tyr Thr 115
120 125Lys Leu Val Gly Gln Asp Val Ala Arg Phe
Ile Asn Trp Met Glu Glu 130 135 140Glu
Phe Asn Tyr Pro Leu Asp Asn Val His Leu Leu Gly Tyr Ser Leu145
150 155 160Gly Ala His Ala Ala Gly
Ile Ala Gly Ser Leu Thr Asn Lys Lys Val 165
170 175Asn Arg Ile Thr Gly Leu Asp Pro Ala Gly Pro Asn
Phe Glu Tyr Ala 180 185 190Glu
Ala Pro Ser Arg Leu Ser Pro Asp Asp Ala Asp Phe Val Asp Val 195
200 205Leu His Thr Phe Thr Arg Gly Ser Pro
Gly Arg Ser Ile Gly Ile Gln 210 215
220Lys Pro Val Gly His Val Asp Ile Tyr Pro Asn Gly Gly Thr Phe Gln225
230 235 240Pro Gly Cys Asn
Ile Gly Glu Ala Ile Arg Val Ile Ala Glu Arg Gly 245
250 255Leu Gly Asp Val Asp Gln Leu Val Lys Cys
Ser His Glu Arg Ser Ile 260 265
270His Leu Phe Ile Asp Ser Leu Leu Asn Glu Glu Asn Pro Ser Lys Ala
275 280 285Tyr Arg Cys Ser Ser Lys Glu
Ala Phe Glu Lys Gly Leu Cys Leu Ser 290 295
300Cys Arg Lys Asn Arg Cys Asn Asn Leu Gly Tyr Glu Ile Ser Lys
Val305 310 315 320Arg Ala
Lys Arg Ser Ser Lys Met Tyr Leu Lys Thr Arg Ser Gln Met
325 330 335Pro Tyr Lys Val Phe His Tyr
Gln Val Lys Ile His Phe Ser Gly Thr 340 345
350Glu Ser Glu Thr His Thr Asn Gln Ala Phe Glu Ile Ser Leu
Tyr Gly 355 360 365Thr Val Ala Glu
Ser Glu Asn Ile Pro Phe Thr Leu Pro Glu Val Ser 370
375 380Thr Asn Lys Thr Tyr Ser Phe Leu Ile Tyr Thr Glu
Val Asp Ile Gly385 390 395
400Glu Leu Leu Met Leu Lys Leu Lys Trp Lys Ser Asp Ser Tyr Phe Ser
405 410 415Trp Ser Asp Trp Trp
Ser Ser Pro Gly Phe Ala Ile Gln Lys Ile Arg 420
425 430Val Lys Ala Gly Glu Thr Gln Lys Lys Val Ile Phe
Cys Ser Arg Glu 435 440 445Lys Val
Ser His Leu Gln Lys Gly Lys Ala Pro Ala Val Phe Val Lys 450
455 460Cys His Asp Lys Ser Leu Asn Lys Lys Ser
Gly465 470 475133617DNARattus
norvegicusCDS(175)..(1596) 13ttctgcccct tgtagctgtt ctgccctccc ctttaaaggt
tgacttgccc cgcggcgctc 60caccgcgctc tagtcctctg acgcctccgg ctcaaccctt
tgcaacgcgg atccccgccc 120gcctgactgc ccgcgcagcg cagttccagc agcaaagcag
aagggcgcgc cgag atg 177Met1gag agc aaa gcc ctg ctc ctg gtg gcc ctg
gga gtt tgg ctc cag agt 225Glu Ser Lys Ala Leu Leu Leu Val Ala Leu
Gly Val Trp Leu Gln Ser 5 10
15ttg acc gcc ttc cgc gga ggg gtg gcc gca gca gac ggg gga aga gat
273Leu Thr Ala Phe Arg Gly Gly Val Ala Ala Ala Asp Gly Gly Arg Asp
20 25 30ttc tca gac atc gaa agt aaa ttt
gcc cta agg acc cct gaa gac aca 321Phe Ser Asp Ile Glu Ser Lys Phe
Ala Leu Arg Thr Pro Glu Asp Thr 35 40
45gct gag gac act tgt cat ctg att cct gga tta gca gac tct gtg tct
369Ala Glu Asp Thr Cys His Leu Ile Pro Gly Leu Ala Asp Ser Val Ser50
55 60 65aac tgc cac ttc aac
cac agc agc aaa acc ttt gtg gtg atc cat gga 417Asn Cys His Phe Asn
His Ser Ser Lys Thr Phe Val Val Ile His Gly 70
75 80tgg acg gtg aca gga atg tat gag agt tgg gtg
ccc aaa ctt gtg gct 465Trp Thr Val Thr Gly Met Tyr Glu Ser Trp Val
Pro Lys Leu Val Ala 85 90
95gcc cta tac aaa aga gaa cct gac tcc aat gtc att gta gta gac tgg
513Ala Leu Tyr Lys Arg Glu Pro Asp Ser Asn Val Ile Val Val Asp Trp
100 105 110ttg tat cgg gcc cag caa cat
tat cca gtg tct gcc ggc tat acc aag 561Leu Tyr Arg Ala Gln Gln His
Tyr Pro Val Ser Ala Gly Tyr Thr Lys 115 120
125ctg gtg gga aat gat gtg gcc agg ttc atc aac tgg ctg gag gaa gaa
609Leu Val Gly Asn Asp Val Ala Arg Phe Ile Asn Trp Leu Glu Glu Glu130
135 140 145ttt aac tac ccc
cta gac aat gtc cac ctc tta ggg tac agt ctt gga 657Phe Asn Tyr Pro
Leu Asp Asn Val His Leu Leu Gly Tyr Ser Leu Gly 150
155 160gcc cat gct gct ggc gtg gca gga agt ctg
acc aac aag aag gtc aat 705Ala His Ala Ala Gly Val Ala Gly Ser Leu
Thr Asn Lys Lys Val Asn 165 170
175aga att act ggc ttg gat cca gct ggg cct aac ttt gag tat gca gaa
753Arg Ile Thr Gly Leu Asp Pro Ala Gly Pro Asn Phe Glu Tyr Ala Glu
180 185 190gcc cct agt cgc ctt tct cct
gat gat gcg gat ttc gta gat gtc tta 801Ala Pro Ser Arg Leu Ser Pro
Asp Asp Ala Asp Phe Val Asp Val Leu 195 200
205cac aca ttt acc agg ggg tcg cct ggt cga agt att ggg atc cag aaa
849His Thr Phe Thr Arg Gly Ser Pro Gly Arg Ser Ile Gly Ile Gln Lys210
215 220 225cca gta ggg cat
gtt gat att tat ccc aat gga ggc act ttc cag cca 897Pro Val Gly His
Val Asp Ile Tyr Pro Asn Gly Gly Thr Phe Gln Pro 230
235 240gga tgc aac att gga gaa gcc att cgt gta
att gca gag aag ggg ctt 945Gly Cys Asn Ile Gly Glu Ala Ile Arg Val
Ile Ala Glu Lys Gly Leu 245 250
255gga gat gtg gac cag ctg gtg aag tgc tcg cac gag cgc tcc atc cat
993Gly Asp Val Asp Gln Leu Val Lys Cys Ser His Glu Arg Ser Ile His
260 265 270ctc ttc att gac tcc ctg ctg
aat gaa gaa aac ccc agc aag gca tac 1041Leu Phe Ile Asp Ser Leu Leu
Asn Glu Glu Asn Pro Ser Lys Ala Tyr 275 280
285agg tgc aat tcc aag gag gcc ttt gag aaa ggg ctc tgc ctg agt tgc
1089Arg Cys Asn Ser Lys Glu Ala Phe Glu Lys Gly Leu Cys Leu Ser Cys290
295 300 305aga aag aat cgc
tgt aac aac gtg ggc tat gag atc aac aag gtc aga 1137Arg Lys Asn Arg
Cys Asn Asn Val Gly Tyr Glu Ile Asn Lys Val Arg 310
315 320gcc aag aga agc agt aag atg tac ctg aag
act cgc tct cag atg ccc 1185Ala Lys Arg Ser Ser Lys Met Tyr Leu Lys
Thr Arg Ser Gln Met Pro 325 330
335tac aaa gta ttc cat tac caa gtc aag att cac ttt tct gga act gag
1233Tyr Lys Val Phe His Tyr Gln Val Lys Ile His Phe Ser Gly Thr Glu
340 345 350aat gac aag caa aac aac cag
gcc ttc gag att tct ctg tat ggc aca 1281Asn Asp Lys Gln Asn Asn Gln
Ala Phe Glu Ile Ser Leu Tyr Gly Thr 355 360
365gtg gct gaa agt gag aac att ccc ttc acc ctg ccg gag gtc gcc aca
1329Val Ala Glu Ser Glu Asn Ile Pro Phe Thr Leu Pro Glu Val Ala Thr370
375 380 385aat aaa acc tac
tcc ttc ttg att tac acg gag gtg gac atc ggg gaa 1377Asn Lys Thr Tyr
Ser Phe Leu Ile Tyr Thr Glu Val Asp Ile Gly Glu 390
395 400ttg ctg atg atg aag ctt aag tgg aag aac
gac tcc tac ttc cgc tgg 1425Leu Leu Met Met Lys Leu Lys Trp Lys Asn
Asp Ser Tyr Phe Arg Trp 405 410
415tca gac tgg tgg agc agt ccc agc ttt gtc atc gag aag atc cga gtg
1473Ser Asp Trp Trp Ser Ser Pro Ser Phe Val Ile Glu Lys Ile Arg Val
420 425 430aaa gcc gga gag act cag aaa
aag gtc atc ttc tgt gcc agg gag aaa 1521Lys Ala Gly Glu Thr Gln Lys
Lys Val Ile Phe Cys Ala Arg Glu Lys 435 440
445gtt tct cat ctg cag aaa gga aag gac gct gca gtg ttt gtg aaa tgc
1569Val Ser His Leu Gln Lys Gly Lys Asp Ala Ala Val Phe Val Lys Cys450
455 460 465cat gac aag tct
ctg aag aag tcg ggc tgacactgga caaaccaaca 1616His Asp Lys Ser
Leu Lys Lys Ser Gly 470agagaagaaa gcatctgagt tctttgaaga
ccgaagaaaa tgaagtaaat tttatttaaa 1676aaaaataccc ttgtttgggt gtttgaaagt
ggattttcct gagtattaat cccagctata 1736tcttgttagt taaatagaag acagtgtcaa
atattaaaag gtggctaaca caacgtgagg 1796aacctaatgg ccgatagcat gtcctccagc
atcagaagac agcagagagg agaagcatgc 1856catcttatat cccttaagaa ggaatcattt
gttcccaacc atacaagact ccttcatgtg 1916acccatttgg tcatggtcta aaattagtaa
gggcctctta ttttcattag atctctgagg 1976ttttaaattg agaccttctc aaagttctct
tgaagtctaa tatagacaac atttttttgt 2036gctgtgagtc agatccattt ctttagcagt
tgaaacagct ggccattgta actagttctt 2096ttaccatcag gatatagcac ccctaccaaa
taaaataaat aaataaagtg accagggaca 2156tgtgactttg caaaagcaat ggacgacgtg
gctcgtggat tcctgaccct tagtcccacc 2216acaacgaagt acaagtcagt agaggtacaa
aacctagact gagtaattct tagtagactt 2276caagttttat ggcttaattc ctctgtcttt
taaaaacgtg tcacatatta taacattatt 2336ctctagacag atgttgaaat gagcttgtga
ttcaggtgac atatgaattg agctgagaga 2396aaataatgcc ctggctgatt ttatttctct
gttttgcttt cttgagaaaa ggaatacttg 2456tcccactccg tatctgagcc tgaccaagaa
ctaaactatg tacttcaggc ttaccttgaa 2516ctctcaacca tcctgccttg gcttcctgag
tgctgggagc ttgataacca taattttatt 2576atcagatttt tcttagtcat tttcaccaat
agaacacatt caatgcccaa tcgttagcat 2636ttcgtttgag actcatcttg accgtacctc
tgtcacacgt ctaacacatc acattaattt 2696ctagtttaga agtgatcaag ttcaaattct
gcactgcgca aagtacaagt tttagagcag 2756gaccattttt tttttaccac gtaaaagtcg
aaattactag gaaatgtgta tatcgatgct 2816tgtacactgt tgcgtgcaaa gtgaggagcc
ttctattgtg atagccatag acagtaccag 2876gctcgttgcc gctcttttgt tttactataa
aaaaataatg aagaattatt tatgaacaag 2936atctcatatg ttcagattgc ttttactatt
catcaatata aaatgttaaa aaaaaaaaat 2996aaaacaagtt ctatctcaga ggctgttgct
gggaacagaa actgtgaaat gtgtgggtat 3056ctgaacacct acacacaagc aaagccccac
aagagtcttt gtcattcaat gtcattcaga 3116aaggaaagag tcaagagata taccataata
tgtcagagaa gtagttccag atatgctgga 3176atgctagccc ttgctaggag aaagttggtt
gtgcctatgt aatataggac aaaagtgact 3236ggtttcatta ggctcagtgt cattctaaca
ataaaatgat gtaccatatg tcaccagcat 3296ccccattatt gctaattcat ggcagtatat
acgtacatat ctcaatgatg ctttgacttt 3356aaattttatt tattagctgt aaataatgtg
tgggtgtgta aggaagcttg taaacactgg 3416aaacgctgtt gtggctatct ggggtgtaga
tttgtggtgc taactctgtg tccacctcca 3476tcagtgattg tctcactgag ccaactcact
ctgatgaaca gcacaatgga atagcttttg 3536aaggaagaaa ataaactcac ctgtgtgaag
aaatgggatc tgctttcaat aaaatcgaga 3596acgttttatc cggaatccgc g
361714474PRTRattus norvegicus 14Met Glu
Ser Lys Ala Leu Leu Leu Val Ala Leu Gly Val Trp Leu Gln1 5
10 15Ser Leu Thr Ala Phe Arg Gly Gly Val
Ala Ala Ala Asp Gly Gly Arg 20 25
30Asp Phe Ser Asp Ile Glu Ser Lys Phe Ala Leu Arg Thr Pro Glu Asp
35 40 45Thr Ala Glu Asp Thr Cys His
Leu Ile Pro Gly Leu Ala Asp Ser Val 50 55
60Ser Asn Cys His Phe Asn His Ser Ser Lys Thr Phe Val Val Ile His65
70 75 80Gly Trp Thr Val
Thr Gly Met Tyr Glu Ser Trp Val Pro Lys Leu Val 85
90 95Ala Ala Leu Tyr Lys Arg Glu Pro Asp Ser
Asn Val Ile Val Val Asp 100 105
110Trp Leu Tyr Arg Ala Gln Gln His Tyr Pro Val Ser Ala Gly Tyr Thr
115 120 125Lys Leu Val Gly Asn Asp Val
Ala Arg Phe Ile Asn Trp Leu Glu Glu 130 135
140Glu Phe Asn Tyr Pro Leu Asp Asn Val His Leu Leu Gly Tyr Ser
Leu145 150 155 160Gly Ala
His Ala Ala Gly Val Ala Gly Ser Leu Thr Asn Lys Lys Val
165 170 175Asn Arg Ile Thr Gly Leu Asp
Pro Ala Gly Pro Asn Phe Glu Tyr Ala 180 185
190Glu Ala Pro Ser Arg Leu Ser Pro Asp Asp Ala Asp Phe Val
Asp Val 195 200 205Leu His Thr Phe
Thr Arg Gly Ser Pro Gly Arg Ser Ile Gly Ile Gln 210
215 220Lys Pro Val Gly His Val Asp Ile Tyr Pro Asn Gly
Gly Thr Phe Gln225 230 235
240Pro Gly Cys Asn Ile Gly Glu Ala Ile Arg Val Ile Ala Glu Lys Gly
245 250 255Leu Gly Asp Val Asp
Gln Leu Val Lys Cys Ser His Glu Arg Ser Ile 260
265 270His Leu Phe Ile Asp Ser Leu Leu Asn Glu Glu Asn
Pro Ser Lys Ala 275 280 285Tyr Arg
Cys Asn Ser Lys Glu Ala Phe Glu Lys Gly Leu Cys Leu Ser 290
295 300Cys Arg Lys Asn Arg Cys Asn Asn Val Gly Tyr
Glu Ile Asn Lys Val305 310 315
320Arg Ala Lys Arg Ser Ser Lys Met Tyr Leu Lys Thr Arg Ser Gln Met
325 330 335Pro Tyr Lys Val
Phe His Tyr Gln Val Lys Ile His Phe Ser Gly Thr 340
345 350Glu Asn Asp Lys Gln Asn Asn Gln Ala Phe Glu
Ile Ser Leu Tyr Gly 355 360 365Thr
Val Ala Glu Ser Glu Asn Ile Pro Phe Thr Leu Pro Glu Val Ala 370
375 380Thr Asn Lys Thr Tyr Ser Phe Leu Ile Tyr
Thr Glu Val Asp Ile Gly385 390 395
400Glu Leu Leu Met Met Lys Leu Lys Trp Lys Asn Asp Ser Tyr Phe
Arg 405 410 415Trp Ser Asp
Trp Trp Ser Ser Pro Ser Phe Val Ile Glu Lys Ile Arg 420
425 430Val Lys Ala Gly Glu Thr Gln Lys Lys Val
Ile Phe Cys Ala Arg Glu 435 440
445Lys Val Ser His Leu Gln Lys Gly Lys Asp Ala Ala Val Phe Val Lys 450
455 460Cys His Asp Lys Ser Leu Lys Lys
Ser Gly465 470153969DNAMus musculusCDS(200)..(1621)
15tgtcagactc tcgatttctc ctcctactcc tcctccgagg aattctgcgc cctgtaactg
60ttctgccctc ccctttaaag gttgacttgc cctacggcgc tccaccgcgc tccagtcctc
120ttgcgcctcc tgctcaaccc gctcctgact gccccacgcc gcgtagttcc agcagcaaag
180cagaagggtg caccgggag atg gag agc aaa gcc ctg ctc ctg gtg gtc ctg
232Met Glu Ser Lys Ala Leu Leu Leu Val Val Leu1 5
10gga gtt tgg ctc cag agt ttg acc gcc ttc cga gga ggg gtg gcc gca
280Gly Val Trp Leu Gln Ser Leu Thr Ala Phe Arg Gly Gly Val Ala Ala
15 20 25gca gac gca gga aga
gat ttc tca gac atc gaa agc aaa ttt gcc cta 328Ala Asp Ala Gly Arg
Asp Phe Ser Asp Ile Glu Ser Lys Phe Ala Leu 30 35
40agg acc cct gaa gac aca gct gag gac act tgt cat ctc
att cct gga 376Arg Thr Pro Glu Asp Thr Ala Glu Asp Thr Cys His Leu
Ile Pro Gly 45 50 55tta gca gac tct
gtg tct aac tgc cac ttc aac cac agc agc aag acc 424Leu Ala Asp Ser
Val Ser Asn Cys His Phe Asn His Ser Ser Lys Thr60 65
70 75ttc gtg gtg atc cat gga tgg acg gta
acg gga atg tat gag agt tgg 472Phe Val Val Ile His Gly Trp Thr Val
Thr Gly Met Tyr Glu Ser Trp 80 85
90gtg ccc aaa ctt gtg gcc gcc ctg tac aag aga gaa cct gac tcc
aat 520Val Pro Lys Leu Val Ala Ala Leu Tyr Lys Arg Glu Pro Asp Ser
Asn 95 100 105gtc att gta gta
gac tgg ttg tat cgg gcc cag caa cat tat cca gtg 568Val Ile Val Val
Asp Trp Leu Tyr Arg Ala Gln Gln His Tyr Pro Val 110
115 120tca gct ggc tac acc aag ctg gtg gga aat gat gtg
gcc aga ttc atc 616Ser Ala Gly Tyr Thr Lys Leu Val Gly Asn Asp Val
Ala Arg Phe Ile 125 130 135aac tgg atg
gag gag gag ttt aag tac ccc cta gac aac gtc cac ctc 664Asn Trp Met
Glu Glu Glu Phe Lys Tyr Pro Leu Asp Asn Val His Leu140
145 150 155tta ggg tac agc ctt gga gcc
cat gct gct ggc gta gca gga agt ctg 712Leu Gly Tyr Ser Leu Gly Ala
His Ala Ala Gly Val Ala Gly Ser Leu 160
165 170acc aat aag aag gtc aat aga att act ggt ttg gat
cca gct ggg cct 760Thr Asn Lys Lys Val Asn Arg Ile Thr Gly Leu Asp
Pro Ala Gly Pro 175 180 185aac
ttt gag tat gca gaa gcc ccc agt cgc ctt tct cct gat gac gct 808Asn
Phe Glu Tyr Ala Glu Ala Pro Ser Arg Leu Ser Pro Asp Asp Ala 190
195 200gat ttt gta gat gtc tta cac aca ttt
acc agg ggg tca cct ggt cga 856Asp Phe Val Asp Val Leu His Thr Phe
Thr Arg Gly Ser Pro Gly Arg 205 210
215agt att ggg atc cag aaa cca gtg ggg cat gtt gac att tat ccc aat
904Ser Ile Gly Ile Gln Lys Pro Val Gly His Val Asp Ile Tyr Pro Asn220
225 230 235gga ggc act ttc
cag cca gga tgc aac att gga gaa gcc atc cgt gtg 952Gly Gly Thr Phe
Gln Pro Gly Cys Asn Ile Gly Glu Ala Ile Arg Val 240
245 250att gca gag aga gga ctc gga gac gtg gac
cag ctg gtg aag tgc tcg 1000Ile Ala Glu Arg Gly Leu Gly Asp Val Asp
Gln Leu Val Lys Cys Ser 255 260
265cat gag cgc tcc att cat ctc ttc att gac tcc ctg ctg aat gaa gaa
1048His Glu Arg Ser Ile His Leu Phe Ile Asp Ser Leu Leu Asn Glu Glu
270 275 280aac ccc agc aaa gca tac agg
tgc aac tcc aag gaa gcc ttt gag aaa 1096Asn Pro Ser Lys Ala Tyr Arg
Cys Asn Ser Lys Glu Ala Phe Glu Lys 285 290
295ggg ctc tgc ctg agt tgt aga aag aat cgc tgt aac aat ctg ggc tat
1144Gly Leu Cys Leu Ser Cys Arg Lys Asn Arg Cys Asn Asn Leu Gly Tyr300
305 310 315gag atc aac aag
gtc aga gcc aag aga agc agc aag atg tac ctg aag 1192Glu Ile Asn Lys
Val Arg Ala Lys Arg Ser Ser Lys Met Tyr Leu Lys 320
325 330act cgc tct cag atg ccc tac aaa gtg ttc
cat tac caa gtc aag att 1240Thr Arg Ser Gln Met Pro Tyr Lys Val Phe
His Tyr Gln Val Lys Ile 335 340
345cac ttt tct ggg act gag aat ggc aag caa cac aac cag gcc ttc gaa
1288His Phe Ser Gly Thr Glu Asn Gly Lys Gln His Asn Gln Ala Phe Glu
350 355 360att tct ctg tac ggc aca gtg
gcc gag agc gag aac att ccc ttc acc 1336Ile Ser Leu Tyr Gly Thr Val
Ala Glu Ser Glu Asn Ile Pro Phe Thr 365 370
375ctg ccc gag gtt tcc aca aat aaa acc tac tcc ttc ttg att tac acg
1384Leu Pro Glu Val Ser Thr Asn Lys Thr Tyr Ser Phe Leu Ile Tyr Thr380
385 390 395gag gtg gac atc
gga gaa ctg ctc atg atg aag ctt aag tgg atg agc 1432Glu Val Asp Ile
Gly Glu Leu Leu Met Met Lys Leu Lys Trp Met Ser 400
405 410gac tcc tac ttc agc tgg ccc gac tgg tgg
agc agc ccc agc ttc gtc 1480Asp Ser Tyr Phe Ser Trp Pro Asp Trp Trp
Ser Ser Pro Ser Phe Val 415 420
425atc gag agg atc cga gtg aaa gcc gga gag act cag aaa aag gtc atc
1528Ile Glu Arg Ile Arg Val Lys Ala Gly Glu Thr Gln Lys Lys Val Ile
430 435 440ttc tgt gct agg gag aaa gtt
tct cat ctg cag aag gga aag gac tca 1576Phe Cys Ala Arg Glu Lys Val
Ser His Leu Gln Lys Gly Lys Asp Ser 445 450
455gca gtg ttt gtg aaa tgc cat gac aag tct ctg aag aag tct ggc
1621Ala Val Phe Val Lys Cys His Asp Lys Ser Leu Lys Lys Ser Gly460
465 470tgacactgga caaacaaaca agagaagaaa
gcatccgagt tctttgaaga cagaagaaaa 1681caaagtaaat ttaatttaaa aaaataatac
ccttgtttgg gtgtttgaaa gtgggttttc 1741ctgagtatta atcccagctc tatcttgtta
gttaaacaga agacagtctc aaatattaaa 1801cggtggctaa cccagggtga ggaatctaat
ggcccatagc aggtcttcca gcatcagaag 1861acatcaggca ggagaaacat gctgtcttgt
atcccttaag aaggaatcat ttgttcccaa 1921caatataaga ctccatcatg tgacccattt
ggtcatggtc taaaattagt aagaactctg 1981aggttttata ttgagacctt ttcaaagttt
tctcaaagtc taatatagac aatatttttt 2041gtggcatgag tcaggtccat ttctttagcg
gttgaaacac ctggcctttg caactagttt 2101ttttttacca ttgggatata ttccccccac
caaaaaaaaa aaaaaaaaaa agtaaccagg 2161aacgtgtgac ttggcaaaag cagttgaaga
catggctcat gaagtcctga cccttggtcc 2221caccacaaca aagtacaagt caacagagat
acaaaaccta gactgagtaa ttcttaatag 2281acttgaattt ttatggctta atccttctat
cttttaaata tttgtcagat attttaacat 2341tgttctctgg atagatgttg aaaatgagct
tataagctgg gcaatggtgg cgctcacctt 2401taatcccagc acttggcagg cagaggcagg
cggatttctg agttcaaggc cagcctggtt 2461tacagagtga gttccaggac atccagagct
acacagagaa accctgtctc gggaaaaaaa 2521aaaaaaaaga agaagaagga gaagaagagg
gagggaggga gggagggagg gagggaggga 2581ggaaggaagg aaggaaggaa ggaaggaagg
aaggaaggaa ggaaggaagg aagaaagaaa 2641gaaagaaaga aagaaagaaa gaaagaaaga
aagaaagaaa gaaagaaaga aagaaagaaa 2701atgagcttgt aattgaggtg acacataaat
tttgctgaaa gacaaaaatg cctaggttga 2761ttttacttct cttttttgct ttcttgaaaa
aagtcacaat tgtcccatgc tgtaaccaag 2821tctggcctag aactaaacta tgtatttcag
gctggccttg aactctcaac catcctgcct 2881tagcttcctg tgtcctggga gcttgagaac
cgtaatttta ttatcagatt tttcttactt 2941gttttcatca atttgaaatg cccaatatcc
aatactttgt atttcatttg agactcatct 3001ccgccatgcc tctgtcacac ttctaacaca
tcacattaat ttctagttta gatgtgatca 3061agttcaaatt ctgcactgtg caaagtacaa
gttttagagc aggaccattt tttttatcac 3121ataaaagttg aaattactag aaaatgtgca
tatggatgct tgtaaactgc tgtgcaaaga 3181gaagagccct caactgtaat agctatagaa
agtaccagga ttgttgccgc tgttttgttt 3241taccttaaca acaacaacaa caaaaatcaa
taatgaagaa ttatttatga acgagatctc 3301acattttcag attgctttta ttattcatta
atgtaaaatg ataaagaaga tctatctcag 3361aggctatagc tgggagcaga aactgtgaaa
tttgtgggta tctgaacacc aacccacatg 3421caaaacccca caagtgtagt cgtcattcaa
tgtgattcag aaaggaaaga gtcaagggat 3481atactggaat atgttagaga agtagttcca
gatatgctgg aatgttagcc cttgctagga 3541gaaagctggt tgtgcctatg taatatagga
caaaggtgac cgatttcatc aagtttggag 3601tcaattctaa caataaaaat atgtataatt
tgttaccggc atccccatta ttgctaattc 3661attacagtat atacacatcc atgcatacat
atgtcaatga tgctttagct ttcaatttat 3721ttattagctg taaataatgt gtgggtatgt
aagaatgctt gtaaacactg gaaagtctgt 3781tgtggttatc tgcagtatag atttgtggtg
ctaactttgt gtccgtctcc atccatgatt 3841gtctgtctca ctgagccaac ttaactctga
tgaaacagta caatgaaata ggcttttgaa 3901agaagaaaac tcacctgtgt gaagaaatgg
tatctgcttt caataaaact gagaacattt 3961tatcatga
396916474PRTMus musculus 16Met Glu Ser
Lys Ala Leu Leu Leu Val Val Leu Gly Val Trp Leu Gln1 5
10 15Ser Leu Thr Ala Phe Arg Gly Gly Val
Ala Ala Ala Asp Ala Gly Arg 20 25
30Asp Phe Ser Asp Ile Glu Ser Lys Phe Ala Leu Arg Thr Pro Glu Asp
35 40 45Thr Ala Glu Asp Thr Cys His
Leu Ile Pro Gly Leu Ala Asp Ser Val 50 55
60Ser Asn Cys His Phe Asn His Ser Ser Lys Thr Phe Val Val Ile His65
70 75 80Gly Trp Thr Val
Thr Gly Met Tyr Glu Ser Trp Val Pro Lys Leu Val 85
90 95Ala Ala Leu Tyr Lys Arg Glu Pro Asp Ser
Asn Val Ile Val Val Asp 100 105
110Trp Leu Tyr Arg Ala Gln Gln His Tyr Pro Val Ser Ala Gly Tyr Thr
115 120 125Lys Leu Val Gly Asn Asp Val
Ala Arg Phe Ile Asn Trp Met Glu Glu 130 135
140Glu Phe Lys Tyr Pro Leu Asp Asn Val His Leu Leu Gly Tyr Ser
Leu145 150 155 160Gly Ala
His Ala Ala Gly Val Ala Gly Ser Leu Thr Asn Lys Lys Val
165 170 175Asn Arg Ile Thr Gly Leu Asp
Pro Ala Gly Pro Asn Phe Glu Tyr Ala 180 185
190Glu Ala Pro Ser Arg Leu Ser Pro Asp Asp Ala Asp Phe Val
Asp Val 195 200 205Leu His Thr Phe
Thr Arg Gly Ser Pro Gly Arg Ser Ile Gly Ile Gln 210
215 220Lys Pro Val Gly His Val Asp Ile Tyr Pro Asn Gly
Gly Thr Phe Gln225 230 235
240Pro Gly Cys Asn Ile Gly Glu Ala Ile Arg Val Ile Ala Glu Arg Gly
245 250 255Leu Gly Asp Val Asp
Gln Leu Val Lys Cys Ser His Glu Arg Ser Ile 260
265 270His Leu Phe Ile Asp Ser Leu Leu Asn Glu Glu Asn
Pro Ser Lys Ala 275 280 285Tyr Arg
Cys Asn Ser Lys Glu Ala Phe Glu Lys Gly Leu Cys Leu Ser 290
295 300Cys Arg Lys Asn Arg Cys Asn Asn Leu Gly Tyr
Glu Ile Asn Lys Val305 310 315
320Arg Ala Lys Arg Ser Ser Lys Met Tyr Leu Lys Thr Arg Ser Gln Met
325 330 335Pro Tyr Lys Val
Phe His Tyr Gln Val Lys Ile His Phe Ser Gly Thr 340
345 350Glu Asn Gly Lys Gln His Asn Gln Ala Phe Glu
Ile Ser Leu Tyr Gly 355 360 365Thr
Val Ala Glu Ser Glu Asn Ile Pro Phe Thr Leu Pro Glu Val Ser 370
375 380Thr Asn Lys Thr Tyr Ser Phe Leu Ile Tyr
Thr Glu Val Asp Ile Gly385 390 395
400Glu Leu Leu Met Met Lys Leu Lys Trp Met Ser Asp Ser Tyr Phe
Ser 405 410 415Trp Pro Asp
Trp Trp Ser Ser Pro Ser Phe Val Ile Glu Arg Ile Arg 420
425 430Val Lys Ala Gly Glu Thr Gln Lys Lys Val
Ile Phe Cys Ala Arg Glu 435 440
445Lys Val Ser His Leu Gln Lys Gly Lys Asp Ser Ala Val Phe Val Lys 450
455 460Cys His Asp Lys Ser Leu Lys Lys
Ser Gly465 470172328DNAGallus gallusCDS(115)..(1584)
17ccttcacagt cgtgtgtttt agaacttagt tattctattt tgttttgttt gcttttaacc
60ttaaccatcc cccccccctc ctcccactga aactttttcg ccgctgcaca acgc atg
117Met1gag cga gga cgc ggg atg ggg aag aca gcg ctg ctg gct gtg ctg tgc
165Glu Arg Gly Arg Gly Met Gly Lys Thr Ala Leu Leu Ala Val Leu Cys
5 10 15ctc tgc ctg cgc ggg gcc
gcc ggc tcc gat ccc gaa gct gag atg aat 213Leu Cys Leu Arg Gly Ala
Ala Gly Ser Asp Pro Glu Ala Glu Met Asn 20 25
30ttt gag gga atc gag agc aag ttt tcc tta aga aca cct gca
gag cct 261Phe Glu Gly Ile Glu Ser Lys Phe Ser Leu Arg Thr Pro Ala
Glu Pro 35 40 45gat gaa gat gtc tgc
tac ctg gtt cct gga cag atg gac agc ttg gca 309Asp Glu Asp Val Cys
Tyr Leu Val Pro Gly Gln Met Asp Ser Leu Ala50 55
60 65cag tgc aac ttc aac cat acc agt aaa acc
ttt gtg gtg atc cat ggg 357Gln Cys Asn Phe Asn His Thr Ser Lys Thr
Phe Val Val Ile His Gly 70 75
80tgg acg gtg aca gga atg tat gaa agc tgg gtc cca aag cta gtg gat
405Trp Thr Val Thr Gly Met Tyr Glu Ser Trp Val Pro Lys Leu Val Asp
85 90 95gct ctg tac aag agg gaa
cct gat tca aat gtc att gtt gtg gac tgg 453Ala Leu Tyr Lys Arg Glu
Pro Asp Ser Asn Val Ile Val Val Asp Trp 100 105
110ctg gtt cga gct cag cag cac tac cca gtg tct gct gct tac
acg aag 501Leu Val Arg Ala Gln Gln His Tyr Pro Val Ser Ala Ala Tyr
Thr Lys 115 120 125ctg gtg gga aag gat
gtt gcc atg ttc att gat tgg atg gag gag aaa 549Leu Val Gly Lys Asp
Val Ala Met Phe Ile Asp Trp Met Glu Glu Lys130 135
140 145ttc aat tac cct ctc aac aat gtc cac ttg
ctg ggg tac agt ctg ggt 597Phe Asn Tyr Pro Leu Asn Asn Val His Leu
Leu Gly Tyr Ser Leu Gly 150 155
160gct cat gct gct ggg att gct gga agt tta acc aag aaa aag gtg aac
645Ala His Ala Ala Gly Ile Ala Gly Ser Leu Thr Lys Lys Lys Val Asn
165 170 175aga att act ggt ctg gat
cct gct ggt ccc acc ttt gag tat gct gat 693Arg Ile Thr Gly Leu Asp
Pro Ala Gly Pro Thr Phe Glu Tyr Ala Asp 180 185
190gcc cct atc cgc ctc tcc ccg gat gat gct gac ttt gtg gat
gtc ctg 741Ala Pro Ile Arg Leu Ser Pro Asp Asp Ala Asp Phe Val Asp
Val Leu 195 200 205cac acc tac act cga
ggc tct cca gat cgc agc att ggg att cag aag 789His Thr Tyr Thr Arg
Gly Ser Pro Asp Arg Ser Ile Gly Ile Gln Lys210 215
220 225cct gtt gga cac att gat atc tac cct aat
ggt gga ggt ttc cag cca 837Pro Val Gly His Ile Asp Ile Tyr Pro Asn
Gly Gly Gly Phe Gln Pro 230 235
240ggc tgc aac ttg gga gaa gct ctc cgc ctg att gct gaa aaa ggc ttt
885Gly Cys Asn Leu Gly Glu Ala Leu Arg Leu Ile Ala Glu Lys Gly Phe
245 250 255tca gat gtg gat cag
ctg gtg aag tgc tct cat gaa cga tcc atc cat 933Ser Asp Val Asp Gln
Leu Val Lys Cys Ser His Glu Arg Ser Ile His 260
265 270ctc ttc att gac tca ctc ctc tat gaa gag aag ccc
agc atg gcc tac 981Leu Phe Ile Asp Ser Leu Leu Tyr Glu Glu Lys Pro
Ser Met Ala Tyr 275 280 285cgc tgc aac
aca aaa gag gcc ttt gag aag ggc ctc tgc cta agc tgc 1029Arg Cys Asn
Thr Lys Glu Ala Phe Glu Lys Gly Leu Cys Leu Ser Cys290
295 300 305cgg aag aac cgt tgc aac aac
ttg ggt tat aaa gtc aac aga gtg aga 1077Arg Lys Asn Arg Cys Asn Asn
Leu Gly Tyr Lys Val Asn Arg Val Arg 310
315 320aca aag aga aac acc aaa atg tac ttg aag acc cgt
gct cag atg ccc 1125Thr Lys Arg Asn Thr Lys Met Tyr Leu Lys Thr Arg
Ala Gln Met Pro 325 330 335tac
aaa gtc ttc cat tat cag gtc aag ata cat ttc ttt gga aag aca 1173Tyr
Lys Val Phe His Tyr Gln Val Lys Ile His Phe Phe Gly Lys Thr 340
345 350aat gtg acc aag gta gac cag cca ttc
ctg atc tct ctg tat ggc act 1221Asn Val Thr Lys Val Asp Gln Pro Phe
Leu Ile Ser Leu Tyr Gly Thr 355 360
365cta gac gag agt gag aac att cct ttc acg ctg cct gaa gtc tct tcc
1269Leu Asp Glu Ser Glu Asn Ile Pro Phe Thr Leu Pro Glu Val Ser Ser370
375 380 385aac aag acc ttc
tcc ttc ctg atc tac aca gaa gtg gac att ggt gac 1317Asn Lys Thr Phe
Ser Phe Leu Ile Tyr Thr Glu Val Asp Ile Gly Asp 390
395 400ctg ctt atg cta aag ctg cag tgg gag aaa
gat act ttc ttc agc tgg 1365Leu Leu Met Leu Lys Leu Gln Trp Glu Lys
Asp Thr Phe Phe Ser Trp 405 410
415tca gac tgg tgg act cca ttt gca ttc acc att cag aga gtc aga gtg
1413Ser Asp Trp Trp Thr Pro Phe Ala Phe Thr Ile Gln Arg Val Arg Val
420 425 430aag tca ggc gaa act cag aaa
aag gtg gta ttc tgt tct cga gat ggc 1461Lys Ser Gly Glu Thr Gln Lys
Lys Val Val Phe Cys Ser Arg Asp Gly 435 440
445agc tca cgt ctt ggt aaa gga gaa gag gca gca ata ttt gtg aag tgc
1509Ser Ser Arg Leu Gly Lys Gly Glu Glu Ala Ala Ile Phe Val Lys Cys450
455 460 465ctg gag cag cct
gtc agc agg aag agg gga ggt gcc aag aaa gcc tct 1557Leu Glu Gln Pro
Val Ser Arg Lys Arg Gly Gly Ala Lys Lys Ala Ser 470
475 480aaa gaa aat tct gca cac gag tct gct
taaaaagtgg caagaatgag 1604Lys Glu Asn Ser Ala His Glu Ser Ala
485 490aatttccaca ctggggagga ggatggagtc
tgttcatccc tgtgaactgg atgttcagaa 1664ccaaatatat agaaatactt atctgctgct
ggcttttgtg cctgcctata cctagctata 1724ttaggaggct tcttgtaagg aagtctcagc
gtacaaagtt actaaccata aagttacatt 1784acattatctg atagttaaga acaaagaaac
ccctgcaaca acttccgaaa ggcttgagtg 1844ttaggaagga ataagtaatt ttgcttaatc
gtggtgcctt gtgacagttt cttgccatca 1904gttcctcttt agcagttttg tagtatttat
tgaaaagatg caaagctctg tacctggtcc 1964tctttttagt gttttttgtt tccaattttt
atttttttaa gagatcttct ggaactgcac 2024agatcttttt ttgttgttct cctggccttg
ctaactgaat tttcaggcag ttcattggct 2084agagttcgtt gtcttcaagt ggtgtgtttg
gcaagtgagt agttttctca tggaaaaaaa 2144tacccttgtg tgtagagcta taacagagat
gtcagggcct ggttcaatat ggggatgaat 2204cttctaggtt gtggttatga atgtgcttta
ctgggtgtag atgccaatgc ttcttagcaa 2264tagttataat ctgttaagat atgtaatcct
atgcagctta tcccggaata aatagcaata 2324ggag
232818490PRTGallus gallus 18Met Glu Arg
Gly Arg Gly Met Gly Lys Thr Ala Leu Leu Ala Val Leu1 5
10 15Cys Leu Cys Leu Arg Gly Ala Ala Gly
Ser Asp Pro Glu Ala Glu Met 20 25
30Asn Phe Glu Gly Ile Glu Ser Lys Phe Ser Leu Arg Thr Pro Ala Glu
35 40 45Pro Asp Glu Asp Val Cys Tyr
Leu Val Pro Gly Gln Met Asp Ser Leu 50 55
60Ala Gln Cys Asn Phe Asn His Thr Ser Lys Thr Phe Val Val Ile His65
70 75 80Gly Trp Thr Val
Thr Gly Met Tyr Glu Ser Trp Val Pro Lys Leu Val 85
90 95Asp Ala Leu Tyr Lys Arg Glu Pro Asp Ser
Asn Val Ile Val Val Asp 100 105
110Trp Leu Val Arg Ala Gln Gln His Tyr Pro Val Ser Ala Ala Tyr Thr
115 120 125Lys Leu Val Gly Lys Asp Val
Ala Met Phe Ile Asp Trp Met Glu Glu 130 135
140Lys Phe Asn Tyr Pro Leu Asn Asn Val His Leu Leu Gly Tyr Ser
Leu145 150 155 160Gly Ala
His Ala Ala Gly Ile Ala Gly Ser Leu Thr Lys Lys Lys Val
165 170 175Asn Arg Ile Thr Gly Leu Asp
Pro Ala Gly Pro Thr Phe Glu Tyr Ala 180 185
190Asp Ala Pro Ile Arg Leu Ser Pro Asp Asp Ala Asp Phe Val
Asp Val 195 200 205Leu His Thr Tyr
Thr Arg Gly Ser Pro Asp Arg Ser Ile Gly Ile Gln 210
215 220Lys Pro Val Gly His Ile Asp Ile Tyr Pro Asn Gly
Gly Gly Phe Gln225 230 235
240Pro Gly Cys Asn Leu Gly Glu Ala Leu Arg Leu Ile Ala Glu Lys Gly
245 250 255Phe Ser Asp Val Asp
Gln Leu Val Lys Cys Ser His Glu Arg Ser Ile 260
265 270His Leu Phe Ile Asp Ser Leu Leu Tyr Glu Glu Lys
Pro Ser Met Ala 275 280 285Tyr Arg
Cys Asn Thr Lys Glu Ala Phe Glu Lys Gly Leu Cys Leu Ser 290
295 300Cys Arg Lys Asn Arg Cys Asn Asn Leu Gly Tyr
Lys Val Asn Arg Val305 310 315
320Arg Thr Lys Arg Asn Thr Lys Met Tyr Leu Lys Thr Arg Ala Gln Met
325 330 335Pro Tyr Lys Val
Phe His Tyr Gln Val Lys Ile His Phe Phe Gly Lys 340
345 350Thr Asn Val Thr Lys Val Asp Gln Pro Phe Leu
Ile Ser Leu Tyr Gly 355 360 365Thr
Leu Asp Glu Ser Glu Asn Ile Pro Phe Thr Leu Pro Glu Val Ser 370
375 380Ser Asn Lys Thr Phe Ser Phe Leu Ile Tyr
Thr Glu Val Asp Ile Gly385 390 395
400Asp Leu Leu Met Leu Lys Leu Gln Trp Glu Lys Asp Thr Phe Phe
Ser 405 410 415Trp Ser Asp
Trp Trp Thr Pro Phe Ala Phe Thr Ile Gln Arg Val Arg 420
425 430Val Lys Ser Gly Glu Thr Gln Lys Lys Val
Val Phe Cys Ser Arg Asp 435 440
445Gly Ser Ser Arg Leu Gly Lys Gly Glu Glu Ala Ala Ile Phe Val Lys 450
455 460Cys Leu Glu Gln Pro Val Ser Arg
Lys Arg Gly Gly Ala Lys Lys Ala465 470
475 480Ser Lys Glu Asn Ser Ala His Glu Ser Ala
485 49019287DNACanis familiarisCDS(1)..(285) 19ctc
ttt att gac tct ctg ctg aat gaa gaa aat cca agt aag gcc tac 48Leu
Phe Ile Asp Ser Leu Leu Asn Glu Glu Asn Pro Ser Lys Ala Tyr1
5 10 15cgg tgc aac tca aag gaa gcc
ttt gag aaa ggg ctt tgc ctg agt tgc 96Arg Cys Asn Ser Lys Glu Ala
Phe Glu Lys Gly Leu Cys Leu Ser Cys 20 25
30aga aag aac cgt tgc aac aac atg ggc tat gag atc aat aag
gtc aga 144Arg Lys Asn Arg Cys Asn Asn Met Gly Tyr Glu Ile Asn Lys
Val Arg 35 40 45gcc aaa aga ggc
agc aaa atg tac ctg aag act cgc tct cag atg cct 192Ala Lys Arg Gly
Ser Lys Met Tyr Leu Lys Thr Arg Ser Gln Met Pro 50 55
60tac aaa gtc ttc cat tac caa gta aag ata cat ttt tct
ggg act gag 240Tyr Lys Val Phe His Tyr Gln Val Lys Ile His Phe Ser
Gly Thr Glu65 70 75
80agt gat gca cag acc aac cag gcc ttc gag att tct ctg tat ggc ac
287Ser Asp Ala Gln Thr Asn Gln Ala Phe Glu Ile Ser Leu Tyr Gly
85 90 952095PRTCanis familiaris
20Leu Phe Ile Asp Ser Leu Leu Asn Glu Glu Asn Pro Ser Lys Ala Tyr1
5 10 15Arg Cys Asn Ser Lys Glu
Ala Phe Glu Lys Gly Leu Cys Leu Ser Cys 20 25
30Arg Lys Asn Arg Cys Asn Asn Met Gly Tyr Glu Ile Asn
Lys Val Arg 35 40 45Ala Lys Arg
Gly Ser Lys Met Tyr Leu Lys Thr Arg Ser Gln Met Pro 50
55 60Tyr Lys Val Phe His Tyr Gln Val Lys Ile His Phe
Ser Gly Thr Glu65 70 75
80Ser Asp Ala Gln Thr Asn Gln Ala Phe Glu Ile Ser Leu Tyr Gly
85 90 9521612DNABos
taurusCDS(1)..(207) 21ctc aaa tgg att agt gat tcc tac ttc agc tgg tcc aac
tgg tgg agc 48Leu Lys Trp Ile Ser Asp Ser Tyr Phe Ser Trp Ser Asn
Trp Trp Ser1 5 10 15agc
ccc ggc ttt gat att ggg aag atc aga gta aag gca gga gag act 96Ser
Pro Gly Phe Asp Ile Gly Lys Ile Arg Val Lys Ala Gly Glu Thr 20
25 30caa aaa aag gtg atc ttc tgt tcc
cgg gag aaa atg tct tat ctg cag 144Gln Lys Lys Val Ile Phe Cys Ser
Arg Glu Lys Met Ser Tyr Leu Gln 35 40
45aaa gga aag tca cct gtg ata ttt gtg aaa tgc cat gac aag tcc ctg
192Lys Gly Lys Ser Pro Val Ile Phe Val Lys Cys His Asp Lys Ser Leu
50 55 60aat aga aag tct ggc tgaaacttgg
caaagctacg gaagaaagaa cagcatatga 247Asn Arg Lys Ser Gly65attctatgaa
gaatgaagta acttttacaa aagatgccca gtgctttaga tggtgaaatg 307tggattttcc
ggagtattaa ccccagctct agccttatta gttattttag gagacagtct 367caaatactaa
aactaattca atttgaggtg tatagtggcc aaatagcaca tcttccaaca 427ttaaaaaaat
aacagatatg aaaagcactg cattctgtct tttgaaaaaa tatgagttat 487ttaaaatgat
aaaataatca gatctcttca tgtagtaagt ttagccatag cctaaaattg 547attaaaatct
catttttaat tgggattctg cgttttctag actgataacc ttctcagagt 607tttct
6122269PRTBos
taurus 22Leu Lys Trp Ile Ser Asp Ser Tyr Phe Ser Trp Ser Asn Trp Trp Ser1
5 10 15Ser Pro Gly Phe
Asp Ile Gly Lys Ile Arg Val Lys Ala Gly Glu Thr 20
25 30Gln Lys Lys Val Ile Phe Cys Ser Arg Glu Lys
Met Ser Tyr Leu Gln 35 40 45Lys
Gly Lys Ser Pro Val Ile Phe Val Lys Cys His Asp Lys Ser Leu 50
55 60Asn Arg Lys Ser
Gly65231285DNACaenorhabditis elegansCDS(342)..(1091) 23atctatgagg
aaatgctgag aaacttattt tcaatcactt atcgattcgc ttcatctgat 60tctccgagga
aagtcgtagt ttgtgcaaac ggaacgattg ctgcctggca tccaccacaa 120cattttccat
acgagcatac gaaaccaatt gatctcggtt cactgactaa aaaggatcaa 180agctctcgtt
tgtcagcagc agcaaaagct tcttccattc cacgcgagcc agttaacgct 240gagctcaagg
acattttcta cacgagcaag cacgagtggt attccagaac tcgcgaagaa 300cgcctccgca
acgtggctgc tccaattcca cgtcgtaaat a atg cgt ctc tcc tca 356Met Arg Leu
Ser Ser1 5cta ctt cgt caa aaa tca aca gta aat gct atc gat
ttg ggt cag atc 404Leu Leu Arg Gln Lys Ser Thr Val Asn Ala Ile Asp
Leu Gly Gln Ile 10 15
20tcg tat ggt gcc gca ttg aaa gaa caa caa aaa tat gta gat ttg gtt
452Ser Tyr Gly Ala Ala Leu Lys Glu Gln Gln Lys Tyr Val Asp Leu Val
25 30 35aaa gcg aat aaa tct gaa aca
cat tct tta aat ttt ata ttg gct ctc 500Lys Ala Asn Lys Ser Glu Thr
His Ser Leu Asn Phe Ile Leu Ala Leu 40 45
50gaa cac aca ccg gtt tat aca gtg ggc att cga agt aaa ggt tat
aca 548Glu His Thr Pro Val Tyr Thr Val Gly Ile Arg Ser Lys Gly Tyr
Thr 55 60 65aaa gaa gaa gag aca agg
ttg atg aga ctt ggt gca gaa ttt cat aga 596Lys Glu Glu Glu Thr Arg
Leu Met Arg Leu Gly Ala Glu Phe His Arg70 75
80 85aca tct cgt gga ggg ctc atc act ttt cat gga
cct ggg caa ctt gtt 644Thr Ser Arg Gly Gly Leu Ile Thr Phe His Gly
Pro Gly Gln Leu Val 90 95
100cta tat cca att tgc gat gtt cgc aga att tca atc aag caa cta ggt
692Leu Tyr Pro Ile Cys Asp Val Arg Arg Ile Ser Ile Lys Gln Leu Gly
105 110 115gtt agg cat ttt gtg gac
aag tta gag caa acg att ata gat gca gcg 740Val Arg His Phe Val Asp
Lys Leu Glu Gln Thr Ile Ile Asp Ala Ala 120 125
130aca gag gga ttt gga atc aaa aat gtt ggc cga act gcg aat
aca ggt 788Thr Glu Gly Phe Gly Ile Lys Asn Val Gly Arg Thr Ala Asn
Thr Gly 135 140 145gta tgg gta tcc aat
gaa cgt aaa ctc gct gca att gga att gct gtc 836Val Trp Val Ser Asn
Glu Arg Lys Leu Ala Ala Ile Gly Ile Ala Val150 155
160 165tct ggt gga gta tcg tat cac ggg atc gca
ata aat tgt aac act gac 884Ser Gly Gly Val Ser Tyr His Gly Ile Ala
Ile Asn Cys Asn Thr Asp 170 175
180ctt aga tgg ttc gat aat att gtt gga tgt ggt atc gaa gga gtc tcc
932Leu Arg Trp Phe Asp Asn Ile Val Gly Cys Gly Ile Glu Gly Val Ser
185 190 195act act tcc tta tcc cag
gaa aca tcc cga aat gtg acc gtt tct gat 980Thr Thr Ser Leu Ser Gln
Glu Thr Ser Arg Asn Val Thr Val Ser Asp 200 205
210gct cgt cct att ctt ctg aac gct ttt gcc aat aac ttt gaa
tgc ctt 1028Ala Arg Pro Ile Leu Leu Asn Ala Phe Ala Asn Asn Phe Glu
Cys Leu 215 220 225ctc aat gaa ccc aat
gat tat tcg aca tgt tcc aat tta aaa att acg 1076Leu Asn Glu Pro Asn
Asp Tyr Ser Thr Cys Ser Asn Leu Lys Ile Thr230 235
240 245aat gtt gtt tct agt taacttcatc tccttccatt
agtttttagt ttttagttct 1131Asn Val Val Ser Ser
250agatttttca atttttatta gaattttata gaaattacca aatcgccatt gttctttgtt
1191catttaattg tttgtactcc ctactcaatt cgctactcaa attttggtcg ttgttgttcc
1251caattgtcac cctaaaaatg caatttttga aaca
128524250PRTCaenorhabditis elegans 24Met Arg Leu Ser Ser Leu Leu Arg Gln
Lys Ser Thr Val Asn Ala Ile1 5 10
15Asp Leu Gly Gln Ile Ser Tyr Gly Ala Ala Leu Lys Glu Gln Gln
Lys 20 25 30Tyr Val Asp Leu
Val Lys Ala Asn Lys Ser Glu Thr His Ser Leu Asn 35
40 45Phe Ile Leu Ala Leu Glu His Thr Pro Val Tyr Thr
Val Gly Ile Arg 50 55 60Ser Lys Gly
Tyr Thr Lys Glu Glu Glu Thr Arg Leu Met Arg Leu Gly65 70
75 80Ala Glu Phe His Arg Thr Ser Arg
Gly Gly Leu Ile Thr Phe His Gly 85 90
95Pro Gly Gln Leu Val Leu Tyr Pro Ile Cys Asp Val Arg Arg
Ile Ser 100 105 110Ile Lys Gln
Leu Gly Val Arg His Phe Val Asp Lys Leu Glu Gln Thr 115
120 125Ile Ile Asp Ala Ala Thr Glu Gly Phe Gly Ile
Lys Asn Val Gly Arg 130 135 140Thr Ala
Asn Thr Gly Val Trp Val Ser Asn Glu Arg Lys Leu Ala Ala145
150 155 160Ile Gly Ile Ala Val Ser Gly
Gly Val Ser Tyr His Gly Ile Ala Ile 165
170 175Asn Cys Asn Thr Asp Leu Arg Trp Phe Asp Asn Ile
Val Gly Cys Gly 180 185 190Ile
Glu Gly Val Ser Thr Thr Ser Leu Ser Gln Glu Thr Ser Arg Asn 195
200 205Val Thr Val Ser Asp Ala Arg Pro Ile
Leu Leu Asn Ala Phe Ala Asn 210 215
220Asn Phe Glu Cys Leu Leu Asn Glu Pro Asn Asp Tyr Ser Thr Cys Ser225
230 235 240Asn Leu Lys Ile
Thr Asn Val Val Ser Ser 245
250252463DNAHomo sapiensCDS(1)..(2460) 25atg aag atg tta ctc ctg ctg cat
tgc ctt ggg gtg ttt ctg tcc tgt 48Met Lys Met Leu Leu Leu Leu His
Cys Leu Gly Val Phe Leu Ser Cys1 5 10
15tct gga cac atc cag gat gag cac ccc caa tat cac agc cct
ccg gat 96Ser Gly His Ile Gln Asp Glu His Pro Gln Tyr His Ser Pro
Pro Asp 20 25 30gtg gtg att
cct gtg agg ata act ggc acc acc aga ggc atg aca cct 144Val Val Ile
Pro Val Arg Ile Thr Gly Thr Thr Arg Gly Met Thr Pro 35
40 45cca ggc tgg ctc tcc tat atc ctg ccc ttt gga
ggc cag aaa cac att 192Pro Gly Trp Leu Ser Tyr Ile Leu Pro Phe Gly
Gly Gln Lys His Ile 50 55 60atc cac
ata aag gtc aag aag ctt ttg ttt tcc aaa cac ctc cct gtg 240Ile His
Ile Lys Val Lys Lys Leu Leu Phe Ser Lys His Leu Pro Val65
70 75 80ttc acc tac aca gac cag ggt
gct atc ctt gag gac cag cca ttt gtc 288Phe Thr Tyr Thr Asp Gln Gly
Ala Ile Leu Glu Asp Gln Pro Phe Val 85 90
95cag aat aac tgc tac tat cat ggt tat gtg gaa ggg gac
cca gaa tcc 336Gln Asn Asn Cys Tyr Tyr His Gly Tyr Val Glu Gly Asp
Pro Glu Ser 100 105 110ctg gtt
tcc ctc agt acc tgt ttt ggg ggt ttt caa gga ata tta cag 384Leu Val
Ser Leu Ser Thr Cys Phe Gly Gly Phe Gln Gly Ile Leu Gln 115
120 125ata aat gac ttt gct tat gaa atc aag ccc
cta gca ttt tct acc acg 432Ile Asn Asp Phe Ala Tyr Glu Ile Lys Pro
Leu Ala Phe Ser Thr Thr 130 135 140ttt
gaa cat ctg gta tac aag atg gac agt gag gag aaa caa ttt tca 480Phe
Glu His Leu Val Tyr Lys Met Asp Ser Glu Glu Lys Gln Phe Ser145
150 155 160acc atg aga tcc gga ttt
atg caa aat gaa ata aca tgc cga atg gaa 528Thr Met Arg Ser Gly Phe
Met Gln Asn Glu Ile Thr Cys Arg Met Glu 165
170 175ttt gaa gaa att gat aat tcc act cag aag caa agt
tct tat gtg ggc 576Phe Glu Glu Ile Asp Asn Ser Thr Gln Lys Gln Ser
Ser Tyr Val Gly 180 185 190tgg
tgg atc cat ttt agg att gtt gaa att gta gtc gtc att gat aat 624Trp
Trp Ile His Phe Arg Ile Val Glu Ile Val Val Val Ile Asp Asn 195
200 205tat ctg tac att cgt tat gaa agg aac
gac tca aag ttg ctg gag gat 672Tyr Leu Tyr Ile Arg Tyr Glu Arg Asn
Asp Ser Lys Leu Leu Glu Asp 210 215
220cta tat gtt att gtt aat ata gtg gat tcc att ttg gat gtc att ggt
720Leu Tyr Val Ile Val Asn Ile Val Asp Ser Ile Leu Asp Val Ile Gly225
230 235 240gtt aag gtg tta
tta ttt ggt ttg gag atc tgg acc aat aaa aac ctc 768Val Lys Val Leu
Leu Phe Gly Leu Glu Ile Trp Thr Asn Lys Asn Leu 245
250 255att gta gta gat gat gta agg aaa tct gtg
cac ctg tat tgc aag tgg 816Ile Val Val Asp Asp Val Arg Lys Ser Val
His Leu Tyr Cys Lys Trp 260 265
270aag tcg gag aac att acg ccc cgg atg caa cat gac acc tca cat ctt
864Lys Ser Glu Asn Ile Thr Pro Arg Met Gln His Asp Thr Ser His Leu
275 280 285ttc aca act cta gga tta aga
ggg tta agt ggc ata gga gct ttt aga 912Phe Thr Thr Leu Gly Leu Arg
Gly Leu Ser Gly Ile Gly Ala Phe Arg 290 295
300gga atg tgt aca cca cac cgt agt tgt gca att gtt act ttc atg aac
960Gly Met Cys Thr Pro His Arg Ser Cys Ala Ile Val Thr Phe Met Asn305
310 315 320aaa act ttg ggc
act ttt tca att gca gtg gct cat cat cta ggt cat 1008Lys Thr Leu Gly
Thr Phe Ser Ile Ala Val Ala His His Leu Gly His 325
330 335aat ttg ggc atg aac cat gat gag gat aca
tgt cgt tgt tca caa cct 1056Asn Leu Gly Met Asn His Asp Glu Asp Thr
Cys Arg Cys Ser Gln Pro 340 345
350aga tgc ata atg cat gaa ggc aac cca cca ata act aaa ttt agc aat
1104Arg Cys Ile Met His Glu Gly Asn Pro Pro Ile Thr Lys Phe Ser Asn
355 360 365tgt agt tat ggt gat ttt tgg
gaa tat act gta gag agg aca aag tgt 1152Cys Ser Tyr Gly Asp Phe Trp
Glu Tyr Thr Val Glu Arg Thr Lys Cys 370 375
380ttg ctt gaa aca gta cac aca aag gac atc ttt aat gtg aag cgc tgt
1200Leu Leu Glu Thr Val His Thr Lys Asp Ile Phe Asn Val Lys Arg Cys385
390 395 400ggg aat ggt gtt
gtt gaa gaa gga gaa gag tgt gac tgt gga cct tta 1248Gly Asn Gly Val
Val Glu Glu Gly Glu Glu Cys Asp Cys Gly Pro Leu 405
410 415aag cat tgt gca aaa gat ccc tgc tgt ctg
tca aat tgc act ctg act 1296Lys His Cys Ala Lys Asp Pro Cys Cys Leu
Ser Asn Cys Thr Leu Thr 420 425
430gat ggt tct act tgt gct ttt ggg ctt tgt tgc aaa gac tgc aag ttc
1344Asp Gly Ser Thr Cys Ala Phe Gly Leu Cys Cys Lys Asp Cys Lys Phe
435 440 445cta cca tca ggg aaa gtg tgt
aga aag gag gtc aat gaa tgt gat ctt 1392Leu Pro Ser Gly Lys Val Cys
Arg Lys Glu Val Asn Glu Cys Asp Leu 450 455
460cca gag tgg tgc aat ggt act tcc cat aag tgc cca gat gac ttt tat
1440Pro Glu Trp Cys Asn Gly Thr Ser His Lys Cys Pro Asp Asp Phe Tyr465
470 475 480gtg gaa gat gga
att ccc tgt aag gag agg ggc tac tgc tat gaa aag 1488Val Glu Asp Gly
Ile Pro Cys Lys Glu Arg Gly Tyr Cys Tyr Glu Lys 485
490 495agc tgt cat gac cgc aat gaa cag tgt agg
agg att ttt ggt gca ggc 1536Ser Cys His Asp Arg Asn Glu Gln Cys Arg
Arg Ile Phe Gly Ala Gly 500 505
510gca aat act gca agt gag act tgc tac aaa gaa ttg aac acc tta ggt
1584Ala Asn Thr Ala Ser Glu Thr Cys Tyr Lys Glu Leu Asn Thr Leu Gly
515 520 525gac cgt gtt ggt cac tgt ggt
atc aaa aat gct aca tat ata aag tgt 1632Asp Arg Val Gly His Cys Gly
Ile Lys Asn Ala Thr Tyr Ile Lys Cys 530 535
540aat atc tca gat gtc cag tgt gga aga att cag tgt gag aat gtg aca
1680Asn Ile Ser Asp Val Gln Cys Gly Arg Ile Gln Cys Glu Asn Val Thr545
550 555 560gaa att ccc aat
atg agt gat cat act act gtg cat tgg gct cgc ttc 1728Glu Ile Pro Asn
Met Ser Asp His Thr Thr Val His Trp Ala Arg Phe 565
570 575aat gac ata atg tgc tgg agt act gat tac
cat ttg ggg atg aag gga 1776Asn Asp Ile Met Cys Trp Ser Thr Asp Tyr
His Leu Gly Met Lys Gly 580 585
590cct gat att ggt gaa gtg aaa gat gga aca gag tgt ggg ata gat cat
1824Pro Asp Ile Gly Glu Val Lys Asp Gly Thr Glu Cys Gly Ile Asp His
595 600 605ata tgc atc cac agg cac tgt
gtc cat ata acc atc ttg aat agt aat 1872Ile Cys Ile His Arg His Cys
Val His Ile Thr Ile Leu Asn Ser Asn 610 615
620tgc tca cct gca ttt tgt aac aag agg ggc atc tgc aac aat aaa cat
1920Cys Ser Pro Ala Phe Cys Asn Lys Arg Gly Ile Cys Asn Asn Lys His625
630 635 640cac tgc cat tgc
aat tat ctg tgg gac cct ccc aac tgc ctg ata aaa 1968His Cys His Cys
Asn Tyr Leu Trp Asp Pro Pro Asn Cys Leu Ile Lys 645
650 655ggc tat gga ggt agt gtt gac agt ggc cca
ccc cct aag aga aag aag 2016Gly Tyr Gly Gly Ser Val Asp Ser Gly Pro
Pro Pro Lys Arg Lys Lys 660 665
670aaa aag aag ttc tgt tat ctg tgt ata ttg ttg ctt att gtt ttg ttt
2064Lys Lys Lys Phe Cys Tyr Leu Cys Ile Leu Leu Leu Ile Val Leu Phe
675 680 685att tta tta tgt tgt ctt tat
cga ctt tgt aaa aaa agt aaa cca ata 2112Ile Leu Leu Cys Cys Leu Tyr
Arg Leu Cys Lys Lys Ser Lys Pro Ile 690 695
700aaa aag cag caa gat gtt caa act cca tct gca aaa gaa gag gaa aaa
2160Lys Lys Gln Gln Asp Val Gln Thr Pro Ser Ala Lys Glu Glu Glu Lys705
710 715 720att cag cgt cga
cct cat gag tta cct ccc cag agt caa cct tgg gtg 2208Ile Gln Arg Arg
Pro His Glu Leu Pro Pro Gln Ser Gln Pro Trp Val 725
730 735atg cct tcc cag agt caa cct cct gtg acg
cct tcc cag agt cat cct 2256Met Pro Ser Gln Ser Gln Pro Pro Val Thr
Pro Ser Gln Ser His Pro 740 745
750cgg gtg atg cct tct cag agt caa cct cct gtg atg cct tcc cag agt
2304Arg Val Met Pro Ser Gln Ser Gln Pro Pro Val Met Pro Ser Gln Ser
755 760 765cat cct cag ttg acg cct tcc
cag agt caa cct cct gtg atg cct tcc 2352His Pro Gln Leu Thr Pro Ser
Gln Ser Gln Pro Pro Val Met Pro Ser 770 775
780cag agt cat cct cag ttg acg cct tcc cag agt caa cct cct gtg aca
2400Gln Ser His Pro Gln Leu Thr Pro Ser Gln Ser Gln Pro Pro Val Thr785
790 795 800ccc tcc cag agg
caa cct cag ttg atg cct tcc cag agt caa cct cct 2448Pro Ser Gln Arg
Gln Pro Gln Leu Met Pro Ser Gln Ser Gln Pro Pro 805
810 815gtg acg ccc tcc tag
2463Val Thr Pro Ser 82026820PRTHomo
sapiens 26Met Lys Met Leu Leu Leu Leu His Cys Leu Gly Val Phe Leu Ser
Cys1 5 10 15Ser Gly His
Ile Gln Asp Glu His Pro Gln Tyr His Ser Pro Pro Asp 20
25 30Val Val Ile Pro Val Arg Ile Thr Gly Thr
Thr Arg Gly Met Thr Pro 35 40
45Pro Gly Trp Leu Ser Tyr Ile Leu Pro Phe Gly Gly Gln Lys His Ile 50
55 60Ile His Ile Lys Val Lys Lys Leu Leu
Phe Ser Lys His Leu Pro Val65 70 75
80Phe Thr Tyr Thr Asp Gln Gly Ala Ile Leu Glu Asp Gln Pro
Phe Val 85 90 95Gln Asn
Asn Cys Tyr Tyr His Gly Tyr Val Glu Gly Asp Pro Glu Ser 100
105 110Leu Val Ser Leu Ser Thr Cys Phe Gly
Gly Phe Gln Gly Ile Leu Gln 115 120
125Ile Asn Asp Phe Ala Tyr Glu Ile Lys Pro Leu Ala Phe Ser Thr Thr
130 135 140Phe Glu His Leu Val Tyr Lys
Met Asp Ser Glu Glu Lys Gln Phe Ser145 150
155 160Thr Met Arg Ser Gly Phe Met Gln Asn Glu Ile Thr
Cys Arg Met Glu 165 170
175Phe Glu Glu Ile Asp Asn Ser Thr Gln Lys Gln Ser Ser Tyr Val Gly
180 185 190Trp Trp Ile His Phe Arg
Ile Val Glu Ile Val Val Val Ile Asp Asn 195 200
205Tyr Leu Tyr Ile Arg Tyr Glu Arg Asn Asp Ser Lys Leu Leu
Glu Asp 210 215 220Leu Tyr Val Ile Val
Asn Ile Val Asp Ser Ile Leu Asp Val Ile Gly225 230
235 240Val Lys Val Leu Leu Phe Gly Leu Glu Ile
Trp Thr Asn Lys Asn Leu 245 250
255Ile Val Val Asp Asp Val Arg Lys Ser Val His Leu Tyr Cys Lys Trp
260 265 270Lys Ser Glu Asn Ile
Thr Pro Arg Met Gln His Asp Thr Ser His Leu 275
280 285Phe Thr Thr Leu Gly Leu Arg Gly Leu Ser Gly Ile
Gly Ala Phe Arg 290 295 300Gly Met Cys
Thr Pro His Arg Ser Cys Ala Ile Val Thr Phe Met Asn305
310 315 320Lys Thr Leu Gly Thr Phe Ser
Ile Ala Val Ala His His Leu Gly His 325
330 335Asn Leu Gly Met Asn His Asp Glu Asp Thr Cys Arg
Cys Ser Gln Pro 340 345 350Arg
Cys Ile Met His Glu Gly Asn Pro Pro Ile Thr Lys Phe Ser Asn 355
360 365Cys Ser Tyr Gly Asp Phe Trp Glu Tyr
Thr Val Glu Arg Thr Lys Cys 370 375
380Leu Leu Glu Thr Val His Thr Lys Asp Ile Phe Asn Val Lys Arg Cys385
390 395 400Gly Asn Gly Val
Val Glu Glu Gly Glu Glu Cys Asp Cys Gly Pro Leu 405
410 415Lys His Cys Ala Lys Asp Pro Cys Cys Leu
Ser Asn Cys Thr Leu Thr 420 425
430Asp Gly Ser Thr Cys Ala Phe Gly Leu Cys Cys Lys Asp Cys Lys Phe
435 440 445Leu Pro Ser Gly Lys Val Cys
Arg Lys Glu Val Asn Glu Cys Asp Leu 450 455
460Pro Glu Trp Cys Asn Gly Thr Ser His Lys Cys Pro Asp Asp Phe
Tyr465 470 475 480Val Glu
Asp Gly Ile Pro Cys Lys Glu Arg Gly Tyr Cys Tyr Glu Lys
485 490 495Ser Cys His Asp Arg Asn Glu
Gln Cys Arg Arg Ile Phe Gly Ala Gly 500 505
510Ala Asn Thr Ala Ser Glu Thr Cys Tyr Lys Glu Leu Asn Thr
Leu Gly 515 520 525Asp Arg Val Gly
His Cys Gly Ile Lys Asn Ala Thr Tyr Ile Lys Cys 530
535 540Asn Ile Ser Asp Val Gln Cys Gly Arg Ile Gln Cys
Glu Asn Val Thr545 550 555
560Glu Ile Pro Asn Met Ser Asp His Thr Thr Val His Trp Ala Arg Phe
565 570 575Asn Asp Ile Met Cys
Trp Ser Thr Asp Tyr His Leu Gly Met Lys Gly 580
585 590Pro Asp Ile Gly Glu Val Lys Asp Gly Thr Glu Cys
Gly Ile Asp His 595 600 605Ile Cys
Ile His Arg His Cys Val His Ile Thr Ile Leu Asn Ser Asn 610
615 620Cys Ser Pro Ala Phe Cys Asn Lys Arg Gly Ile
Cys Asn Asn Lys His625 630 635
640His Cys His Cys Asn Tyr Leu Trp Asp Pro Pro Asn Cys Leu Ile Lys
645 650 655Gly Tyr Gly Gly
Ser Val Asp Ser Gly Pro Pro Pro Lys Arg Lys Lys 660
665 670Lys Lys Lys Phe Cys Tyr Leu Cys Ile Leu Leu
Leu Ile Val Leu Phe 675 680 685Ile
Leu Leu Cys Cys Leu Tyr Arg Leu Cys Lys Lys Ser Lys Pro Ile 690
695 700Lys Lys Gln Gln Asp Val Gln Thr Pro Ser
Ala Lys Glu Glu Glu Lys705 710 715
720Ile Gln Arg Arg Pro His Glu Leu Pro Pro Gln Ser Gln Pro Trp
Val 725 730 735Met Pro Ser
Gln Ser Gln Pro Pro Val Thr Pro Ser Gln Ser His Pro 740
745 750Arg Val Met Pro Ser Gln Ser Gln Pro Pro
Val Met Pro Ser Gln Ser 755 760
765His Pro Gln Leu Thr Pro Ser Gln Ser Gln Pro Pro Val Met Pro Ser 770
775 780Gln Ser His Pro Gln Leu Thr Pro
Ser Gln Ser Gln Pro Pro Val Thr785 790
795 800Pro Ser Gln Arg Gln Pro Gln Leu Met Pro Ser Gln
Ser Gln Pro Pro 805 810
815Val Thr Pro Ser 820272726DNAMus musculusCDS(221)..(2509)
27agaagctgtc ctgggcttct tggaggactc cttacatcat aagaaagaca atactaattt
60aatactcaca tacctgtact tttatcatgg accaaaggaa tacagaccta aaggtttggc
120acttccagag gacagatgca gtctagaagg attcagtcac tatgagtacc agttcttaat
180tcttctttga atcaacattt ttataggagc cacatacata atg aat atg att gaa
235Met Asn Met Ile Glu1 5gca tta tta tcc atg aga gtc ttg
ttc ctg aca caa gtg ttt ggg att 283Ala Leu Leu Ser Met Arg Val Leu
Phe Leu Thr Gln Val Phe Gly Ile 10 15
20ttc ctg tgt ttt cct gga ctc aca aag gct gga cat ctg cac
tac cac 331Phe Leu Cys Phe Pro Gly Leu Thr Lys Ala Gly His Leu His
Tyr His 25 30 35agt tcc ata
gaa gtg gtg att ccc atg aag gta act gag aaa acc aga 379Ser Ser Ile
Glu Val Val Ile Pro Met Lys Val Thr Glu Lys Thr Arg 40
45 50gga atg aac ctt cca aat tgg atc tcc tat agc
ctt aaa ctt gga ggc 427Gly Met Asn Leu Pro Asn Trp Ile Ser Tyr Ser
Leu Lys Leu Gly Gly 55 60 65cag aga
tac atc atc cac atg aag atc aag aat ctt ttt cta acc agg 475Gln Arg
Tyr Ile Ile His Met Lys Ile Lys Asn Leu Phe Leu Thr Arg70
75 80 85cac ctt cca gtg ttc acc tac
tct gat cag gac tct ctg ctt gaa gat 523His Leu Pro Val Phe Thr Tyr
Ser Asp Gln Asp Ser Leu Leu Glu Asp 90 95
100tac cct ttt gta cag gat gac tgc tac tac caa ggt tat
gtg gag ggt 571Tyr Pro Phe Val Gln Asp Asp Cys Tyr Tyr Gln Gly Tyr
Val Glu Gly 105 110 115gac tca
gaa tca tta gtt tcc ctc agt tcc tgt ttt gga ggc ttt cat 619Asp Ser
Glu Ser Leu Val Ser Leu Ser Ser Cys Phe Gly Gly Phe His 120
125 130gga cta tta gag ata aat aat att gtt tat
gaa att atg ccc aag aag 667Gly Leu Leu Glu Ile Asn Asn Ile Val Tyr
Glu Ile Met Pro Lys Lys 135 140 145ttt
tct agg aaa ttt gaa cat ctg gtc tat aaa gtg gac att aat aaa 715Phe
Ser Arg Lys Phe Glu His Leu Val Tyr Lys Val Asp Ile Asn Lys150
155 160 165aca gaa tca agg ggt tcc
agc ctt atg caa gat aac ata aca tgc caa 763Thr Glu Ser Arg Gly Ser
Ser Leu Met Gln Asp Asn Ile Thr Cys Gln 170
175 180gta gag tta caa aaa agt ggt aat ccc att ctc aag
caa agt agt ttt 811Val Glu Leu Gln Lys Ser Gly Asn Pro Ile Leu Lys
Gln Ser Ser Phe 185 190 195gaa
gac tgg tgg acc cat act aaa att gtt gaa tta gta gtg gtg gtg 859Glu
Asp Trp Trp Thr His Thr Lys Ile Val Glu Leu Val Val Val Val 200
205 210gat aag act cta tat gac cac tat gga
aat tat aca gta atg ctg tca 907Asp Lys Thr Leu Tyr Asp His Tyr Gly
Asn Tyr Thr Val Met Leu Ser 215 220
225gat ctg tat tct gtg ata aat ata gtg gat acc att tat gag gta att
955Asp Leu Tyr Ser Val Ile Asn Ile Val Asp Thr Ile Tyr Glu Val Ile230
235 240 245ggt att aaa ata
tta ttg gtt ggt gtg gag gtt tgg aat aag aaa aat 1003Gly Ile Lys Ile
Leu Leu Val Gly Val Glu Val Trp Asn Lys Lys Asn 250
255 260ctt att gtg ata gat gac gta agt aaa tct
cta aga cta tat tgc cgg 1051Leu Ile Val Ile Asp Asp Val Ser Lys Ser
Leu Arg Leu Tyr Cys Arg 265 270
275tgg aaa gcc tca aac ttt ctt cat cgt tta aaa cat gat gtc tcg cat
1099Trp Lys Ala Ser Asn Phe Leu His Arg Leu Lys His Asp Val Ser His
280 285 290ctt ttc ata tat agg cac ttg
aga gga tta agt ggc ata ggt tcc act 1147Leu Phe Ile Tyr Arg His Leu
Arg Gly Leu Ser Gly Ile Gly Ser Thr 295 300
305ggg ggg att tgt gat cca aaa cgt agt tgt gca gtt gtt act ttc ata
1195Gly Gly Ile Cys Asp Pro Lys Arg Ser Cys Ala Val Val Thr Phe Ile310
315 320 325gac aga act ttg
aac ctt cgt gcc att gga gtg gct cat cac tta ggt 1243Asp Arg Thr Leu
Asn Leu Arg Ala Ile Gly Val Ala His His Leu Gly 330
335 340cat aat ttg ggc atg aaa cat gat gaa gat
ata tgt aag tgt agt tac 1291His Asn Leu Gly Met Lys His Asp Glu Asp
Ile Cys Lys Cys Ser Tyr 345 350
355agt aaa tgt ata atg cac atg gac agc cca ccg ata ccc aaa ttc agc
1339Ser Lys Cys Ile Met His Met Asp Ser Pro Pro Ile Pro Lys Phe Ser
360 365 370 aat tgt agc tat aat tac ttt
tgg tct tac act gta aag aac aca agg 1387Asn Cys Ser Tyr Asn Tyr Phe
Trp Ser Tyr Thr Val Lys Asn Thr Arg 375 380
385tgt ttg atg gaa aac atg tac aca aag gat atc ttt gac agg aca cgc
1435Cys Leu Met Glu Asn Met Tyr Thr Lys Asp Ile Phe Asp Arg Thr Arg390
395 400 405tgt gga aat ggt
gtt gtt gaa gac aaa gaa caa tgt gac tgt gga tca 1483Cys Gly Asn Gly
Val Val Glu Asp Lys Glu Gln Cys Asp Cys Gly Ser 410
415 420tta agg aat tgt aca aat gac ctt tgt tgc
atg tca aac tgc act ctg 1531Leu Arg Asn Cys Thr Asn Asp Leu Cys Cys
Met Ser Asn Cys Thr Leu 425 430
435agt act ggg tct tcc tgt gcc ttt gga ctt tgc tgc aaa aac tgt cag
1579Ser Thr Gly Ser Ser Cys Ala Phe Gly Leu Cys Cys Lys Asn Cys Gln
440 445 450ttt tta cca tca ggg act ctg
tgt aga aaa agg gat aac att tgt gac 1627Phe Leu Pro Ser Gly Thr Leu
Cys Arg Lys Arg Asp Asn Ile Cys Asp 455 460
465ctt cca gag tgg tgc aat ggg acg tcc cat gaa tgt cca gat gat gct
1675Leu Pro Glu Trp Cys Asn Gly Thr Ser His Glu Cys Pro Asp Asp Ala470
475 480 485tat gta gaa gat
gga att ccc tgt ggg gtc tca gcc tat tgc tat gaa 1723Tyr Val Glu Asp
Gly Ile Pro Cys Gly Val Ser Ala Tyr Cys Tyr Glu 490
495 500aag caa tgt aat gac cgc aat gag cac tgt
agg caa att ttt ggc cag 1771Lys Gln Cys Asn Asp Arg Asn Glu His Cys
Arg Gln Ile Phe Gly Gln 505 510
515aat gca aag act gca agt gta cat tgc tac aga gaa ata aac act aaa
1819Asn Ala Lys Thr Ala Ser Val His Cys Tyr Arg Glu Ile Asn Thr Lys
520 525 530ggt gat cgt ttt ggc cat tgt
ggt ctt cag gga cct act tac ata aaa 1867Gly Asp Arg Phe Gly His Cys
Gly Leu Gln Gly Pro Thr Tyr Ile Lys 535 540
545tgt aaa agc aat gat gct ctt tgt gga aga att caa tgt gat aat gtg
1915Cys Lys Ser Asn Asp Ala Leu Cys Gly Arg Ile Gln Cys Asp Asn Val550
555 560 565gta caa att ccc
aat atg aaa gat cac agt act att cac ttt gct ctt 1963Val Gln Ile Pro
Asn Met Lys Asp His Ser Thr Ile His Phe Ala Leu 570
575 580gtc aaa aat gta tct tgc tgg ggc act gat
tac cac act ggg aca agc 2011Val Lys Asn Val Ser Cys Trp Gly Thr Asp
Tyr His Thr Gly Thr Ser 585 590
595cta act gat ata ggc gat gtg aaa gat ggc aca gag tgt gag caa aat
2059Leu Thr Asp Ile Gly Asp Val Lys Asp Gly Thr Glu Cys Glu Gln Asn
600 605 610cat atc tgt atc aat agg cat
tgt gta cat ata tct aca tta gac agc 2107His Ile Cys Ile Asn Arg His
Cys Val His Ile Ser Thr Leu Asp Ser 615 620
625aac tgt aca cct gca ttc tgt aat tac agg ggc atc tgt aac aat aaa
2155Asn Cys Thr Pro Ala Phe Cys Asn Tyr Arg Gly Ile Cys Asn Asn Lys630
635 640 645cat cac tgc cac
tgc aac ttc cac tgg gat cct cct aac tgt atg att 2203His His Cys His
Cys Asn Phe His Trp Asp Pro Pro Asn Cys Met Ile 650
655 660aga gga cat gga ggt agt gta gac agt ggc
tta cct cct aaa aca aat 2251Arg Gly His Gly Gly Ser Val Asp Ser Gly
Leu Pro Pro Lys Thr Asn 665 670
675aaa aag aaa cat ttc ttc tat ctg ctt cta tta cag ctc att att ttg
2299Lys Lys Lys His Phe Phe Tyr Leu Leu Leu Leu Gln Leu Ile Ile Leu
680 685 690gct tgc ctt tta agt tgt ctt
ctt tgg cta ctt ttt aat ata aaa gga 2347Ala Cys Leu Leu Ser Cys Leu
Leu Trp Leu Leu Phe Asn Ile Lys Gly 695 700
705agt aaa cga aag ccc caa gtt cag cct aca cct gta aaa aca aag aaa
2395Ser Lys Arg Lys Pro Gln Val Gln Pro Thr Pro Val Lys Thr Lys Lys710
715 720 725gtt tca aag aaa
gtt cca agc caa aaa ccg agt cca gtg cct tcc ccg 2443Val Ser Lys Lys
Val Pro Ser Gln Lys Pro Ser Pro Val Pro Ser Pro 730
735 740agt cta cct caa tta aga atg cca tca cga
tct gct tca cca aca tca 2491Ser Leu Pro Gln Leu Arg Met Pro Ser Arg
Ser Ala Ser Pro Thr Ser 745 750
755tcc ata aaa agt acc aat taaatattaa tcattagtat ggctctcctt
2539Ser Ile Lys Ser Thr Asn 760gttcttcatg attttaagta atatgaagac
tgttttctgt aatttcgttc tttacatttc 2599cagaaaaaaa taatgtatga ataggtattt
ttcagattac tggctatcag cttttaatat 2659tttatatact ttgattgata ttgcaccatt
tctgctaaag caatcctctt cctatgggga 2719aatagac
272628763PRTMus musculus 28Met Asn Met
Ile Glu Ala Leu Leu Ser Met Arg Val Leu Phe Leu Thr1 5
10 15 Gln Val Phe Gly Ile Phe Leu Cys Phe
Pro Gly Leu Thr Lys Ala Gly 20 25
30His Leu His Tyr His Ser Ser Ile Glu Val Val Ile Pro Met Lys Val
35 40 45Thr Glu Lys Thr Arg Gly Met
Asn Leu Pro Asn Trp Ile Ser Tyr Ser 50 55
60Leu Lys Leu Gly Gly Gln Arg Tyr Ile Ile His Met Lys Ile Lys Asn65
70 75 80Leu Phe Leu Thr
Arg His Leu Pro Val Phe Thr Tyr Ser Asp Gln Asp 85
90 95Ser Leu Leu Glu Asp Tyr Pro Phe Val Gln
Asp Asp Cys Tyr Tyr Gln 100 105
110Gly Tyr Val Glu Gly Asp Ser Glu Ser Leu Val Ser Leu Ser Ser Cys
115 120 125Phe Gly Gly Phe His Gly Leu
Leu Glu Ile Asn Asn Ile Val Tyr Glu 130 135
140Ile Met Pro Lys Lys Phe Ser Arg Lys Phe Glu His Leu Val Tyr
Lys145 150 155 160Val Asp
Ile Asn Lys Thr Glu Ser Arg Gly Ser Ser Leu Met Gln Asp
165 170 175Asn Ile Thr Cys Gln Val Glu
Leu Gln Lys Ser Gly Asn Pro Ile Leu 180 185
190Lys Gln Ser Ser Phe Glu Asp Trp Trp Thr His Thr Lys Ile
Val Glu 195 200 205Leu Val Val Val
Val Asp Lys Thr Leu Tyr Asp His Tyr Gly Asn Tyr 210
215 220Thr Val Met Leu Ser Asp Leu Tyr Ser Val Ile Asn
Ile Val Asp Thr225 230 235
240Ile Tyr Glu Val Ile Gly Ile Lys Ile Leu Leu Val Gly Val Glu Val
245 250 255Trp Asn Lys Lys Asn
Leu Ile Val Ile Asp Asp Val Ser Lys Ser Leu 260
265 270Arg Leu Tyr Cys Arg Trp Lys Ala Ser Asn Phe Leu
His Arg Leu Lys 275 280 285His Asp
Val Ser His Leu Phe Ile Tyr Arg His Leu Arg Gly Leu Ser 290
295 300Gly Ile Gly Ser Thr Gly Gly Ile Cys Asp Pro
Lys Arg Ser Cys Ala305 310 315
320Val Val Thr Phe Ile Asp Arg Thr Leu Asn Leu Arg Ala Ile Gly Val
325 330 335Ala His His Leu
Gly His Asn Leu Gly Met Lys His Asp Glu Asp Ile 340
345 350Cys Lys Cys Ser Tyr Ser Lys Cys Ile Met His
Met Asp Ser Pro Pro 355 360 365Ile
Pro Lys Phe Ser Asn Cys Ser Tyr Asn Tyr Phe Trp Ser Tyr Thr 370
375 380Val Lys Asn Thr Arg Cys Leu Met Glu Asn
Met Tyr Thr Lys Asp Ile385 390 395
400Phe Asp Arg Thr Arg Cys Gly Asn Gly Val Val Glu Asp Lys Glu
Gln 405 410 415Cys Asp Cys
Gly Ser Leu Arg Asn Cys Thr Asn Asp Leu Cys Cys Met 420
425 430Ser Asn Cys Thr Leu Ser Thr Gly Ser Ser
Cys Ala Phe Gly Leu Cys 435 440
445Cys Lys Asn Cys Gln Phe Leu Pro Ser Gly Thr Leu Cys Arg Lys Arg 450
455 460Asp Asn Ile Cys Asp Leu Pro Glu
Trp Cys Asn Gly Thr Ser His Glu465 470
475 480Cys Pro Asp Asp Ala Tyr Val Glu Asp Gly Ile Pro
Cys Gly Val Ser 485 490
495Ala Tyr Cys Tyr Glu Lys Gln Cys Asn Asp Arg Asn Glu His Cys Arg
500 505 510Gln Ile Phe Gly Gln Asn
Ala Lys Thr Ala Ser Val His Cys Tyr Arg 515 520
525Glu Ile Asn Thr Lys Gly Asp Arg Phe Gly His Cys Gly Leu
Gln Gly 530 535 540Pro Thr Tyr Ile Lys
Cys Lys Ser Asn Asp Ala Leu Cys Gly Arg Ile545 550
555 560Gln Cys Asp Asn Val Val Gln Ile Pro Asn
Met Lys Asp His Ser Thr 565 570
575Ile His Phe Ala Leu Val Lys Asn Val Ser Cys Trp Gly Thr Asp Tyr
580 585 590His Thr Gly Thr Ser
Leu Thr Asp Ile Gly Asp Val Lys Asp Gly Thr 595
600 605Glu Cys Glu Gln Asn His Ile Cys Ile Asn Arg His
Cys Val His Ile 610 615 620Ser Thr Leu
Asp Ser Asn Cys Thr Pro Ala Phe Cys Asn Tyr Arg Gly625
630 635 640Ile Cys Asn Asn Lys His His
Cys His Cys Asn Phe His Trp Asp Pro 645
650 655Pro Asn Cys Met Ile Arg Gly His Gly Gly Ser Val
Asp Ser Gly Leu 660 665 670Pro
Pro Lys Thr Asn Lys Lys Lys His Phe Phe Tyr Leu Leu Leu Leu 675
680 685Gln Leu Ile Ile Leu Ala Cys Leu Leu
Ser Cys Leu Leu Trp Leu Leu 690 695
700Phe Asn Ile Lys Gly Ser Lys Arg Lys Pro Gln Val Gln Pro Thr Pro705
710 715 720Val Lys Thr Lys
Lys Val Ser Lys Lys Val Pro Ser Gln Lys Pro Ser 725
730 735Pro Val Pro Ser Pro Ser Leu Pro Gln Leu
Arg Met Pro Ser Arg Ser 740 745
750Ala Ser Pro Thr Ser Ser Ile Lys Ser Thr Asn 755
7602922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29cagatgccct acaaagtctt cc
223022DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 30gccacggtgc catacagaga aa
223122DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 31ggcaacccac caataactaa at
223222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32tcccacagcg cttcacatta aa
22
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: