Patent application title: Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
Inventors:
Daniel J. Von Seggern (San Deigo, CA, US)
Glen R. Nemerow (Encinitas, CA, US)
Paul Hallenbeck (Gaithersburg, MD, US)
Susan Stevenson (Frederick, MD, US)
Yelena Skripchenko (Gaithersburg, MD, US)
Assignees:
The Scripps Research Institute
NOVARTIS AG
IPC8 Class: AC12P2104FI
USPC Class:
435 691
Class name: Chemistry: molecular biology and microbiology micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide
Publication date: 2009-04-16
Patent application number: 20090098599
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Adenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
Inventors:
Daniel J. Von Seggern
Glen R. Nemerow
Paul Hallenbeck
Susan Stevenson
Yelena Skripchenko
Agents:
Lisa A. Haile, J.D., Ph.D.;DLA PIPER US LLP
Assignees:
Origin: SAN DIEGO, CA US
IPC8 Class: AC12P2104FI
USPC Class:
435 691
Abstract:
The present invention relates to methods for gene therapy, especially to
adenovirus-based gene therapy, and related cell lines and compositions.
In particular, novel nucleic acid constructs and packaging cell lines are
disclosed, for use in facilitating the development of high-capacity and
targeted vectors. The invention also discloses a variety of high-capacity
adenovirus vectors and related compositions and kits including the
disclosed cell lines and vectors. Finally, the invention discloses
methods of preparing and using the disclosed vectors, cell lines and
kits.Claims:
1-30. (canceled)
31. A helper-independent fiberless recombinant adenovirus vector genome comprising genes which:(a) encodes all adenovirus structural gene products but do not express sufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of the fiber gene or the genome lacks at least the fiber gene, and(b) encodes an exogenous protein.
32. The adenovirus vector genome of claim 31 wherein the adenovirus vector genome does not encode one or more functional proteins selected from the group consisting of E1A, E1B, E2A, E2B, E3 and E4 protein.
33. The adenovirus vector genome of claim 31 wherein the adenovirus vector genome is Ad5.βgal.ΔF.
34. The adenovirus vector genome of claim 33 wherein the adenovirus vector genome has a nucleotide sequence shown in SEQ ED NO:27 and corresponds to Ad5.βgal.ΔF.
35. The adenovirus vector genome of claim 31 wherein the adenovirus vector genome is contained in the adenovirus particle deposited under ATCC accession VR-2636 corresponding to Ad5.βgal.ΔF.
36. The adenovirus vector genome of claim 31 wherein the exogenous protein is a therapeutic gene product.
37. An isolated nucleic acid that comprises the adenovirus vector genome of claim 31.
38-59. (canceled)
60. A method for specifically targeting an adenovirus vector to a cell of choice comprising introducing a helper-independent or helper-dependent fiberless recombinant adenovirus vector genome into a packaging cell line for producing a fiber gene-deleted adenovirus vector, wherein a gene for a missing fiber protein is complemented with a gene for a desired modification for targeting the vector to a cell of choice.
61-70. (canceled)
71. A composition for preparing a therapeutic vector, the composition comprising a plasmid comprising an adenovirus genome lacking a nucleotide sequence encoding a fiber protein or a genome that is incapable of expressing sufficient fiber to result in packaging.
72-73. (canceled)
74. The recombinant adenovirus vector genome of claim 31, wherein no fiber protein is expressed.
75. (canceled)
76. The recombinant adenovirus genome of claim 31, wherein the genome expresses insufficient fiber to allow incorporation of the protein into a particle such that the particle cannot use the fiber pathway for infection.
77. A method for producing a gutless adenoviral vector particle comprising:a) delivering a helper adenovirus vector genome to an adenovirus vector packaging cell, wherein the helper adenovirus vector genome lacks any gene encoding adenovirus fiber protein or lacks the ability to encode sufficient adenovirus fiber protein to produce an adenoviral vector comprising fiber protein in the absence of complementation by the packing cell and wherein the packaging cell comprises the nucleic acid molecule of claim 2 operably linked to a promoter and to an adenoviral fiber protein or to a chimeric protein that includes an adenovirus fiber protein tail domain;(b) delivering a gutless adenovirus vector genome to the packaging cell; and(c) recovering the gutless adenoviral vector particle produced by the cell.
78. The method of claim 77, wherein the helper adenovirus vector genome is delivered by viral infection.
79. The method of claim 78, wherein the gutless adenovirus vector genome is delivered by transfection.
80. The method of claim 77, wherein the gutless adenovirus vector genome comprises an operable packaging sequence.
81. The method of claim 80, wherein the helper adenovirus vector genome has a mutation in its packaging sequence that renders the genome substantially incapable of being packaged as an adenoviral vector particle by the packaging cell.
82. The method of claim 80, wherein the helper adenovirus vector genome comprises recombinase sites flanking its packaging sequence and the packaging cell further comprises a nucleotide sequence encoding a recombinase.
83. The method of claim 82, wherein the recombinase site is a lox site and the recombinase is Cre.
84. A helper adenovirus particle comprising an adenovirus vector genome that does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber-containing adenovirus particle without complementation of the fiber gene, wherein said genome has a mutation in its packaging sequence that renders the genome substantially incapable of being packaged.
85. The helper adenovirus particle of claim 84, wherein the mutation comprises a deletion of at least one nucleotide in the packaging sequence.
86. The helper adenovirus particle of claim 85, wherein the adenovirus vector genome does not encode functional proteins selected from the group consisting of E1A, E1B, E2A, E2B, E3, and E4 proteins.
87-94. (canceled)
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001]This application is a continuation application of U.S. application Ser. No. 09/482,682 filed Jan. 14, 2000, now issued as U.S. Pat. No. 7,232,899; which is a continuation-in-part application of U.S. application Ser. No. 09/423,783 filed Jun. 26, 2000, now abandoned; which is a 35 USC § 371 National Stage application of PCT Application No. PCT/EP97/05251 filed Sep. 24, 1997; which is a continuation-in-part application of U.S. application Ser. No. 08/719,806 filed Sep. 25, 1996, now abandoned. This application is also a continuation application of U.S. application Ser. No. 09/482,682 filed Jan. 14, 2000, now issued as U.S. Pat. No. 7,232,899; which is a continuation-in-part application of U.S. application Ser. No. 09/795,292 filed Jan. 14, 1999, now pending; which is a 35 USC § 371 National Stage application of PCT Application No. PCT/EP97/05251 filed Sep. 24, 1997; which is a continuation-in-part application of U.S. application Ser. No. 08/719,806 filed Sep. 25, 1996, now abandoned. The disclosure of each of the prior applications is considered part of and is incorporated by reference in the disclosure of this application.
BACKGROUND OF THE INVENTION
[0003]1. Field of the Invention
[0004]The present invention relates to gene therapy, especially to adenovirus-based gene therapy. In particular, novel packaging cell lines are disclosed, for use in facilitating the development of high-capacity and targeted vectors. High-capacity adenovirus vectors are also disclosed herein, as are related compositions, kits, and methods of preparation and use of the disclosed vectors, cell lines and kits.
[0005]2. Background Information
[0006]Enhanced transfer of DNA conjugates into cells has been achieved with adenovirus, a human DNA virus which readily infects epithelial cells (Horwitz, "Adenoviridae and Their Replication", in Virology, Fields and Knipe, eds., Raven Press, NY (1990) pp. 1679-1740).
[0007]Although adenovirus-mediated gene therapy represents an improved method of DNA transfer into cells, a potential limitation of this approach is that adenovirus replication results in disruption of the host cell. In addition, adenovirus also possesses oncogenic properties including the ability of one of its proteins to bind to tumor suppressor gene products. The use of so-called replication defective strains of adenovirus (which typically possess E1A and/or E1B deletions that render the virus unable to replicate in host cells) is in principle more suitable for in vivo therapy; however, the potential of co-infection of epithelial cells with wild-type strains of virus resulting in transactivation of the recombinant virus may represent a significant safety concern for in vivo applications.
[0008]Another undesirable aspect of using intact or replication-competent adenovirus as a gene transfer means is that it is an oncogenic virus whose gene products are known to interfere with the function of host cell tumor suppressor proteins as well as immune recognition molecules, such as the major histocompatibility complex (MHC). In addition, pre-existing circulating antibodies to adenovirus may significantly reduce the efficiency of in vivo gene delivery. Lastly, only a foreign gene of 6 kilobases (kb) or less can be incorporated into the intact adenovirus genome for gene transfer experiments, whereas DNA segments of greater than 12 kb can be transferred using the methods of this invention.
[0009]In order to make Ad vectors more replication-incompetent, some investigators have attempted to construct recombinant Ad-derived vectors which have nearly all of their genome deleted, except for portions known to be required for packaging of virus particles. For example, helper-dependent vectors lacking all viral ORFs but including essential cis elements (the inverted terminal repeats--ITRs--and the contiguous packaging sequence) have been constructed, but the virions package less efficiently than the helper and package as multimers part of the time, which suggests that the virus may "want" to package a fuller DNA complement (see, e.g., Fisher, et al., Virology 217: 11-22, 1996). Mitani et al. (Proc. Natl. Acad. Sci. USA 92: 3854-3858, 1995) also describe a helper-dependent Ad vector that was apparently not completely replication-defective.
[0010]Amalfitano, et al. (Proc. Natl. Acad. Sci. USA 93: 3352-3356, 1996) describe the construction of Ad packaging cell lines that support the growth of E1- and polymerase-deleted Ad vectors, in an effort to block the replication of Ad vectors in vivo. Similarly, Armentano, et al. (Hum. Gene Ther. 6: 1343-53, 1995) describes Ad vectors with most--but not all--of the E4 sequence deleted therefrom. However, since such a small amount of genetic material is deleted from the vectors, their ability to transport therapeutic sequences is rather limited. Published International App. No. WO96/14061 describes efforts to construct packaging cell lines containing nucleotide sequences encoding E1 and ORF6 of E4.
[0011]In addition to being able to incorporate large amounts of DNA into a vector, the ability to target the vectors to specific cell types will result in more efficient administration of desired therapeutics. Such targeting of adenovirus in a relatively simple system is one of the advantages of the current invention.
[0012]Thus, there is a need in the art to obtain Adenovirus vectors 1) capable of incorporating large segments of foreign DNA and capable of being targeted to specific cells, as well as to obtain cell lines which can package such adenovirus-gene deficient vector or targeted vectors. These needs, as well as others, are met by the invention.
SUMMARY OF THE INVENTION
[0013]This invention utilizes recombinant adenovirus constructs which duplicate the cell receptor binding and DNA delivery properties of intact adenovirus virions and thus represents an improved method for gene therapy and cell targeting as well as for antisense-based antiviral therapy.
[0014]In contrast to the disadvantages of using intact adenovirus, modified adenovirus vectors requiring a helper plasmid or virus, or so-called replication-deficient adenovirus in the art, the use of recombinant adenovirus-derived vectors according to one aspect of the present invention provides certain advantages for gene delivery. First, the Ad-derived vectors of the present invention possess all of the functional properties required for gene therapy including binding to epithelial cell receptors and penetration of endocytic vesicles. Therapeutic viral vectors of the present invention may also be engineered to target the receptors of and achieve penetration of non-epithelial cells; means of engineering viral vectors to accomplish these ends are described in detail herein below.
[0015]Second, the vectors of the present invention have deletions of substantial portions of the Ad genome, which not only limits the ability of the Ad-derived vectors to "spread" to other host cells or tissues, but allows significant amounts of "foreign" (or non-native) nucleic acids to be incorporated into the viral genome without interfering with the reproduction and packaging of the viral genome. Therefore, the vectors of the present invention are ideal for use in a wide variety of therapeutic applications.
[0016]Third, while the vectors disclosed herein are safe for use as therapeutic agents in the treatment of a variety of human afflictions, some of these vectors do not require the presence of any "helpers" for propagation and packaging, largely because of the novel cell lines in which they are reproduced. Such cell lines--referred to herein as packaging cell lines--comprise yet another aspect of the invention.
[0017]To reduce the frequency of contamination with wild-type adenovirus, it is desirable to improve either the viral vector or the cell line to reduce the probability of recombination. For example, an adenovirus from a group with less homology to the group C viruses may be used to engineer recombinant viruses with little propensity for recombination with the Ad5 sequence contained in the packaging lines. The invention describes the preparation of packaging cells lines which stably expresses adenovirus proteins or polypeptides. These cell lines are useful for complementing viral vectors bearing deletions of regulatory and/or structural genes, irrespective of the serotype from which such a vector was derived.
[0018]It is also contemplated that the constructs and methods of the present invention will support the design and engineering of chimeric viral vectors which express amino acid residue sequences derived from two or more Ad serotypes.
[0019]Thus, unlike methods and constructs available prior to the advent of the present disclosure, this invention allows the greatest possible flexibility in the design and preparation of useful viral vectors and cell lines which support their construction and propagation--all with a decreased risk of recombining with wild-type Ad to produce potentially-harmful recombinants.
[0020]In part, the present invention discloses a simpler, alternative means of reducing the recombination between viral and cellular sequences than those discussed in the art. One such means is to increase the size of the deletion in the recombinant virus and thereby reduce the extent of shared sequences between that virus and any Ad genes present in a packaging cell line e.g., the Ad5 genes in 293 cells, or the various Ad genes in the novel cell lines of the present invention.
[0021]Deletions of all or portions of structural genes of the adenovirus have been considered undesirable because of the anticipated deleterious effects such deletions would have on viral reproduction and packaging. Indeed, the use of "helper" viruses or plasmids has often been recommended when using Ad-derived vectors containing large deletions in structural protein sequences precisely for this reason.
[0022]Contrary to what has been suggested in the art, however, this invention discloses the preparation, propagation and use of recombinant Ad-derived vectors having deletions of all or part of various gene sequences encoding Ad structural proteins, both as away of reducing the risk of wild-type adenovirus contamination in virus preparations, as a way of allowing foreign DNA to be packaged in such vectors for a variety of diagnostic and therapeutic applications and as a way of targeting an adenovirus vector to a specific cell type.
[0023]The invention further discloses a wide variety of nucleic acid sequences and viral vectors. Thus, in one embodiment, the invention discloses a nucleic acid sequence encoding any one of the adenovirus fiber proteins mentioned in the specification, polypeptides or fragments thereof--including, without limitation, those that include deletions or other mutations; those that are chimeric; and those that have linkers, foreign amino acid residues, or other molecules attached for various purposes as disclosed herein. Nucleic acid sequences encoding various other adenovirus structural and/or regulatory proteins or polypeptides are also within the scope of the present invention. In various embodiments, the adenovirus is a Group C adenovirus selected from serotypes 1, 2, 5 or 6; while in other embodiments, adenovirus selected from other serotypes, such as for example Ad37 (subgroup D) are useful as disclosed herein.
[0024]The invention is also directed to an isolated nucleic-acid molecule comprising an adenovirus tripartite leader (TPL) nucleotide sequence, said TPL nucleotide sequence comprising (a) first and second different TPL exons or (b) first, second and third same or different TPL exons, said TPL exons selected from the group consisting of complete TPL exon 1, partial TPL exon 1, complete TPL exon 2 and complete TPL exon 3. A preferable embodiment of the invention may further comprise an intron operatively linked to the TPL, wherein said intron also contains requisite processing signals for the intron's removal. Another preferable embodiment of the invention is directed to the isolated nucleic acid molecule wherein said TPL nucleotide sequence consists essentially of complete TPL exon 1 operatively linked to complete TPL exon 2 operatively linked to complete TPL exon 3. A related embodiment may further include an intron and appropriate processing signals. Additional embodiments of the invention are directed to nucleic acid molecules contained in plasmids selected from the group; consisting of pCLF, pDV60, pDV67, pDV69, pDV80 and pDV90. Packaging cell lines and adenovirus particles containing the nucleic acids described above are also included in the invention.
[0025]The invention is further directed to methods for producing an adenovirus vector particle containing a helper-independent fiberless recombinant adenovirus vector genome comprising providing a) a packaging cell line which complements replication and packaging of said genome and b) a helper-independent fiberless recombinant adenovirus vector genome which is deficient in expressing sufficient functional fiber protein to support assembly of fiber-containing particles. The genome is introduced into the cell line. Additional embodiments of the invention may also include the following steps; a) growing the cell line produced under conditions for producing particles; and/or b) harvesting an adenovirus vector particle containing said helper-independent fiberless recombinant adenovirus vector genome. The method may also include a cell line that expresses a fiber protein and complements a fiber mutation in the vector.
[0026]The invention is also directed to an adenovirus vector packaging cell line comprising a stably integrated nucleic acid molecule as described above, an operatively-linked promoter and a nucleic acid sequence which encodes an adenovirus structural protein, wherein said TPL sequence consists essentially of a first TPL exon operatively linked to a complete second TPL exon operatively linked to a complete third TPL exon. Preferably, the cell line may have a complete or partial first TPL exon. Another embodiment of the invention comprises adenovirus structural protein, such as adenovirus fiber protein or a chimeric protein which includes an adenovirus fiber protein tail domain.
[0027]The invention is further directed to a recombinant adenovirus particle comprising a recombinant adenovirus vector genome wherein said genome: (a) does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber-containing adenovirus particle without complementation of said fiber gene, and (b) encodes an adenovirus packaging signal and inverted terminal repeats containing adenovirus origin of replication. The invention is also directed to a helper-independent fiberless recombinant adenovirus vector genome comprising genes which (a) encode all adenovirus structural gene products but do not express sufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of said fiber gene or said genome lacks at least the fibre gene and (b) encodes an exogenous protein. Either of the above embodiments may substitute a helper-dependent for a helper-independent recombinant adenovirus vector genome. In a preferable embodiment, no fiber protein is expressed. In yet another embodiment of the invention, the recombinant adenovirus particle fails to express sufficient fiber protein to allow fiber incorporation into the particle such that the particle can use the fiber pathway for infection.
[0028]The invention is further directed to a method for producing an adenovirus vector particle containing a helper-independent fiberless recombinant adenovirus vector genome, said method comprising providing a packaging cell line which complements replication and packaging of said genome and a helper-independent fiberless recombinant adenovirus vector genome which is deficient in expressing sufficient functional fiber protein to support assembly of fiber-containing particles and harvesting said particles produced by said cell line. The method may also comprise a step of coating (i.e. providing fiber protein in any way) to a particle with an adenovirus fiber protein. In a preferable embodiment the adenovirus particle comprises an exogenous protein or a modified fiber protein.
[0029]Another aspect of the invention is directed to a method for pseudotyping recombinant viral vectors comprising complementing a missing fiber gene of a helper-independent fiberless recombinant adenovirus vector genome by expressing in packaging cells a fiber gene from a different adenoviral serotype than said recombinant adenovirus vector, thereby pseudotyping said vector. An additional embodiment of the invention is directed to the method for pseudotyping recombinant viral vectors comprising: a) providing a packaging cell line for propagating a fiber gene deleted recombinant adenovirus vector, b) introducing into said cell line a helper-independent fiberless recombinant adenovirus vector genome, and c) complementing the missing fiber gene by expression in the cells of a fiber gene from a different adenoviral serotype thereby pseudotyping the vector.
[0030]The invention is further directed to a method for specifically targeting an adenovirus vector to a cell of choice comprising providing a packaging cell line for producing a fiber gene-deleted adenovirus vector and providing a helper-independent fiberless recombinant adenovirus vector genome, wherein said gene for a missing fiber protein is complemented with a gene for a desired modification for targeting the vector to a cell of choice.
[0031]The invention is farther directed to a method for producing a modified adenovirus comprising providing in vitro an exogenous fiber protein to a fiberless adenovirus. Additional embodiments of the invention may provide any combination of all of the following steps such that the invention be directed to a method for producing a modified adenovirus comprising: a) providing a packaging cell line for producing a fiberless adenovirus vector, b) introducing into said cell line a helper-independent fiberless or helper-dependent fiberless recombinant adenovirus vector genome, c) growing and harvesting a fiberless adenovirus, d) maintaining the fiberless adenovirus in any suitable buffer, and e) providing exogenous fiber, wherein said fiber may be a modified fiber, to the fiberless adenovirus by adding conditioned media or a soluble fiber preparation or a fiber in any suitable buffer to a virus preparation thereby producing the modified adenovirus.
[0032]The invention is further directed to a method for producing a modified adenovirus comprising providing a packaging cell line for producing a helper-dependent fiberless adenovirus vector genome and providing a helper virus vector, wherein said cell line complements at least a deficient fiber protein gene, thereby producing the modified adenovirus. Another aspect of the invention is directed to a method for producing a modified adenovirus comprising: a) providing a packaging cell line for producing a fiberless adenovirus vector, b) introducing into said cell line a helper dependent fiberless recombinant adenovirus vector genome and a fiberless helper virus vector, c) growing and harvesting a fiberless adenovirus, and d) maintaining the fiberless adenovirus in infectious media, and e) providing exogenous fiber to the fiberless adenovirus by adding conditioned media or a soluble fiber preparation to a virus preparation thereby producing the modified adenovirus.
[0033]Additional aspects of the invention are directed to hybrid Ad/AAV vectors and to new helper-dependent vectors used with fiberless adenovirus vectors.
[0034]The invention is also directed to a method for delivering a heterologous gene to an EBV-infected B cells comprising infecting said B cells with a pseudotyped Ad5βgal.ΔF particle or other fiber-deleted adenovirus particle, said particle having a chimeric fiber with the receptor-binding knob domain of the adenovirus type 3 fiber.
[0035]The invention is also directed to an isolated nucleic acid comprising a post-transcriptional regulatory element (PRE) and a TPL. Preferably the PRE is the woodchuck hepatitis virus PRE (WPRE).
[0036]The invention is further directed to a composition for preparing a therapeutic vector, said composition comprising a plasmid comprising an adenovirus genome lacking a nucleotide sequence encoding a fiber protein or a genome that is incapable of expressing sufficient fiber to result in packaging.
[0037]Another aspect of the invention is directed to a method of delivering a heterologous gene to a human or any animal comprising providing an exogenous gene to a target cell comprising contacting said cell in vivo or ex vivo with an amount of a recombinant adenovirus particle sufficient to infect said cell.
[0038]The invention is also directed to A method for producing a gutless adenoviral vector particle comprising: a) delivering a helper adenovirus vector genome to an adenovirus vector packaging cell, wherein said helper adenovirus vector genome lacks any gene encoding adenovirus fiber protein or lacks the ability to encode sufficient adenovirus fiber protein to produce an adenoviral vector comprising fiber protein in the absence of complementation by said packing cell and wherein said packaging cell comprises the nucleic acid molecule of claim 2 operably linked to a promoter and to an adenoviral fiber protein or to a chimeric protein that includes an adenovirus fiber protein tail domain; (b) delivering a gutless adenovirus vector genome to said packaging cell; and (c) recovering the gutless adenoviral vector particle produced by said cell.
[0039]Another aspect of the invention is directed to a helper adenovirus particle comprising an adenovirus vector genome that does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber-containing adenovirus particle without complementation of said fiber gene, wherein said genome has a mutation in its packaging sequence that renders said genome substantially incapable of being packaged. Packaging sequence are those sequences are those sequences involved in packaging the viral particle.
[0040]The invention is further directed to a helper adenovirus particle comprising an adenovirus vector genome with recombinase sites flanking its packaging sequence, wherein said vector genome does not encode or does not express sufficient adenovirus fiber protein to support packaging of a fiber-containing adenovirus particle without complementation of said fiber gene.
[0041]The invention is also directed to an adenovirus particle comprising a gutless adenoviral vector genome and a fiberless capsid, as well as an adenovirus particle comprising a gutless adenoviral vector genome and a capsid comprising a modified fiber protein.
[0042]Another aspect of the invention is directed to a packaging cell for the production of a fiberless or fiber-modified gutless adenovirus particle comprising an adenovirus vector complementing plasmid and a nucleotide sequence encoding a recombinase, wherein said complementing plasmid comprises the nucleic acid molecule of claim 2 operably linked to a promoter and to a nucleotide sequence encoding an adenoviral fiber protein or a chimeric adenoviral fiber protein. Preferably the cell line may comprise a recombinase. In an embodiment of the invention the recombinase may be Cre.
[0043]In another embodiment of the invention, the fiber-deleted adenovirus vectors of the invention and the fiber-complementing adenovirus packaging cells of the invention are used to produce a gutless adenovirus vector particle. Such particle comprises a gutless adenoviral vector genome in an adenoviral capsid. The fiber proteins of the capsid may be wild-type fiber, or the modified fiber proteins disclosed herein. Alternatively, such particle may have a fiberless capsid as disclosed herein. Preferably, the gutless genome contains at least one heterologous gene as described herein. As used herein, the term "gutless adenoviral vector genome" means an adenoviral vector genome from which all of the viral genes have been deleted.
[0044]The invention also discloses systems or kits for use in any of the aforementioned methods. The systems or kits may contain any appropriate combination of the within-described vectors, plasmids, cell lines, virus particles and additional therapeutic agents as disclosed. Preferably, each such kit or system includes a quantity of the appropriate therapeutic substance or sequence sufficient for at least one administration, and instructions for administration and use. Thus, one system further comprises an effective amount of a therapeutic agent which enhances the therapeutic effect of the therapeutic viral vector-containing composition. Another variation discloses that the composition and the therapeutic agent are each included in a separate receptacle or container.
[0045]It will also be appreciated that any combination of the preceding elements may also be efficacious as described herein, and that all related methods are also within the scope of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]FIG. 1 is a schematic diagram of the entire adenoviral E4 transcriptional unit with the open reading frames (ORF) indicated by blocked segments along with the promoter and terminator sequences. The location of primers for amplifying specific portions of E4 are also indicated as further described in Example 1A.
[0047]FIG. 2 is a schematic map of plasmid pE4/Hygro as further described in Example 1B.
[0048]FIG. 3 is a schematic map of plasmid pcDNA3/Fiber as further described in Example 1B.
[0049]FIG. 4 is a schematic map of plasmid pCLF as further described in Example 1B.
[0050]FIG. 5 is a photograph of a Southern blot showing the presence of intact adenovirus E4 3.1 kilobase (kb) insert in the 211 cell line as further described in Example 1C.
[0051]FIG. 6 is an autoradiograph showing labeled fiber protein immunoprecipitated from cells and electrophoresed under native and denaturing electrophoresis conditions as described in Example 1C. The 293 cells lack fiber while the sublines 211A, 211B and 211R contain fiber protein detectable in functional trimerized form and denatured monomeric form.
[0052]FIG. 7 is a schematic map of plasmid pDEX/E1 as further described in Example 1D.
[0053]FIG. 8 is a schematic map of plasmid pE1/Fiber as further described in Example 1F1.
[0054]FIG. 9 is a schematic map of plasmid pE4/Fiber as further described in Example 1F2).
[0055]FIG. 10 is a schematic illustration of linearized pD EIBb gal delivery plasmids for use in cotransfection and recombination to form a recombinant adenoviral vector having multiple adenoviral gene deletions. The plasmids and recombination event are more fully described in Example 2A.
[0056]FIG. 11 is a schematic of plasmid p11.3 as further described in Example 2A used in the construction of pDV44 delivery plasmid.
[0057]FIG. 12 is a schematic of plasmid 8.2.
[0058]FIG. 13 shows the trimeric structure of the recombinant fiber. 293, 211A, 211B, or 211R cells as indicated were metabolically labeled with [35S]methionine, soluble protein extracts prepared, and fiber was immunoprecipitated. A portion of the precipitated protein was electrophoresed on an 8% SDS-PAGE gel under either semi-native or denaturing conditions. The positions of trimeric (T) and monomeric (M) fiber are indicated. As a control for electrophoretic conditions, recombinant Ad2 fiber produced in baculovirus-infected cells was run under identical conditions and stained with Coomassie blue.
[0059]FIG. 14 shows the complementation of a fiber mutant adenovirus by fiber-producing cells. The cell lines indicated (2×106 cells per sample) were infected with the temperature-sensitive fiber mutant adenovirus H5ts142 at 10 PFU/cell and incubated at either the permissive (32.5° C., stippled bars) or the restrictive (39.5° C., solid bars) temperature. 48 hours post-infection, virus was isolated by freeze-thaw lysis and yields determined by fluorescent focus assay on SW480 cells. Each value represents the mean of duplicate samples, and the data shown is representative of multiple experiments.
[0060]FIG. 15 shows the incorporation of the recombinant Ad5 fiber into Ad3 particles. In FIG. 15A, the alignment of the N-terminal (penton base-binding) domains of fiber proteins from several different adenovirus serotypes is shown. From top to bottom, the five different serotypes are listed as SEQ ID NOs 21-25. In FIG. 15B, type 3 adenovirus was propagated in 293, 211B, or 211R cells as indicated and purified by two sequential CsCl centrifugations. 10 μg of the purified viral particles was then electrophoresed under denaturing conditions and transferred to a PVDF membrane. Ad5 fiber was detected with a polyclonal rabbit antibody raised against recombinant Ad2 fiber. As a positive control for detection, 400 ng of wild-type Ad2 was run in the lane marked "Ad2". Under these conditions, the mobilities of the Ad2 and Ad5 fibers are indistinguishable and the antibody reacts with both proteins.
[0061]FIG. 16 shows the fiber deletion in pDV44 and the genomic structures of the Ad5.βgal.ΔF and Ad5.βgal.wt vectors: FIG. 16A shows pDV44 that was constructed by removing the fiber gene and residual E3 sequences (nt 30819:32743 of AD5) from pBHG10. FIG. 16B shows viruses constructed by cotransfection of either pBHG10 or pDV44 with pΔE1Bβgal. Both are E1/E3 deleted Ad5 vectors, and Ad5.βgal.ΔF has the additional fiber (L5) deletion as in pDV44.
[0062]FIG. 17 shows the analysis of the viral chromosomes. FIG. 17A shows the predicted EcoRI restriction maps of Ad5.βgal.wt and Ad5.βgal.ΔF. The 5.9 kb fragment at the right end of the Ad5.βgal.wt genome is reduced to 4.0 kb by the deletion of fiber sequences in Ad5.βgal.ΔF. FIG. 17B shows an ethidium bromide-stained gel of EcoRI-digested viral DNA. FIG. 17C shows a Southern blot of the gel as described in Example 2 probed either with labeled fiber or E4 sequences.
[0063]FIG. 18 shows the analysis of vertex proteins in the viral particles. 293 (non-fiber expressing) or 211B (fiber-expressing) cells were infected with Ad5.βgal.wt (`wt`) or with Ad5.βgal.ΔF (`ΔF`) and the resulting viral particles were purified on CsCl gradients. 10 μg of purified virions was then electrophoresed on 5-16% gradient gels and Western blotted. Proteins were detected with polyclonal anti-fiber or anti-penton base antibodies.
[0064]FIG. 19 shows the infectivity of Ad particles on THP-1 monocytic cells.
[0065]FIG. 19A shows THP-1 cells that were infected with Ad5.βgal.wt or with fiberless Ad5.βgal.ΔF at 100,000 particles/cell. Forty-eight hours after infection, cells were fixed and stained with X-gal and the fraction of infected cells was determined by light microscopy. FIG. 19B shows cells that were infected with 1000 particles per cell of Ad5.βgal.wt or with 100,000 particles/cell of Ad5.βgal.ΔF. As indicated, cells were pretreated with 100 μg/ml of recombinant penton base or with 20 μg/ml of recombinant Ad2 fiber.
[0066]FIG. 20 shows a schematic of improved fiber-complementing cell lines, 633 and 644 as further described in the Examples.
[0067]FIGS. 21 and 22 illustrates pseudotyping of fiberless particles with fiber proteins and infectivity data as further described in the Examples.
[0068]FIG. 23 shows the ClaI to BglII fragment of Ad5.
[0069]FIG. 24 shows the plasmid pGRE5-2/EBV.
[0070]FIG. 25 shows the plasmid pGRE5-E1.
[0071]FIG. 26 shows the plasmid pSE280-E2 BamHI-SmaI.
[0072]FIG. 27. The fiber-deleted adenovirus vector Ad5.βgal.ΔF was grown in cells expressing either no fiber (293; `Ad5.βgal.ΔF/0`), the Ad5 fiber (633; `Ad5.βgal.ΔF/5F`), or the Ad37 fiber with modifications as described in the text (705; `Ad5.βgal.ΔF/37F`) and CsCl-purified. 10 μg of the purified particles were electrophoresed and transferred to a nylon membrane. As controls, 10 μg of wild-type Ad37 or the fiber gene-containing vector Ad5.βgal.wt or a sample of purified recombinant Ad37 fiber knob were also run. The blot was probed with polyclonal antisera against recombinant Ad37 fiber or Ad2 fiber proteins. As a loading control, the same filter was reprobed with an antibody against the Ad2 penton base (the anti-Ad2 sera cross-recognized the very similar Ad5 fiber and Ad5 penton base proteins).
[0073]FIG. 28 shows PCR analysis for fiber presence.
[0074]FIG. 29 shows the transduction efficiency for fiberless virus with and without soluble fiber.
[0075]FIG. 30 shows the transduction efficiency of AD5BgF.sup.- on HDF cell line with the presence of different amounts of 633 conditioned media.
DETAILED DESCRIPTION OF THE INVENTION
[0076]To reduce the frequency of contamination with wild-type adenovirus, it is considered desirable to improve either the viral vector or the cell line to reduce the probability of recombination. For example, an adenovirus from a group with less homology to the group C viruses may be used to engineer recombinant viruses with little propensity for recombination with the Ad5 sequence in 293 cells. Similarly, an epithelial cell line--e.g. the cell line known as 293--may be used or further modified according to within-disclosed methods which stably expresses adenovirus proteins or polypeptides from Ad3 and/or proteins or polypeptides from another non-group-C or group C serotype; such a cell line would be useful to support adenovirus-derived viral vectors bearing deletions of regulatory and/or structural genes, irrespective of the serotype from which such a vector was derived.
[0077]It is also contemplated that the constructs and methods of the present invention will support the design and engineering of chimeric viral vectors which express amino acid residue sequences derived from two or more Ad serotypes. Thus, unlike methods and constructs available prior to the advent of the present disclosure, this invention allows the greatest possible flexibility in the design and preparation of useful viral vectors and cell lines which support their construction and propagation--all with a decreased risk of recompiling with wild-type Ad to produce potentially-harmful recombinants.
[0078]In part, the present invention discloses a simpler, alternative means of reducing the recombination between viral and cellular sequences than those discussed in the art. One such means is to increase the size of the deletion in the recombinant virus and thereby reduce the extent of shared sequences between that virus and any Ad genes present in a packaging cell line--e.g., the Ad5 genes in 293 cells, or the various Ad genes in the novel cell lines of the present invention.
[0079]Therefore, the present invention makes it feasible to engineer and produce novel viral vectors that are able to package and deliver significantly larger foreign nucleic acid sequences for efficacious use in a variety of therapeutic applications, without endangering the subject to whom they are administered, due to their impaired ability to self-replicate in non-complementing cell lines. Due to the fact that "helper" viruses or plasmids need not be used in conjunction with many of the viral vectors of the present invention, those vectors of the present invention are also simpler to use than those previously described in the art.
I. DEFINITIONS
[0080]In order to provide a clearer understanding of the specification and claims, the following definitions are provided.
[0081]Adenoviral Vector or Ad-Derived Vector: Any adenovirus-derived plasmid, genome or virus into which a foreign DNA may be inserted or expressed. This term may also be used interchangeably with "viral vector." This "type" of vector may be utilized to carry nucleotide sequences encoding therapeutic proteins or polypeptides to specific cells or cell types in a subject in need of treatment, as described further herein below.
[0082]Amino Acid Residue: An amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages. The amino acid residues described herein are preferably in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L-amino acid residue, as long as the desired functional property is retained by the polypeptide. NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxyl terminus of a polypeptide. In keeping with standard polypeptide nomenclature described in J. Biol. Chem., 243:3552-59 (1969) and adopted at 37 C.F.R. §§ 1.821-1.822, abbreviations for amino acid residues are shown in the following Table of Correspondence:
Table of Correspondence
TABLE-US-00001 [0083] TABLE 1 SYMBOL 1-Letter 3-Letter AMINO ACID Y Tyr tyrosine G Gly glycine F Phe phenylalanine M Met methionine A Ala alanine S Ser serine I He isoleucine L Leu leucine T Thr threonine V Val valine P Pro proline K Lys lysine H His histidine Q Gin glutamine E Glu glutamic acid Z Glx Glu and/or Gin W Trp tryptophan R Arg arginine D Asp aspartic acid N Asn asparagine B Asx Asn and/or Asp C Cys cysteine X Xaa Unknown or other
[0084]It should be noted that all amino acid residue sequences represented herein by formulae have a left to right orientation in the conventional direction of amino-terminus to carboxyl-terminus. In addition, the phrase "amino acid residue" is broadly defined to include the amino acids listed in the Table of Correspondence and modified and unusual amino acids, such as those referred to in 37 C.F.R. §§ 1.821-1.822, and incorporated herein by reference. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues or to an amino-terminal group such as NH2 or to a carboxyl-terminal group such as COOH.
[0085]Complementing Plasmid: This term is generally used herein to describe plasmid vectors used to deliver particular nucleotide sequences into a packaging cell line, with the intent of having said sequences stably integrate into the cellular genome.
[0086]Delivery Plasmid: This term is generally used herein to describe a plasmid vector that carries or delivers nucleotide sequences in or into a cell line (e.g., a packaging cell line) for the purpose of propagating therapeutic viral vectors of the present invention.
[0087]DNA Homolog: A nucleic acid having a preselected conserved nucleotide sequence and a sequence encoding a preferred polypeptide according to the present invention, where the nucleic acid is substantial homologous to a named preferred embodiment. By the term "substantially homologous" is meant having at least 80%, preferably at least 90%, most preferably at least 95% homology therewith.
[0088]The terms "homology" and "identity" are often used interchangeably. In this regard, percent homology or identity may be determined, for example, by comparing sequence information using a GAP computer program. The GAP program utilizes the alignment method of Needleman and Wunsch (J. Mol. Biol. 48:443 (1970), as revised by Smith and Waterman (Adv. Appl. Math. 2:482 (1981). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) which are similar, divided by the total number of symbols in the shorter of the two sequences. The preferred default parameters for the GAP program may include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov and Burgess, Nucl. Acids Res. 14:6745 (1986), as described by Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358 (1979); (2) A penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
[0089]Whether any two nucleic acid molecules have nucleotide sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical" can be determined using known computer algorithms such as the "FAST A" program, using for example, the default parameters as in Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988). Alternatively the BLAST function of the National Center for Biotechnology Information database may be used to determine identity
[0090]In general, sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated in using published techniques. (See, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer; Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988)). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988). Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1):387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F., et al., J Molec Biol 215:403 (1990)).
[0091]Therefore, as used herein, the term "identity" represents a comparison between a test and a reference polypeptide or polynucleotide. For example, a test polypeptide may be defined as any polypeptide that is 90% or more identical to a reference polypeptide. As used herein, the term at least "90% identical to" refers to percent identities from 90 to 99.99 relative to the reference polypeptides. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide length of 100 amino acids are compared. No more than 10% (i.e., 10 out of 100) amino acids in the test polypeptide differs from that of the reference polypeptides. Similar comparisons may be made between a test and reference polynucleotides. Such differences may be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they may be clustered in one or more locations of varying length up to the maximum allowable, e.g. 10/100 amino acid difference (approximately 90% identity). Differences are defined as nucleic acid or amino acid substitutions, or deletions.
[0092]An embodiment of the invention may use polynucleotides at least 90% or 95% identical to those encoding the TPL nucleic acid sequences. A further embodiment of the invention may include those polynucleotides that encode a polypeptide of interest that are at least 95% identical when the variation in such a polynucleotide is due to more than merely degenerate changes.
[0093]Expression or Delivery Vector: Any plasmid or virus into which a foreign DNA may be inserted for expression in a suitable host cell--i.e., the protein or polypeptide encoded by the DNA is synthesized in the host cell's system. Vectors capable of directing the expression of DNA segments (genes) encoding one or more proteins are referred to herein as "expression vectors." Also included are vectors which allow cloning of cDNA (complementary DNA) from mRNAs produced using reverse transcriptase.
[0094]Foreign Gene: This term is used to identify a DNA molecule not present in the exact orientation and position as the counterpart DNA molecule found in wild-type adenovirus. It may also refer to a DNA molecule from another organism or species (i.e., exogenous) or from another Ad serotype.
[0095]Gene: A nucleic acid whose nucleotide sequence encodes an RNA or polypeptide. A gene can be either RNA or DNA. Genes may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
[0096]Isolated: This term is used to indicate a nucleic acid or polypeptide sequence separated from the genetic environment from which the sequences were obtained. It may also mean altered from the natural state. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein. Thus, a polypeptide or polynucleotide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention. Also intended as an "isolated polypeptide" or an "isolated polynucleotide" are polypeptides or polynucleotides that have been purified, partially or substantially, from a recombinant host cell or from a native source. For example, a recombinantly produced version of a compounds can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988). The terms isolated and purified are sometimes used interchangeably.
[0097]By "isolated" is meant that the DNA is free of the coding sequences of those genes that, in the naturally-occurring genome of the organism (if any) from which the DNA of the invention is derived, immediately flank the gene encoding the DNA of the invention. The isolated DNA may be single-stranded or double-stranded, and may be genomic DNA, cDNA, recombinant hybrid DNA, or synthetic DNA. It may be identical to a native DNA sequence, or may differ from such sequence by the deletion, addition, or substitution of one or more nucleotides.
[0098]Isolated or purified as it refers to preparations made from biological cells or hosts should be understood to mean any cell extract containing the indicated DNA or protein including a crude extract of the DNA or protein of interest. For example, in the case of a protein, a purified preparation can be obtained following an individual technique or a series of preparative or biochemical techniques and the DNA or protein of interest can be present at various degrees of purity in these preparations. The procedures may include for example, but are not limited to, ammonium sulfate fractionation, gel filtration, ion exchange change chromatography, affinity chromatography, density gradient centrifugation and electrophoresis.
[0099]A preparation of DNA or protein that is "pure" or "isolated" should be understood to mean a preparation free from naturally occurring materials with which such DNA or protein is normally associated in nature. "Essentially pure" should be understood to mean a "highly" purified preparation that contains at least 95% of the DNA or protein of interest.
[0100]A cell extract that contains the DNA or protein of interest should be understood to mean a homogenate preparation or cell-free preparation obtained from cells that express the protein or contain the DNA of interest. The term "cell extract" is intended to include culture media, especially spent culture media from which the cells have been removed.
[0101]Packaging Cell line: A packaging cell line is a cell line that provides a missing gene product or its equivalent.
[0102]Particle: The adenovirus (Ad) particle is relatively complex and may be resolved into various substructures. The particle is the minimal structural or functional unit of a virus. A virus can refer to a single particle, a stock of particles or a viral genome.
[0103]Penton: The terms "penton" or "penton complex" are preferentially used herein to designate a complex of penton base and fiber. The term "penton" may also be used to indicate penton base, as well as penton complex. The meaning of the term "penton" alone should be clear from the context within which it is used.
[0104]Plasmid: An autonomous self-replicating extrachromosomal circular DNA.
[0105]Post-transcription Regulatory Element (PRE) is a regulatory element found in viral or cellular messenger RNA that is not spliced, i.e. intronless messages. Examples include, but are not limited to, human hepatitis virus, woodchuck hepatitis virus, the TK gene and mouse histone gene. The PRE may be placed before a polyA sequence and after a heterologous DNA sequence.
[0106]Pseudotyping: This term as generally used herein describes the production of adenoviral vectors having modified capsid protein or capsid proteins from a different serotype than the serotype of the vector itself. One example, is the production of an adenovirus 5 vector particle containing a chimeric Ad3/Ad5 fiber protein. This may be accomplished by producing the adenoviral vector in packaging cell lines expressing different fiber proteins.
[0107]Promoter: Useful promoters according to the present invention may be inducible or constitutive. Inducible promoters will initiate transcription only in the presence of an additional molecule; constitutive promoters, on the other hand, do not require the presence of any additional molecule to regulate gene expression. A regulatable or inducible promoter may also be described as a promoter wherein the rate of RNA polymerase binding and initiation is modulated by external stimuli. Such stimuli include various compounds or compositions, light, heat, stress, chemical energy sources, and the like. Inducible, suppressible and repressible promoters are considered regulatable promoters.
[0108]Receptor: Receptor is a term used herein to indicate a biologically active molecule that specifically binds to (or with) other molecules. The term "receptor protein" may be used to more specifically indicate the proteinaceous nature of a specific receptor.
[0109]Recombinant: As used herein, the term is intended to refer to any progeny formed as the result of genetic engineering. This may also be used to describe a virus formed by recombination of plasmids in a packaging cell.
[0110]Transgene or Therapeutic Nucleotide Sequence: As described and claimed herein, such a sequence includes DNA and RNA sequences encoding an RNA or polypeptide. Such sequences may be "native" or naturally-derived sequences; they may also be "non-native" or "foreign" sequences which are naturally- or recombinantly-derived. The term "transgene," which may be used interchangeably herein with the term "therapeutic nucleotide sequence," is often used to describe a heterologous or foreign (exogenous) gene that is carried by a viral vector and transduced into a host cell.
[0111]Therefore, therapeutic nucleotide sequences may also include antisense sequences or nucleotide sequences which may be transcribed into antisense sequences. Therapeutic nucleotide sequences (or transgenes) further comprise sequences which function to produce a desired effect in the cell or cell nucleus into which said therapeutic sequences are delivered. For example, a therapeutic nucleotide sequence may encode a functional protein intended for delivery into a cell which is unable to produce that functional protein.
II. ADENOVIRUS
[0112]Fiber plays a crucial role in adenovirus infection by attaching the virus to a specific receptor on the cell surface. The fiber is an elongated protein which exists as a trimer of three identical polypeptides (polypeptide IV) of 582 amino acids in length. An adenovirus fiber consists of three domains: an N-terminal tail domain that interacts with penton base; a shaft composed of variable numbers of repeats of a 15-amino-acid segment that forms beta-sheet and beta-bends; and a knob at the C-terminus ("head domain") that contains the type-specific antigen and is responsible for binding to the cell surface receptor. The gene encoding the fiber protein from Ad2 has been expressed in human cells and has been shown to be correctly assembled into trimers, glycosylated and transported to the nucleus. (See, e.g., Hong and Engler, Virology 185: 758-761, 1991). Thus, alteration of the fiber in recombinant Ad vectors can lead to alteration in gene delivery. This has great utility for a variety of gene therapy applications and is one of the objects of the present invention.
[0113]Hexon, penton and fiber capsomeres are the major components on the surface of the virion. Their constituent polypeptides, nos. II, III and IV, contain tyrosine residues that are exposed on the surface of the virion and can be labeled--e.g., by iodination of intact particles.
[0114]The 35,000+ base pair (bp) genome of adenovirus type 2 has been sequenced and the predicted amino acid sequences of the major coat proteins (hexon, fiber and penton base) have been described. (See, e.g., Neumann et al., Gene 69: 153-157 (1988); Herisse et al., Nuc. Acids Res. 9: 4023-4041 (1981); Roberts et al., J. Biol. Chem. 259: 13968-13975 (1984); Kinloch et al., J. Biol. Chem. 259: 6431-6436 (1984); and Chroboczek et al., Virol. 161: 549-554, 1987).
[0115]The sequence of Ad5 DNA was completed more recently; its sequence includes a total of 35,935 bp. Portions of many other adenovirus genomes have also been sequenced. It is presently understood that the upper packaging limit for adenovirus virions is about 105% of the wild-type genome length. (See, e.g., Bett, et al., J. Virol. 67(10): 5911-21, 1993). Thus, for Ad2 and Ad5, this would be an upper packaging limit of about 38 kb of DNA.
[0116]Adenovirus DNA also includes inverted terminal repeat sequences (ITRs) ranging in size from about 100 to 150 bp, depending on the serotype. The inverted repeats enable single strands of viral DNA to circularize by base-pairing of their terminal sequences, and the resulting base-paired "panhandle" structures required for replication of the viral DNA.
[0117]For efficient packaging, the ITRs and the packaging signal (a few hundred bp in length) comprise the "minimum requirement" for replication and packaging of a genomic nucleic acid into an adenovirus particle. Helper-dependent vectors lacking all viral ORFs but including these essential cis elements (the ITRs and contiguous packaging sequence) have been constructed, but the virions package less efficiently that the helper and package as multimers part of the time, which suggests that the virus may "want" to package a filler DNA complement (see, e.g., Fisher, et al., Virology 217: 11-22, 1996).
[0118]The viral vectors of the present invention may retain their ability to express the genome packaged within--i.e., they may retain their "infectivity"--they do not act as infectious agents, however, to the extent that they cause disease in the subjects to whom they are administered for therapeutic purposes.
[0119]It is to be appreciated that Ad vectors have several distinct advantages over other viral vectors in the art. For example, recombination of such vectors is rare; there are no known associations of human malignancies with adenoviral infections despite common human infection with adenoviruses; the genome may be manipulated to accommodate foreign genes of a fairly substantial size; and host proliferation is not required for expression of adenoviral proteins.
[0120]An extension of this invention is that the Ad-derived viral vectors disclosed herein may be used to target and deliver genes into specific cells by incorporating the attachment sequence for other receptors (such as CD4) onto the fiber protein by recombinant DNA techniques, thus producing a chimeric molecule. This should result in the ability to target and deliver genes into a wide range of cell types with the advantage of evading recognition by the host's immune system. The within-disclosed delivery systems thus provide for increased flexibility in gene design to enable gene delivery into proliferating and nonproliferating cell types.
[0121]For example, U.S. Pat. Nos. 5,756,086, and 5,543,328 as well as WO95/26412 and WO 98/44121 and Krasnykh, et al. (J. Virol. 70: 6839-46, 1996), the disclosures of which are incorporated by reference herein, describe modifications that may be made to the adenovirus fiber protein. Such modifications are useful in altering the targeting mechanism and specificity of adenovirus and could readily be utilized in conjunction with the constructs of the present invention to target the novel viral vectors disclosed herein to different receptors and different cells. Moreover, modifications to fiber protein which alter its tropism may permit greater control over the localization of viral vectors in therapeutic applications.
[0122]Similarly, incorporation of various structural proteins into cell lines of the present invention, whether or not those proteins are modified, is also contemplated by the present invention. Thus, for example, modified penton base polypeptides such as those described in Wickham, et al. (J. Virol. 70: 6831-8, 1996) may have therapeutic utility when used according to the within-disclosed methods.
[0123]While some of the Examples appearing below specifically recite fiber proteins, polypeptides, and fragments thereof, it is expressly provided herein that other structural and non-structural Ad proteins and polypeptides (e.g., regulatory proteins and polypeptides) may be used as components of the various disclosed vectors and cell lines. Moreover, chimeric molecules comprised of proteins, polypeptides, and/or fragments thereof which are derived from different Ad serotypes may be used in any of the within-disclosed methods, constructs and compositions. Similarly, recombinant DNA sequences of the present invention may be prepared using nucleic acid sequences derived from different Ad serotypes, in order to design useful constructs with broad applicability, as disclosed and claimed herein.
[0124]It should also be appreciated that, while the members of Group C or Group D adenovirus--i.e., Ad serotypes 1, 2, 5, 6 or 37--are specifically recited in various examples herein, the present invention is in no way limited to those serotypes alone. In view of the fact that the adenovirus serotypes are all closely-related in structure and functionality, therapeutic viral vectors, packaging cell lines, and plasmids of the present invention may be constructed from components of any and all Ad serotypes--and the within-disclosed methods of making and using the various constructs and cell lines of the present invention apply to all of said serotypes.
[0125]The family of Adenoviridae includes many members with at least 47 known serotypes of human adenovirus (Ad1-Ad47) (Shenk, Virology, Chapter 67, in Fields et al., eds. Lippincott-Raven, Philadelphia, 1996,) as well as members of the genus Mastadenovirus including human, simian, bovine, equine, porcine, ovine, canine and opossum viruses, and members of the Aviadenovirus genus, including bird viruses, e.g. CELO. Thus it is contemplated that the disclosed inventions can be applied to any adenovirus species, and the invention need not be so limited. One of skill in the art would have knowledge of the different adenoviruses as evidenced by (Shenk, Virology, Chapter 67, in Fields et al., eds. Lippincott-Raven, Philadelphia, 1996,) which is herein incorporated by reference.
III. PACKAGING CELL LINES
[0126]A. Adenovirus Complentation Genetics
[0127]The first generation of recombinant adenoviral vectors currently available typically have a deletion in the first viral early gene region which is generally referred to as E1, which comprises the E1a and E1b regions. (These regions span genetic map units 1.30 to 9.24.) FIG. 3 in chapter 67 of Fields Virology, 3d Ed. (Fields et al. eds, Lippincott-Raven Publ., Philadelphia, 1996, p. 2116) illustrates a transcription and translation map of adenovirus type 2 (Ad2).
[0128]Deletion of the viral E1 region renders the recombinant adenovirus defective for replication and incapable of producing infectious viral particles in subsequently-infected target cells. Thus, to generate E1-deleted adenovirus genome replication and to produce virus particles requires a system of complementation which provides the missing E1 gene product. E1 complementation is typically provided by a cell line expressing E1, such as the human embryonic kidney packaging cell line, i.e. an epithelial cell line, called 293. Cell line 293 contains the E1 region of adenovirus, which provides E1 gene region products to "support" the growth of E1-deleted virus in the cell line (see, e.g., Graham et al., J. Gen. Virol. 36: 59-71, 1977). Additionally, cell lines that may be usable for production of defective adenovirus having a portion of the adenovirus E4 region have been reported (WO 96/22378). Multiply deficient adenoviral vectors and complementing cell lines have also been described (WO 95/34671, U.S. Pat. No. 5,994,106). Nevertheless, inherent problems exist concerning first-generation recombinant adenoviruses.
[0129]B. Adenovirus Particle Packaging Cell Lines
[0130]Packaging cell lines disclosed herein support viral vectors with deletions of major portions of the viral genome, without the need for helper viruses. Additionally, the invention provides novel cell lines and helper viruses for use with helper-dependent vectors.
[0131]Thus, in one embodiment of the present invention, a packaging cell line is disclosed having DNA sequences stably integrated into the cellular genome wherein the DNA sequences encode one or more adenovirus regulatory and/or structural polypeptides which complement the genes deleted or mutated in the adenovirus vector genome to be replicated and packaged.
[0132]In another embodiment, the packaging cell line expresses one or more adenovirus structural proteins, polypeptides, or fragments thereof, wherein said structural protein is selected from the group consisting of penton base, hexon, fiber, polypeptide IIIa, polypeptide V, polypeptide VI, polypeptide VII, polypeptide VIII, and biologically active fragments thereof.
[0133]In one variation, the sequences are constitutively expressed; in another, one or more sequences is under the control of a regulatable promoter. In a preferred embodiment expression is constitutive. In various preferred embodiments, the polypeptides expressed by the DNA sequences are biologically active.
[0134]In a further and preferred embodiment the packaging cell line of the present invention supports the production of a viral vector. In a preferred embodiment the viral vector is a therapeutic vector.
[0135]The present invention also discloses a packaging cell line which complements a viral vector having a deletion or mutation of a DNA sequence encoding an adenovirus structural protein, regulatory polypeptides E1A and E1B, and/or one or more of the following regulatory proteins or polypeptides: E2A, E2B, E3, E4, L4, or fragments thereof.
[0136]Various useful packaging cells are contemplated which complement adenovirus. In one aspect of the present invention, each DNA sequence is introduced into the genome of the within-disclosed cell lines via a separate complementing plasmid. In other embodiments, two or more DNA sequences were introduced into the genome via a single complementing plasmid. In one variation, the complementing plasmid comprises a DNA sequence encoding adenovirus fiber protein, polypeptide or fragment thereof. An example of a useful complementing plasmid according to the present invention is a plasmid having the characteristics of pCLF (for deposit details, see Example 3)
[0137]One embodiment discloses a packaging cell useful in the preparation of recombinant adenovirus viral vectors comprising a delivery plasmid comprising an adenovirus genome lacking a nucleotide sequence encoding fiber. In one variation, the delivery plasmid further comprises a nucleotide sequence encoding a foreign polypeptide. A preferred delivery plasmid is pDV44, p E1B gal, or pE1sp1B. In another variation, the cell further comprises a complementing plasmid containing a nucleotide sequence encoding fiber, the plasmid being stably integrated into the cellular genome of the cell.
[0138]In one embodiment, a composition comprises a cell containing first and second delivery plasmids wherein a first delivery plasmid comprises an adenovirus genome lacking a nucleotide sequence encoding fiber and incapable of directing the packaging of new viral particles in the absence of a second delivery plasmid, and a second delivery plasmid comprises an adenoviral genome capable of directing the packaging of new viral particles in the presence of the first delivery plasmid.
[0139]In another variation, the first and second delivery plasmids interact within the cell to produce a therapeutic viral vector. In yet another variation, the cell further comprises a complementing plasmid containing a nucleotide sequence encoding fiber, the plasmid being stably integrated into the cellular genome of the cell. In still another, the first or second delivery plasmid further comprises a nucleotide sequence encoding a foreign polypeptide. In various embodiments, the polypeptide is a therapeutic molecule.
[0140]Another embodiment discloses a composition as before, wherein the first delivery plasmid lacks adenovirus packaging signal sequences. In another aspect, the second delivery plasmid contains a LacZ reporter construct. In another variation, the second delivery plasmid further lacks a nucleotide sequence encoding an adenovirus regulatory protein. In one variation, the regulatory protein is E1. In one embodiment of the above-noted compositions, the complementing plasmid has the characteristics of pCLF.
[0141]In another embodiment, a composition is disclosed wherein the first delivery plasmid lacks a nucleotide sequence encoding an adenovirus structural protein and the second delivery plasmid lacks a nucleotide sequence encoding adenovirus E1 protein. In another, the first delivery plasmid lacks a nucleotide sequence encoding adenovirus E4 protein and the second delivery plasmid lacks a nucleotide sequence encoding adenovirus E1 protein. In still another, the cell contains at least one complementing plasmid encoding an adenoviral regulatory protein and a structural protein.
[0142]In one preferred variation of the present invention, a packaging cell line expresses fiber protein. In one embodiment, the fiber protein has been modified to include a non-native amino acid residue sequence which targets a specific receptor, but which does not disrupt trimer formation or transport of fiber into the nucleus. In another variation, the non-native amino acid residue sequence alters the binding specificity of the fiber for a targeted cell type. In still another embodiment, the structural protein is fiber comprising amino acid residue sequences from more than one adenovirus serotype. As disclosed herein, the nucleotide sequences encoding fiber protein or polypeptide need not be modified solely at one or both termini; fiber protein--and indeed, any of the adenovirus structural proteins, as taught herein--may be modified "internally" as well as at the termini.
[0143]In one variation, the non-native amino acid residue sequence is coupled to the carboxyl terminus of the fiber. In yet another, the non-native amino acid residue sequence further includes a linker sequence. Alternatively, the fiber protein further comprises a ligand coupled to the linker. A suitable ligand may be selected from the group consisting of ligands that specifically bind to a cell surface receptor and ligands that can be used to couple other proteins or nucleic acid molecules. Typically, any of the packaging cell lines of this invention may have a DNA sequence encoding all or part of a fiber protein--including modified or chimeric proteins--stably integrated into the genome.
[0144]In various aspects of the present invention, a packaging cell line of the present invention is derived from a procaryotic cell line; in another, it is derived from a eucaryotic cell line. While various embodiments suggest the use of mammalian cells, and more particularly, epithelial cell lines, a variety of other, non-epithelial cell lines are used in various embodiments. Thus, while various embodiments disclose the use of a cell line selected from the group consisting of 293, A549, W162, HeLa, Vero, 211, and 211A cell lines, it is understood that various other cell lines are likewise contemplated for use as disclosed herein.
IV. THERAPEUTIC VIRAL VECTORS AND RELATED SYSTEMS
[0145]A. Nucleic Acid Segments
[0146]A therapeutic viral vector or composition of the present invention comprises a nucleotide sequence, nucleic acid molecule or segment as described herein. Typically, the nucleic acid molecule or molecule encodes a protein or polypeptide molecule--or a biologically active fragment thereof--which may be used for therapeutic applications. A nucleotide sequence may further comprise an enhancer element or a promoter located 3' or 5' to and controlling the expression of such a therapeutic nucleotide sequence or gene.
[0147]A subject nucleotide sequence consists of a nucleic acid molecule that comprises at least 2 different operatively linked DNA segments. The DNA can be manipulated and amplified by PCR as described herein and by using standard techniques, such as those described in Molecular Cloning: A Laboratory Manual, 2nd Ed., Sambrook et al., eds., Cold Spring Harbor, N.Y. (1989). Typically, to produce a nucleotide sequence of the present invention, the sequence encoding the selected polypeptide and the promoter or enhancer are operatively linked to a DNA molecule capable of autonomous replication in a cell either in vivo or in vitro. By operatively linking the enhancer element or promoter and the nucleotide sequence to the vector, the attached segments are replicated along with the vector sequences.
[0148]Thus, a recombinant DNA molecule (rDNA) of the present invention is a hybrid DNA molecule comprising at least 2 nucleotide sequences not normally found together in nature. In various preferred embodiments, one of the sequences is a sequence encoding an Ad-derived polypeptide, protein, or fragment thereof. Stated another way, a nucleotide sequence of the present invention is one that encodes an expressible protein, polypeptide or fragment thereof, and it may further include an active constitutive or regulatable (e.g. inducible) promoter sequence.
[0149]A nucleotide sequence of the present invention is optimally from about 20 base pairs to about 40,000 base pairs in length. Preferably the nucleotide sequence is from about 50 bp to about 38,000 bp in length. In various embodiments, the nucleotide sequence is of sufficient length to encode one or more adenovirus proteins or functional polypeptide portions thereof. Since individual Ad polypeptides vary in length from about 19 amino acid residues to about 967 amino acid residues, corresponding nucleotide sequences will range from about 50 bp up to about 3000 bp, depending on the number and size of individual polypeptide-encoding sequences that are "replaced" in the viral vectors by therapeutic nucleotide sequences of the present invention.
[0150]1. Tripartite Leader (TPL) Nucleic Acid Sequences
[0151]In one aspect of the invention, it has been discovered that expression of adenovirus late proteins such as the structural proteins in a packaging cell line according to the present invention is substantially improved when the expression cassette present on the complementing plasmid or in the packaging cell line's genome contains an adenovirus tripartite leader (TPL) nucleic acid sequence.
[0152]Thus, the invention contemplates a nucleic acid molecule comprising a TPL nucleotide sequence. Preferably, the TPL nucleotide sequence may be operatively linked to an intron containing RNA processing signals (such as for example, splice donor or splice acceptor sites) suitable for expression in the packaging cell line. Most preferably the intron contains a splice donor site and a splice acceptor site. Alternatively, the TPL nucleotide sequence may not comprise an intron.
[0153]In one embodiment, a subject nucleic acid molecule of this invention is isolated, i.e., separated from the genetic environment from which the component sequences were obtained. Thus, molecular cloning of fragments of a gene will produce an isolated nucleic acid, as will the chemical synthesis of an oligonucleotide to build a nucleic acid molecule.
[0154]The intron useful in the present invention is any nucleotide sequence which functions in the packaging cell line to provide RNA processing signals, as are well known in the art, including splicing signals. Introns have been well characterized from a large number of structural genes, and therefor the invention should not be considered as limited. Well characterized and preferred introns include a native intron 1 from adenovirus, such as Ad5's TPL intron 1; others include the SV40 VP intron; the rabbit beta-globin intron, and synthetic intron constructs. See, for example, Petitclerc et al., J. Biothechnol., 40:169, 1995, and Choi et al., Mol. Cell. Biol., 11:3070, 1991.
[0155]The TPL nucleotide sequence comprises either (a) first and second TPL exons or (b) first, second and third TPL exons, where each TPL exon in the sequence is selected from the group consisting of complete TPL exon 1, partial TPL exon 1, complete TPL exon 2 and complete TPL exon 3. A complete exon is one which contains the complete nucleic acid sequence based on the sequence found in the wild type viral genome. Preferably the TPL exons are from Ad2, Ad3, Ad5, Ad7 and the like, however, they may come from any Ad serotype, as described herein. A preferred partial TPL exon 1 is described in the Examples. The use of a TPL with a partial exon 1 has been reported (WO98/13499).
[0156]The intron and the TPL exons can be operatively linked in a variety of configurations to provide a functional TPL nucleotide sequence, although in some embodiments of the invention, an intron may not be a part of the construct. For example, the intron can be positioned between any of TPL exons 1, 2 or 3, and the exons can be in any order of first and second, or first/second/third. The intron can also be placed preceding the first TPL exon or following the last TPL exon. In a preferred embodiment, complete TPL exon 1 is operatively linked to complete TPL exon 2 operatively linked to complete TPL exon 3. In a preferred variation, adenovirus TPL intron 1 is positioned between complete TPL exon 1 and complete TPL exon 2. It may also be possible to use analogous translational regulators from other viral systems such as rabiesvirus.
[0157]A preferred "complete" TPL nucleic acid molecule containing complete TPL exons 1, 2 and 3 with adenovirus intron 1 inserted between exons 1 and 2 has a nucleotide sequence shown in SEQ ID NO: 32. A preferred "partial" TPL nucleic acid molecule containing partial TPL exon 1 and complete TPL exons 2 and 3 in that order has a nucleotide sequence shown in SEQ ED NO: 26. The construction of these preferred TPL nucleotide sequences is described in the Examples.
[0158]Thus, preferred expression cassettes and complementing plasmids for expressing adenovirus structural genes, particularly fiber protein, contain an adenovirus TPL nucleotide sequence as described herein. Preferred packaging cell lines containing the subject nucleic acid molecules also contain a TPL nucleotide sequence of the invention.
[0159]2. Complementing Plasmids
[0160]The invention describes in a related embodiment nucleic acid molecules and nucleotide sequences, typically in the form of DNA plasmid vectors, which are capable of expression of an adenovirus structural protein or regulatory protein. Because these expression plasmids are used to complement the defective genes of a recombinant adenovirus vector genome of this invention, the plasmids are referred to as complementing or complementation plasmids.
[0161]The complementing plasmid contains an expression cassette, a nucleotide sequence capable of expressing a protein product off the gene encoded by the nucleotide sequence. Expression cassettes are described in more detail herein, but typically contain a promoter and a structural gene operatively linked to the promoter and whose expression is controlled by the promoter. A preferred complementing plasmid further includes a TPL nucleotide sequence described herein to enhance expression of the structural gene product when used in the context of adenovirus genome replication and packaging.
[0162]In one embodiment, a complementing plasmid comprises a promoter nucleotide sequence operatively linked to a nucleotide sequence encoding an adenovirus structural polypeptide. The adenovirus structural polypeptide is selected from the group consisting of penton base; hexon; fiber; polypeptide IIIa; polypeptide V; polypeptide VI; polypeptide VII; polypeptide VIII; and biologically active fragments thereof. In another variation, a complementing plasmid further comprises a nucleotide sequence encoding a first adenovirus regulatory polypeptide, a nucleotide sequence encoding a second regulatory polypeptide, a nucleotide sequence encoding a third regulatory polypeptide; or any combination of the foregoing.
[0163]The present invention also discloses a complementing plasmid comprising a promoter nucleotide sequence operatively linked to a nucleotide sequence encoding an adenovirus structural protein, polypeptide or fragment thereof and a nucleotide sequence encoding an adenovirus regulatory protein, polypeptide or fragment thereof. In one variation, the early region polypeptide is E4; in another, the plasmid comprises pE4/Hygro. In still another variation, the early region polypeptides are E1 and E4.
[0164]In another aspect of the present invention, the complementing plasmid used to transform a cell line of the present invention further comprises a DNA sequence encoding an adenovirus regulatory protein, polypeptide or fragment thereof. In one variation, the regulatory protein is selected from the group consisting of E1A, E1B, E2A, E2B, E3, E4 and L4 (also referred to as "the 100K protein"); an exemplary complementing plasmid has the characteristics of is pE4/Hygro (for deposit details, see the Examples). In another aspect, the complementing plasmid used to transform a cell line of the present invention further comprises a DNA sequence encoding two or more of the above mentioned adenovirus regulatory proteins, polypeptides or fragments thereof.
[0165]Preferred complementing plasmids include pCLF, pDV60, pDV61, pDV67, pDV69, pD V80, pDV90 and the like plasmids described in the Examples. The nucleic acid sequence of particularly preferred complementing plasmids are shown in SEQ ID NO: 43 for pDV60, SEQ ED NO: 44 for pDV67 and SEQ ED NO: 47 for pDV69, SEQ ID NO: 64 for pDV80 and SEQ ED NO: 65 for pDV90.
[0166]3. Nucleic Acid Molecule Synthesis
[0167]A nucleic acid molecule comprising synthetic oligonucleotide sequences of the present invention can be prepared using any suitable method, such as, the phosphotriester or phosphodiester methods. See Narang et al., Meth. Enzymol., 68:90, (1979); U.S. Pat. No. 4,356,270; and Brown et al., Meth. Enzymol., 68:109, (1979), the disclosures of which are incorporated by reference herein.
[0168]For oligonucleotide sequences in which a family of variants is preferred, the synthesis of the family members can be conducted simultaneously in a single reaction vessel, or can be synthesized independently and later admixed in preselected molar ratios. For simultaneous synthesis, the nucleotide residues that are conserved at preselected positions of the sequence of the family member can be introduced in a chemical synthesis protocol simultaneously to the variants by the addition of a single preselected nucleotide precursor to the solid phase oligonucleotide reaction admixture when that position number of the oligonucleotide is being chemically added to the growing oligonucleotide polymer. The addition of nucleotide residues to those positions in the sequence that vary can be introduced simultaneously by the addition of amounts, preferably equimolar amounts, of multiple preselected nucleotide precursors to the solid phase oligonucleotide reaction admixture during chemical synthesis. For example, where all four possible natural nucleotides (A,T,G and C) are to be added at a preselected position, their precursors are added to the oligonucleotide synthesis reaction at that step to simultaneously form four variants.
[0169]This manner of simultaneous synthesis of a family of related oligonucleotides has been previously described for the preparation of "Degenerate Oligonucleotides" by Ausubel et al. (Current Protocols in Molecular Biology, Suppl. 8. p. 2.11.7, John Wiley & Sons, Inc., New York, 1991), and can readily be applied to the preparation of the therapeutic oligonucleotide compositions described herein.
[0170]Nucleotide bases other than the common four nucleotides (A,T,G or C), or the RNA equivalent nucleotide uracil (U), can also be used in the present invention For example, it is well known that inosine (I) is capable of hybridizing with A, T and G, but not C. Examples of other useful nucleotide analogs are known in the art and may be found referred to in 37 C.F.R. §1.822.
[0171]Thus, where all four common nucleotides are to occupy a single position of a family of oligonucleotides, that is, where the preselected nucleotide sequence is designed to contain oligonucleotides that can hybridize to four sequences that vary at one position, several different oligonucleotide structures are contemplated. The composition can contain four members, where a preselected position contains A,T,G or C. Alternatively, a composition can contain two nucleotide sequence members, where a preselected position contains I or C, and has the capacity the hybridize at that position to all four possible common nucleotides. Finally, other nucleotides may be included at the preselected position that have the capacity to hybridize in a non-destabilizing manner with more than one of the common nucleotides in a manner similar to inosine.
[0172]Similarly, larger nucleic acid molecules can be constructed in synthetic oligonucleotide pieces, and assembled by complementary hybridization and ligation, as is well known.
[0173]B. Adenovirus Expression Vector Systems
[0174]One key component of the present invention for producing gene therapy reagents comprised of recombinant adenovirus particles is the recombinant adenovirus vector genome which is encapsulated in the virus particle and which expresses exogenous genes in a gene therapy setting. Thus, the components of an recombinant adenovirus vector genome include the ability to express selected adenovirus structural genes, to express a desired exogenous protein, and to contain sufficient replication and packaging signals that the genome is packaged into a gene delivery vector particle. The preferred replication signal is an adenovirus inverted terminal repeat containing an adenovirus origin of replication, as is well known and described herein.
[0175]According to the present invention, a preferred recombinant adenovirus vector genome is "helper independent" which means the genome can replicate and be packaged without the help of a second, complementing helper virus. Instead, the complementation is provided by a packaging cell line of the present invention. Additional embodiments of the invention, however, are drawn to a vector genome referred to as "gutless" which is "helper dependent."
[0176]In a preferred embodiment, the adenovirus vector genome does not encode a functional adenovirus fiber protein. A non-functional fiber gene refers to a deletion, mutation or other modification to the adenovirus fiber gene such that the gene does not express any or insufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of the fiber gene by a complementing plasmid or packaging cell line. Such a genome is referred to as a "fiberless" genome, not to be confused with a fiberless particle. Alternatively, a fiber protein may be encoded but is insufficiently expressed to result in a fiber containing particle.
[0177]Thus, the invention describes a helper-independent fiberless recombinant adenovirus vector genome comprising genes which (a) express all adenovirus structural gene products but express insufficient adenovirus fiber protein to package a fiber-containing adenovirus particle without complementation of said fiber gene, (b) express an exogenous protein, and (c) contains an adenovirus packaging signal and inverted terminal repeats containing adenovirus origin of replication.
[0178]The introduction of exogenous DNA into eucaryotic cells has become one of the most powerful tools of the molecular biologist. The term "exogenous" encompasses any therapeutic composition of this invention which is administered by the therapeutic methods of this invention. Thus, "exogenous" may also be referred to herein as "foreign," "non-native," and the like. The methods of this invention preferably require efficient delivery of the DNA into the nucleus of the recipient cell and subsequent identification of cells that are expressing the foreign DNA.
[0179]The adenovirus vector genome is propagated in the laboratory in the form of rDNA plasmids containing the genome, and upon introduction into an appropriate host, the viral genetic elements provide for viral genome replication and packaging rather than plasmid-based propogation. Exemplary methods for preparing an Ad-vector genome are described in the Examples.
[0180]A widely-used plasmid is pBR322, a vector whose nucleotide sequence and endonuclease cleavage sites are well known. Various other useful plasmid vectors are described in the Examples that follow.
[0181]A nucleic acid vector of the present invention comprises a nucleic acid (preferably DNA) molecule capable of autonomous replication in a cell and to which a DNA segment, e.g., a gene or polynucleotide, can be operatively linked so as to bring about replication of the attached segment. In the present invention, one of the nucleotide segments to be operatively linked to vector sequences encodes at least a portion of a therapeutic nucleic acid molecule--in effect, a nucleic acid sequence that encodes one or more therapeutic proteins or polypeptides, or fragments thereof.
[0182]As one of skill in the art will note, in various embodiments of the present invention, different "types" of vectors are disclosed. For example, one "type" of vector is used to deliver particular nucleotide sequences into a packaging cell line, with the intent of having said sequences stably integrate into the cellular genome; these "types" of vectors are generally identified herein as complementing plasmids. A further "type" of vector described herein carries or delivers nucleotide sequences in or into a cell line (e.g., a packaging cell line) for the purpose of propagating therapeutic viral vectors of the present invention; hence, these vectors are generally referred to herein as delivery plasmids. A third "type" of vector described herein is utilized to carry nucleotide sequences encoding therapeutic proteins or polypeptides to specific cells or cell types in a subject in need of treatment; these vectors are generally identified herein as therapeutic viral vectors or Ad-derived vectors and are in the form of a virus particle encapsulating a viral nucleic acid containing an expression cassette nucleic acid sequence for expressing the therapeutic gene.
[0183]1. Nucleic Acid Gene Expression Cassettes
[0184]In various embodiments, a peptide-coding sequence of the therapeutic gene is inserted into an expression vector and expressed; however, it is also feasible to construct an expression vector which also includes some non-coding sequences as well. Preferably, however, non-coding sequences are excluded. Alternatively, a nucleotide sequence for a soluble form of a polypeptide may be utilized. Another preferred therapeutic viral vector includes a nucleotide sequence encoding at least a portion of a therapeutic nucleotide sequence operatively linked to the expression vector for expression of the coding sequence in the therapeutic nucleotide sequence.
[0185]As used herein with regard to DNA sequences or segments, the phrase "operatively linked" generally means the sequences or segments have been covalently joined into one piece of DNA, whether in single or double stranded form.
[0186]The choice of viral vector into which a therapeutic nucleotide sequence of this invention is operatively linked depends directly, as is well known in the art, on the functional properties desired, e.g., vector replication and protein expression, and the host cell to be transformed--these being limitations inherent in the art of constructing recombinant DNA molecules. Although certain adenovirus serotypes are recited herein in the form of specific examples, it should be understood that the present invention contemplates the use of any adenovirus serotype, including hybrids and derivatives thereof. As one will observe, it is not unusual or outside the scope of the present invention to utilize nucleotide and/or amino acid residue sequences of two or more serotypes in constructs, compositions and methods of the invention.
[0187]A translatable nucleotide sequence is a linear series of nucleotides that provide an uninterrupted series of at least 8 codons that encode a polypeptide in one reading frame. Preferably, the nucleotide sequence is a DNA sequence. The vector itself may be of any suitable type, such as a viral vector (RNA or DNA), naked straight-chain or circular DNA, or a vesicle or envelope containing the nucleic acid material and any polypeptides that are to be inserted into the cell.
[0188]2. Promoters
[0189]As noted elsewhere herein, an expression nucleic acid in an Ad-derived vector of the present invention may also include a promoter sequence.
[0190]In general, promoters are DNA segments that contain a DNA sequence that controls the expression of a gene located 3' or downstream of the promoter. The promoter is the DNA sequence to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene, typically located 3' of the promoter. A promoter also includes DNA sequences which direct the initiation of transcription, including those to which RNA polymerase specifically binds. If more than one nucleic acid sequence encoding a particular polypeptide or protein is included in a therapeutic viral vector or nucleotide sequence, more than one promoter or enhancer element may be included, particularly if that would enhance efficiency of expression. For purposes of the present invention, regulatable (inducible) as well as constitutive promoters may be used, either on separate vectors or on the same vector.
[0191]Both constitutive and regulatable (often called "inducible") promoters are useful in constructs and methods of the present invention. For example, some useful regulatable promoters are those of the CREB-regulated gene family and include inhibin, gonadotropin, cytochrome c, glucagon, and the like. (See, e.g., published International App. No. WO96/14061, the disclosure of which is incorporated by reference herein.)
[0192]A regulatable or inducible promoter may be described as a promoter wherein the rate of RNA polymerase binding and initiation is modulated by external stimuli. (See U.S. Pat. Nos. 5,750,396 and 5,998,205). Such stimuli include various compounds or compositions, light, heat, stress, chemical energy sources, and the like. Inducible, suppressible and repressible promoters are considered regulatable promoters.
[0193]Regulatable promoters may also include tissue-specific promoters. Tissue-specific promoters direct the expression of the gene to which they are operably linked to a specific cell type. Tissue-specific promoters cause the gene located 3' of it to be expressed predominantly, if not exclusively, in the specific cells where the promoter expressed its endogenous gene. Typically, it appears that if a tissue-specific promoter expresses the gene located 3' of it at all, then it is expressed appropriately in the correct cell types (see, e.g., Palmiter et al., Ann. Rev. Genet. 20: 465-499, 1986).
[0194]When a tissue-specific promoter controls the expression of a gene, that gene will be expressed in a small number of tissues or cell types rather than in substantially all tissues and cell types. Examples of tissue-specific promoters include the immunoglobulin promoter described by Brinster et al., Nature 306: 332-336 (1983) and Storb et al., Nature 310: 238-231 (1984); the elastase-I promoter described by Swift et al., Cell 38: 639-646 (1984); the globin promoter described by Townes et al., Mol. Cell. Biol. 5: 1977-1983 (1985), and Magram et al., Mol. Cell. Biol. 9: 4581-4584 (1989), the insulin promoter described by Bucchini et al., PNAS USA, 83: 2511-2515 (1986) and Edwards et al., Cell 58: 161 (1989); the immunoglobulin promoter described by Ruscon et al., Nature 314: 330-334 (1985) and Grosscheld et al, Cell 38: 647-658 (1984); the alpha actin promoter described by Shani, Mol. Cell. Biol. 6: 2624-2631 (1986); the alpha crystalline promoter described by Overbeek et al, PNAS USA 82: 7815-7819 (1985); the prolactin promoter described by Crenshaw et al., Genes and Development 3: 959-972 (1989); the propiomelanocortin promoter described by Tremblay e/al, PNAS USA 85:8890-8894 (1988); the beta-thyroid stimulating hormone (BTSH) promoter described by Tatsumi et al., Nippon Rinsho 47: 2213-2220 (1989); the mouse mammary tumor virus (MMTV) promoter described by Muller et al., Cell 54: 105 (1988); the albumin promoter described by Palmiter et al., Ann. Rev. Genet. 20: 465-499 (1986); the keratin promoter described by Vassar et al., PNAS USA 86: 8565-8569 (1989); the osteonectin promoter described by McVeye al, J. Biol. Chem. 263: 11,111-11, 116 (1988); the prostate-specific promoter described by Allison et al., Mol. Cell. Biol. 9: 2254-2257 (1989); the opsin promoter described by Nathans et al., PNAS USA 81: 4851-4855 (1984); the olfactory marker protein promoter described by Danciger et al., PNAS USA 86: 8565-8569 (1989); the neuron-specific enolase (NSE) promoter described by Forss-Pelter et al., J. Neurosci. Res. 16: 141-151 (1986); the L-7 promoter described by Sutcliffe, Trends in Genetics 3: 73-76 (1987) and the protamine 1 promoter described Peschon et al., Ann. New York Acad. Sci. 564: 186-197 (1989) and Braun et al., Genes and Development 3: 793-802 (1989). (The disclosures of all references cited are incorporated by reference herein.)
[0195]3. Adenovirus Vectors
[0196]Although adenovirus consists of many proteins, not all adenovirus proteins are required for assembly of a recombinant adenovirus particle (vector) of this invention. Thus, deletion of the appropriate genes from a recombinant Ad vector as taught herein will thus allow the vector to accommodate even larger "foreign" DNA segments. Thus, if the sequences encoding one or more adenovirus polypeptides or proteins are supplanted by a recombinant nucleotide sequence of the present invention, the length of the recombinant sequence can conceivably extend nearly to the packaging limit of the relevant adenovirus-derived vector.
[0197]In view of the fact that preferred embodiments disclosed herein are helper-independent Ad-derived vectors, the entire wild-type Ad genome cannot be completely supplanted by recombinant nucleic acid molecules without transforming such a vector into a vector requiring "help" of some kind. However, most of the Ad-derived vectors of the present invention do not depend on a helper virus; instead, the vectors of the present invention are propagated in cell lines stably expressing proteins or polypeptides that have been removed from said vectors to allow the addition of "foreign" DNA into the vectors. In various disclosed embodiments, specific early region and structural polypeptides are deleted from the vectors of the present invention, thereby enabling the vectors to accommodate recombinant nucleic acid sequences (or cassettes) of various lengths. For example, Ad-derived vectors of the present invention may easily include 12 kb or more of foreign (or "therapeutic") DNA sequences.
[0198]Thus, adenovirus viral vectors are also disclosed which comprise nucleotide sequences encoding a packaging signal and a foreign protein or polypeptide, wherein the nucleotide sequence encoding an adenovirus structural protein has been deleted.
[0199]In one variation, the nucleotide sequence encoding the foreign protein or polypeptide is a DNA molecule up to about 3 kb in length; in another, the nucleotide sequence encoding the foreign protein or polypeptide is a DNA molecule up to about 9.5 kb in length; in still another, the nucleotide sequence encoding the foreign protein or polypeptide is a DNA molecule up to about 12.5 kb in length. Nucleotide sequences of intermediate lengths are also contemplated by the present invention, as are sequences in excess of 12.5 kb.
[0200]The invention also discloses viral vectors wherein the sequence encoding a foreign protein or polypeptide is a sequence encoding an anti-tumor agent, a tumor suppressor protein, a suicide protein, or a fragment or functional equivalent thereof. In one variation, nucleotide sequences encoding one or more regulatory proteins have also been deleted from the vector. In another, the regulatory proteins are selected from the group consisting of E1A, E1B, E2A, E2B, E3, E4, and L4(100K protein).
[0201]A wide variety of therapeutic viral vectors are also embodiments of the present invention. In one embodiment, a therapeutic viral vector is disclosed which lacks a DNA sequence encoding fiber protein, or a portion thereof. In another variation, a therapeutic viral vector may further or alternatively comprise deletion of a DNA sequence encoding one or more regulatory proteins, polypeptides, or fragments thereof. In various embodiments, foreign DNA sequences are inserted in place of the DNA sequence encoding fiber protein in the viral vectors of the present invention. In other embodiments, the therapeutic viral vectors further comprise foreign DNA sequences inserted in place of the DNA sequences encoding one or more regulatory proteins, polypeptides, or fragments thereof, and/or one or more structural proteins, polypeptides, or fragments thereof.
[0202]The present invention further discloses a number of viral vectors. In one variation, a viral vector comprises a deletion or mutation of a DNA sequence encoding an adenovirus structural protein, polypeptide, or fragment thereof. A vector may further comprise deletion or mutation of the DNA sequences encoding regulatory polypeptides E1A and E1B; and it may still further comprise deletion or mutation of the DNA sequence encoding one or more of the following regulatory proteins or polypeptides: E2A, E2B, E3, E4, L4, or fragments thereof. In another variation, in a viral vector of the present invention, the structural protein comprises fiber. Any combination of the foregoing is also contemplated by the present invention. The viral vectors of the present invention are suitable for the preparation of pharmaceutical compositions comprising any of the therapeutic viral vectors disclosed herein--including combinations thereof--are also disclosed herein. A further use of the viral vectors of the present invention is for targeting specific cells in a cell population comprising different cell types. Yet another variation discloses that a foreign DNA sequence encoding one or more foreign proteins, polypeptides or fragments thereof has been inserted in place of any of the deletions in the therapeutic viral vector. In one embodiment, the foreign DNA encodes a tumor-suppressor protein or a biologically active fragment thereof. In another embodiment, the foreign DNA encodes a suicide protein or a biologically active fragment thereof.
[0203]The invention further contemplates that a viral vector comprises a foreign DNA sequence encoding one or more foreign proteins, polypeptides or fragments thereof wherein said DNA sequence has been inserted in place of any structural and/or regulatory proteins (or portions thereof) that have been deleted. Thus, in one embodiment, the foreign DNA encodes a therapeutic molecule such as a tumor-suppressor protein; a suicide protein; a cystic fibrosis transmembrane conductance regulator (CFTR) protein; or a biologically active fragment of any of them.
[0204]The therapeutic (or foreign) nucleotide sequence can be a gene or gene fragment that encodes a protein or polypeptide--or a biologically active fragment thereof. (See, e.g., Crystal, et al., Nature Genetics 8: 42-51 (1994); Zabner, et al., Cell 75: 207-216 (1993); Knowles, et al, NEJM333(13): 823-831 (1995); and Rosenfeld, et al., Cell 68: 143-155 (1992), the disclosures of which are incorporated by reference herein.)
[0205]It is further contemplated that a therapeutic protein or polypeptide expressed by a therapeutic viral vector of the present invention may be used in conjunction with another therapeutic agent when appropriate--e.g., a thymidine kinase metabolite may be used in conjunction with the gene encoding thymidine kinase and its gene product--in order to be even more effective.
[0206]Alternatively, a therapeutic viral vector can include a DNA or RNA oligonucleotide sequence that exhibits therapeutic activity without needing to be translated into a polypeptide product before exerting a therapeutic effect. Examples of the latter include antisense oligonucleotides that will inhibit the transcription of deleterious genes or ribozymes that act as site-specific ribonucleases for cleaving selected mutated gene sequences. In another variation, a therapeutic nucleotide sequence of the present invention may comprise a DNA construct capable of generating therapeutic nucleotide molecules, including ribozymes and antisense DNA, in high copy numbers in target cells, as described in published PCT application No. WO 92/06693 (the disclosure of which is incorporated herein by reference). Other preferred therapeutic nucleotide sequences according to the present invention are capable of delivering HIV antisense oligonucleotides to latently-infected T cells via CD4. Similarly, delivery of Epstein-Barr Virus (EBV) EBNa-1 antisense oligonucleotides to B cells via CR2 is capable of effecting therapeutic results.
[0207]A preferred recombinant adenovirus vector genome is based on the vector described in the Examples and designated Ad5.βgal.ΔF. This vector is a helper independent, fiberless vector genome which can host, upon insertion, an exogenous gene for expression of an exogenous or therapeutic protein. The genome of Ad5.βgal.ΔF has a nucleotide sequence shown in SEQ ID NO: 27. A virus particle containing Ad5.βgal.ΔF vector genome has been prepared as described in the Examples and is deposited with the ATCC as Accession No. VR-2636
[0208]The Ad5.βgal.ΔF genome nucleic acid can be manipulated to contain any exogenous gene in place of the beta-galactosidase gene present in the construct, as described herein.
V. CONSTRUCTION OF THERAPEUTIC VIRAL VECTORS FOR GENE DELIVERY
[0209]A. Adenovirus Particles
[0210]Various methods of making and using the vectors, plasmids, cell lines and other compositions and constructs of the present invention are also disclosed herein. The following methods are considered exemplary and not limiting.
[0211]Thus, in one variation, the invention discloses a method of constructing therapeutic viral vectors, comprising introducing a delivery plasmid into an Ad fiber-expressing complementing cell line, wherein the DNA sequence encoding Ad fiber protein has been deleted from the delivery plasmid. In one variation, the delivery plasmid further includes a DNA sequence encoding a foreign protein, polypeptide, or fragment thereof. In other embodiments, a combination of pDV44 and pDE1Bβgal or a similar construct such as, for example, that found in pDV44, pΔE1Bβgal or the equivalent.
[0212]A recombinant adenovirus particle may be produced with a fiber protein, or it may be produced without a fiber protein ("fiberless particle") according to the present invention. Where the particle is made without fiber, such as by passaging the fiberless viral vector genome, e.g., Ad5.βgal.ΔF in the 293 cells, a fiberless genome is replicated and packaged in a fiberless particle. In contrast, where the fiberless genome Ad5.βgal.ΔF is passaged in the 211B or other fiber expressing cells, a fiberless genome is replicated and packaged into a fiber-containing particle.
[0213]Recombinant adenovirus particles may be made such that they include no fiber proteins, modified fiber proteins or other exogenous proteins. They may also be produced in systems using either helper-independent or helper-dependent adenovirus recombinant genomes, i.e. with or without helper viruses.
[0214]B. Targeting of Particles to Tissues--Virus Trophism
[0215]A preferred viral vector particle in which therapeutic nucleotide compositions of this invention are present is derived from adenovirus (Ad). As taught herein, viral vector particles of this invention may be designed and constructed in such a way that they specifically target a preselected recipient cell type, depending on the nature of therapy one seeks to administer. Methods of making and using therapeutic viral vectors that target specific cells are further described in the Examples that follow.
[0216]Novel vectors, viral particles or compositions may also be designed and prepared to preferentially target cells that might not otherwise be targeted by wild-type adenovirus virions. For example, in order to target non-epithelial cells, one following the teachings of the present specification may be able to prepare a therapeutic vector particle including a nucleotide sequence encoding a foreign protein, polypeptide or other ligand directed to a non-epithelial cell or to a different receptor than that generally targeted by a particular adenovirus. Examples of useful ligands directed to specific receptors (identified in parentheses) include the V3 loop of HIV gp120 (CD4); transferrin (transferrin receptor); LDL, apolipoprotein B100, apolipoprotein E (LDL receptors); and deglycosylated proteins (asialoglycoprotein receptor). Various useful ligands which may be added to adenovirus fiber--and methods for preparing and attaching same--are set forth in U.S. Pat. Nos. 5,756,086 and 5,543,328, the disclosures of which are incorporated by reference herein.
[0217]In yet another embodiment, the non-native amino acid residue sequence is incorporated into the fiber amino acid residue sequence at a location other than one of the fiber termini. Alternatively, the non-native amino acid residue sequence alters the binding specificity of the fiber for a targeted cell type. In other embodiments, the linker sequence alters the binding specificity of the fiber for a targeted cell type. The expressed fiber may, in various embodiments, bind to a specific targeted cell type not usually targeted by adenovirus and/or may comprise amino acid residue sequences from more than one adenovirus serotype.
[0218]Useful ligands may be encoded by a foreign nucleotide sequence contained within a viral vector of the present invention, or may be linked to proteins or polypeptides, include antibodies and attachment sequences, as well as receptors themselves. For example, antibodies to cell receptor molecules such as integrins and the like, MHC Class I and Class II, asialoglycoprotein receptor, transferrin receptors, LDL receptors, CD4, and CR2 are but a few which are useful according to the present invention. It is also understood that the ligands typically bound by receptors, as well as analogs to those ligands, may be used as cellular targeting agents, as disclosed herein.
VI. THERAPEUTIC METHODS
[0219]The recombinant adenovirus vectors of the present invention, typically in the form of an adenovirus particle encapsulating a recombinant adenovirus vector genome containing an expression cassette for expressing a therapeutic gene, are particularly suited for gene therapy. Thus, various therapeutic methods are contemplated by the present invention.
[0220]For example, it has now been discovered that Ad-derived viral vectors are capable of delivering a therapeutic nucleotide sequence to a specific cell or tissue, based on the tissue tropism of the particle, thereby expanding and enhancing treatment options available in numerous conditions in which more conventional therapies are of limited efficacy. Accordingly, methods of gene therapy utilizing a recombinant adenovirus particle containing a modified fiber or chimeric fiber which targets a preselected tissue, as described herein, is within the scope of the invention. Vector particles are typically purified and then an effective amount is administered in vivo or ex vivo (in vitro) into the subject.
[0221]For in vitro or ex vivo gene transfer, administration is often accomplished by first isolating a selected cell population from a patient such as lung epithelial cells, lymphocytes and the like followed by in vitro or ex vivo gene transfer of the therapeutic compositions of this invention and the replacement of the cells into the patient. In vivo therapy is also contemplated, e.g., via the administration of therapeutic compositions of this invention by various delivery means. For example, aerosol administration and administration via subcutaneous, intravenous, intraperitoneal, intramuscular, ocular means and the like are also within the scope of the present invention.
[0222]Other gene-delivery methods are also useful in conjunction with the methods, compositions and constructs of the present invention; see, e.g., published International Application No. WO 95/11984, the disclosures of which are incorporated by reference herein.
[0223]The present invention also contemplates various methods of targeting specific cells--e.g., cells in a subject in need of diagnosis and/or treatment. As discussed herein, the present invention contemplates that the viral vectors and compositions of the present invention may be directed to specific receptors or cells, for the ultimate purpose of delivering those vectors and compositions to specific cells or cell types. The viral vectors and constructs of the present invention are particularly useful in this regard.
[0224]In general, adenovirus attachment and uptake into cells are separate but cooperative events that result from the interaction of distinct viral coat proteins with a receptor for attachment and av integrin receptors for internalization. Adenovirus attachment to the cell surface via the fiber coat proteins has been discovered to be dissociable and distinct from the subsequent step of internalization, and the present invention is able to take advantage of and function in conjunction with these differing receptors.
[0225]The invention also discloses methods of transforming a pathologic hyperproliferative mammalian cell comprising contacting the cell with any of the vectors described herein. In another embodiment, methods of infecting a mammalian target cell with a viral vector containing a preselected foreign nucleotide sequence are disclosed. One such variation comprises the following steps: (a) infecting the target cell with a viral vector of the present invention, the viral vector carrying a preselected foreign nucleotide sequence; and (b) expressing the foreign nucleotide sequence in the targeted cell.
[0226]The invention also encompasses mammalian target cells infected with a preselected foreign nucleotide sequence produced by the methods disclosed herein. In one variation, the target cells are selected from the group consisting of replicating, slow-replicating and non-replicating human cells.
[0227]Methods of treating an acquired or hereditary disease are also disclosed. One method comprises (a) administering a pharmaceutically acceptable dose of a viral vector to a target cell, wherein the vector comprises a preselected therapeutic nucleotide sequence; and (b) expressing the therapeutic sequence in the target cell for a time period sufficient to ameliorate the acquired or hereditary disease in the cell. Method of gene therapy comprising administering to a subject an effective amount of a therapeutic viral vector produced by a packaging cell line of the present invention are also disclosed.
[0228]Also contemplated by the present invention are various methods of inhibiting the proliferation of a tumor in a subject comprising administering an effective amount of a therapeutic viral vector of the present invention under suitable conditions to the subject. In one variation, the gene encodes an antitumor agent. In another variation, the agent is a tumor-suppressor gene. In still another embodiment, the agent is a suicide gene or a functional equivalent thereof. In another variation, the vector is administered via intra-tumoral injection.
[0229]A composition of this invention may be used prophylactically or therapeutically in vivo to disrupt HIV infection and mechanisms of action by inhibiting gene expression or activation, via delivery of antisense HIV sequences or ribozymes to T cells or monocytes. Using methods of the present invention, one may target therapeutic viral vectors as disclosed herein to specific cells and tissues, including hematopoietic cells, as infection of such cells appears to be mediated by distinct integrins to which viral vectors of the present invention may readily be targeted. (See, e.g., Huang, et al., J. Virol. 70: 4502-8, 1996). Other useful therapeutic nucleotide sequences include antisense nucleotide sequences complementary to EBV EBNa-1 gene. Use of such therapeutic sequences may remediate or prevent latent infection of B cells with EBV. As discussed herein and in the Examples below, targeting and delivery may be accomplished via the use of various ligands, receptors, and other appropriate targeting agents.
[0230]Thus, in one embodiment, a therapeutic method of the present invention comprises contacting the cells of a subject infected with EBV or HIV with a therapeutically effective amount of a pharmaceutically acceptable composition comprising a therapeutic nucleotide sequence of this invention. In a related embodiment, the contacting involves introducing the therapeutic nucleotide sequence composition into cells having an EBV or HTV-mediated infection.
[0231]Methods of gene therapy are well known in the art (see, e.g., Larrick and Burck, Gene Therapy Application of Molecular Biology, Elsevier Science Publ. Co., Inc., New York, N.Y. (1991); Kriegler, Gene Transfer and Expression: A Laboratory Manual, W. H. Freeman and Company, New York, 1990). The term "subject" should be understood to include any animal--particularly mammalian--patient, such as any murine, rat, bovine, porcine, canine, feline, equine, ursine, or human patient.
[0232]When the foreign gene carried in the vector encodes a tumor suppressor gene or another anti-tumor protein, the vector is useful to treat or reduce hyperproliferative cells in a subject, to inhibit tumor proliferation in a subject or to ameliorate a particular, related pathology.
[0233]The present invention also contemplates methods of depleting suitable samples of pathologic mammalian hyperproliferative cells contaminating hematopoietic precursors during bone marrow reconstitution via the introduction of a wild-type tumor suppressor gene into the cell preparation using a vector of this invention. As used herein, a suitable sample is defined as a heterogeneous cell preparation obtained from a patient, e.g., a mixed population of cells containing both phenotypically normal and pathogenic cells.
[0234]Administration includes--but is not limited to--the introduction of therapeutic agents of the present invention into a cell or subject via various means, including direct injection, intravenously, intraperitoneally, via intra-tumor injection, via aerosols, or topically. Therapeutic agents as disclosed herein may also be combined for administration of an effective amount of the agents with a pharmaceutically-acceptable carrier, as described herein.
[0235]As used herein, "effective amount" generally means the amount of vector particle (or proteins produced/released thereby) which achieves a positive outcome in the subject to whom the vector is administered. The total volume administered will necessarily vary depending on the mode of administration, as those of skill in the relevant art will appreciate, and dosages may vary as well.
[0236]The dose of a biologic vector (particle) is somewhat complex and may be described in terms of the concentration (in plaque-forming units per milliliter (pfu/ml)), the total dose (in pfus), or the estimated number of particles administered per cell (the estimated multiplicity of infection or MOI). Thus, if a vector is administered via infusion--say, across nasal epithelium--at a constant total volume, the respective concentration, etc. may be described as follows:
[0237]In general, when recombinant adenoviral vector particles are administered via infusion across the nasal epithelium (e.g. an area of nasal epithelium containing 2×107 cells,) administered amounts producing an estimated MOI (multiplicity of infection) of about 10 or greater are much more effective than lower
TABLE-US-00002 TABLE 2 Concentration (pfu/ml) Volume (ml) Dose (pfu) Estimated MOI 107 2 2 × 107 1 108 2 2 × 108 10 109 2 2 × 109 100 .sup. 1010 2 .sup. 2 × 1010 1000
dosages. (See, e.g., Knowles, et al., New Eng. J. Med. 333: 823-831, 1995). Similarly, when direct injection is the preferred treatment modality--e.g., direct injection of a viral vector into a tumor--doses of 1×109 pfu or greater are generally preferred. (See, e.g., published International App. No. WO95/11984.) Thus, depending on the mode of administration, an effective amount administered in a single dose preferably contains from about 106 to about 109 infectious units. A typical course of treatment would be one such dose per day over a period of five days. As those of skill in the art will appreciate, an effective amount may vary depending on (1) the pathology or other condition to be treated, (2) the status and sensitivity of the patient, and (3) various other factors well known to those of skill in the art, such as the patient's tolerance to other courses of treatment that may have been applied previously. Thus, those of skill in the art may easily and precisely determine effective amounts of the agents/vectors of the present invention which may be administered to a particular patient, based on their understanding of and evaluation of such factors.
[0238]The present invention also contemplates methods of ameliorating pathologies characterized by hyperproliferative cells or genetic defects in a subject, by administering to the subject an effective amount of a vector as described herein. Such vectors preferably contain a foreign gene encoding a gene product (e.g. polypeptide or protein) having the ability to ameliorate the pathology, under suitable conditions. As used herein, the term "genetic defect" means any disease, condition or abnormality which results from inherited factors, e.g. Huntington's Disease, Tay-Sachs Disease, or Sickle Cell Disease.
[0239]The present invention further provides methods for reducing the proliferation of tumor cells in a subject by introducing into the tumor mass an effective amount of an adenoviral expression vector containing an anti-tumor gene other than a tumor suppressor gene. The anti-tumor gene can encode, for example, thymidine kinase (TK). An effective amount of a therapeutic agent is then administered to the subject; the therapeutic agent, in the presence of the anti-tumor gene, is toxic to the cell.
[0240]Using thymidine kinase as exemplary, the therapeutic agent is a thymidine kinase metabolite such as ganciclovir (GCV), 6-methoxypurine arabinonucleoside (araM), or a functional equivalent thereof. Both the thymidine kinase gene and the thymidine kinase substrate must be used concurrently in order to exert a toxic effect on the host cell. In the presence of the TK gene, GCV is phosphorylated and becomes a potent inhibitor of DNA synthesis, whereas araM is converted to the cytotoxic anabolite araATP. Thus, the precise method of action or synergism is not relevant to therapeutic efficacy; what is relevant is the fact that the concurrent use of appropriate genes and therapeutic agents may effectively ameliorate a specific disease condition.
[0241]Another useful example contemplates use of a vector of the present invention which expresses the enzyme cytosine deaminase. Such a vector could be used in conjunction with administration of the drug 5-fluorouracil (Austin and Huber, Mol. Pharm. 43: 380-387, 1993) or the recently-described E. coli Deo gene in combination with 6-methyl-purine-2'-deoxyribonucleoside (Sorschere et al., Gene Therapy 1: 233-238, 1994).
[0242]As with the use of the tumor suppressor genes described previously, the use of other anti-tumor genes, either alone or in combination with the appropriate therapeutic agent, provides a treatment for the uncontrolled cell growth or proliferation characteristic of tumors and malignancies. Thus, the present invention provides therapies to halt the uncontrolled cellular growth in a patient, thereby alleviating the symptoms or the disease or cachexia present in the patient. The effect of this treatment includes, but is not limited to, prolonged survival time of the patient, reduction in tumor mass or burden, apoptosis of tumor cells, or the reduction in the number of circulating tumor cells. Means of quantifying the beneficial effects of this therapy are well known to those of skill in the art.
[0243]The present invention provides a recombinant adenovirus expression vector characterized by the partial or total deletion of one or more adenoviral structural protein genes, such as the gene encoding fiber, which allows the vector to accommodate a therapeutic, foreign nucleic acid sequence encoding a functional foreign polypeptide, protein, or biologically active fragment thereof.
[0244]A therapeutic gene sequence may be introduced into a tumor mass by combining the adenoviral expression vector with a suitable pharmaceutically acceptable carrier. Introduction can be accomplished, for example, via direct injection of the recombinant Ad vector into the tumor mass.
[0245]A method of tumor-specific delivery of a tumor-suppressor gene is accomplished by contacting target tissue in a subject with an effective amount of a recombinant Ad-derived vector of this invention. In the case of anti-tumor therapy, the gene is intended to encode an anti-tumor agent, such as a functional tumor suppressor gene product or suicide gene product. The term "contacting" is intended to encompass any delivery method for the efficient transfer of the vector, such as via intra-tumoral injection.
[0246]In another example, adenovirus vectors of the present invention can be used to transfer genes to central nervous system (CNS) tumors in vivo.
[0247]The present invention also contemplates methods for determining the efficacy of the within-disclosed therapeutic compositions and methods. One such method for confirming efficacy utilizes the human/SCID (severe combined immunodeficient) mouse model of EBV-induced LPD (lymphoproliferative disease) to ascertain whether EBV-antisense therapeutic nucleotide sequences block tumor formation. (See, e.g., Pisa, et al, Blood 79: 173-179 (1992), Rowe, et al., Curr. Top. Microbiol. Immunol. 166: 325 (1990); and Cannon, et al., J. Clin. Invest. 85: 1333-1337 (1990), the disclosures of which are incorporated by reference herein.)
[0248]Finally, the use of Ad vectors of the present invention to prepare medicaments for the treatment, therapy and/or diagnosis of various diseases is also contemplated by this invention. Moreover, other anti-tumor genes may be used in combination with the corresponding therapeutic agent to reduce the proliferation of tumor cells. Such other gene-and-therapeutic-agent combinations are known to those of skill in the art and may be applied as taught herein.
[0249]A. Therapeutic Compositions
[0250]In various alternative embodiments of the present invention, therapeutic sequences and compositions useful for practicing the therapeutic methods described herein are contemplated. Therapeutic compositions of the present invention may contain a physiologically tolerable carrier together with one or more therapeutic nucleotide sequences of this invention, dissolved or dispersed therein as an active ingredient. In a preferred embodiment, the composition is not immunogenic or otherwise able to cause undesirable side effects when administered to a subject for therapeutic purposes.
[0251]As used herein, the terms "pharmaceutically acceptable," "physiologically tolerable" and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a subject--e.g., a mammal--without the production of undesirable physiological effects such as nausea, dizziness, gastric upset and the like.
[0252]For example, the present invention comprises therapeutic compositions useful in the specific targeting of epithelial or non-epithelial cells as well as in delivering a therapeutic nucleotide sequence to those cells. Therapeutic compositions designed to preferentially target to epithelial cells may comprise a recombinant adenovirus-derived vector particle including a therapeutic nucleotide sequence. As described herein, a number of adenovirus-derived moieties are described, including particles lacking fiber, particles that contain wild type adenovirus fiber, and particles that contain modified or chimeric fiber, each type providing a different tissue tropism to the particle.
[0253]The preparation of a pharmacological composition that contains active ingredients dissolved or dispersed therein is well understood in the art. Typically such compositions are prepared as injectables--either as liquid solutions or suspensions--however, solid forms suitable for solution or suspension in liquid prior to use can also be prepared. A preparation can also be emulsified, or formulated into suppositories, ointments, creams, dermal patches, or the like, depending on the desired route of administration.
[0254]Physiologically tolerable carriers are well known in the art. Exemplary of liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions.
[0255]A therapeutic composition typically contains an amount of a therapeutic material, i.e., a nucleotide sequence or adenovirus vector particle of the present invention, sufficient to deliver a therapeutically effective amount to the target tissue, typically an amount of at least 0.1 weight percent to about 90 weight percent of therapeutic material per weight of total therapeutic composition. A weight percent is a ratio by weight of therapeutic material, e.g., a nucleotide sequence, to total composition. Thus, for example, 0.1 weight percent is 0.1 grams of DNA segment per 100 grams of total composition.
VII. OTHER APPLICATIONS
[0256]The cell lines, viral vectors and methods of the present invention may also be used for purposes other than the direct administration of therapeutic nucleotide sequences. In one such application, the production of large quantities of biologically active proteins or polypeptides in cells transfected with the within-disclosed viral vectors is contemplated herein. For example, human lymphoblastoid cells may be transfected with a viral vector of the present invention carrying a human hematopoietic growth factor such as the gene for erythropoietin (EPO); cells so transfected are thus able to produce biologically active EPO. (See, e.g., Lopez et al., Gene 148: 285-91, 1994).
[0257]Various other applications and uses of the within-described methods, cell lines, plasmids, vectors, and compositions of the present invention shall become apparent upon closer examination of the Examples that follow.
EXAMPLES
[0258]The following examples are intended to illustrate, but not limit, the present invention. As such, the following description provides details of the manner in which particular embodiments of the present invention may be made and used. This description, while exemplary of the present invention, is not to be construed as specifically limiting the invention. Variations and equivalents, now known or later developed, which would be within the understanding and technical competence of one skilled in this art are to be considered as falling within the scope of this invention.
Example 1
Preparation of Adenovirus Packaging Cell Lines
[0259]Cell lines that are commonly used for growing adenovirus are useful as host cells for the preparation of adenovirus packaging cell lines. Preferred cells include 293 cells, an adenovirus-transformed human embryonic kidney cell line obtained from the ATCC, having Accession Number CRL 1573; HeLa, a human epithelial carcinoma cell line (ATCC Accession Number CCL-2); A549, a human lung carcinoma cell line (ATCC Accession Number CCL 1889); and the like epithelial-derived cell lines. As a result of the adenovirus transformation, the 293 cells contain the E1 early region regulatory gene. All cells were maintained in complete DMEM+10% fetal calf serum unless otherwise noted.
[0260]The cell lines of this invention allow for the production and propagation of novel adenovirus-based gene delivery vectors having deletions in preselected gene regions, that are obtained by cellular complementation of adenoviral genes. To provide the desired complementation of such deleted adenoviral genomes in order to generate a novel viral vector of the present invention, plasmid vectors that contain preselected functional units were designed as described herein. Such units include but are not limited to E1 early region, E4 and the viral fiber gene. The preparation of plasmids providing such complementation, thereby being "complementary plasmids or constructs," that are stably inserted into host cell chromosomes are described below.
[0261]A. Preparation of an E4-Expressing Plasmid for Complementation of E4-Gene-Deleted Adenoviruses
[0262]The viral E4 regulatory region contains a single transcription unit which is alternately spliced to produce several different mRNAs. The E4-expressing plasmid prepared as described herein and used to transfect the 293 cell line contains the entire E4 transcriptional unit as shown in FIG. 1. A DNA fragment extending from 175 nucleotides upstream of the E4 transcriptional start site including the natural E4 promoter to 153 nucleotides downstream of the E4 polyadenylation signal including the natural E4 terminator signal, corresponding to nucleotides 32667-35780 of the adenovirus type 5 (hereinafter referred to as Ad5) genome as described in Chroboczek et al., (Virol, 186:280-285 (1992), GenBank Accession Number M73260), was amplified from Ad5 genomic DNA, obtained from the ATCC, via the polymerase chain reaction (PCR). Sequences of the primers used were 5'CGGTACACAGAATTCAGGAGACAC AACTCC3' (forward or 5' primer referred to as E4L) (SEQ ID NO: 1) and 5'GCCTGGATCCGGGAAGTTACGTAACGTGGGAAAAC3' (SEQ ID NO: 2) (backward or 3' primer referred to as E4R). To facilitate cloning of the PCR fragment, these oligonucleotides were designed to create novel sites for the restriction enzymes EcoRI and BamHI, respectively, as indicated with underlined nucleotides. DNA was amplified via PCR using 30 cycles of 92 C for 1 minute, 50 C for 1 minute, and 72 C for 3 minutes resulting in amplified full-length E4 gene products.
[0263]The amplified DNA E4 products were then digested with EcoRI and BamHI for cloning into the compatible sites of pBluescript/SK+ by standard techniques to create the plasmid pBS/E4. A 2603 base pair (bp) cassette including the herpes simplex virus thymidine kinase promoter, the hygromycin resistance gene, and the thymidine kinase polyadenylation signal was excised from the plasmid pMEP4 (Invitrogen, San Diego, Calif.) by digestion with Fsp1 followed by addition of BamHI linkers (5'CGCGGATCCGCG3') (SEQ ID NO: 3) for subsequent digestion with BamHI to isolate the hygromycin-containing fragment. The isolated BamHI-modified fragment was then cloned into the BamHI site of pBS/E4 containing the E4 region to create the plasmid pE4/Hygro containing 8710 bp (FIG. 2). The pE4/Hygro plasmid has been deposited with the ATCC as described in Example 3. The complete nucleotide sequence of pE4/Hygro is listed in SEQ ID NO: 4. Position number 1 of the linearized vector corresponds to approximately the middle portion of the pBS/SK+ backbone as shown in FIG. 2 as a thin line between the 3' BamHI site in the hygromycin insert and the 3' EcoRI site in the E4 insert. The 5' and 3' ends of the E4 gene are located at respective nucleotide positions 3820 and 707 of SEQ ED NO: 4 while the 5' and 3' ends of the hygromycin insert are located at respective nucleotide positions 3830 and 6470. In the clone that was selected for use, the E4 and hygromycin resistance genes were divergently transcribed.
[0264]B. Preparation of a Fiber-Expressing Plasmid for Complementation of Fiber-Gene-Deleted Adenoviruses
[0265]To prepare a fiber-encoding construct, primers were designed to amplify the fiber coding region from Ad5 genomic DNA with the addition of unique BamHI and NotI sites at the 5' and 3' ends of the fragment, respectively. The Ad5 nucleotide sequence is available with the GenBank Accession Number M18369. The 5' and 3' primers had the respective nucleotide sequences of 5'ATGGGATCCAAGATGAAGCGCGCAAGACCG3' (SEQ ID NO: 5) and 5'CATAACGCGGCCGCTTCTTTATTCTTGGGC3' (SEQ ID NO: 6), where the inserted BamHI and NotI sites are indicated by underlining. The 5' primer also contained a nucleotide substitution 3 nucleotides 5' of the second ATG codon (C to A) that is the initiation site. The nucleotide substitution was included so as to improve the consensus for initiation of fiber protein translation.
[0266]The amplified DNA fragment was inserted into the BamHI and NotI sites of pcDNA3 (Invitrogen) to create the plasmid designated pCDN A3/Fiber having 7148 bp, the plasmid map of which is shown in FIG. 3. The parent plasmid contained the CMV promoter, the bovine growth hormone (BHG) terminator and the gene for conferring neomycin resistance. The viral sequence included in this construct corresponds to nucleotides 31040-32791 of the Ad5 genome.
[0267]The complete nucleotide sequence of pcDNA3/Fiber is listed in SEQ ED NO: 7 where the nucleotide position 1 corresponds to approximately the middle of the pcDNA3 vector sequence. The 5' and 3' ends of the fiber gene are located at respective nucleotide positions 916 with ATG and 2661 with TAA.
[0268]To enhance expression of fiber protein by the constitutive CMV promoter provided by the pcDNA vector, a BglII fragment containing the tripartite leader (TPL) of adenovirus type 5 was excised from pRD 112a (Sheay et al., BioTechniques, 15:856-862 (1993) and inserted into the BamHI site of pcDNA3/Fiber to create the plasmid pCLF having 7469 bp, the plasmid map of which is shown in FIG. 4. The adenovirus tripartite leader sequence, present at the 5' end of all major late adenoviral mRNAs as described by Logan et al., Proc. Natl. Acad. Set, USA, 81:3655-3659 (1984) and Berkner, BioTechniques, (5:616-629 (1988), also referred to as a "partial TPL" since it contains a partial exon 1, shows correspondence with the Ad5 leader sequence having three spatially separated exons corresponding to nucleotide positions 6081-6089 (the 3' end of the first leader segment), 7111-7182 (the entire second leader segment), and 9644-9845 (the third leader segment and sequence downstream of that segment). The corresponding cDNA sequence of the partial tripartite leader sequence present in pCLF is listed in SEQ ID NO: 8 bordered by BamHI/BglII 5' and 3' sites at respective nucleotide positions 907-912 to 1228-1233. The nucleotide sequence of an isolated partial TPL of the present invention is also listed separately as SEQ ID NO: 26 with the noted 5' and 3' restriction sites and with the following nucleotide regions identified: 1-6 nt BglII site; 1-18 nt polylinker; 19-27 nt last 9 nt of the first leader segment (exon 1); 28-99 nt second leader segment (exon 2); 100-187 nt third leader segment (exon 3); 188-301 nt contains the nt sequence immediately following the third leader in the genome with an unknown function; and 322-327 nt BglII site.
[0269]The pCLF plasmid has been deposited with the ATCC as described in Example 3. The complete nucleotide sequence of pCLF is listed in SEQ ID NO: 8 where the nucleotide position 1 corresponds to approximately the middle of the pcDNA3 parent vector sequence. The 5' and 3 ends of the Ad5 fiber gene are located at respective nucleotide positions 1237-1239 with ATG and 2980-2982 with TAA. The rest of the vector construct has been previously described above.
[0270]C. Generation of an Adenovirus Packaging Cell Line Carrying Plasmids Encoding Functional E4 and Fiber Proteins
[0271]The 293 cell line was selected for preparing the first adenovirus packaging line as it already contains the E1 gene as prepared by Graham et al., J. Gen. Virol, 36: 59-74 (1977) and as further characterized by Spector, Virol., 130: 533-538 (1983). Before electroporation, 293 cells were grown in RPMI medium+10% fetal calf serum. Four x 106 cells were electroporated with 20 μg each of pE4/Hygro DNA and pCLF DNA using a BioRad Gene Pulser and settings of 300 V, 25 μF. DNA for electroporation was prepared using the Qiagen system according to the manufacturer's instructions (Bio-Rad, Richmond, Calif.).
[0272]Following electroporation, cells were split into fresh complete DMEM+10% fetal calf serum containing 200 μg/ml Hygromycin B (Sigma, St. Louis, Mo.).
[0273]From expanded colonies, genomic DNA was isolated using the "MICROTURBOGEN" system (Invitrogen) according to manufacturer's instructions. The presence of integrated E4 DNA was assessed by PCR using the primer pair E4R and ORF6L (5'TGCTTAAGCGGCCGCGAAGGAGAAGTCC3') (SEQ ID NO: 9), the latter of which is a 5' forward primer near adenovirus 5 open reading frame 6. Refer to FIG. 1 for position of the primers relative to the E4 genes.
[0274]One clone, designated 211, was selected exhibiting altered growth properties relative to that seen in parent cell line 293. The 211 clone contained the expected product, indicating the presence of inserted DNA corresponding to most, if not all, of the E4 fragment contained in the pE4/Hygro plasmid. The 211 cell line has been deposited with the ATCC as described in Example 3. This line was further evaluated by amplification using the primer pair E4L/E4R described above, and a product corresponding to the full-length E4 insert was detected. Genomic Southern blotting was performed on DNA restricted with EcoRI and BamHI. The E4 fragment was then detected at approximately one copy/genome compared to standards with the EcoRI/BamHI E4 fragment as cloned into pBS/E4 for use as a labeled probe with the Genius system according to manufacturer's instructions (Boehringer Mannheim, Indianapolis, Ind.). In DNA from the 211 cell line, the expected labeled internal fragment pE4/Hygro hybridized with the isolated E4 sequences. In addition, the probe hybridized to a larger fragment which may be the result of a second insertion event (FIG. 5).
[0275]Although the 211 cell line was not selected by neomycin resistance, thus indicating the absence of fiber gene, to confirm the lack of fiber gene, the 211 cell line was analyzed for expression of fiber protein by indirect immunofluorescence with an anti-fiber polyclonal antibody and a FITC-labeled anti-rabbit IgG (KPL) as secondary. No immunoreactivity was detected. Therefore, to generate 211 clones containing recombinant fiber genes, the 211 clone was expanded by growing in RPMI medium and subjected to additional electroporation with the fiber-encoding pCLF plasmid as described above.
[0276]Following electroporation, cells were plated in DMEM+10% fetal calf serum and colonies were selected with 200 μg/ml G418 (Gibco, Gaithersburg, Md.). Positive cell lines remained hygromycin resistant. These candidate sublines of 211 were then screened for fiber protein expression by indirect immunofluorescence as described above. The three sublines screened, 211A, 211B and 211R, along with a number of other sublines, all exhibited nuclear staining qualitatively comparable to the positive control of 293 cells infected with AdRSVβgal (1 pfu/cell) and stained 24 hours post-infection.
[0277]Lines positive for nuclear staining in this assay were then subjected to Western blot analysis under denaturing conditions using the same antibody. Several lines in which the antibody detected a protein of the expected molecular weight (62 kd for the Ad5 fiber protein) were selected for further study including 211A, 211B and 211R. The 211A cell line has been deposited with ATCC as described in Example 3.
[0278]Immunoprecipitation analysis using soluble nuclear extracts from these three cell lines and a seminative electrophoresis system demonstrated that the fiber protein expressed is in the functional trimeric form characteristic of the native fiber protein as shown in FIG. 6. The predicted molecular weight of a trimerized fiber is 186 kd. The lane marked 293 lacks fiber while the sublines contain detectable fiber. Under denaturing conditions, the trimeric form was destroyed resulting in detectable fiber monomers as shown in FIG. 6. Those clones containing endogenous E1, newly expressed recombinant E4 and fiber proteins were selected for use in complementing adenovirus gene delivery vectors having the corresponding adenoviral genes deleted as described in Example 2.
[0279]D. Preparation of an E1-Expressing Plasmid for Complementation of E1-Gene-Deleted Adenoviruses
[0280]In order to prepare adenoviral packaging cell lines other than those based on the E1-gene containing 293 cell line as described in Example 1C above, plasmid vectors containing E1 alone or in various combinations with E4 and fiber genes are constructed as described below.
[0281]The region of the adenovirus genome containing the E1a and E1b gene is amplified from viral genomic DNA by PCR as previously described. The primers used are E1L, the 5' or forward primer, and E1R, the 3' or backward primer, having the respective nucleotide sequences 5'CCG AGCTAGCGACTGAAAATGAG3' (SEQ ID NO: 10) and 5'CCTCTCGAG AGACAGC AAGACAC3' (SEQ ID NO: 11). The E1L and E1R primers include the respective restriction sites NheI and XhoI as indicated by the underlines. The sites are used to clone the amplified E1 gene fragment into the NheI/XhoI sites in pMAM commercially available from Clontech (Palo Alto, Calif.) to form the plasmid pDEX/E1 having 11152 bp, the plasmid map of which is shown in FIG. 7.
[0282]The complete nucleotide sequence of pDEX/E1 is listed in SEQ ID NO: 12 where the nucleotide position 1 corresponds to approximately 1454 nucleotides from the 3' end of the pMAM backbone vector sequence. The pDEX/E1 plasmid includes nucleotides 552 to 4090 of the adenovirus genome positioned downstream (beginning at nucleotide position 1460 and ending at 4998 in the pDEX/E1 plasmid) of the glucocorticoid-inducible mouse mammary tumor virus (MMTV) promoter of pMAM. The pMAM vector contains the E. coli gpt gene that allows stable transfectants to be isolated using hypoxanthine/aminopterin/thymidine (HAT) selection. The pMAM backbone occupies nucleotide positions 1-1454 and 5005-11152 of SEQ ED NO: 12.
[0283]E. Generation of an Adenovirus Packaging Cell Line Carrying Plasmids Encoding Functional E1, and Fiber Proteins
[0284]To create separate adenovirus packaging cell lines equivalent to that of the 211 sublines, 211A, 211B and 211R, as described in Example 1C, alternative cell lines lacking adenoviral genomes are selected for transfection with the plasmid constructs as described below. Acceptable host cells include A549, Hela, Vero and the like cell lines as described in Example 1. The selected cell line is transfected with the separate plasmids, pDEX/E1 and pCLF, respectively for expressing E1, and fiber complementary proteins. Following transfection procedures as previously described, clones containing stable insertions of the two plasmids are isolated by selection with neomycin and HAT. Integration of full-length copy of the E1 gene is assessed by PCR amplification from genomic DNA using the primer set E1L/E1R, as described above. Functional insertion of the fiber gene is assayed by staining with the anti-fiber antibody as previously described.
[0285]The resultant stably integrated cell line is then used as a packaging cell system to complement adenoviral gene delivery vectors having the corresponding adenoviral gene deletions as described in Example 2.
[0286]F. Preparation of a Plasmid Containing Two or More Adenoviral Genes for Complementing Gene-Deleted Adenoviruses
[0287]The methods described in the preceding Examples rely on the use of two plasmids, pE4/Hygro and pCLF, or, pCLF and pDEX/E1 for generating adenoviral cell packaging systems. In alternative embodiments contemplated for use with the methods of this invention, complementing plasmids containing two or more adenoviral genes for expressing of encoded proteins in various combinations are also prepared as described below. The resultant plasmids are then used in various cell systems with delivery plasmids having the corresponding adenoviral gene deletions. The selection of packaging cell, content of the delivery plasmids and content of the complementing plasmids for use in generating recombinant adenovirus viral vectors of this invention thus depends on whether other adenoviral genes are deleted along with the adenoviral fiber gene, and, if so, which ones.
[0288]1. Preparation of a Complementing Plasmid Containing Fiber and E1 Adenoviral Genes
[0289]A DNA fragment containing sequences for the CMV promoter, adenovirus tripartite leader, fiber gene and bovine growth hormone terminator is amplified from pCLF prepared in Example 1B using the forward primer 5'GACGGATCGGGAGATCTCC3' (SEQ ID NO: 13), that anneals to the nucleotides 1-19 of the pcDNA3 vector backbone in pCLF, and the backward primer 5'CCGCCTCAGAAGCCATAGAGCC3' (SEQ ID NO: 14) that anneals to nucleotides 1278-1257 of the pcDNA3 vector backbone. The fragment is amplified as previously described and then cloned into the pDEX/E1 plasmid, prepared in Example 1D. For cloning in the DNA fragment, the pDEX/E1 vector is first digested with NdeI, that cuts at a unique site in the pMAM vector backbone in pDEX/E1, then the ends are repaired by treatment with bacteriophage T4 polymerase and dNTPs.
[0290]The resulting plasmid containing E1 and fiber genes, designated pE1/Fiber, provides both dexamethasone-inducible E1 function as described for DEX/E1 and expression of Ad5 fiber protein as described above. A schematic plasmid map of pE1/Fiber, having 14455 bp, is shown in FIG. 8.
[0291]The complete nucleotide sequence of pE1/Fiber is listed in SEQ ID NO: 15 where the nucleotide position 1 corresponds to approximately to 1459 nucleotides from the 3' end of the parent vector pMAM sequence. The 5' and 3 ends of the Ad5 μl gene are located at respective nucleotide positions 1460 and 4998 followed by pMAM backbone and then separated from the Ad5 fiber from pCLF by the filled-in blunt ended NdeI site. The 5' and 3' ends of the pCLF fiber gene fragment are located at respective nucleotide positions 10922-14223 containing elements as previously described for pCLF.
[0292]The resultant pE1/Fiber plasmid is then used to complement one or more delivery plasmids expressing E1 and fiber.
[0293]The pE1/Fiber construct is then used to transfect a selected host cell as described in Example 1E to generate stable chromosomal insertions preformed as previously described followed by selection on HAT medium. The stable cells are then used as packaging cells as described in Example 2.
[0294]2. Preparation of a Complementing Plasmid Containing E4 and Fiber Adenoviral Genes
[0295]pCLF prepared as described in Example 1B is partially digested with BglII to cut only at the site in the pcDNA3 backbone. The pE4/Hygro plasmid prepared in Example 1A is digested with BamHI to produce a fragment containing E4 The E4 fragment is then inserted into the BamHI site of pCLF to form plasmid pE4/Fiber. The resultant plasmid provides expression of the fiber gene as described for pCLF and E4 function as described for pE4/Hygro.
[0296]A schematic plasmid map of pE4/Fiber, having 10610 bp, is shown in FIG. 9. The complete nucleotide sequence of pE4/Fiber is listed in SEQ ID NO: 16 where the nucleotide position 1 corresponds to approximately 14 bp from the 3' end of the parent vector pcDNA3 backbone sequence. The 5' and 3 ends of the Ad5 E4 gene are located at respective nucleotide positions 21 and 3149 followed by fused BglII/BamHI sites and pcDNA3 backbone including the CMV promoter again followed by BglII/BamHI sites. The adenovirus leader sequence begins at nucleotide position 4051 and extends to 4366 followed by fused BamHI/BglII sites and the 5' and 3' ends of the fiber gene located at respective nucleotide positions 4372 and 6124.
[0297]Stable chromosonal insertions of pE4/Fiber in host cells are obtained as described above.
Example 2
Preparation of Adenoviral Gene Delivery Vectors Using Adenoviral Packaging Cell Lines
[0298]Adenoviral delivery vectors of this invention are prepared to separately lack the combinations of E1/fiber and E4/fiber. Such vectors are more replication-defective than those previously in use due to the absence of multiple viral genes. A preferred adenoviral delivery vector of this invention that is replication competent but only via a non-fiber means is one that only lacks the fiber gene but contains the remaining functional adenoviral regulatory and structural genes. Furthermore, the adenovirus delivery vectors of this invention have a higher capacity for insertion of foreign DNA.
[0299]A. Preparation of Adenoviral Gene Delivery Vectors Having Specific Gene Deletions and Methods of Use
[0300]To construct the E1/fiber deleted viral vector containing the LacZ reporter gene construct, two new plasmids were constructed. The plasmid pΔE1Bβgal was constructed as follows. A DNA fragment containing the SV40 regulatory sequences and E. coli β-galactosidase gene was isolated from pSVβgal (Promega) by digesting with VspI, filling the overhanging ends by treatment with Klenow fragment of DNA polymerase I in the presence of dNTP's and digesting with Bam H1. The resulting fragment was cloned into the EcoRV and BamHI sites in the polylinker of pΔE1sp1B (Microbix Biosystems, Hamilton, Ontario) to form pΔE1B βgal that therefore contained the left end of the adenovirus genome with the E1a region replaced by the LacZ cassette (nucleotides 6690 to 4151) of pSVβ gal. Plasmid DNA may be prepared by the alkaline lysis method as described by Birnboim and Doly, Nuc. Acids Res., 7:1513-1523 (1978) or by the Quiagen method according to the manufacturer's instruction, from transformed cells used to expand the plasmid DNA was then purified by CsCl-ethidium bromide density gradient centrifugation. Alternatively, plasmid DNAs may be purified from E. coli by standard methods known in the art (e.g. see Sambrook et al.)
[0301]The second plasmid (pDV44), prepared as described herein, is derived from pBHG10, a vector prepared as described by Bett et al., Proc. Natl. Acad. Sci., USA, 91:8802-8806 (1994), now described in International Application Publication Number WO 9500655, with methodology well known to one of ordinary skill in the art and also is commercially available from Microbix, which contains an Ad5 genome with the packaging signals at the left end deleted and the E3 region (nucleotides 28133:30818) replaced by a linker with a unique site for the restriction enzyme PacI. An 11.9 kb BamHI fragment, which contains the right end of the adenovirus genome, is isolated from pBHG10 and cloned into the BamHI site of pBS/SK(+) to create plasmid p11.3 having approximately 14,658 bp. A schematic of the plasmid map is shown in FIG. 13. The p11.3 plasmid was then digested with PacI and SalI to remove the fiber, E4, and inverted terminal repeat (ITR) sequences.
[0302]This fragment was replaced with a 3,4 kb fragment containing the ITR segments and the E4 gene which was generated by PCR amplification from pBHG10 using the following oligonucleotide sequences (5' TGTACACCG GATCCGGCGCACACC3' SEQ ID NO: 17) and (5'CACAACGAGCTCAATTAATTAATTGCCACATCCTC3' SEQ ED NO: 18). These primers incorporated sites for PacI and BamHI. Cloning this fragment into the PacI and blunt ended SalI sites of the p 11.3 backbone resulted in a substitution of the fused ITRs, E4 region and fiber gene present in pBHG10, by the ITRs and E4 region alone. The resultant p11.3 plasmid containing the ITR and E4 regions, now called plasmid pDV43 a, was then digested with BamHI. This BamHI fragment was then used to replace a BamHI fragment in pBHG10 thereby creating pDV44 in a pBHG 10 backbone.
[0303]In an alternative approach to preparing pDV44 with an additional subcloning step to facilitate the incorporation of restriction cloning sites, the following cloning procedure was performed. pDV44 as above was constructed by removing the fiber gene and some of the residual E3 sequences from pBHG10 (Microbix Biosystems). As above, to simplify manipulations, the 11.9 kb BamHI fragment including the rightmost part of the Ad5 genome was removed from pBHG10 and inserted into pBS/SK. The resulting plasmid was termed p11.3. The 3.4 kb DNA fragment corresponding to the E4 region and both ITRs of adenovirus type 5 was amplified as described above from pBHG10 using the oligonucleotides listed above and subcloned into the vector pCR2.1 (Invitrogen) to create pDV42. This step is the additional cloning step to facilitate the incorporation of a SalI restriction site. pD V42 was then digested with PacI, which cuts at a unique site (bold type) in one of the PCR primers, and with SalI, which cuts at a unique site in the pCR2.1 polylinker. This fragment was used to replace the corresponding PacI/XhoI fragment of p11.3 (the pBS polylinker adjacent to the Ad DNA fragment contains a unique XhoI site), creating pDV43. Finally, pDV44 was constructed by replacing the 11.9 kb BamHI fragment or pBHG10 by the analogous BamHI fragment of pDV43. As generated in the first procedure, pDV44 therefore differs from pBHG10 by the deletion of Ad5 nucleotides 30819:32743 (residual E3 sequences and all but the 3'-most 41 nucleotides of the fiber open reading frame).
[0304]Thus, to summarize, the cloning procedures described above result in the production of a fiber-deleted Ad5 genomic plasmid (pDV44) that was constructed by removing the fiber gene and some of the residual E3 sequences from pBHG10 (FIG. 16A). pDV44 contains a wild-type E4 region, but only the last 41 nucleotides of the fiber ORF (this sequence was retained to avoid affecting expression of the adjacent E4 transcription unit). Both pBHG10 and pDV44 contain unpackageable Ad5 genomes, and must be rescued by cotransfection and subsequent homologous recombination with DNA carrying functional packaging signals. In order to generate vectors marked with a reporter gene, either pDV44 or pBHG10 was cotransfected with pΔE1Bβgal, which contains the left end of the Ad5 genome with an SV40-driven B-galactosidase reporter gene inserted in place of the E1 region.
[0305]In general, and as described below, the method for virus production by recombination of plasmids followed by complementation in cell culture involves the isolation of recombinant viruses by cotransfection of any one of the adenovirus packaging cell systems prepared in Example 1, namely 211A, 211B, 211R, A549, Vero cells, and the like, with plasmids carrying sequences corresponding to viral gene delivery vectors.
[0306]A selected cell line is plated in dishes and cotransfected with pDV44 and pΔE1Bβ gal using the calcium phosphate method as described by Bett et al., Proc. Natl. Acad. Sci., USA, 97:8802-8806 (1994). Recombination between the overlapping adenovirus sequences in the two plasmids leads to the creation of a full-length viral chromosome where pDV44 and pΔE1Bβ gal recombine to form a recombinant adenovirus vector having multiple deletions. The deletion of E1 and of the fiber gene from the viral chromosome is compensated for by the sequences integrated into the packaging cell genome, and infectious virus particles are produced. The plaques thus generated are isolated and stocks of the recombinant virus are produced by standard methods.
[0307]A pDV44-derived virus is expected to be replication-defective due to the fiber deletion, so that the cells in which it is grown must complement this defect. The 211B cell line (a derivative of 293 cells which expresses the wild-type (wt) AD5 fiber and is equivalent to 211A on deposit with ATCC as described in Example 3) was used for rescue and propagation of the virus described here. pDV44 and pΔE1Bgal were cotransfected into 211B cells, and the monolayers were observed for evidence of cytopathic effect (CPE). Briefly, for virus construction, cells were transfected with the indicated plasmids using the Gibco Calcium Phosphate Transfection system according to the manufacturer's instructions and observed daily for evidence of CPE.
[0308]One of a total of 58 transfected dishes showed evidence of spreading cell death at day 15. A crude freeze-thaw lysate was prepared from these cells and the resulting virus (termed Ad5.βgal.ΔF) was plaque purified twice and then expanded. To prepare purified viral preparations, cells were infected with the indicated Ad and observed for completion of CPE. Briefly, at day zero, 211B cells were plated in DMEM plus 10% fetal calf serum at approximately 1×107 cells/150 cm2 flask or equivalent density. At day one, the medium was replaced with one half the original volume of fresh DMEM containing the indicated Ad, in this case Ad5.βgal.ΔF, at approximately 100 particles/cell. At day two, an equal volume of medium was added to each flask and the cells were observed for CPE. Two to five days after infection, cells were collected and virus isolated by lysis via four rapid freeze-thaw cycles. Virus was then purified by centrifugation on preformed 15-40% CsCl gradients (111,000×g for three hours at 4° C.). The bands were harvested, dialyzed into storage buffer (10 mM Tris-pH 8.1, 0.9% NaCl, and 10% glycerol), aliquoted and stored at -70° C. Purified Ad5.βgal.ΔF virus particles containing human adenovirus Ad5.βgal.ΔF genome (described further below) have been deposited with the ATCC on Jan. 15, 1999 as further described in Example 3.
[0309]For viral titering, as necessary in the below Examples, Ad preparations were titered by plaque assay on 211B cells. Cells were plated on polylysine-coated 6 well plates at 1.5×106 cells/well. Duplicate dilutions of virus stock were added to the plates in 1 ml/well of complete DMEM. After a five hour incubation at 37° C., virus was removed and the wells overlaid with 2 ml of 0.6% low-melting agarose in Medium 199 (Gibco). An additional 1 ml of overlay was added at five day intervals.
[0310]As a control, the first-generation virus Ad5.βgal.wt, which is identical to Ad5.βgal.ΔF except for the fiber deletion, was constructed by cotransfection of pBHG10 and pΔE1Bβgal (FIG. 16B). In contrast to the low efficiency of recovery of the fiberless genome (1/58 dishes), all of 9 dishes cotransfected with pΔE1Bβgal and pBHG10 produced virus.
[0311]In a preferred embodiment of this invention as more fully described herein and below, a delivery plasmid is prepared that does not require the above-described recombination events to prepare a viral vector having a fiber gene deletion. In one embodiment, a single delivery plasmid containing all the adenoviral genome necessary for packaging but lacking the fiber gene is prepared from plasmid pFG140 containing full-length Ad5 that is commercially available from Microbix. The resultant delivery plasmid referred to as pFG140-f is then used with pCLF stably integrated cells as described above to prepare a viral vector lacking fiber. In a preferred aspect of this invention, the fiber gene is replaced with a therapeutic gene of interest for preparing a therapeutic delivery adenoviral vector. Other embodiments including production of fiberless vector with a complete TPL are described in Example 5.
[0312]Vectors for the delivery of any desired gene and preferably a therapeutic gene are prepared by cloning the gene of interest into the multiple cloning sites in the polylinker of commercially available pΔE1sp1B (Microbix Biosystems), in an analogous manner as performed for preparing p E1Bβ gal as described above. The same cotransfection and recombination procedure is then followed as described herein to obtain viral gene delivery vectors as further discussed in later Examples.
[0313]1. Characterization of the Ad5.βgal.ΔF Genome
[0314]To confirm that the vector genomes had the expected structures and that the fiber gene was absent from the Ad5.βgal.ΔF chromosome, the DNA isolated from viral particles was analyzed. Briefly, purified viral DNA was obtained by adding 10 μl of 10 mg/ml proteinase K, 40 μl of 0.5 M EDTA and 50 μl of 10% SDS to 800 μl of adenovirus-containing culture supernatant. The suspension was then incubated at 55° C. for 60 minutes. The solution was then extracted once with 400 μl of a 24:1 mixture of chloroform:isoamyl alcohol. The aqueous phase was then removed and precipitated with sodium acetate/ethanol. The pellet was washed once with 70% ethanol and lightly dried. The pellet was then suspended in 40 μl of 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Genomic DNA from both Ad5.βgal.wt and Ad5.βgal. AF produced the expected restriction patterns (FIG. 17A) following digestion with either EcoRI (FIG. 17B) or with NdeI (data not shown). Southern blotting, performed with standard methods, with labeled fiber DNA as a probe demonstrated the presence of fiber sequence in Ad5.βgal.wt but not in Ad5.βgal.ΔF DNA (FIG. 17C). As a positive control, the blot was stripped and reprobed with labeled E4 sequence. Fiber and E4 sequences were detected by using labeled inserts from pCLF and pE4/Hygro, respectively. As expected, E4 signal was readily detectable in both genomes at equal intensities (FIG. 17C). The complete nucleotide sequence of Ad5.βgal.ΔF is presented in SEQ ID NO: 27 and is contained in the virus particle on deposit with ATCC.
[0315]2. Characterization of the Fiberless Adenovirus Ad5.βgal.ΔF
[0316]To verify that Ad5.βgal.ΔF was fiber-defective, 293 cells (which are permissive for growth of E1-deleted Ad vectors but do not express fiber) were infected with Ad5.βgal.ΔF or with Ad5.βgal.wt. Twenty-four hours post infection, the cells were stained with polyclonal antibodies directed either against fiber or against the penton base protein. Cells infected with either virus were stained by the anti-penton base antibody, while only cells infected with the Ad5.βgal.wt control virus reacted with the anti-fiber antibody. This confirms that the fiber-deleted Ad mutant does not direct the synthesis of fiber protein.
[0317]3. Growth of the Fiber-Deleted Ad5.βgal.ΔF Vector in Complementing Cells0
[0318]Ad5.βgal.ΔF was found to readily be propagated in 211B cells. As assayed by protein concentration, CsCl-purified stocks of either Ad5.βgal.ΔF or Ad5.βgal.wt contained similar numbers of viral particles (Table 1), and the particles appeared to band normally on CsCl gradients. However, infectivity of the Ad5.βgal.ΔF particles was lower than the Ad5.βgal.wt control, as indicated by an increased particle/PFU ratio (Table 1). This is likely due to a reduced amount of fiber protein incorporated into mutant particles during growth in the
TABLE-US-00003 TABLE 3 CsCl- Particle/ purified Particles/ PFU Virus prepn Cell line mla PFU/mlb ratio Fiber source Ad5.βgal.wt 1 211B 7.4 × 10'' 7.5 × 1010 10 Ad chromosome 2 211B 3.0 × 1011 5.0 × 109 60 Ad chromosome Ad5.βgal.ΔF 3 2UB 7.7 × 1011 3.5 × 108 2,200 Packaging cells 4 211B 1.9 × 1012 2.3 × 109 808 Packaging cells 5 293 4.5 × 1011 9.5 × 106 47,400 None 6 293 3.4 × 1011 3.5 × 107 9,700 None ''Calculated from viral protein concentration (lug of protein = 4 × 109 particles). bAssayed by plaquing on 211B cells.
[0319]*Particle numbers and infectious titers of representative adenovirus preps. Each line represents a single CsCl-purified preparation of the indicated virus. Particle numbers were calculated from viral protein concentration (1 μg protein=4×109 particles). Pfu was assayed by plaquing on 211B cells (see above).
[0320]211B cells (see below). Ad5.βgal.ΔF was also found to plaque more slowly than the control virus. When plated on 211B cells, Ad5.βgal.wt plaques appeared within 5-7 days, while plaques of Ad5.βgal.ΔF continued to appear until as much as 15-18 days post infection. Despite their slower formation, the morphology of Ad5.βgal.ΔF plaques was essentially normal.
[0321]4. Production of Fiberless Ad5.βgal.ΔF Particles
[0322]As Ad5.βgal.ΔF represents a true fiber null mutation and its stocks are free of helper virus, the fiber mutant phenotype was readily investigated. A single round of growth in cells (such as 293) which do not produce fiber generating a homogeneous preparation of fiberless Ad allowed for the determination of whether such particles would be stable and/or infectious. Either Ad5.flgal.wt or Ad5.βgal.ΔF was grown in 293 or 211B cells, and the resulting particles purified on CsCl gradients as previously described. Ad5.βgal.ΔF particles were readily produced in 293 cells at approximately the same level as the control virus and behaved similarly on the gradients, indicating that there was not a gross defect in morphogenesis of fiberless capsids (Table 1).
[0323]As shown in FIG. 18, particles of either virus contained similar amounts of penton base regardless of the cell type in which they were grown. This demonstrated that fiber is not required for assembly of the penton base complex into virions. However, as predicted, the Ad5.βgal.ΔF particles produced in 293 cells did not contain fiber protein. 211B-grown Ad5.βgal.ΔF also contained less fiber than the Ad5.βgal.wt control virus (FIG. 18). Importantly, the infectivities of the different viral preparations on epithelial cells (Table 1) correlated with the amount of fiber protein present. The fiberless Ad particles were several thousand-fold less infectious than the first-generation vector control on a per-particle basis, while infectivity of 211B-grown Ad5.βgal.ΔF was only 50-100 fold less than that of Ad5.βgal.wt. These studies confirmed fiber's crucial role in infection of epithelial cells via CAR binding.
[0324]5. Composition and Structure of the Fiberless Ad5.βgal.ΔF Particles
[0325]The proteins contained in particles of 293-grown Ad5.βgal.ΔF were compared to those in Ad5.βgal.wt, to determine whether proteolysis or particle assembly was defective in this fiber null mutant (data not shown). The overall pattern of proteins in the fiberless particles was observed to be quite similar to that of a first-generation vector, with the exception of reduced intensity of the composite band resulting from both proteins IIIa and IV (fiber) (data not shown). The fiberless particles also had a reduced level of protein VII. Although substantial amounts of uncleaved precursors to proteins VI, VII, and VIII were not seen, it is possible that the low-molecular weight bands migrating ahead of protein VII represent either aberrantly cleaved viral proteins or their breakdown products.
[0326]Cryo-electron microscopy was used to more closely examine the structure of the 293 grown Ad5.βgal.ΔF and of Ad5.βgal.wt. The fiber, which consists of an extended stalk with a knob at the end, was faintly visible in favorable orientations of wild-type Ad5 particles, but not in images of the fiberless particles (data not shown). Filamentous material likely corresponding to free viral DNA was seen in micrographs of fiberless particles. This material was also present in micrographs of the first-generation control virus, albeit at much lower levels.
[0327]Three-dimensional image reconstructions of fiberless and wild-type particles at ˜20 Å resolution showed similar sizes and overall features, with the exception that fiberless particles lacked density corresponding to the fiber protein. The densities corresponding to other capsid proteins, including penton base and proteins IIIa, VI, and IX, were comparable in the two structures. This confirms that absence of fiber does not prevent assembly of these components into virions. The fiber was truncated in the wild-type structure as only the lower portion of its flexible shaft follows icosahedral symmetry. The RGD protrusions on the fiberless penton base were angled slightly inward relative to those of the wild-type structure. Another difference between the two penton base proteins was that there is a ˜30 Å diameter depression in the fiberless penton base around the five-fold axis where the fiber would normally sit. The Ad5 reconstructions confirm that capsid assembly, including addition of penton base to the vertices, is able to proceed in the complete absence of fiber.
[0328]6. Integrin-Dependent Infectivity of Fiberless Ad5.βgal.ΔF Particles
[0329]While attachment via the viral fiber protein is a critical step in the infection of epithelial cells, an alternative pathway for infection of certain hematopoietic cells has been described. In this case, penton base mediates both binding to the cells (via 132 integrins) and internalization (through interaction with avintegrins). Particles lacking fiber might therefore be expected to be competent for infection of these cells, even though on a per-particle basis they are several thousand-fold less infectious than normal Ad vectors on epithelial cells.
[0330]To investigate this, THP-1 monocytic cells were infected with Ad5.βgal.wt or with Ad5.βgal.ΔF grown in the absence of fiber. Infection of THP-1 cells was assayed by infecting 2×105 cells at the indicated m.o.i. in 0.5 ml of complete RPML. Forty-eight hours post-infection, the cells were fixed with glutaraldehyde and stained with X-gal, and the percentage of stained cells was determined by light microscopy.
[0331]The results of the infection assay showed that the fiberless particles were only a few-fold less infectious than first-generation Ad on THP-1 cells (FIG. 19A). In contrast to this, very large differences were seen in plaquing efficiency on epithelial (211B) cells (Table 1). Infection of THP-1 cells by either Ad5.βgal.ΔF or Ad5.βgal.wt was not blocked by an excess of soluble recombinant fiber protein, but could be inhibited by the addition of recombinant penton base (FIG. 19B). These results indicate that the fiberless Ad particles use a fiber-independent pathway to infect these cells. Furthermore, the lack of fiber protein did not prevent Ad5.βgal.ΔF from internalizing into the cells and delivering its genome to the nucleus, demonstrating that fiberless particles are properly assembled and are capable of uncoating.
[0332]The foregoing results with the recombinant viruses thus produced indicates that they can be used as gene delivery tools both in cultured cells and in vivo as described more fully in the Examples. For example, for studies of the effectiveness and relative immunogenicity of multiply-deleted vectors, virus particles are produced by growth in the packaging lines described in Example 1 and are purified by CsCl gradient centrifugation. Following titering, virus particles are administered to mice via systemic or local injection or by aerosol delivery to lung. The LacZ reporter gene allows the number and type of cells which are successfully transduced to be evaluated. The duration of transgene expression is evaluated in order to determine the long-term effectiveness of treatment with multiply-deleted recombinant adenoviruses relative to the standard technologies which have been used in clinical trials to date. The immune response to the improved vectors described here is determined by assessing parameters such as inflammation, production of cytotoxic T lymphocytes directed against the vector, and the nature and magnitude of the antibody response directed against viral proteins.
[0333]Versions of the vectors which contain therapeutic genes such as CFTR for treatment of cystic fibrosis or tumor suppressor genes for cancer treatment are evaluated in the animal system for safety and efficiency of gene transfer and expression. Following this evaluation, they are used as experimental therapeutic agents in human clinical trials.
[0334]B. Retargeting of Adenoviral Gene Delivery Vectors by Producing Viral Particles Containing Different or Altered Fiber Proteins
[0335]As the specificity of adenovirus binding to target cells is largely determined by the fiber protein, viral particles that incorporate modified fiber proteins or fiber proteins from different adenoviral serotypes (pseudotyped vectors) have different specificities. Thus, the methods of expression of the native Ad5 fiber protein in adenovirus packaging cells as described above is also applicable to production of different fiber proteins.
[0336]In one aspect of invention, chimeric fiber proteins are produced according to the methods of Stevenson et al., J. Virol, 69:2850-2857 (1995). The authors showed that the determinants for fiber receptor binding activity are located in the head domain of the fiber and that isolated head domain is capable of trimerization and binding to cellular receptors. The head domains of adenovirus type 3 (Ad3) and Ad5 were exchanged in order to produce chimeric fiber proteins. Similar constructs for encoding chimeric fiber proteins for use in the methods of this invention are contemplated. Thus, instead of the using the intact Ad5 fiber-encoding construct prepared in Example 1 as a complementing viral vector in adenoviral packaging cells, the constructs described herein are used to transfect cells along with E4 and/or E1-encoding constructs.
[0337]Briefly, full-length Ad5 and Ad3 fiber genes were amplified from purified adenovirus genomic DNA as a template. The Ad5 and Ad3 nucleotides sequences are available with the respective GenBank Accession Numbers M18369 and M12411. Oligonucleotide primers are designed to amplify the entire coding sequence of the full-length fiber genes, starting from the start codon, ATG, and ending with the termination codon TAA. For cloning purposes, the 5' and 3' primers contain the respective restriction sites BamHI and NotI for cloning into pcDNA plasmid as described in Example 1A. PCR is performed as described above.
[0338]The resultant products are then used to construct chimeric fiber constructs by PCRgene overlap extension, as described by Hortonerai, BioTechniques, 5:525-535 (1990). The Ad5 fiber tail and shaft regions (5TS; the nucleotide region encoding amino acid residue positions 1 to 403) are connected to the Ad3 fiber head region (3H; the nucleotide region encoding amino acid residue positions 136 to 319) to form the 5TS3H fiber chimera. Conversely, the Ad3 fiber tail and shaft regions (3TS; the nucleotide region encoding amino acid residues positions 1 to 135) are connected to the Ad5 fiber head region (5H; the nucleotide region encoding the amino acid residue positions 404 to 581) to form the 3TS5H fiber chimera. The fusions are made at the conserved TLWT (SEQ ED NO: 19) sequence at the fiber shaft-head junction.
[0339]The resultant chimeric fiber PCR products are then digested with BamHI and NotI for separate directional ligation into a similarly digested pcDNA 3.1. The TPL sequence is then subcloned into the BamHI as described in Example 1A for preparing an expression vector for subsequent transfection into 211 cells as described above or into the alternative packaging cell systems as previously described. The resultant chimeric fiber construct-containing adenoviral packaging cell lines are then used to complement adenoviral delivery vectors as previously described. Other fiber chimeric constructs are obtained using a similar approach with the various adenovirus serotypes known.
[0340]In an alternative embodiment, the methods of this invention contemplate the use of the modified proteins including novel epitopes as described by Michael et al., Gene Therapy, 2:660-668 (1995) and in International Publication WO 95/26412, the disclosures of which are incorporated by reference herein. Both publications describe the construction of a cell-type specific therapeutic viral vector having a new binding specificity incorporated into the virus concurrent with the destruction of the endogenous viral binding specificity. In particular, the authors described the production of an adenoviral vector encoding a gastrin releasing peptide (GRP) at the 3' end of the coding sequence of the Ad5 fiber gene. The resulting fiber-GRP fusion protein was expressed and shown to assemble functional fiber trimers that were correctly transported to the nucleus of HeLa cells following synthesis.
[0341]Based on the teachings in the paper and International Publication, similar constructs are contemplated for use in the complementing adenoviral packaging cell systems of this invention for generating new adenoviral gene delivery vectors that are targetable, replication-deficient and less immunogenic. Heterologous ligands contemplated for use herein to redirect fiber specificity range from as few as 10 amino acids in size to large globular structures, some of which necessitate the addition of a spacer region so as to reduce or preclude steric hindrance of the heterologous ligand with the fiber or prevent trimerization of the fiber protein. The ligands are inserted at the end or within the linker region. Preferred ligands include those that target specific cell receptors or those that are used for coupling to other moieties such as biotin and avidin.
[0342]A preferred spacer includes a short 12 amino acid peptide linker composed of a series of serines and alanine flanked by a proline residue at each end. One of ordinary skill in the art is familiar with the preparation of linkers to accomplish sufficient protein presentation and for altering the binding specificity of the fiber protein without compromising the cellular events that follow viral internalization. Moreover, within the context of this invention, preparation of modified fibers having ligands positioned internally within the fiber protein and at the carboxy terminus as described below are contemplated for use with the methods described herein.
[0343]The preparation of a fiber having a heterologous binding ligand is prepared essentially as described in the above-cited paper. Briefly, for the ligand of choice, site-directed mutagenesis is used to insert the coding sequence for a linker into the 3' end of the Ad5 fiber construct in pCLF as prepared in Example 1.
[0344]The 3' or antisense or mutagenic oligonucleotide encodes a preferred linker sequence of ProSerAlaSerAlaSerAlaSerAlaProGlySer (SEQ ID NO: 20) followed by a unique restriction site and two stop codons, respectively, to allow the insertion of a coding sequence for a selected heterologous ligand and to ensure proper translation termination. Flanking this linker sequence, the mutagenic oligonucloetide contains sequences that overlap with the vector sequence and alio its incorporation into the construct. Following mutagenesis of the pCLF sequence adding the linker and stop codon sequences, a nucleotide sequence encoding a preselected ligand is obtained, linkers corresponding to the unique restriction site in the modified construct are attached and then the sequence is cloned into linearized corresponding restriction site.
[0345]The resultant fiber-ligand construct is then used to transfect 211 or the alternative cell packaging systems previously described to produce complementing viral vector packaging systems for use with the methods of this invention.
[0346]In a further embodiment, intact fiber genes from different Ad serotypes are expressed by 211 cells or an alternative packaging system as previously described. A gene encoding the fiber protein of interest is first cloned to create a plasmid analogous to pCLF, and stable cell lines producing the fiber protein are generated as described above for Ad5 fiber. The adenovirus vector described which lacks the fiber gene is then propagated in the cell line producing the fiber protein relevant for the purpose at hand. As the only fiber gene present is the one in the packaging cells, the adenoviruses produced contain only the fiber protein of interest and therefore have the binding specificity conferred by the complementing protein. Such viral particles are used in studies such as those described above to determine their properties in experimental animal systems.
Example 3
Deposit of Materials
[0347]The following cell lines and plasmids have been deposited on Sep. 25, 1996, with the American Type Culture Collection, 10801 University Blvd, Manassas, Va., USA (ATCC) under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty):Plasmid pE4/Hygro (accession number 97739), Plasmid pCLF (accession number 97737), 211 Cell Line (accession number CRL-12193) and 211A Cell Line (accession number CRL-12194).
[0348]The following virus, Ad5.βgal.ΔF, was deposited on Jan. 15, 1999, with the ATCC as listed above and provided with accession number VR2636.
[0349]Additionally, plasmids pDV60, pDV67, pDV69, pDV80 and pDV90 were deposited at the ATCC on Jan. 5, 2000 and provided with accession numbers PTA-1144, PTA-1145, PTA-1146, PTA-1147 and PTA-1148 respectively.
Example 4
Complementation of Fiber-Defective and Fiber-Modified Virus
[0350]The native fiber protein is a homotrimer (Henry L. J. et al., J. Virol. (55:5239-5246 (1994)), and trimerization is essential for assembly of the penton/fiber complex (Novelli A et al., J. Biol. Chem., 266:9299-9303 (1991)). To assess the multimeric structure of the recombinant fiber protein produced by the cell lines, cells were labeled with 50 μCi/ml [35S] Translabel (ICN) for two hours at 37° C., lysed in RIPA buffer, and fiber protein was immunoprecipitated as described (Harlow E et al., Antibodies. Cold Spring Harbour Laboratory, Cold Spring Harbor (1988). Immune complexes were collected on Protein A-Sepharose beads (Pierce), extensively washed with RIPA buffer, and incubated at room temperature in 0.1 M triethylamine, pH 11.5 to release bound fiber protein. A portion of the precipitated fiber was electrophoresed on a 8% SDS-PAGE gel under denaturing (1% SDS in loading buffer, samples boiled for 5 minutes) or semi-native (0.1% SDS in loading buffer, samples not heated) conditions.
[0351]As seen in FIG. 13, lines 211A, 211B, and 211R, but not the control 293 cells, expressed an immunologically reactive protein which migrated at the predicted molecular weight for trimer (186 kD) under seminative conditions and for monomer (62 IcD) under denaturing conditions. The behavior of the precipitated fiber was indistinguishable from that of purified baculovirus-produced recombinant Ad2 fiber (Wickham T et al., Cell 73:309-319 (1993)) (the 58 kD Ad2 and 62 kD Ad5 fibers have very similar mobilities under these conditions).
[0352]To determine whether the fiber-expressing lines could support the growth of a fiber-defective adenovirus, we performed one-step growth experiments using the temperature-sensitive fiber mutant Ad U5ts\42 (the gift of Harold Ginsberg). At the restrictive temperature (39.5° C.), this mutant produces an underglycoslyated fiber protein which is not incorporated into mature virions (Chee-Sheung C. C et al., J. Virol 42: 932-950 (1982)). This results in the accumulation of non-infectious viral particles. We asked whether the recombinant fiber protein expressed by our cell lines could complement the H5ts142 defect and rescue viral growth.
[0353]Cell lines 293, 211A, 211B and 211R (2×106 cells/sample) were infected with H5M42 at 10 pfu/cell. 48 hours later, cells were detached with 25 mM EDTA and virus was harvested by four rapid freeze-thaw cycles. Debris was removed by a 10 minute spin at 1500×g, and viral titers determined by fluorescent focus assay (Thiel J. F et al., Proc. Soc. Exp. Biol. Med. 725:892-895 (1967)) on SW480 cells with a polyclonal anti-penton base Ab (Wickham T et al., Cell 75:309-319 (1993)). As shown in FIG. 14, the fiber mutant virus replicated to high-titers in 293 cells at 32.5° C. (the permissive temperature), but to a much lower extent at the restrictive temperature of 39.5° C. The fiber-producing packaging lines 211A, 211B, or 211R supported virus production at 39° C. to levels within two- to three-fold of those seen at the permissive temperature in 293 cells, indicating that these cells provided partial complementation of the fiber defect.
[0354]Interestingly, virus yields from the fiber-producing cell lines were also somewhat higher than those from 293 cells at 32.5° C. (the `permissive` temperature). This suggests that fiber produced by the ts142 virus may be partially defective even at the permissive temperature. Alternatively, a non-specific increase in adenoviral titer could result when viruses are grown in the packaging cells, by a mechanism not involving fiber complementation. However, it was found that viruses with wild type fiber genes (such as Ad.RSVβgal) replicate to identical levels either in our packaging lines or in 293 cells (data not shown). Taken together, these results demonstrate that the observed increase in H5ts42 growth is due to specific complementation of the fiber mutation.
[0355]Even in the fiber-expressing cell lines, the fiber mutant grows to higher titers at 32CC than at 39.5° C. This incomplete complementation may be due to the packaging lines' expression of fiber at a level somewhat below that seen in a wild-type infection (data not shown). A recent study reported an E4-deleted vector which coincidentally reduced fiber protein expression, resulting in a large reduction in the titer of virus produced (Brought et al, J. Virol. 70:6497-6501 (1996)). Another possibility is that the defective ts142 fiber protein produced at the restrictive temperature might form complexes with some of the wild type protein produced by the cells and prevent its assembly into particles.
[0356]Although the fiber proteins of different Ad serotypes differ in the length of their shaft domains and in their receptor-binding knob domains, the N-terminal regions responsible for interaction with the viral penton base are highly conserved Arnberg N et al., Virology 227:239-244 (1997)) (FIG. 15A). This suggests that fibers from many viral serotypes, with their different cell-binding specificities, may be amenable for use in producing gene delivery vectors.
[0357]In order to determine whether the recombinant Ad5 fiber produced by the packaging cells could be incorporated into particles of another adenovirus serotype, adenovirus type 3 was grown either in fiber-producing cell lines or in 293 cells. Viral particles were purified by two sequential centrifugations (3 h at 111,000×g) on preformed 15-40% CsCl gradients to remove soluble cellular proteins and then dialyzed extensively against 10 mM Tris-HCl, pH 8.1, 150 mM NaCl, 10% glycerol. Ad5 fiber protein was detected by immunoblotting using the polyclonal anti-fiber serum, followed by detection with a horseradish peroxidase-conjugated goat anti-rabbit antibody (Kirkegaard and Perry Laboratories) and the ECL chemiluminescence substrate (Amersham). The purified Ad3 particles contained Ad5 fiber protein after a single passage through a fiber-expressing cell line but not after passage through 293 cells (FIG. 15B). Previous work has demonstrated that Ad2 fiber is capable of interacting in vitro with Ad3 penton base (Fender et al., Nature Biotech. 15:52-56 (1997)), and our result demonstrates that the type 5 fiber protein produced by the cells is capable of assembling into complete Ad3 particles.
[0358]A vector based on Ad5 but containing the gene for the Ad7 fiber protein has been described (Gall J. et al., J. Virol. 70:2116-2123 (1996)), as well as Ads containing chimeric fiber genes (Krasnykh et al., J. Virol. 70.6839-6846 (1996) and Stevenson et al., J. Virol. 69:2850-2857 (1995)). Chimeric Ad5/Ad3 vectors have also been reported (Stevenson, S. et al, J. Virol. 77:4782-4790, (1997). Addition of a short peptide linker to the fiber in order to confer binding to a different cellular protein has also been reported (Michael et al, Gene Therapy 2:660-668 (1995). By using packaging technology such as that presented here, Ad vectors equipped with different fiber proteins may be produced simply by growth in cells expressing the fiber of interest, without the time-consuming step of generating a new vector genome for each application.
[0359]Replacing or modifying the fiber gene in the vector chromosome would also require that the new fiber protein bind a receptor on the surface of the cells it which it is to be grown. The packaging cell approach will allow the generation of Ad particles containing a fiber which can no longer bind to its host cells, by a single round of growth in cells expressing the desired fiber gene. This will greatly expand the repertoire of fiber proteins which can be incorporated into particles, as well as simplifying the process of retargeting gene delivery vectors.
[0360]Finally, a novel fiber-independent pathway of infection has recently been described in hematopoietic cells, in which penton base provides the initial virus-cell interaction by binding to integrin amb2 (Huang S. et al., J Virol 70: 4502-4508 (1996)). This suggests that viral particles lacking fiber protein may be useful in targeting gene, delivery to specific cell types via this pathway.
Example 5
Preparation of Alternative TPLs
[0361]The present invention contemplates the use of tripartite leader sequences (TPLs) that are useful in enhancing the expression of complementing adenoviral proteins, particularly fiber protein, for use in preparing an adenoviral gene delivery vector. One preferred TPL is the complete Ad5 tripartite leader contained in complementing vectors such as pDV67 and pDV69, both of which are prepared as described below. The complete Ad5 TPL was constructed by assembling PCR fragments. First, the third TPL exon (exon 3) (nt 9644-9731 of the Ad5 genome) was amplified from Ad5 genomic DNA using the synthetic oligonucleotide primers 5'CTCAACAATTGTGGATCCGTACTCC3'(SEQ ID NO: 28) and 5'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 29). The resulting product was cloned to the BamHI and BglII sites of pΔE 1Sp1a (Microbix Biosystems) using novel sites in the primers (shown in bold) to create plasmid pDV52. A fragment corresponding to the first TPL exon (exon 1), the natural first intron (intron 1), and the second TPL exon (exon 2) (Ad5 nt 6049-7182) was then amplified using primers 5'GGCGCGTTCGGATCCACTCTCTTCC3' (SEQ ID NO:30) and 5'CTA CATGCTAGGCAGATCTCGTTCGGAG3' (SEQ ID NO: 31), and cloned into the BamHI site of pDV52 (again using novel sites in the primers) to create pDV55. This plasmid contains a 1.2 kb BamHI/BglII fragment consisting of the first TPL exon, the natural first intron, and the fused second and third TPL exons. The nucleotide sequence of the complete TPL containing the noted 5' and 3' restriction sites is shown in SEQ ID NO: 32 with the following nucleotide regions identified: 1-6 nt BamHI site; 7-47 nt first leader segment (exon 1); 48-1068 nt natural first intron (intron 1); 1069-1140 nt second leader segment (exon 2); 1141-1146 nt fused BamHI and BglII sites; 1147-1234 nt third leader segment (exon 3); and 1235-1240 nt BglII site.
[0362]TPLs fragments containing two of the three exons, exons in non-native order, or containing either the first or second TPL intron are also constructed for use in preparing complementing plasmids for use in the methods of the present invention. Briefly, DNA fragments containing any combination of 2 TPL exons can be constructed as follows: Exon 1 is amplified from genomic DNA as prepared above by using the oligonucleotides 5'GGCGCGTTCGGATCCACTCTCTTCC3'(SEQ ID NO: 33) and 5'GGGAGTAGATCTCCCAACAG3' (SEQ ID NO: 34). Exon 2 is similarly amplified from the same genomic DNA using oligonucleotides 5'CCCTTTTTTTTGGATCCCTCGCGG3' (SEQ ID NO: 35) and 5'CTACATGCTAGGCAGATCTCGTTCGGAG3' (SEQ ID NO: 36). Exon 3 is amplified using the oligonucleotides 5'CTCAACAATTGTTGGATCCGTACTCC3' (SEQ ID NO: 37) and 5'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 38).
[0363]The amplified exons are ligated together in any desired number and/or order by virtue of the unique BamHI and BglII restriction sites (bold) in the primers for subsequent ligation into a construct analogous to pDV67, prepared as described below, for expression of viral structural genes.
[0364]Similarly, a fragment consisting of the first TPL exon (exon 1), the native first intron (intron 1), and the second TPL exon (exon 2) is produced by amplification from Ad5 genomic DNA with the oligonucleotide pair 5'GGCGCGTTCGGATCC ACTCTCTTCC3' (SEQ ID NO: 39) and 5'CTACATGCTAGGCAGATCT CGTTCGGAG3' (SEQ ID NO: 40). Finally, a fragment consisting of the second TPL exon (exon 2), the native second intron (intron 2), and the third TPL exon (exon 3) is produced by amplification using the oligonucleotides 5'CCCTTTTTTTTGGATCC CTCGCGG3' (SEQ ID NO: 41) and 5'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 42). Either of the intron-containing fragments are used either alone or in combination with another TPL fragment(s) in constructs analogous to pDV67. Introns in addition to adenoviral intron 1 used herein that have been shown to increase the expression of recombinant proteins when included in expression constructs include SV40 VP1 intron, rabbit β-globin intron among others. The use of these alternative intron sequences are contemplated for use in preparing a TPL in the present invention.
Example 6
Preparation and Use of Adenoviral Packaging Cell Lines Containing Plasmids Containing Alternative TPLs
[0365]Plasmids were first constructed as described below that contained TPLs are described above. The resultant plasmids containing different selectable markers such as neomycin or zeocin were then used to prepare stable cell lines for use as complementing vectors for preparing adenoviral vectors for use in the present invention. In a preferred embodiment, the resulting cell lines represent improvements over preexisting fiber-complementing cell lines in that fiber expression is enhanced with the use of alternative TPLs.
[0366]A. pDV60
[0367]pDV60 was constructed by inserting this TPL cassette of SEQ ID NO; 32 into the BamHI site upstream of the Ad5 fiber gene in pcDNA3/Fiber, a neomycin selectable plasmid, prepared as described in Example 1 and also as described by Von Seggern et al., J. Gen Virol., 79: 1461 (1998). The nucleotide sequence of pDV60 is listed in SEQ ID NO: 43.
[0368]B. pDV61
[0369]To construct pDV61, an Asp718/NotI fragment containing the CMV promoter, partial Ad5 TPL, wildtype Ad5 fiber gene, and bovine growth hormone terminator was transferred from pCLF, prepared as described in Example 1 and also as described by Von Seggern et al., J Gen Virol., 79: 1461 (1998), to a zeocin selectable cloning vector referred to as pcDNA3.1/Zeo(+) (commerically available from Invitrogen and the sequence is also available).
[0370]C. pDV67
[0371]In an analogous process, pDV67 containing complete TPL was constructed by transferring an Asp 718/XbaI fragment from pDV60 to the pcDNA3.1/Zeo(+) backbone. The nucleotide sequence of pDV67 is listed in SEQ ED NO: 44.
[0372]D. pDV69
[0373]To prepare pDV69 containing a modified fiber protein, the chimeric Ad3/Ad5 fiber gene was amplified from pGEM5TS3H (Stevenson et al., J. Virol., 69: 2850-2857, 1995)) using the primers 5'ATGGGAT CAAGATGAAGCGCGCAAGACCG3' (SEQ ID NO: 45) and 5'CACTATAGCGGCCGCATTCTCAGTCATCTT3' (SEQ ID NO: 46), and cloned to the BamHI and NotI sites of pcDNA3.1/Zeo(+) via novel BamHI and NotI sites engineered into the primers to create pDV68. Finally, the complete TPL fragment described above was then added to the unique BamHI site of pDV68 to create pDV69. The nucleotide sequence of pDV69 is listed in SEQ ID NO: 47.
[0374]E. Preparation of Stable Adenovirus Packaging Cell Lines
[0375]E1-2a S8 cells are derivatives of the A549 lung carcinoma line (ATCC # CCL 185) with chromosomal insertions of the plasmids pGRE5-2.E1 (also referred to as GRE5-E1-SV40-Hygro construct and listed in SEQ ID NO: 48) and pMNeoE2a-3.1 (also referred to as MMTV-E2a-SV40-Neo construct and listed in SEQ ED NO: 49), which provide complementation of the adenoviral E1 and E2a functions, respectively. This line and its derivatives were grown in Richter's modified medium (BioWhitaker)+10% FCS. E1-2a S8 cells were electroporated as previously described (Von Seggern et al., J. Gen Virol, 79: 1461 (1998)) with pDV61, pDV67, or with pDV69, and stable lines were selected with zeocin (600 μg/ml). The cell line generated with pDV61 is designated 601. The cell line generated with pDV67 is designated 633 while that generated with pDV69 is designated 644. Candidate clones were evaluated by immunofluorescent staining with a polyclonal antibody raised against the Ad2 fiber. Lines expressing the highest level of fiber protein were further characterized.
[0376]For the S8 cell complementing cell lines, to induce E1 expression, 0.3 p.M of dexamethasone was added to cell cultures 16-24 hours prior to challenge with virus for optimal growth kinetics. For preparing viral plaques, 5×105 cells/well in 6 well plates are prepared and pre-induced with the same concentration of dexamethasone the day prior to infection with 0.5 μM included at a final concentration in the agar overlay after infection.
[0377]F. Development of Cell Lines for Complementation of E1.sup.-/E2a.sup.- Vectors
[0378]This example shows the construction of S.8 cells
[0379]The Adenovirus 5 genome was digested with Seal enzyme, separated on an agarose gel, and the 6,095 bp fragment comprising the left end of the virus genome was isolated. The complete Adenovirus 5 genome is registered as Genbank accession #M73260, incorporated herein by reference, and the virus is available from the American Type Culture Collection, Manassas, Va., U.S.A., under accession number VR-5. The ScaI 6,095 bp fragment was digested further with ClaI at bp 917 and BglII at bp 3,328. The resulting 2,411 bp ClaI to BglII fragment was purified from an agarose gel and ligated into the superlinker shuttle plasmid pSE280 (Invitrogen, San Diego, Calif.), which was digested with ClaI and BglII, to form pSE280-E. (FIG. 23). Polymerase chain reaction (PCR) was performed to synthesize DNA encoding an XhoI and SalI restriction site contiguous with Adenovirus 5 DNA bp 552 through 924. The primers which were employed were as follows: 5' end, Ad5 bp 552-585: 5'-GTCACTCGAGGACTCGGTC-GACTGAAAATGAGACATATTATCTGCCA CGGACC-31 (SEQ ID NO: 66) 3' end, Ad5 bp 922-891: 5'-CGAGATCGATCACCTCCGGTACAAGGTTTGGCATAG-3' (SEQ ID NO: 67)
[0380]This amplified DNA fragment (sometimes hereinafter referred to as Fragment A) then was digested with XhoI and ClaI, which cleaves at the native ClaI site (bp 917), and ligated to the XhoI and ClaI sites of pSE280-E, thus reconstituting the 5 (end of the E1 region beginning 8 bp upstream of the ATG codon.
[0381]PCR then was performed to amplify Adenovirus 5 DNA from bp 3,323 through 4,090 contiguous with an EcoRI restriction site. The primers which were employed were as follows: 5' end, Ad5 bp 3323-3360:
TABLE-US-00004 (SEQ ID NO:68) 5'-CATGAAGATCTGGAAGGTGCTGAGGTACGATGAGACC-3'
3' end, Ad5 bp 4090-4060:
TABLE-US-00005 (SEQ ID NO:69) 5'-GCGACTTAAGCAGTCAGCTG-AGACAGCAAGACACTTGCTTGATCCA AATCC-3'
[0382]This amplified DNA fragment (sometimes hereinafter referred to as Fragment B) was digested with BglII, thereby cutting at the Adenovirus 5 BglII site (bp 3,382) and EcoRI, and ligated to the BglII and EcoRI sites of pSE280-AE to reconstruct the complete E1a and E1b region from Adenovirus 5 bp 552 through 4,090. The resulting plasmid is referred to as pSE280-E1 (FIG. 23).
[0383]A construct containing the intact E1 a/b region under the control of the synthetic promoter GRE5 was prepared as follows. The intact E1 a/b region was excised from pSE280-E1, which was modified previously to contain a BamHI site 3' to the E1 gene, by digesting with XhoI and BamHI. The XhoI to BamHI fragment containing the E1 a/b fragment was cloned into the unique XhoI and BamHI sites of pGRE5-2/EB V (FIG. 4, U.S. Biochemicals, Cleveland, Ohio) to form pGRE5-E1 (FIG. 24).
[0384]Bacterial transformants containing the final construct were identified. Plasmid DNA was prepared and purified by banding in CsTFA prior to use for transfection of cells. Construction of plasmid including Adenovirus 5 E2A sequence.
[0385]The Adenovirus 5 genome was digested with BamHI and SpeI, which cut at bp 21,562 and 27,080, respectively. Fragments were separated on an agarose gel and the 5,518 bp BamHI to SpeI fragment was isolated. The 5,518 bp BamHI to SpeI fragment was digested further with SmaI, which cuts at bp 23,912. The resulting 2,350 bp BamHI to SmaI fragment was purified from an agarose gel, and ligated into the superlinker shuttle plasmid pSE280, and digested with BamHI and SmaI to form pSE280-E2 BamHI-SmaI (FIG. 26).
[0386]PCR then was performed to amplify Adenovirus 5 DNA from the SmaI site at bp 23,912 through 24,730 contiguous with NheI and EcoRI restriction sites. The primers which were employed were as follows: 5' end, Ad5 bp 24,732-24,708:
TABLE-US-00006 (SEQ ID NO:70) 5'-CACGAATTCGTCAGCGCTTCTCGTCGCGTCCAAGACCC-3'
3' end, Ad5 bp 23,912-23,934:
TABLE-US-00007 (SEQ ID NO:71) 5'-CACCCCGGGGAGGCGGCGGCGACGGGGACGGG-3'
[0387]This amplified DNA fragment was digested with SmaI and EcoRI, and ligated to the SmaI and EcoRI sites of pSE280-E2 Bam-Sma to reconstruct the complete E2a region from Ad5 bp 24,730 through 21,562. The resulting construct is pSE280-E2a. (FIG. 27.)
[0388]In order to convert the BamHI site at the 3' end of E2a to a SalI site, the E2a region was excised from pSE280-E2a by cutting with BamHI and NheI, and recloned into the unique BamHI and NheI sites of pSE280. (FIG. 27.) Subsequently, the E2a region was excised from this construction with NheI and SalI in order to clone into the NheI and SalI sites of the pMAMneo (Clonetech, Palo Alto, Calif.) multiple cloning site in a 5' to 3' orientation, respectively. The resulting construct is pMAMneo E2a. (FIG. 27).
[0389]Bacterial transformants containing the final pMAMneo-E2a were identified. Plasmid DNA was prepared and purified by banding in CsTFA. Circular plasmid DNA was linearized at the XmnI site within the ampicillin resistance gene of pMAMneo-E2a, and further purified by the phenol/chloroform extraction and ethanol precipitation prior to use for transfection of cells. Transfection and selection of cells.
[0390]In general, this process involved the sequential introduction, by calcium phosphate precipitation, or other means of DNA delivery, of two plasmid constructions each with a different viral gene, into a single tissue culture cell. The cells were transfected with a first construct and selected for expression of the associated drug resistance gene to establish stable integrants. Individual cell clones were established and assayed for function of the introduced viral gene. Appropriate candidate clones then were transfected with a second construct including a second viral gene and a second selectable marker. Transfected cells then were selected to establish stable integrants of the second construct, and cell clones were established. Cell clones were assayed for functional expression of both viral genes.
[0391]In order to determine the most suitable cell lines for the above-mentioned transfections, sequential transfections and selections were carried out with the following parental cell types:
[0392]A549 (ATCC Accession No. CCL-185);
[0393]Hep-2 (ATCC Accession No. CCL-23); or
[0394]KB (ATCC Accession No. CCL-17).
[0395]Appropriate selection conditions were established for both G418 and hygromycin B for all three cell lines by standard kill curve determination.
Transfection of Cell Lines with Plasmids Including E1 and E2a Regions.
[0396]pMAMNeo-E2a was linearized with XmnI with the AmpR gene, introduced into cells by transfection, and cells were selected for stable integration of this plasmid by G418 selection until drug resistant colonies arose. The clones were isolated and screened for E2a expression by staining for E2a protein with a polyclonal antiserum, and visualizing by immunofluorescence. E2a function was screened by complementation of the temperature-sensitive mutant Ad5ts125 virus which contains a temperature-sensitive mutation in the E2a gene. (Van Der Vliet, et al., J. Virology, Vol. 15, pgs. 348-354 (1975)). Positive clones expressing the E2a gene were identified and used for transfection with the 7 kb EcoRV to XmnI fragment from pGRE5-E1 (FIG. 5), which contains the GRE5 promoted E1a/b region plus the hygromycinR gene. Cells were selected for hygromycin resistance and assayed for E1a/b expression by staining with a monoclonal antibody for the E1 protein (Oncogene Sciences, Uniondale, N.Y.). E1 function was assayed by ability to complement an E1-deleted vector. At this point, expression and function of E2a was verified as described above, thus establishing the Expression of both E1a/b and E2a in the positive cell clones.
[0397]One of the transfected A549 cell lines showed good E1a/b and E2a expression and was selected for further characterization. It was designated the S8 cell line.
[0398]G. Preparation of Adenoviral Vectors Containing Ad5.βgal.ΔF Genome in S8 Improved Fiber-Complementing Cell Lines
[0399]To prepare adenoviral vectors containing Ad5.βgal.ΔF in S8 cells containing alternative forms of TPL for enhancing the expression of fiber proteins, the protocol as described in Example 2 for preparing Ad5.βgal.ΔF in 211B cells was followed with the exception of pretreatment with 0.3 μM dexamethasone for 24 hours as described above. Thus, viral particles with the wildtype Ad5 fiber protein on their surface and containing the fiberless Ad5.βgal.ΔF genome were produced in 633 cells. Particles produced in 644 cells also contained the fiberless Ad5.βgal.ΔF genome, but had the chimeric 5T3H fiber protein, with the Ad3 fiber known, on their surface.
[0400]The preparation of the cell lines and demonstration of stable nuclear expression of either wild-type Ad5 fiber protein or chimeric Ad5/Ad3 protein is shown in FIG. 20. In the figure, schematic diagrams are presented of the constructs used to generate the cell lines as well as immunofluorescence results indicating the presence of expressed fiber protein in the nucleus of the cells.
[0401]Thus, these viral preparations, prepared as described herein and in Example 2, are useful for targeting delivery of Ad5.βgal.ΔF fiberless genome with either wild-type or modified fibers, embodiments of which uses have been previously discussed and as further exemplified with the pseudotyping and infectivity results described in Example 7.
Example 7
Pseudotyping and Infectivity of Recombinant Adenoviral Vectors Produced with Improved Fiber-Complementing Cell Lines
[0402]A. Pseudotyping of Ad5.βgal.ΔF
[0403]To verify that adenoviral vectors were produced had altered tropisms, viral particles were purified from either 633 or 644 cells and were then Western blotted and probed with a polyclonal rabbit antibody against the Ad2 fiber (which detects both the Ad5 and chimeric 5T3H fiber proteins.). The results are shown in FIG. 21 where both fiber proteins were detectable confirming pseudotyping.
[0404]B. Infectivity of Cells with 633 or 644 Generated Virus Particles
[0405]The cell lines, 633 or 644, prepared as described above, were infected with the indicated number of particles/cell of Ad5.βgal.ΔF and virus particles produced. Virus was then used to infect, as previously described, selected cell lines as shown in FIG. 22, including 211B, MRC-5 human fibroblasts, A-10 rat aortic endothelial cells, and THP-1 human monocytic cells. Unbound virus was removed by washing the cells and the cells were further incubated at 37° C. for 48 hours. Cells were then fixed with glutaraldehyde and stained with X-gal. The percentage of stained cells was then determined by light microscopy where all experiments were done in triplicate.
[0406]The results shown in FIG. 22 indicate that adenoviral vectors could be retargeted by pseudotyping using packaging cell lines expressing different fiber proteins. The data marked with "none" indicates virus grown in 293 cells and lacking fiber, while "Ad5" indicates virus prepared in 633 cells (containing the wild type fiber) and Ad3 indicates virus prepared in 644 cells (containing the chimeric 5T3H fiber.) Particles containing either fiber were equally infectious on 211B cells, while MRC-5 fibroblasts and THP-1 cells were more readily infected by virus containing the chimeric fiber. The A-10 rat endothelial cells were more readily infected by particles containing the wildtype Ad5 fiber protein.
Example 8
Targeted Gene Delivery Using Viral Vector Particles Lacking Fiber Protein
[0407]An alternative mode of entry for adenoviral infection of hematopoietic cells has been described by Huang, et al., J. Virol., (59:2257-2263 (1995) which does not involve the fiber protein-host cell receptor interaction. As infection of most other cell types does require the presence of fiber protein, vector particles which lack fiber may preferentially infect hematopoietic cells, such as monocytes or macrophages.
[0408]To produce a fiber-free adenovirus vector particle, a vector lacking the fiber gene as described above in Example 2A but containing a gene of interest for delivery is amplified by growth in cells which do not produce a fiber protein, such as the 211 cells prepared in Example 1 or 293 or S8 cells as described herein, thereby producing large numbers of particles lacking fiber protein. The recovered fiber-free viral particles are then used to deliver the inserted gene of interest following the methods of this invention via targeting mechanisms provided by other regions of the adenoviral vector, i.e., via the native penton base.
[0409]A. Construction of an Adenovirus Vector Deleted for E1, E3, and Fiber, and Carrying a Therapeutic Gene of Interest
[0410]A general method of constructing a fiber-deleted Ad vector containing a therapeutic gene of interest (in this example, the Herpes Simplex Virus Thymidine Kinase (TK) gene) is described here. Linear viral DNA is isolated from a preparation of Ad5.βgal.ΔF particles. This DNA is digested with the restriction enzyme ClaI, which removes the leftmost viral sequences including the left ITR, the packaging signals, and part of the SV40-driven β-galactosidase gene. The large ClaI fragment with the remainder of the fiber-deleted viral genome is then isolated by centrifugation on a sodium chloride or sucrose gradient. The plasmid pAdShuttleTK, which contains the left part of the Ad chromosome with an RSV-driven TK gene inserted in place of the E1 region, is linearized by digestion with NotI. The nucleotide sequence of the pAdShuttleTK is shown in SEQ ID NO: 50. The large ClaI fragment of Ad5.βgal.ΔF and the linearized pAdShuttleTK are cotransfected into 211B cells, and an infectious adenovirus genome is generated by homologous recombination. A virus deleted for E1, E3, and fiber that contains the TK cassette in the place of the E1 deletion is thus recovered. A virus containing any desired therapeutic gene of interest can be created in this manner by replacing the TK gene of the example with the gene of interest.
[0411]An alternative method of constructing a fiber-deleted genome containing a therapeutic gene (in this example the retinal degeneration-slow (RDS) gene driven by the CMV immediate early promoter) is described here. RDS is a protein expressed in photoreceptors, and essential for their proper development and functioning. RDS mutations have been implicated in retinal degenerative disorders, and transfer of the wildtype RDS gene by means of an Ad vector provides an avenue towards treating such disorders.
[0412]A plasmid (pDV50) analogous to pΔE1Bβgal but containing a CMV-driven RDS gene was constructed as follows. First, a fragment containing the CMV promoter and enhancer was excised from pCHaMIEP by digestion with HindIII, filling the overhanging ends with the large fragment of E. coli DNA polymerase 1, ligation of BamHI linkers (5'CGCGGATCCCG3' SEQ ID NO: 51) to the blunt ends, and digesting with BamHI. The resulting fragment was then ligated into the BamHI site of pΔE1sp1a (Mikrobix) to create pDV45. A fragment containing the SV40 polyadenylation signal was amplified from pSVPgal (Promega) using the oligonucleotides 5'CTGACAAACTCAGATCTTGTTTATTG3' (SEQ ID NO: 51) and 5'GTCGACTCTAGAGGATCCAGA3' (SEQ ID NO: 52). This fragment was ligated into the BglII site of pDV45 to create pDV46, using the unique BamHI and BglII sites (bold type) in the primers. Finally, the human RDS open reading frame was amplified from the plasmid pRDS-T7 using the oligonucleotides 5'CCGGACTCTAGATGGCAACCATGGCGCTAC3' (SEQ ID NO: 53) and 5'GGAGGGGAAGCTTGGCCCTCAGCCAGCCTCT3' (SEQ ID NO: 54). This fragment was inserted into the HindIII and XbaI sites of pDV46, again using unique restriction sites in the primers, to create pDV50. pDV50 therefore contains a cassette consisting of the CMV promoter, the RDS open reading frame, and the SV40 terminator sequences inserted in place of the Ad5 E1 region.
[0413]In a manner analogous to the construction of Ad5.βgal.ΔF, pDV50 and pD V44 are then co-transfected into 211B cells, and an infectious Ad genome (Ad5.RDS.ΔF) is recovered. A fiber-deleted Ad vector containing any desired gene to be expressed can be constructed by replacing the RDS gene of this example with the gene of interest.
Example 9
Transient Transcomplementation
[0414]Human adenovirus type 5 (Ad5) is being developed as a vector for gene therapy. Its ability to deliver therapeutic genes to cells is mediated by the interaction of the adenoviral fiber protein with the coxsackievirus-adenoviral receptor (CAR). Because a wide-range of cells express CAR, it can be difficult to use adenoviruses to deliver genes to specific cell types. One way to address this is to target the virus to a particular cell type by genetically altering the fiber. However, the genetic manipulations involved in cloning and production of the viruses with altered fibers can be time-consuming. Thus it would be a significant advancement in the field of adenoviral gene therapy to have a more streamlined system for testing modified fiber genes. An in vitro system has thus been developed that involves infection of tissue culture cells with a fiber-deleted Ad and transient co-transfection with a plasmid directing fiber expression. This system allows one to produce and evaluate such modified fibers in the context of a viral particle easily and quickly. In addition this system can be envisioned to actually produce therapeutic quantities of adenoviral vectors with modified fiber proteins, with such fibers having a new tropism added by insertion of a desired ligand into the fiber gene. These fibers may also have the natural tropism (i.e. binding to CAR) ablated.
[0415]Plasmids used were pDV60 and pDV55, prepared as described herein. pDV60 is an pcDNA3.1-based expression plasmid that contains the CMV promoter, Ad5 tripartite leader, an intron, and the Ad5 fiber gene sequence. pDV55 contains no fiber gene and serves as the negative control. Ad5.βgal.ΔF and 211B are described above. 293T cells are identical to 293 cells except they express an integrated SV40 large T antigen gene. HDF cells are human diploid fibroblasts. 293T cells express CAR and av integrins, HDF cells express av integrins but no CAR. Transfections with fiber expression plasmids were performed with Lipofectamine (GIBCO-BRL) using 20 mg DNA and 50 ml Lipofectamine per 15 cm dish. Cells were maintained in DMEM supplemented with 10% fetal bovine serum.
[0416]The fiber deletion mutation of Ad5.βgal.ΔF is complemented in trans by passaging virions through 211B, a cell line that stably expresses functional Ad5 fiber. The present system was designed to complement Ad5.βgal.ΔF by modified fibers expressed from transfected episomal plasmids in 293T cells. The result is a simplified and rapid method to incorporate modified fibers on a viral particle containing the Ad5.βgal.ΔF genome that does not require propagation of the virus.
[0417]The feasibility of transcomplementation of Ad5.βgal.ΔF with episomal fiber-expressing plasmids was demonstrated in the following experiment. 293T cells were transfected with one of two plasmids: pDV55, which expresses no fiber or pDV60, which expresses wildtype Ad5 fiber. Fiber expression persists for at least six days, suggesting that the plasmid is stable as an episome for this amount of time Twenty-four hours after transfection, these cells were infected at 2000 particles/cell with Ad5.βgal.ΔF passaged through 211B cells. Seventy-two hours later, a crude viral lysate (CVL) was generated by exposing the cells to five freeze-thaw cycles. Viral particles were purified by cesium chloride gradient centrifugation. The resulting virions incorporated the fiber expressed from the episomal plasmid, as confirmed by Western blots performed with an antibody specific to the Ad5 fiber.
[0418]To demonstrate the functionality of these virions, the transduction efficiency was tested. The virions containing no fiber (pDV55) or wildtype fiber (pDV60) were applied to monolayers of 293T and HDF cells at different multiplicity of infection (MOI's). 293T cells express CAR and αv integrins; HDF cells express αv integrins but no CAR. After 2 days, the cells were fixed and stained with X-gal to detect the β-galactosidase reporter gene activity. The results showed low transduction efficiency for the pDV55-complemented virions in both cell lines. As expected, the pDV60-complemented virions transduced 293T cells to a high degree but did not transduce HDF cells, indicating that functional fiber proteins had been expressed from the episomal plasmids and incorporated into the virions. This transduction efficiency was comparable to or better than that of Ad5.βgal.ΔF virions passaged through the 211B cells.
[0419]Episomal plasmid transcomplementation system is suitable for quickly expressing and evaluating the properties of modified fibers in the context of a viral particle. Episomal plasmid transcomplementation will also be of great utility for quickly evaluating a bank of modified fibers for other binding properties, including novel tropism and the ablation of the native tropism. In addition to the rapid generation and testing of large numbers of modified fibers, there are other advantages to the Ad5.βgal.ΔF transcomplementation system in terms of production and safety. Episomal plasmid transcomplementation has the inherent advantage over transcomplementation in that it is not necessary to make a stable cell line for every modified fiber with which you want to complement Ad5.βgal.ΔF. Because the Ad5.βgal.ΔF is deleted in E1, E3 and fiber, there is an additional gene deletion compared to other first generation vectors. This makes Ad5.βgal.ΔF more replication defective and presumably safer. In addition, the presence of the fiber gene deletion decreases the opportunity to generate replication-competent virus via recombination in the packaging cells. In terms of production a single Ad vector prep could be retargeted to any number of different cell types simply by transfecting the cells with the appropriate fiber-expression construct.
Example 10
Adenoviral Gene Delivery Vectors Containing the AD37 Fiber Protein
[0420]Adenovirus type 3 7 (subgroup D) has been associated with infections of the eye and genital tract, and may be useful for targeting these tissues or other mucous membranes, as well as other cell types. The tropism of Ad37 is due to the binding preference of its fiber protein, which binds to an as yet-unidentified receptor located on the surface of cells including Chang C, conjunctival epithelial cell line (Huang et al., J. Virology 75(4): 2798-2802 (1999)). As this fiber directs viral infection to cell types different than those infected by Ad5, it is likely to provide a method for targeting gene delivery. This example describes construction of packaging cell lines expressing the Ad37 fiber protein, and their use in generating particles of a fiber-deleted Ad vector (such as Ad5.βgal.ΔF) containing this fiber protein. The fiber protein is attached to the viral capsid by binding to the pentonbase protein through its N-terminus, and the Ad37 fiber was modified in order to make its N-terminal sequence more closely match that of the Ad5 protein to ensure that it would efficiently bind the Ad5 penton base in these vectors.
[0421]1. Construction of an Expression Plasmid for the Ad37 Fiber Protein (pDV80)
[0422]This plasmid uses the same regulatory elements as contained in pDV60, pDV67, and pDV69 to express the Ad37 fiber in packaging lines, and was constructed in two steps. First, the Ad37 fiber open reading frame was amplified from Ad37 genomic DNA (obtained from the ATCC--accession number VR-929) using the synthetic oligonucleotides primers L37 (5' TGT CTT GGA TCC AAG ATG AAG CGC GCC CGC CCC AGC GAAGATGACTTC 3') (SEQ ID NO: 56) and 37FR(5' AAA CAC GGC GGC CGC TCT TTC ATT CTT G 3') (SEQ ED NO: 57). L37 contains nucleotides that differ from the Ad37 genomic sequence in order to add an unique Bam H1 site (bold in the above sequence) and create point mutations to make the N-terminal sequence of the fiber more closely match that of the Ad6 protein (underlined in the above sequence; the start codon is italicized). 37FR incorporates changes to create a unique Not 1 site (bold). The PCR product was inserted into the Bam HI and Not 1 sites of pcDNA3.1 zeo(+) (Invitrogen) to create pDV78. The correct sequence of the Ad37 fiber gene, including the predicted changes, was confirmed by sequencing.
[0423]Second, a 1.2 kb Bam H1/Bgl II fragment containing an adenovirus type 5 tripartite leader was excised from pDV55 (DVS1999) and inserted into the Bam H1 site of pDV78 to create pDV80 (SEQ ID NO:64).
[0424]2. Isolation of Cell Lines Expressing the Ad37 Fiber Protein
[0425]pD V80 DNA was purified using the Qiagen method and electroporated into the adenovirus-complementingcellineE1-2aS8(Gorziglia et al., J. Virology 70(5):4173-4178 (1996)) as previously described (Von Seggern, et al, J. Gen. Virol. 79:1461-1418), and stable clones were selected with 600 μg/ml zeocin (Invitrogen). Clones were expanded and screened for fiber expression by indirect immunofluorescence using a rabbit polyclonal antibody directed against the Ad37 fiber. Two clones (lines 705 and 731) that expressed the protein at a uniformly high level were selected for further study.
[0426]3. Production of Pseudotyped Ad Vector Particles
[0427]To generate vector particles equipped (`pseudotyped`) with the Ad37 fiber protein, the Ad37 fiber-expressing 705 cells were infected (approximately 1000 particles/cell) with Ad5.βgal.ΔF or with Ad5.GFP.ΔF.
[0428]Ad5.βgal.ΔF is prepared as previously described. Ad5.GFP.ΔF was constructed by recombination in bacteria using a modification of the method of (He, et al, PNAS 95:2509-2514 (1998)). First, a fiber-deleted genomic plasmid was constructed by removing the fiber gene from pAdEasyl (He, et al, PNAS 95:2509-2514 (1998)). pDV43 (Von Seggern, et al., J. Virol. 75:1601-1608 (1999)) was digested with Pac 1, the ends blunted by treatment with the large fragment of E. coli DNA polymerase and dNTPs, and the product re-ligated. The resulting plasmid, pDV76, is identical to pDV43 except for loss of the Pac 1 site and contains the right end of the Ad5 genome with E3 and fiber deletions. A 4.2 kb fragment was amplified from pDV76 using the oligonucleotides primers 5'CGC GCT GAC TCT TA GGA CTA GTT TC 3' (SEQ ED NO: 58) (including the unique Spe 1 site in the Ad5 genome, bold) and 5' GCG CTT AAT TAA CAT CAT CAA TAA TAT ACC TTA TTT T 3' (SEQ ID NO: 59) (including a novel Pac 1 site (bold) adjacent to the right Ad5 ITR). This PCR fragment therefore contains nucleotides 27,082 to 35,935 of the Ad5 genome with a deletion of nucleotides 28133 to 32743 (the E3 and fiber genes), and was used to replace the corresponding Spe 1/Pac 1 fragment of PAdEasyl to create pDV77.
[0429]E. coli strain BJ5183 was electroporated with a mixture of pDV77 and Pme I-linearized pAdTrack as described (He et al., 1998), and DNA was isolated from kanamycin-resistant colonies. The resulting plasmid, pDV83, contains a complete E1-, E3-, and fiber-deleted Ad5 genome with a CMV-driven GFP reporter gene inserted at the site of the E1 deletion. The full-length Ad chromosome was isolated by Pac 1 digestion, and transfected to the E1- and fiber-complementing 633 cells (Von Seggern et al., J. Virol January 2000). The recovered virus was then plaque purified by plating on 633 cells and stocks were prepared.
[0430]Ad5-pseudotyped particles were generated by virus growth in 633 cells, which express the wild type Ad5 fiber protein. Viral particles were isolated and purified over CsCl gradients as previously described (Von Seggern et al., J. Virol. 73:1601-1608, 1999). For analysis of viral proteins, ten μg of the purified particles were electrophoresed on 8-16% gradient gels and the protein transferred to nylon membranes. The blot was then probed with rabbit polyclonal antibodies raised against recombinant Ad37 fiber or Ad5 fiber or penton base proteins expressed in baculovirus-infected cells (FIG. 27).
Example 11
Construction of a Fiber Expression Construct Containing a Post-Transcriptional Regulatory Element
[0431]Previous studies have shown that mRNA transcribed from the woodchuck hepatitis virus (WHV) genome contains an element (the WHV post-transcriptional regulatory element, or WPRE) which can increase expression of aprotein encoded by the mRNA via a post-trancriptional mechanism (Loeb et al., Human Gene Therapy 70:2295-2305 (1999)). The WPRE has also been shown to enhance expression of transgenes delivered by retroviral vectors. (Zufferey, R. et al., J. Virol. 73:2886-2892 (1999)). This example describes the construction of a fiber expression construct (pDV90) (SEQ ID NO:6s) containing a WPRE as well as the promoter and TPL sequences as contained in pDV67.
[0432]A plasmid (pBS/tyPRE) which contains the WPRE was obtained from Dr. Thomas Hope, Salk Institute. Digestion of pBS/WPRE with ClaI releases a 600 bp fragment containing the WpRE (nt 193-1684 of the WHV genome.) Following ClaI digestion, the ends of this fragment were filled by treatment with the large fragment of E. coli DNA polymerase 1 in the presence of dNTPs to render them blunt. pDV67 DNA was digested with XbaI (which cuts at a unique site in the transcribed region downstream of the Ad5 fiber open reading frame) and the ends filled by the same treatment. The filled WPRE fragment was then ligated into the filled Xba 1 site of pDV67 to create pDV90. The sequence is found at GenBank accession no. J04514 (entire genome) in Zufferey R. et al., J. Virol. 75:2886-2892 (1999). pDV90 (SEQ ID KO:65) was electroporated into E1-2a S8 cells and stable clones expressing fiber isolated as described previously for pDV80.
Example 12
Construction of an Ad5 Fiber Protein with Heterologous Peptide Sequences Inserted in the HI Loop
[0433]The receptor-binding knob domain of the Ad5 fiber protein contains several surface loops which are attractive candidates for the insertion of heterologous peptide sequence, as an additional ligand for vector targeting. This example describes the construction of a fiber gene which encodes a fiber protein containing a 6 amino acid peptide linker in the HI loop, and retains the ability to trimerize. The modified gene also contains a unique novel restriction site at the position of the linker insertion to facilitate addition of the targeting ligand into the HI loop.
[0434]The Ad5 fiber gene was amplified from Ad5 genomic DNA (ATCC accession number VR-5) using the primers Fiber ATG (51 TGA AGC GCG CAA GAC CGT CTG AAG 31) (SEQ ID NO: 60) and Fiber TAA (5'CAT AAC ACT GCA GAT TCT TTA TTC TTG G 3') (SEQ ID NO: 61), and cloned to the NdeI (filled with the large fragment of E. coli DNA polymerase 1 in the presence of dNTPs) and Pst 1 sites of pT7-7 using a unique Pst 1 site (bold) in the `Fiber TAA` oligo. The resulting plasmid, pT7/fiber, was digested with Xba 1 and Pst 1 to excise the fiber gene, which was then cloned into the Pst 1 and Xba 1 sites of pUC119 to create pUC/fiber. This pUC-derived plasmid contains an origin for single-stranded DNA replication and can therefore be used to create template DNA for site-directed mutagenesis.
[0435]Site-directed mutagenesis was carried out according to the method of Kunkel (T. A. Kunkel, PNAS 52:488-492 (1985)) using the oligonucleotide primer T542 (5' GGT ACA CAG GAA ACA GGA GGT TCC GGA GGT GGA GGA GAC ACA ACT CC 3') (SEQ ID NO: 62). This results in the addition of 18 new bases (underlined) encoding the sequence Gly Gly Ser Gly Gly Gly (SEQ ED NO: 63), with a novel BspE1 site (bold) for the addition of further sequences. The inserted sequence is between Thr542 and Gly543 of the Ad5 fiber protein, in the HI loop. The modified plasmid is termed pDV14.
[0436]Finally, the modified fiber gene was excised from pDV14 by digestion with Pst 1 and Xba 1 and cloned into the Pst 1 and Xba 1 sites of pGEM3Z (Promega) to create pDV18. In vitro transcription/translation experiments with pDV18 (using the TNT® kit, Promega) demonstrated that the modified fiber gene encoded a protein which was capable of trimerizing.
[0437]Alternatively an Ad5 fiber open reading frame (ORF) is amplified from Ad5 genomic DNA (wildtype Ad5 was purchased from the ATCC) using the oligonucleotides 51 ATG GGA TCC AAG ATG AAG CGC GCA AGA CCG 31 (SEQ ID NO: 72) and 5' CAT AAC CTG CAG GAT TCT TTA TTC TTG GGC 3' (SEQ ID NO: 73), and inserted into the BamHI and Pst 1 sites of pGEM-3Zf(+) (Promega Inc., Madison, Wis.) via novel restriction sites (bold type) designed into the primers. The 5' oligonucleotide also contains a G to A change 3 nucleotides 5' of the initial ATG codon (underlined), designed to improve the consensus for translation initiation.
[0438]Site-directed mutagenesis is performed by the method of Kunkel (Proc. Nat. Acad. Sci. 82:488-492 (1985)), using the synthetic oligonucleotide 5' GGT ACA CAG GAA ACA GGA GGT TCC GGA GGT GGA GGA GAC ACA ACT CC 3 (SEQ ID NO: 74). This operation introduced sequence (bold type) encoding 6 novel amino acids (Gly Gly Ser Gly Gly Gly) immediately following Threonine 542 of the Ad5 fiber, and including a unique restriction site for the insertion of further heterologous sequences (underlined). The resulting plasmid (pDV18A) contains the modified fiber gene under the control of the T7 promoter in the parental pGEM-3Zf(+) and can be used for in vitro transcription/translation reactions to produce labeled fiber protein.
Example 13
Use of the Fiber Expression System to Retarget (`Pseudotype`) Hybrid AD/AAV Vectors
[0439]Adenoviral vectors which lack essentially all Ad genes (`helper-dependent` or `gutless` vectors) have recently been developed. In a modification of this idea, vectors (`hybrid` vectors) which contain an adeno-associated virus (AAV) or retroviral genome have been generated. As AAV and retroviral genomes integrate into the chromosome of the target cells, the hybrid Ad/AAV or Ad/retroviral vectors have the potential to provide very long-term gene expression.
[0440]Lieber et al., (J. Virol. 73(11):9314-9324) describe an Ad vector (Ad.AAV1) which contains an AAV vector genome (a transgene insert flanked by the AAV inverted terminal repeats) inserted into the E1 region. When 293 cells are infected by Ad.AAV1, recombination between the AAV sequences generates a minimal Ad chromosome which carries the Ad inverted terminal repeats and packaging signal flanking the AAV vector genome. This chromosome cannot direct the synthesis of Ad proteins, but can be packaged into Ad vector particles. The remaining unrecombined Ad chromosomes provide the Ad structural proteins in trans, and both the full-length and minimal genomes are packaged into particles. The particles carrying the minimal Ad/AAV hybrid vector are then isolated by CsCl centrifugation.
[0441]These particles have the capsid structure of adenovirus, and infect cells using the efficient fiber- and penton base-mediated pathway used by Ad. Following infection, the hybrid genome is able to integrate into the cell's chromosomes by virtue of its AAV sequences. In this example, the AAV vector genome is inserted into the E1 region of a fiber-deleted vector, and the resulting vector is grown in packaging lines expressing either the Ad5 or Ad37 fiber proteins. The particles recovered therefore have the tropisms expected from the respective fiber proteins combined with the ability to integrate their AAV genome into target cells. Such pseudotyping should be possible with any of a number of modified fiber proteins, as for the fiber-deleted vectors already described by us.
[0442]The Ad vector is constructed in a manner analogous to that described for Ad5.βgal.ΔF, by recombination between pAd.AAV1 (Lieber et al. J. Virol. 73/9314-9324, 1999) and pDV44 (as described earlier in the specification.) pAd.AAV1 carries an MLV promoter-driven secreted alkaline phosphatase gene (SEAP) as a reporter, and an S V40-driven neomycin phosphotransferase (neo) gene to allow the selection of cells stable transduced by the AAV cassette. The resulting vector (Ad.AAV1.AF) has the AAV vector cassette of Ad.AAV1 inserted into the E1 region of a genome with the fiber deletion of Ad5.βgal.ΔF. Growth of Ad. AAV1.ΔF in 63 3 cells results in particles carrying the AAV genome and the Ad5 fiber, and which have the tropism associated with Ad5. Growth of Ad.AAV1.ΔF in 705 cells produces particles bearing the Ad37 fiber and therefore having its associated different tropism.
[0443]Tropism is evaluated by infecting Chang C cells (which express the Ad37 receptor) and A549 cells which do not express this protein but do express the Ad5 receptor (CAR). The extent of infection is monitored by assaying alkaline phosphatase expression, and the fraction of cells stable transduced is assayed by selection with neomycin. By using purified recombinant Ad5 or Ad37 fiber proteins as competitors during infection, the usage of the expected receptors by the pseudotyped particles is evaluated.
Example 14
Use of the Fiber Expression System to Retarget (`Pseudotype`) Helper-Dependent AD Vectors
[0444]Gutted Ad vectors are those from which most or all viral genes have been deleted. They are grown by co-infection of the producing cells with a "helper" virus (using an E1-deleted Ad vector). The helper virus trans-complements the missing Ad functions, including production of the viral structural proteins needed for particle assembly. In one embodiment of this invention, the helper virus is a fiber-deleted Ad (such as that described in Von Seggern et al., J. Virol 75:1601-1608 (1999)). The vector is prepared in a fiber expressing cell line such as has been previously described by Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998), Von Seggern et al., J. Virol 74:354-362 (2000). All the necessary Ad proteins except fiber are provided by the fiber-deleted helper virus, and the particles are equipped with the particular fiber expressed by the host cells. A concern with gutted vectors has been contamination of a vector preparation with residual helper virus. As the helper virus in one aspect of this invention is deleted for both E1 and for fiber, it is more replication defective and therefore safer than those currently used.
[0445]A helper adenovirus vector genome and a gutless adenoviral vector genome are delivered to the packaging cells of the invention. The cells are maintained under standard cell maintenance or growth conditions, whereby the helper vector genome and the packaging cell together provide the complementing proteins for the packaging of the adenoviral vector particle. Such gutless adenoviral vector particles are recovered by standard techniques. The helper vector genome may be delivered in the form of a plasmid or similar construct by standard transfection techniques, or it may be delivered through infection by a viral particle containing the genome. Such viral particle is commonly called a helper virus. Similarly, the gutless adenoviral vector genome may be delivered to the cell by transfection or viral infection.
[0446]The helper vims genome is preferably the fiberless adenovirus vector genome as disclosed herein. Preferably, such genome also lacks the genes encoding the adenovirus E1 A and E1B proteins. More preferably, the genome further lacks the adenovirus genes encoding the adenovirus E3 proteins. Alternatively, the genes encoding such proteins may be present but mutated so that they do not encode functional E1A, E1B and E3 proteins. Furthermore, such vector genome may not encode other functional early proteins, such as E2A, E2B, and E4 proteins. Alternatively, the genes encoding such other early proteins may be present but mutated so that they do not encode functional proteins.
[0447]The helper virus genome is used in conjunction with the packaging cell of the invention. As disclosed elsewhere herein, the packaging cell also provides proteins necessary for the complementation of the gutless vector so that an adenovirus particle containing the gutless vector genome may be produced. Thus, the packaging cell can provide wild-type or modified fiber protein as described herein. Alternatively, the cell could package a fiberless particle which could be used by itself or to which exogenously provided fiber could be added as described elsewhere herein.
[0448]In producing the gutless vectors, the helper virus genome is also packaged, thereby producing helper virus. In order the minimize the amount of helper virus produced and maximize the amount of gutless vector particles produced, it is preferable to delete or otherwise modify the packaging sequence in the helper virus genome, so that packaging of the genome is prevented or limited. Since the gutless vector genome will have a packaging sequence, it will be preferentially packaged.
[0449]One way to do this is to mutate the packaging sequence by deleting one or more of the nucleotides comprising the sequence or otherwise mutating the sequence to inactivate or hamper the packaging function. An alternative approach is to engineer the helper genome so that recombinase target sites flank the packaging sequence and to provide a recombinase in the packaging cell. The action of recombinase on such sites results in the removal of the packaging sequence from the helper virus genome. Preferably, the recombinase is provided by a nucleotide sequence in the packaging cell that encodes the recombinase. Most preferably, such sequence is stably integrated into the genome of the packaging cell. Various kinds of recombinase are known by those skilled in the art. The preferred recombinase is Cre recombinase, which operates on so-called lox sites, which are engineered on either side of the packaging sequence as discussed above. Further information about the use of Cre-loxP recombination is found in U.S. Pat. No. 5,919,676 and Morsy and Caskey, Molecular Medicine Today, January 1999, pgs. 18-24, both incorporated herein by reference.
[0450]This example demonstrates how the fiber-expressing packaging lines can be used to generate pseudotyped particles of helper-dependent or `gutless` vectors with altered tropisms. As the gutless vectors lack many or all Ad genes, they must be grown as mixed cultures in the presence of a helper virus which can provide the missing functions. To date, such helper viruses have provided all Ad functions except E1, and E1 is complemented by growth in 293 cells or the equivalent. The resulting virus particles are harvested, and the helper virus is typically removed by CsCl gradient centrifugation (the vector chromosome is generally shorter than the helper chromosome, resulting in a difference in buoyant density between the two particles).
[0451]An example of a gutless vector is pAdΔRSVDys (Haecker et al., Human Gene Therapy 7:1907-1914 (1996)). This plasmid contains a full-length human dystrophin cDNA driven by the RSV promoter and flanked by Ad inverted terminal repeats and packaging signals. 293 cells are infected with a first-generation Ad which serves as a helper virus, and then transfected with purified pAdΔRSVDys DNA. Both the helper Ad genome and the pAdΔRSVDys DNA are replicated as Ad chromosomes, and packaged into particles using the viral proteins produced by the helper virus. Particles are isolated and the pAdΔRSVDys-containing particles separated from the helper by virtue of their smaller genome size and therefore different density on CsCl gradients.
[0452]To generate pseudotyped particles containing the pAdΔRSVDys genome, the vector is grown in either 633 or 705 cells and Ad5.βgal.ΔF is used as a helper virus. As in the published method, both the Ad5.βgal.ΔF and pAdΔRSVDys genomes replicate and are packaged into particles. The Ad5.βgal.ΔF helper provides all the essential Ad proteins except fiber, and the fiber protein is that produced by the cells (Ad5 fiber in 633 cells and Ad37 fiber in the case of 705 cells). The particles containing pAdΔRSVDys genomes are then isolated by centrifugation.
[0453]Tropism is evaluated by infecting Chang C cells (which express the Ad37 receptor) and A549 cells which do not express this protein but do express the natural Ad5 receptor (CAR). The extent of infection is assessed by immunofluorescence staining of the infected cells with an anti-dystrophin antibody. By using purified recombinant Ad5 and Ad37 fiber proteins as competitors during infection, the usage of the expected receptors by the pseudotyped particles is evaluated.
Example 15
Targeting EBV-Infected B Cells
[0454]There are a number of cell types, such as EBV-transformed B-lymphocytes, that are involved in human disease which are not transducible using standard Ad vectors. To address this problem `pseudotyped` Ad5.GFP.ΔF particles containing either the wildtype Ad5 fiber protein or a chimeric fiber with the receptor-binding knob domain of the adenovirus type 3 (Ad3) fiber were generated. (Von Seggern et al., J. Virol. January, 2000). The strategy used for targeting the B-cells should be broadly applicable for targeting gene delivery to other specific cell types.
[0455]Cells and Viruses. THP-1, MRC-5, FaDu, and A-10 cells were purchased from the ATCC. 211B is a 293-derived cell line that expresses the wild-type Ad5 fiber protein (Von Seggern et al, J. Gen. Virol. 79:1461-1468 (1998)). E1-2a (Gorziglia et al., J. Virol. 70:4173-4178 (1996)) is an A549-derived cell line which complements adenoviral E1 and E2a functions. The JR, TO, and TL LCL lines were established as described (Huang et al., Proc. Natl. Acad. Sci. 94:8156-8161 (1997) by EBV infection of lymphocytes from three normal donors. THP-1 and all LCL lines were maintained in RPMI 1640 medium (Gibco)+10% fetal calf serum (FCS) (Hyclone). 211B, MRC-5, and A-10 cells were grown in DMEM+10% FCS. E1-2a and its derivatives were grown in Richter's modified medium (BioWhitaker)+10% FCS. Peripheral blood mononuclear cells were isolated from normal human blood (General Clinical Research Center, Scripps Clinic) by sedimentation on Ficoll-Paque (Pharmacia) per the manufacturer's instructions. Wild type Ad2 and Ad3 were purchased from the ATCC. Construction of Ad5.βgal.wt and Ad5.βgal.ΔF (Von Seggern et al., J. Virol. 73:1601-1608 (1999)) has been previously described. Av9LacZ4 (Mitttereder et al., J. Virol. 70:7498-7509 (1996)) is a first-generation Ad5 vector containing an RSV-driven β-galactosidase reporter gene. Av9LacZ4 (Stevenson et al., J. Virol. 77:4782-4790 (1997)) is identical to Av1LacZ4 except that the fiber gene in the vector chromosome was replaced by a recombinant gene encoding a chimeric fiber protein with the receptor-binding domain of the Ad3 fiber (Stevenson et al., J. virol. 69:2850-2857 (1995)). Accession numbers for the above are as follows. THP-1: TEB-202, MRC-5: CCL-171, FaDu: HTB-43, A-10: CRL-1476, Ad2: VR-846, Ad3: VR-3.
[0456]DNA constructs. The complete Ad5 tripartite leader contained in pDV67 and pDV69 was constructed by assembly of PCR fragments. pDV55 was constructed similar to Example 5. This plasmid contains a 1.2 kb Bam HI/Bgl II fragment consisting of the first TPL exon, the natural first intron, and the fused second and third TPL exons. Finally, pDV60 was constructed by inserting this TPL cassette into the Bam HI site upstream of the Ad5 fiber gene in pcDNA3/Fiber (Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998)). pDV61 and pDV67 were then constructed similar to example 6.
[0457]The chimeric Ad3/Ad5 fiber gene was amplified from pGEM5T3H (Stevenson et al., J. Virol. 69:2850-2857 (1995) using the primers 5' ATG GGA TCC AAG ATG AAG CGC GCA AGA CCG3'(SEQ ID NO: 75) and 5'CAC TAT AGC GGC CGC ATT CTC AGT CAT CTT 3' (SEQ ID NO: 76), and cloned to the Bam HI and Not I sites of pcDNA3.1/Zeo(+) via novel Bam HI and Not I sites (bold) engineered into the primers to create pDV68. Finally, the complete TPL fragment described above was then added to the unique Bam HI site of this plasmid to create pDV69.
[0458]Construction of stable Cell Lines. E1-2a cells were electroporated as previously described (Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998)) with pDV61, pDV67, or pDV69, and stable lines were selected with 600 ng/ml Zeocin (Invitrogen). Candidate clones were evaluated by immunofluorescence (Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998)) using a polyclonal antibody generated against the Ad2 fiber (Wickham et al, Cell 75:309-319 (1993). Those lines expressing the highest level of nuclear fiber expression were further characterized. Line 601 and 633 were produced by transfection of pDV61 and pDV67, respectively, and therefore express the wildtype Ad5 fiber. Line 644 contains pDV69 and expresses the chimeric 5T3H fiber.
[0459]Virus Growth and Analysis. Adenovirus stocks were prepared in the indicated cell lines, and plaque-titered on 633 cells essentially as described (Von Seggern et al, J. Virol. 73:1601-1608 (1999)). E1-2a cells (Gorziglia et al., J. Virol. 70:4173-4178 (1996). and their derivatives contain a dexamethasone-inducible construct for complementation of E1a. 601, 633, or 644 cells were therefore treated with 0.3 μM dexamethasone for 24 hours prior to infection, and 0.5 μM dexamethasone was included in the overlay for plaque assays. Protein concentration of viral preparations was determined using the BioRad Protein Assay (BioRad) with purified bovine serum albumin as a standard. Particle number was calculated using the formula 1 ng protein=4×109 viral particles. Western blotting was performed as described (Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998)) using polyclonal rabbit antibodies raised against either the Ad2 (Wickham et al., Cell 73:309-319 (1993) or Ad3 fibers (Stevenson et al., J. Virol. 79:4782-4790 (1997).
[0460]Determination of infection and binding to receptor was performed using methods known to those of skill in the art. 2×105 cells in a total volume of 200 μl were incubated with the indicated Ad preparation for three hours at 37° C. Cells were then washed twice with fresh medium, and returned to 37° C. Two days later, cells were fixed and stained with X-gal and counted by light microscopy as described (Von Seggern et al, J. Virol. 73:1601-1608 (1999)). For competition assays, cells were pre-incubated on ice for one hour with either recombinant Ad3 fiber (10 μg/ml) purified from baculovirus or with a crude baculovirus lysate (100 μg/ml) containing the recombinant Ad2 fiber protein (Wickham et al., Cell 73:309-319 (1997)). Expression of a, integrins on cell surfaces was assayed by FACS assay using monoclonal antibodies (the gift of David Cheresh, TSR1) against either αvβ3 (LM609) or αvβ5 (P1F6) as previously described (Huang et al., Proc. Natl. Acad. Sci. USA 94:8156-8161 (1997)). For virus binding assays, CsCl-purified Ad2 or Ad3 was labeled with 1251 using Jodogen tubes (Pierce). Free iodine was removed by filtration with a PD-10 Sephadex column (Pharmacia). Cells (1×106 cells in a volume of 200 μl either with or without a 100-fold excess of unlabeled vims) were rocked at 4° C. for two hours with 1×106 cpm of the labeled vims, washed three times with PBS and counted.
[0461]Altered in vitro tropism and infection of B lymphoid cell lines. Experiments with genetically modified vimses showed that a number of different cell types are more readily infected through interaction with the Ad3 receptor than by the CAR-dependent pathway used by Ad5 (Stevenson et al., J. Virol. 77:4782-4790 (1997)). In order to further evaluate the pseudotyping system, the ability of Ad5.βgal.ΔF carrying either the Ad5 or chimeric 5T3H fibers to infect several cell lines was assayed: FaDu (a head and neck tumor line), THP-1 monocytic cells, and MRC-5 fibroblasts were assayed. Consistent with the previous studies (Stevenson et al., J. Virol. 77:4782-4790 (1997)), use of the chimeric Ad5/Ad3 fiber protein increased infection of all of these lines at equal particle/cell ratios. In contrast, the rat smooth muscle cell line A-10 was infected somewhat more readily by Ad5- than by Ad3-pseudotyped particles.
[0462]Gene delivery to EBV-infected B cells could allow the development of therapies for a variety of lymphoproliferative disorders. For example, ex vivo purging of donor marrow to eliminate infected cells could reduce the risk of EBV-associated lymphoproliferative disease, and EBV-induced malignancies such as AIDS-associated lymphoma are also potential targets. However, neither B cells nor EBV-transformed lymphoblastoid cell lines (LCLs) are efficiently infected by Ad5-based vectors. As the tropism of Ad3-pseudotyped particles appeared to be somewhat broader, it was asked whether EBV-infected LCLs could be infected using this system. The ability of Ad3-pseudotyped particles to infect LCLs generated by EBV infection of lymphocytes from three different normal human donors was tested. In agreement with previous reports, there was little or no infection of these by particles carrying the Ad5 fiber. In contrast, vims particles equipped with the chimeric fiber protein were able to efficiently infect all of these lines. At equal particle/cell ratios, all LCLs examined were at least 10-fold more infectible using the Ad3 receptor.
[0463]Further studies were performed to correlate the efficiency of infection with the level of attachment and internalization receptors expressed by the cells. The three LCL lines tested all bound very low levels of radiolabeled Ad2 particles, indicating that they expressed little or no CAR. In contrast, all three were able to specifically bind labeled Ad3 particles. This result suggested that fiber receptor distribution was largely responsible for the increased infection of these cells by Ad3-pseudotyped particles.
[0464]Selective gene delivery to EB V-infected cells. The results above suggested that the minority of EB V-infected B cells present in donor marrow or peripheral blood would be preferentially infected by vectors using the Ad3 receptor. To test this hypothesis, a mixing experiment with normal uninfected peripheral blood mononuclear cells (PBMCs) and EB V-infected cells was performed. JR-LCL cells were mixed at varying ratios with PBMCs isolated from a normal human donor, and the mixture was then infected with Ad5.βgal.ΔF particles containing the 5T3H fiber protein. No infection of normal PBMCs alone was detected. Moreover, the percent of total cells infected increased with the fraction of JR cells added. These experiments indicate that EB V-infected cells can be selectively infected in vitro by relatively short (3 hours) exposure to a retargeted Ad vector.
Example 16
Production of Adenovirus Vectors by Addition of Exogenous Fiber
[0465]The production of fiberless viruses by growth in a complementing cell line may result in a preparation that also contains contaminating fiber genome resulting from recombination in the complementing cell lines. This disadvantage is eliminated by addition of exogenous fiber to a fiberless adenovirus vector.
[0466]Production of fiberless virus by standard methods may include a two-step preparation protocol. This has been described in the earlier examples and is briefly described here again as follows:
[0467]Step I--amplification of fiber containing fiberless virus (Ad5/F7F.sup.+ or Ad5.βgal.ΔF- fiberless, but there is fiber on the surface, not encoded in genome) on 211B cell line (which stably expresses fiber), followed by CsCl-purification and characterization.
[0468]Step II--preparation of virus particles lacking fiber (Ad5F--) by infection of S.8 cell line with Ad5/F.sup.-/F.sup.+, followed by CsCl purification and characterization. This produces a large stock of particles which do not contain fiber.
[0469]Step 1 is necessary because the infection efficiency of fiberless virus is extremely low, e.g. the dose of 20,000 particles/cell of Ad5.βgal.F.sup.- gives only 10% infected cells.
[0470]Contrary to the above, the production of fiberless virus by addition of exogenous fiber involves only a one-step protocol. The fiberless virus is amplified using the S.8 cell line with addition of exogenous fiber into infection media. The amount of exogenous fiber necessary for production is very low, no more than 75 ng of purified fiber required per roller bottle. If desired the process may be followed by CsCl purification. As mentioned above, one advantage to this protocol is that it should provide no chance for recombination of adenovector during preparation.
[0471]A 10 roller bottle (RB) preparation of fiberless virus was made using the above two-step procedure. The yield of adenovector was 6.6×1012 particles-total Ad5.βgal.F.sup.- (two step procedure.) A1 RB preparation of fiberless adenovector was also made from the same initial material using a one-step procedure with exogenous fiber. The total yield was 2.5×1015 particles--Ad5.βgal.F.sup.- (one step procedure).
[0472]DNA was isolated from both preparations and a PCR assay for fiber contamination was performed. (FIG. 28). The PCR assay was developed for detection of very low amounts of fiber contamination, as low as 10-18 g. PCR assay showed much lower contamination for the preparation which was done by adding exogenous fiber (10-15 g one-step procedure) vs. 10-8 two-step procedure). Therefore, less contamination was obtained by simpler one-step approach.
[0473]Experiments were done using soluble purified fiber which does not have F.English Pound.is-taq on the end (Ad5Fiber=5F) and with His-taq on the end (Ad5Fiber His=5FHis). These experiments showed that addition of Ad5Fiber can dramatically increase transduction efficiency of fiberless adenovector by simply adding it exogenously to a fiberless vector. The presence of the His tag on the Ad5FiberHis doesn't have any effect.
[0474]The results of these experiments suggest that the fiber is self-assembling with the fiberless vector. This self-assembled virus can then infect cell through the normal entry pathway. (FIG. 29) Also, an experiment was done using conditioned media from 633 cell line, which can stably express fiber. A Western blot analysis for 633 condition media, showed that soluble fiber was present in the media during the period of cultivation of this cell line. Presence of soluble fiber in the media gives the possibility to increase transduction efficiency of fiberless adenovector on the HDF cell line. (FIG. 30) Because the HDF cell line doesn't have a CAR-receptor, it is especially difficult to transduce this particular cell line, not only with fiberless vector, but also with regular fiber containing adenovector. Different amounts of 633 conditioned media (250 ul, 500 μl or 1000 μl) were added to infectious media during the incubation period with fiberless adenovector.
[0475]This experiment also showed a role of soluble fiber in the process of cell entry. The conclusion is that by adding any fiber (wild-type, mutated, with ligand fusions) as long as on has the wild-type shaft (or region necessary to bind penton) one can retarget fiberless vector with any genome inside (gutless, oncolytic, expressing any transgene, etc.) to any cell type that your fiber is specific to. The advantage of this approach is that one does not have to make vectors with each new ligand. Just one fiberless vector need be made that can then be used to make different backbones by adding an exogenous "targetable" fiber off the shelf.
[0476]The foregoing specification, including the specific embodiments and examples, is intended to be illustrative of the present invention and is not to be taken as limiting. Numerous other variations and modifications can be effected without departing from the true spirit and scope of the present invention. All publications, patents and patent applications cited herein are incorporated by reference in their entirety into the present disclosure.
Sequence CWU
1
76130DNAArtificial SequenceDescription of Artificial Sequence primer
1cggtacacag aattcaggag acacaactcc
30235DNAArtificial SequenceDescription of Artificial Sequence primer
2gcctggatcc gggaagttac gtaacgtggg aaaac
35312DNAArtificial SequenceDescription of Artificial Sequence linker
3cgcggatccg cg
1248710DNAArtificial SequenceDescription of Artificial Sequence plasmid
4cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag
60ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac
120cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga
180ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc
240accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg
300gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa
360gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac
420caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct
480gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa
540agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg
600ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccgg
660gccccccctc gaggtcgacg gtatcgataa gcttgatatc gaattcagga gacacaactc
720caagtgcata ctctatgtca ttttcatggg actggtctgg ccacaactac attaatgaaa
780tatttgccac atcctcttac actttttcat acattgccca agaataaaga atcgtttgtg
840ttatgtttca acgtgtttat ttttcaattg cagaaaattt caagtcattt ttcattcagt
900agtatagccc caccaccaca tagcttatac agatcaccgt accttaatca aactcacaga
960accctagtat tcaacctgcc acctccctcc caacacacag agtacacagt cctttctccc
1020cggctggcct taaaaagcat catatcatgg gtaacagaca tattcttagg tgttatattc
1080cacacggttt cctgtcgagc caaacgctca tcagtgatat taataaactc cccgggcagc
1140tcacttaagt tcatgtcgct gtccagctgc tgagccacag gctgctgtcc aacttgcggt
1200tgcttaacgg gcggcgaagg agaagtccac gcctacatgg gggtagagtc ataatcgtgc
1260atcaggatag ggcggtggtg ctgcagcagc gcgcgaataa actgctgccg ccgccgctcc
1320gtcctgcagg aatacaacat ggcagtggtc tcctcagcga tgattcgcac cgcccgcagc
1380ataaggcgcc ttgtcctccg ggcacagcag cgcaccctga tctcacttaa atcagcacag
1440taactgcagc acagcaccac aatattgttc aaaatcccac agtgcaaggc gctgtatcca
1500aagctcatgg cggggaccac agaacccacg tggccatcat accacaagcg caggtagatt
1560aagtggcgac ccctcataaa cacgctggac ataaacatta cctcttttgg catgttgtaa
1620ttcaccacct cccggtacca tataaacctc tgattaaaca tggcgccatc caccaccatc
1680ctaaaccagc tggccaaaac ctgcccgccg gctatacact gcagggaacc gggactggaa
1740caatgacagt ggagagccca ggactcgtaa ccatggatca tcatgctcgt catgatatca
1800atgttggcac aacacaggca cacgtgcata cacttcctca ggattacaag ctcctcccgc
1860gttagaacca tatcccaggg aacaacccat tcctgaatca gcgtaaatcc cacactgcag
1920ggaagacctc gcacgtaact cacgttgtgc attgtcaaag tgttacattc gggcagcagc
1980ggatgatcct ccagtatggt agcgcgggtt tctgtctcaa aaggaggtag acgatcccta
2040ctgtacggag tgcgccgaga caaccgagat cgtgttggtc gtagtgtcat gccaaatgga
2100acgccggacg tagtcatatt tcctgaagca aaaccaggtg cgggcgtgac aaacagatct
2160gcgtctccgg tctcgccgct tagatcgctc tgtgtagtag ttgtagtata tccactctct
2220caaagcatcc aggcgccccc tggcttcggg ttctatgtaa actccttcat gcgccgctgc
2280cctgataaca tccaccaccg cagaataagc cacacccagc caacctacac attcgttctg
2340cgagtcacac acgggaggag cgggaagagc tggaagaacc atgttttttt ttttattcca
2400aaagattatc caaaacctca aaatgaagat ctattaagtg aacgcgctcc cctccggtgg
2460cgtggtcaaa ctctacagcc aaagaacaga taatggcatt tgtaagatgt tgcacaatgg
2520cttccaaaag gcaaacggcc ctcacgtcca agtggacgta aaggctaaac ccttcagggt
2580gaatctcctc tataaacatt ccagcacctt caaccatgcc caaataattc tcatctcgcc
2640accttctcaa tatatctcta agcaaatccc gaatattaag tccggccatt gtaaaaatct
2700gctccagagc gccctccacc ttcagcctca agcagcgaat catgattgca aaaattcagg
2760ttcctcacag acctgtataa gattcaaaag cggaacatta acaaaaatac cgcgatcccg
2820taggtccctt cgcagggcca gctgaacata atcgtgcagg tctgcacgga ccagcgcggc
2880cacttccccg ccaggaacct tgacaaaaga acccacactg attatgacac gcatactcgg
2940agctatgcta accagcgtag ccccgatgta agctttgttg catgggcggc gatataaaat
3000gcaaggtgct gctcaaaaaa tcaggcaaag cctcgcgcaa aaaagaaagc acatcgtagt
3060catgctcatg cagataaagg caggtaagct ccggaaccac cacagaaaaa gacaccattt
3120ttctctcaaa catgtctgcg ggtttctgca taaacacaaa ataaaataac aaaaaaacat
3180ttaaacatta gaagcctgtc ttacaacagg aaaaacaacc cttataagca taagacggac
3240tacggccatg ccggcgtgac cgtaaaaaaa ctggtcaccg tgattaaaaa gcaccaccga
3300cagctcctcg gtcatgtccg gagtcataat gtaagactcg gtaaacacat caggttgatt
3360catcggtcag tgctaaaaag cgaccgaaat agcccggggg aatacatacc cgcaggcgta
3420gagacaacat tacagccccc ataggaggta taacaaaatt aataggagag aaaaacacat
3480aaacacctga aaaaccctcc tgcctaggca aaatagcacc ctcccgctcc agaacaacat
3540acagcgcttc acagcggcag cctaacagtc agccttacca gtaaaaaaga aaacctatta
3600aaaaaacacc actcgacacg gcaccagctc aatcagtcac agtgtaaaaa agggccaagt
3660gcagagcgag tatatatagg actaaaaaat gacgtaacgg ttaaagtcca caaaaaacac
3720ccagaaaacc gcacgcgaac ctacgcccag aaacgaaagc caaaaaaccc acaacttcct
3780caaatcgtca cttccgtttt cccacgttac gtaacttccc ggatccgcgg cattcacagt
3840tctccgcaag aattgattgg ctccaattct tggagtggtg aatccgttag cgaggtgccg
3900ccggcttcca ttcaggtcga ggtggcccgg ctccatgcac cgcgacgcaa cgcggggagg
3960cagacaaggt atagggcggc gcctacaatc catgccaacc cgttccatgt gctcgccgag
4020gcggcataaa tcgccgtgac gatcagcggt ccagtgatcg aagttaggct ggtaagagcc
4080gcgagcgatc cttgaagctg tccctgatgg tcgtcatcta cctgcctgga cagcatggcc
4140tgcaacgcgg gcatcccgat gccgccggaa gcgagaagaa tcataatggg gaaggccatc
4200cagcctcgcg tcgcgaacgc cagcaagacg tagcccagcg cgtcggccgc catgccctgc
4260ttcatccccg tggcccgttg ctcgcgtttg ctggcggtgt ccccggaaga aatatatttg
4320catgtcttta gttctatgat gacacaaacc ccgcccagcg tcttgtcatt ggcgaattcg
4380aacacgcaga tgcagtcggg gcggcgcggt cccaggtcca cttcgcatat taaggtgacg
4440cgtgtggcct cgaacaccga gcgaccctgc agcgacccgc ttaacagcgt caacagcgtg
4500ccgcagatcc cgggcaatga gatatgaaaa agcctgaact caccgcgacg tctgtcgaga
4560agtttctgat cgaaaagttc gacagcgtct ccgacctgat gcagctctcg gagggcgaag
4620aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctgcgg gtaaatagct
4680gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg gccgcgctcc
4740cgattccgga agtgcttgac attggggaat tcagcgagag cctgacctat tgcatctccc
4800gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac cgaactgccc gctgttctgc
4860agccggtcgc ggaggccatg gatgcgatcg ctgcggccga tcttagccag acgagcgggt
4920tcggcccatt cggaccgcaa ggaatcggtc aatacactac atggcgtgat ttcatatgcg
4980cgattgctga tccccatgtg tatcactggc aaactgtgat ggacgacacc gtcagtgcgt
5040ccgtcgcgca ggctctcgat gagctgatgc tttgggccga ggactgcccc gaagtccggc
5100acctcgtgca cgcggatttc ggctccaaca atgtcctgac ggacaatggc cgcataacag
5160cggtcattga ctggagcgag gcgatgttcg gggattccca atacgaggtc gccaacatct
5220tcttctggag gccgtggttg gcttgtatgg agcagcagac gcgctacttc gagcggaggc
5280atccggagct tgcaggatcg ccgcggctcc gggcgtatat gctccgcatt ggtcttgacc
5340aactctatca gagcttggtt gacggcaatt tcgatgatgc agcttgggcg cagggtcgat
5400gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg tacacaaatc gcccgcagaa
5460gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc cgatagtgga aaccgacgcc
5520ccagcactcg tccgagggca aaggaatagg ggagatgggg gaggctaact gaaacacgga
5580aggagacaat accggaagga acccgcgcta tgacggcaat aaaaagacag aataaaacgc
5640acgggtgttg ggtcgtttgt tcataaacgc ggggttcggt cccagggctg gcactctgtc
5700gataccccac cgagacccca ttggggccaa tacgcccgcg tttcttcctt ttccccaccc
5760caccccccaa gttcgggtga aggcccaggg ctcgcagcca acgtcggggc ggcaggccct
5820gccatagcca ctggccccgt gggttaggga cggggtcccc catggggaat ggtttatggt
5880tcgtgggggt tattattttg ggcgttgcgt ggggtctggt ccacgactgg actgagcaga
5940cagacccatg gtttttggat ggcctgggca tggaccgcat gtactggcgc gacacgaaca
6000ccgggcgtct gtggctgcca aacacccccg acccccaaaa accaccgcgc ggatttctgg
6060cgcccagtgc cgtcgaccgg tcatggctgc gccccgacac ccgccaacac ccgctgacgc
6120gccctgacgg gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg
6180gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgaggc agccggatca
6240taatcagcca taccacattt gtagaggttt tacttgcttt aaaaaacctc cccacctccc
6300cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt aacttgttta ttgcagctta
6360taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact
6420gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggatccacta
6480gttctagagc ggccgccacc gcggtggagc tccagctttt gttcccttta gtgagggtta
6540atttcgagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc
6600acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga
6660gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg
6720tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg
6780cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg
6840gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga
6900aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg
6960gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag
7020aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc
7080gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg
7140ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt
7200cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc
7260ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc
7320actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg
7380tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca
7440gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc
7500ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat
7560cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt
7620ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt
7680tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc
7740agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc
7800gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata
7860ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg
7920gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc
7980cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct
8040acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa
8100cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt
8160cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca
8220ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac
8280tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca
8340atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt
8400tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc
8460actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca
8520aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata
8580ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc
8640ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc
8700cgaaaagtgc
8710530DNAArtificial SequenceDescription of Artificial Sequence primer
5atgggatcca agatgaagcg cgcaagaccg
30630DNAArtificial SequenceDescription of Artificial Sequence primer
6cataacgcgg ccgcttcttt attcttgggc
3077148DNAArtificial SequenceDescription of Artificial Sequence plasmid
7gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg
60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata
300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
420attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt
480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca
600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc
900gagctcggat ccaagatgaa gcgcgcaaga ccgtctgaag ataccttcaa ccccgtgtat
960ccatatgaca cggaaaccgg tcctccaact gtgccttttc ttactcctcc ctttgtatcc
1020cccaatgggt ttcaagagag tccccctggg gtactctctt tgcgcctatc cgaacctcta
1080gttacctcca atggcatgct tgcgctcaaa atgggcaacg gcctctctct ggacgaggcc
1140ggcaacctta cctcccaaaa tgtaaccact gtgagcccac ctctcaaaaa aaccaagtca
1200aacataaacc tggaaatatc tgcacccctc acagttacct cagaagccct aactgtggct
1260gccgccgcac ctctaatggt cgcgggcaac acactcacca tgcaatcaca ggccccgcta
1320accgtgcacg actccaaact tagcattgcc acccaaggac ccctcacagt gtcagaagga
1380aagctagccc tgcaaacatc aggccccctc accaccaccg atagcagtac ccttactatc
1440actgcctcac cccctctaac tactgccact ggtagcttgg gcattgactt gaaagagccc
1500atttatacac aaaatggaaa actaggacta aagtacgggg ctcctttgca tgtaacagac
1560gacctaaaca ctttgaccgt agcaactggt ccaggtgtga ctattaataa tacttccttg
1620caaactaaag ttactggagc cttgggtttt gattcacaag gcaatatgca acttaatgta
1680gcaggaggac taaggattga ttctcaaaac agacgcctta tacttgatgt tagttatccg
1740tttgatgctc aaaaccaact aaatctaaga ctaggacagg gccctctttt tataaactca
1800gcccacaact tggatattaa ctacaacaaa ggcctttact tgtttacagc ttcaaacaat
1860tccaaaaagc ttgaggttaa cctaagcact gccaaggggt tgatgtttga cgctacagcc
1920atagccatta atgcaggaga tgggcttgaa tttggttcac ctaatgcacc aaacacaaat
1980cccctcaaaa caaaaattgg ccatggccta gaatttgatt caaacaaggc tatggttcct
2040aaactaggaa ctggccttag ttttgacagc acaggtgcca ttacagtagg aaacaaaaat
2100aatgataagc taactttgtg gaccacacca gctccatctc ctaactgtag actaaatgca
2160gagaaagatg ctaaactcac tttggtctta acaaaatgtg gcagtcaaat acttgctaca
2220gtttcagttt tggctgttaa aggcagtttg gctccaatat ctggaacagt tcaaagtgct
2280catcttatta taagatttga cgaaaatgga gtgctactaa acaattcctt cctggaccca
2340gaatattgga actttagaaa tggagatctt actgaaggca cagcctatac aaacgctgtt
2400ggatttatgc ctaacctatc agcttatcca aaatctcacg gtaaaactgc caaaagtaac
2460attgtcagtc aagtttactt aaacggagac aaaactaaac ctgtaacact aaccattaca
2520ctaaacggta cacaggaaac aggagacaca actccaagtg catactctat gtcattttca
2580tgggactggt ctggccacaa ctacattaat gaaatatttg ccacatcctc ttacactttt
2640tcatacattg cccaagaata aagaagcggc cgctcgagca tgcatctaga gggccctatt
2700ctatagtgtc acctaaatgc tagagctcgc tgatcagcct cgactgtgcc ttctagttgc
2760cagccatctg ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc
2820actgtccttt cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct
2880attctggggg gtggggtggg gcaggacagc aagggggagg attgggaaga caatagcagg
2940catgctgggg atgcggtggg ctctatggct tctgaggcgg aaagaaccag ctggggctct
3000agggggtatc cccacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg
3060cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct
3120tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg catcccttta
3180gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt
3240tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg
3300ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat
3360tcttttgatt tataagggat tttggggatt tcggcctatt ggttaaaaaa tgagctgatt
3420taacaaaaat ttaacgcgaa ttaattctgt ggaatgtgtg tcagttaggg tgtggaaagt
3480ccccaggctc cccaggcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc
3540aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
3600tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt
3660tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc
3720gcctctgcct ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt
3780tgcaaaaagc tcccgggagc ttgtatatcc attttcggat ctgatcaaga gacaggatga
3840ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg
3900gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg
3960ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc
4020ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct
4080tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa
4140gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg
4200gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa
4260gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat
4320gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg
4380cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc
4440atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac
4500cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg
4560gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc
4620tatcgccttc ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag
4680cgacgcccaa cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg
4740gcttcggaat cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc
4800tggagttctt cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca
4860atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt
4920ccaaactcat caatgtatct tatcatgtct gtataccgtc gacctctagc tagagcttgg
4980cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca
5040acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca
5100cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc
5160attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt
5220cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact
5280caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag
5340caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata
5400ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc
5460cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg
5520ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc
5580tttctcaatg ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg
5640gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc
5700ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga
5760ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg
5820gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa
5880aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg
5940tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt
6000ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat
6060tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct
6120aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta
6180tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa
6240ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac
6300gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa
6360gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag
6420taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg
6480tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag
6540ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg
6600tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc
6660ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat
6720tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata
6780ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa
6840aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca
6900actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc
6960aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc
7020tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg
7080aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac
7140ctgacgtc
714887469DNAArtificial SequenceDescription of Artificial Sequence plasmid
8gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg
60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata
300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
420attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt
480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca
600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc
900gagctcggat ctgaattcga gctcgctgtt gggctcgcgg ttgaggacaa actcttcgcg
960gtctttccag tactcttgga tcggaaaccc gtcggcctcc gaacggtact ccgccaccga
1020gggacctgag cgagtccgca tcgaccggat cggaaaacct ctcgagaaag gcgtctaacc
1080agtcacagtc gcaaggtagg ctgagcaccg tggcgggcgg cagcgggtgg cggtcggggt
1140tgtttctggc ggaggtgctg ctgatgatgt aattaaagta ggcggtcttg agacggcgga
1200tggtcgaggt gaggtgtggc aggcttgaga tccaagatga agcgcgcaag accgtctgaa
1260gataccttca accccgtgta tccatatgac acggaaaccg gtcctccaac tgtgcctttt
1320cttactcctc cctttgtatc ccccaatggg tttcaagaga gtccccctgg ggtactctct
1380ttgcgcctat ccgaacctct agttacctcc aatggcatgc ttgcgctcaa aatgggcaac
1440ggcctctctc tggacgaggc cggcaacctt acctcccaaa atgtaaccac tgtgagccca
1500cctctcaaaa aaaccaagtc aaacataaac ctggaaatat ctgcacccct cacagttacc
1560tcagaagccc taactgtggc tgccgccgca cctctaatgg tcgcgggcaa cacactcacc
1620atgcaatcac aggccccgct aaccgtgcac gactccaaac ttagcattgc cacccaagga
1680cccctcacag tgtcagaagg aaagctagcc ctgcaaacat caggccccct caccaccacc
1740gatagcagta cccttactat cactgcctca ccccctctaa ctactgccac tggtagcttg
1800ggcattgact tgaaagagcc catttataca caaaatggaa aactaggact aaagtacggg
1860gctcctttgc atgtaacaga cgacctaaac actttgaccg tagcaactgg tccaggtgtg
1920actattaata atacttcctt gcaaactaaa gttactggag ccttgggttt tgattcacaa
1980ggcaatatgc aacttaatgt agcaggagga ctaaggattg attctcaaaa cagacgcctt
2040atacttgatg ttagttatcc gtttgatgct caaaaccaac taaatctaag actaggacag
2100ggccctcttt ttataaactc agcccacaac ttggatatta actacaacaa aggcctttac
2160ttgtttacag cttcaaacaa ttccaaaaag cttgaggtta acctaagcac tgccaagggg
2220ttgatgtttg acgctacagc catagccatt aatgcaggag atgggcttga atttggttca
2280cctaatgcac caaacacaaa tcccctcaaa acaaaaattg gccatggcct agaatttgat
2340tcaaacaagg ctatggttcc taaactagga actggcctta gttttgacag cacaggtgcc
2400attacagtag gaaacaaaaa taatgataag ctaactttgt ggaccacacc agctccatct
2460cctaactgta gactaaatgc agagaaagat gctaaactca ctttggtctt aacaaaatgt
2520ggcagtcaaa tacttgctac agtttcagtt ttggctgtta aaggcagttt ggctccaata
2580tctggaacag ttcaaagtgc tcatcttatt ataagatttg acgaaaatgg agtgctacta
2640aacaattcct tcctggaccc agaatattgg aactttagaa atggagatct tactgaaggc
2700acagcctata caaacgctgt tggatttatg cctaacctat cagcttatcc aaaatctcac
2760ggtaaaactg ccaaaagtaa cattgtcagt caagtttact taaacggaga caaaactaaa
2820cctgtaacac taaccattac actaaacggt acacaggaaa caggagacac aactccaagt
2880gcatactcta tgtcattttc atgggactgg tctggccaca actacattaa tgaaatattt
2940gccacatcct cttacacttt ttcatacatt gcccaagaat aaagaagcgg ccgctcgagc
3000atgcatctag agggccctat tctatagtgt cacctaaatg ctagagctcg ctgatcagcc
3060tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg
3120accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat
3180tgtctgagta ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag
3240gattgggaag acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctgaggcg
3300gaaagaacca gctggggctc tagggggtat ccccacgcgc cctgtagcgg cgcattaagc
3360gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc
3420gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct
3480ctaaatcggg gcatcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa
3540aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc
3600cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca
3660ctcaacccta tctcggtcta ttcttttgat ttataaggga ttttggggat ttcggcctat
3720tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attaattctg tggaatgtgt
3780gtcagttagg gtgtggaaag tccccaggct ccccaggcag gcagaagtat gcaaagcatg
3840catctcaatt agtcagcaac caggtgtgga aagtccccag gctccccagc aggcagaagt
3900atgcaaagca tgcatctcaa ttagtcagca accatagtcc cgcccctaac tccgcccatc
3960ccgcccctaa ctccgcccag ttccgcccat tctccgcccc atggctgact aatttttttt
4020atttatgcag aggccgaggc cgcctctgcc tctgagctat tccagaagta gtgaggaggc
4080ttttttggag gcctaggctt ttgcaaaaag ctcccgggag cttgtatatc cattttcgga
4140tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca
4200ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc
4260ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc
4320aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg
4380ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg
4440gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct
4500gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct
4560acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa
4620gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa
4680ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt gacccatggc
4740gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt
4800ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct
4860gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc
4920gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc gggactctgg
4980ggttcgaaat gaccgaccaa gcgacgccca acctgccatc acgagatttc gattccaccg
5040ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc tggatgatcc
5100tccagcgcgg ggatctcatg ctggagttct tcgcccaccc caacttgttt attgcagctt
5160ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac
5220tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tgtataccgt
5280cgacctctag ctagagcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt
5340atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
5400cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg
5460gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
5520gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
5580ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
5640acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
5700cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
5760caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
5820gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
5880tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt
5940aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
6000ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
6060cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
6120tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
6180tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
6240ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
6300aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
6360aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
6420aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
6480gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
6540gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
6600caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
6660ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
6720attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
6780ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
6840gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
6900ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
6960tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
7020gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
7080cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
7140gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
7200tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
7260ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
7320gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
7380tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
7440catttccccg aaaagtgcca cctgacgtc
7469928DNAArtificial SequenceDescription of Artificial Sequence primer
9tgcttaagcg gccgcgaagg agaagtcc
281023DNAArtificial SequenceDescription of Artificial Sequence primer
10ccgagctagc gactgaaaat gag
231123DNAArtificial SequenceDescription of Artificial Sequence primer
11cctctcgaga gacagcaaga cac
231211152DNAArtificial SequenceDescription of Artificial Sequence plasmid
12aagcttgggc agaaatggtt gaactcccga gagtgtccta cacctagggg agaagcagcc
60aaggggttgt ttcccaccaa ggacgacccg tctgcgcaca aacggatgag cccatcagac
120aaagacatat tcattctctg ctgcaaactt ggcatagctc tgctttgcct ggggctattg
180ggggaagttg cggttcgtgc tcgcagggct ctcacccttg actcttttaa tagctcttct
240gtgcaagatt acaatctaaa caattcggag aactcgacct tcctcctgag gcaaggacca
300cagccaactt cctcttacaa gccgcatcga ttttgtcctt cagaaataga aataagaatg
360cttgctaaaa attatatttt taccaataag accaatccaa taggtagatt attagttact
420atgttaagaa atgaatcatt atcttttagt actattttta ctcaaattca gaagttagaa
480atgggaatag aaaatagaaa gagacgctca acctcaattg aagaacaggt gcaaggacta
540ttgaccacag gcctagaagt aaaaaaggga aaaaagagtg tttttgtcaa aataggagac
600aggtggtggc aaccagggac ttatagggga ccttacatct acagaccaac agatgccccc
660ttaccatata caggaagata tgacttaaat tgggataggt gggttacagt caatggctat
720aaagtgttat atagatccct cccttttcgt gaaagactcg ccagagctag acctccttgg
780tgtatgttgt ctcaagaaga aaaagacgac atgaaacaac aggtacatga ttatatttat
840ctaggaacag gaatgcactt ttggggaaag attttccata ccaaggaggg gacagtggct
900ggactaatag aacattattc tgcaaaaact catggcatga gttattatga atagccttta
960ttggcccaac cttgcggttc ccagggctta agtaagtttt tggttacaaa ctgttcttaa
1020aacgaggatg tgagacaagt ggtttcctga cttggtttgg tatcaaaggt tctgatctga
1080gctctgagtg ttctattttc ctatgttctt ttggaattta tccaaatctt atgtaaatgc
1140ttatgtaaac caagatataa aagagtgctg attttttgag taaacttgca acagtcctaa
1200cattcacctc ttgtgtgttt gtgtctgttc gccatcccgt ctccgctcgt cacttatcct
1260tcactttcca gagggtcccc ccgcagaccc cggcgaccct caggtcggcc gactgcggca
1320gctggcgccc gaacagggac cctcggataa gtgacccttg tctctatttc tactatttgg
1380tgtttgtctt gtattgtctc tttcttgtct ggctatcatc acaagagcgg aacggactca
1440ccatagggac caagctagcg actgaaaatg agacatatta tctgccacgg aggtgttatt
1500accgaagaaa tggccgccag tcttttggac cagctgatcg aagaggtact ggctgataat
1560cttccacctc ctagccattt tgaaccacct acccttcacg aactgtatga tttagacgtg
1620acggcccccg aagatcccaa cgaggaggcg gtttcgcaga tttttcccga ctctgtaatg
1680ttggcggtgc aggaagggat tgacttactc acttttccgc cggcgcccgg ttctccggag
1740ccgcctcacc tttcccggca gcccgagcag ccggagcaga gagccttggg tccggtttct
1800atgccaaacc ttgtaccgga ggtgatcgat cttacctgcc acgaggctgg ctttccaccc
1860agtgacgacg aggatgaaga gggtgaggag tttgtgttag attatgtgga gcaccccggg
1920cacggttgca ggtcttgtca ttatcaccgg aggaatacgg gggacccaga tattatgtgt
1980tcgctttgct atatgaggac ctgtggcatg tttgtctaca gtaagtgaaa attatgggca
2040gtgggtgata gagtggtggg tttggtgtgg taattttttt tttaattttt acagttttgt
2100ggtttaaaga attttgtatt gtgatttttt taaaaggtcc tgtgtctgaa cctgagcctg
2160agcccgagcc agaaccggag cctgcaagac ctacccgccg tcctaaaatg gcgcctgcta
2220tcctgagacg cccgacatca cctgtgtcta gagaatgcaa tagtagtacg gatagctgtg
2280actccggtcc ttctaacaca cctcctgaga tacacccggt ggtcccgctg tgccccatta
2340aaccagttgc cgtgagagtt ggtgggcgtc gccaggctgt ggaatgtatc gaggacttgc
2400ttaacgagcc tgggcaacct ttggacttga gctgtaaacg ccccaggcca taaggtgtaa
2460acctgtgatt gcgtgtgtgg ttaacgcctt tgtttgctga atgagttgat gtaagtttaa
2520taaagggtga gataatgttt aacttgcatg gcgtgttaaa tggggcgggg cttaaagggt
2580atataatgcg ccgtgggcta atcttggtta catctgacct catggaggct tgggagtgtt
2640tggaagattt ttctgctgtg cgtaacttgc tggaacagag ctctaacagt acctcttggt
2700tttggaggtt tctgtggggc tcatcccagg caaagttagt ctgcagaatt aaggaggatt
2760acaagtggga atttgaagag cttttgaaat cctgtggtga gctgtttgat tctttgaatc
2820tgggtcacca ggcgcttttc caagagaagg tcatcaagac tttggatttt tccacaccgg
2880ggcgcgctgc ggctgctgtt gcttttttga gttttataaa ggataaatgg agcgaagaaa
2940cccatctgag cggggggtac ctgctggatt ttctggccat gcatctgtgg agagcggttg
3000tgagacacaa gaatcgcctg ctactgttgt cttccgtccg cccggcgata ataccgacgg
3060aggagcagca gcagcagcag gaggaagcca ggcggcggcg gcaggagcag agcccatgga
3120acccgagagc cggcctggac cctcgggaat gaatgttgta caggtggctg aactgtatcc
3180agaactgaga cgcattttga caattacaga ggatgggcag gggctaaagg gggtaaagag
3240ggagcggggg gcttgtgagg ctacagagga ggctaggaat ctagctttta gcttaatgac
3300cagacaccgt cctgagtgta ttacttttca acagatcaag gataattgcg ctaatgagct
3360tgatctgctg gcgcagaagt attccataga gcagctgacc acttactggc tgcagccagg
3420ggatgatttt gaggaggcta ttagggtata tgcaaaggtg gcacttaggc cagattgcaa
3480gtacaagatc agcaaacttg taaatatcag gaattgttgc tacatttctg ggaacggggc
3540cgaggtggag atagatacgg aggatagggt ggcctttaga tgtagcatga taaatatgtg
3600gccgggggtg cttggcatgg acggggtggt tattatgaat gtaaggttta ctggccccaa
3660ttttagcggt acggttttcc tggccaatac caaccttatc ctacacggtg taagcttcta
3720tgggtttaac aatacctgtg tggaagcctg gaccgatgta agggttcggg gctgtgcctt
3780ttactgctgc tggaaggggg tggtgtgtcg ccccaaaagc agggcttcaa ttaagaaatg
3840cctctttgaa aggtgtacct tgggtatcct gtctgagggt aactccaggg tgcgccacaa
3900tgtggcctcc gactgtggtt gcttcatgct agtgaaaagc gtggctgtga ttaagcataa
3960catggtatgt ggcaactgcg aggacagggc ctctcagatg ctgacctgct cggacggcaa
4020ctgtcacctg ctgaagacca ttcacgtagc cagccactct cgcaaggcct ggccagtgtt
4080tgagcataac atactgaccc gctgttcctt gcatttgggt aacaggaggg gggtgttcct
4140accttaccaa tgcaatttga gtcacactaa gatattgctt gagcccgaga gcatgtccaa
4200ggtgaacctg aacggggtgt ttgacatgac catgaagatc tggaaggtgc tgaggtacga
4260tgagacccgc accaggtgca gaccctgcga gtgtggcggt aaacatatta ggaaccagcc
4320tgtgatgctg gatgtgaccg aggagctgag gcccgatcac ttggtgctgg cctgcacccg
4380cgctgagttt ggctctagcg atgaagatac agattgaggt actgaaatgt gtgggcgtgg
4440cttaagggtg ggaaagaata tataaggtgg gggtcttatg tagttttgta tctgttttgc
4500agcagccgcc gccgccatga gcaccaactc gtttgatgga agcattgtga gctcatattt
4560gacaacgcgc atgcccccat gggccggggt gcgtcagaat gtgatgggct ccagcattga
4620tggtcgcccc gtcctgcccg caaactctac taccttgacc tacgagaccg tgtctggaac
4680gccgttggag actgcagcct ccgccgccgc ttcagccgct gcagccaccg cccgcgggat
4740tgtgactgac tttgctttcc tgagcccgct tgcaagcagt gcagcttccc gttcatccgc
4800ccgcgatgac aagttgacgg ctcttttggc acaattggat tctttgaccc gggaacttaa
4860tgtcgtttct cagcagctgt tggatctgcg ccagcaggtt tctgccctga aggcttcctc
4920ccctcccaat gcggtttaaa acataaataa aaaaccagac tctgtttgga tttggatcaa
4980gcaagtgtct tgctgtctct cgagggatct ttgtgaagga accttacttc tgtggtgtga
5040cataattgga caaactacct acagagattt aaagctctaa ggtaaatata aaatttttaa
5100gtgtataatg tgttaaacta ctgattctaa ttgtttgtgt attttagatt ccaacctatg
5160gaactgatga atgggagcag tggtggaatg cctttaatga ggaaaacctg ttttgctcag
5220aagaaatgcc atctagtgat gatgaggcta ctgctgactc tcaacattct actcctccaa
5280aaaagaagag aaaggtagaa gaccccaagg actttccttc agaattgcta agttttttga
5340gtcatgctgt gtttagtaat agaactcttg cttgctttgc tatttacacc acaaaggaaa
5400aagctgcact gctatacaag aaaattatgg aaaaatattc tgtaaccttt ataagtaggc
5460ataacagtta taatcataac atactgtttt ttcttactcc acacaggcat agagtgtctg
5520ctattaataa ctatgctcaa aaattgtgta cctttagctt tttaatttgt aaaggggtta
5580ataaggaata tttgatgtat agtgccttga ctagagatca taatcagcca taccacattt
5640gtagaggttt tacttgcttt aaaaaacctc ccacacctcc ccctgaacct gaaacataaa
5700atgaatgcaa ttgttgttgt taacttgttt attgcagctt ataatggtta caaataaagc
5760aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg
5820tccaaactca tcaatgtatc ttatcatgtc tggatccggc tgtggaatgt gtgtcagtta
5880gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
5940tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc
6000atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta
6060actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca
6120gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga
6180ggcctaggct tttgcaaaaa gcttggacac aagacaggct tgcgagatat gtttgagaat
6240accactttat cccgcgtcag ggagaggcag tgcgtaaaaa gacgcggact catgtgaaat
6300actggttttt agtgcgccag atctctataa tctcgcgcaa cctattttcc cctcgaacac
6360tttttaagcc gtagataaac aggctgggac acttcacatg agcgaaaaat acatcgtcac
6420ctgggacatg ttgcagatcc atgcacgtaa actcgcaagc cgactgatgc cttctgaaca
6480atggaaaggc attattgccg taagccgtgg cggtctggta ccgggtgcgt tactggcgcg
6540tgaactgggt attcgtcatg tcgataccgt ttgtatttcc agctacgatc acgacaacca
6600gcgcgagctt aaagtgctga aacgcgcaga aggcgatggc gaaggcttca tcgttattga
6660tgacctggtg gataccggtg gtactgcggt tgcgattcgt gaaatgtatc caaaagcgca
6720ctttgtcacc atcttcgcaa aaccggctgg tcgtccgctg gttgatgact atgttgttga
6780tatcccgcaa gatacctgga ttgaacagcc gtgggatatg ggcgtcgtat tcgtcccgcc
6840aatctccggt cgctaatctt ttcaacgcct ggcactgccg ggcgttgttc tttttaactt
6900caggcgggtt acaatagttt ccagtaagta ttctggaggc tgcatccatg acacaggcaa
6960acctgagcga aaccctgttc aaaccccgct ttaaacatcc tgaaacctcg acgctagtcc
7020gccgctttaa tcacggcgca caaccgcctg tgcagtcggc ccttgatggt aaaaccatcc
7080ctcactggta tcgcatgatt aaccgtctga tgtggatctg gcgcggcatt gacccacgcg
7140aaatcctcga cgtccaggca cgtattgtga tgagcgatgc cgaacgtacc gacgatgatt
7200tatacgatac ggtgattggc taccgtggcg gcaactggat ttatgagtgg gccccggatc
7260tttgtgaagg aaccttactt ctgtggtgtg acataattgg acaaactacc tacagagatt
7320taaagctcta aggtaaatat aaaattttta agtgtataat gtgttaaact actgattcta
7380attgtttgtg tattttagat tccaacctat ggaactgatg aatgggagca gtggtggaat
7440gcctttaatg aggaaaacct gttttgctca gaagaaatgc catctagtga tgatgaggct
7500actgctgact ctcaacattc tactcctcca aaaaagaaga gaaaggtaga agaccccaag
7560gactttcctt cagaattgct aagttttttg agtcatgctg tgtttagtaa tagaactctt
7620gcttgctttg ctatttacac cacaaaggaa aaagctgcac tgctatacaa gaaaattatg
7680gaaaaatatt ctgtaacctt tataagtagg cataacagtt ataatcataa catactgttt
7740tttcttactc cacacaggca tagagtgtct gctattaata actatgctca aaaattgtgt
7800acctttagct ttttaatttg taaaggggtt aataaggaat atttgatgta tagtgccttg
7860actagagatc ataatcagcc ataccacatt tgtagaggtt ttacttgctt taaaaaacct
7920cccacacctc cccctgaacc tgaaacataa aatgaatgca attgttgttg ttaacttgtt
7980tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc
8040atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt
8100ctggatcccc aggaagctcc tctgtgtcct cataaaccct aacctcctct acttgagagg
8160acattccaat cataggctgc ccatccaccc tctgtgtcct cctgttaatt aggtcactta
8220acaaaaagga aattgggtag gggtttttca cagaccgctt tctaagggta attttaaaat
8280atctgggaag tcccttccac tgctgtgttc cagaagtgtt ggtaaacagc ccacaaatgt
8340caacagcaga aacatacaag ctgtcagctt tgcacaaggg cccaacaccc tgctcatcaa
8400gaagcactgt ggttgctgtg ttagtaatgt gcaaaacagg aggcacattt tccccacctg
8460tgtaggttcc aaaatatcta gtgttttcat ttttacttgg atcaggaacc cagcactcca
8520ctggataagc attatcctta tccaaaacag ccttgtggtc agtgttcatc tgctgactgt
8580caactgtagc attttttggg gttacagttt gagcaggata tttggtcctg tagtttgcta
8640acacaccctg cagctccaaa ggttccccac caacagcaaa aaaatgaaaa tttgaccctt
8700gaatgggttt tccagcacca ttttcatgag ttttttgtgt ccctgaatgc aagtttaaca
8760tagcagttac cccaataacc tcagttttaa cagtaacagc ttcccacatc aaaatatttc
8820cacaggttaa gtcctcattt aaattaggca aaggaattct tgaagacgaa agggcctcgt
8880gatacgccta tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg
8940cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa
9000tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa
9060gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct
9120tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg
9180tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg
9240ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt
9300atcccgtgtt gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga
9360cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga
9420attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac
9480gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg
9540ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac
9600gatgcctgca gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct
9660agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct
9720gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg
9780gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat
9840ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg
9900tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat
9960tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct
10020catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa
10080gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa
10140aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc
10200gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta
10260gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct
10320gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg
10380atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag
10440cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc
10500cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg
10560agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt
10620tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg
10680gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca
10740catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg
10800agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc
10860ggaagagcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt cacaccgcat
10920atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagt atacactccg
10980ctatcgctac gtgactgggt catggctgcg ccccgacacc cgccaacacc cgctgacgcg
11040ccctgacggg cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg
11100agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac gcgcgaggca gc
111521319DNAArtificial SequenceDescription of Artificial Sequence primer
13gacggatcgg gagatctcc
191422DNAArtificial SequenceDescription of Artificial Sequence primer
14ccgcctcaga agccatagag cc
221514455DNAArtificial SequenceDescription of Artificial Sequence plasmid
15aagcttgggc agaaatggtt gaactcccga gagtgtccta cacctagggg agaagcagcc
60aaggggttgt ttcccaccaa ggacgacccg tctgcgcaca aacggatgag cccatcagac
120aaagacatat tcattctctg ctgcaaactt ggcatagctc tgctttgcct ggggctattg
180ggggaagttg cggttcgtgc tcgcagggct ctcacccttg actcttttaa tagctcttct
240gtgcaagatt acaatctaaa caattcggag aactcgacct tcctcctgag gcaaggacca
300cagccaactt cctcttacaa gccgcatcga ttttgtcctt cagaaataga aataagaatg
360cttgctaaaa attatatttt taccaataag accaatccaa taggtagatt attagttact
420atgttaagaa atgaatcatt atcttttagt actattttta ctcaaattca gaagttagaa
480atgggaatag aaaatagaaa gagacgctca acctcaattg aagaacaggt gcaaggacta
540ttgaccacag gcctagaagt aaaaaaggga aaaaagagtg tttttgtcaa aataggagac
600aggtggtggc aaccagggac ttatagggga ccttacatct acagaccaac agatgccccc
660ttaccatata caggaagata tgacttaaat tgggataggt gggttacagt caatggctat
720aaagtgttat atagatccct cccttttcgt gaaagactcg ccagagctag acctccttgg
780tgtatgttgt ctcaagaaga aaaagacgac atgaaacaac aggtacatga ttatatttat
840ctaggaacag gaatgcactt ttggggaaag attttccata ccaaggaggg gacagtggct
900ggactaatag aacattattc tgcaaaaact catggcatga gttattatga atagccttta
960ttggcccaac cttgcggttc ccagggctta agtaagtttt tggttacaaa ctgttcttaa
1020aacgaggatg tgagacaagt ggtttcctga cttggtttgg tatcaaaggt tctgatctga
1080gctctgagtg ttctattttc ctatgttctt ttggaattta tccaaatctt atgtaaatgc
1140ttatgtaaac caagatataa aagagtgctg attttttgag taaacttgca acagtcctaa
1200cattcacctc ttgtgtgttt gtgtctgttc gccatcccgt ctccgctcgt cacttatcct
1260tcactttcca gagggtcccc ccgcagaccc cggcgaccct caggtcggcc gactgcggca
1320gctggcgccc gaacagggac cctcggataa gtgacccttg tctctatttc tactatttgg
1380tgtttgtctt gtattgtctc tttcttgtct ggctatcatc acaagagcgg aacggactca
1440ccatagggac caagctagcg actgaaaatg agacatatta tctgccacgg aggtgttatt
1500accgaagaaa tggccgccag tcttttggac cagctgatcg aagaggtact ggctgataat
1560cttccacctc ctagccattt tgaaccacct acccttcacg aactgtatga tttagacgtg
1620acggcccccg aagatcccaa cgaggaggcg gtttcgcaga tttttcccga ctctgtaatg
1680ttggcggtgc aggaagggat tgacttactc acttttccgc cggcgcccgg ttctccggag
1740ccgcctcacc tttcccggca gcccgagcag ccggagcaga gagccttggg tccggtttct
1800atgccaaacc ttgtaccgga ggtgatcgat cttacctgcc acgaggctgg ctttccaccc
1860agtgacgacg aggatgaaga gggtgaggag tttgtgttag attatgtgga gcaccccggg
1920cacggttgca ggtcttgtca ttatcaccgg aggaatacgg gggacccaga tattatgtgt
1980tcgctttgct atatgaggac ctgtggcatg tttgtctaca gtaagtgaaa attatgggca
2040gtgggtgata gagtggtggg tttggtgtgg taattttttt tttaattttt acagttttgt
2100ggtttaaaga attttgtatt gtgatttttt taaaaggtcc tgtgtctgaa cctgagcctg
2160agcccgagcc agaaccggag cctgcaagac ctacccgccg tcctaaaatg gcgcctgcta
2220tcctgagacg cccgacatca cctgtgtcta gagaatgcaa tagtagtacg gatagctgtg
2280actccggtcc ttctaacaca cctcctgaga tacacccggt ggtcccgctg tgccccatta
2340aaccagttgc cgtgagagtt ggtgggcgtc gccaggctgt ggaatgtatc gaggacttgc
2400ttaacgagcc tgggcaacct ttggacttga gctgtaaacg ccccaggcca taaggtgtaa
2460acctgtgatt gcgtgtgtgg ttaacgcctt tgtttgctga atgagttgat gtaagtttaa
2520taaagggtga gataatgttt aacttgcatg gcgtgttaaa tggggcgggg cttaaagggt
2580atataatgcg ccgtgggcta atcttggtta catctgacct catggaggct tgggagtgtt
2640tggaagattt ttctgctgtg cgtaacttgc tggaacagag ctctaacagt acctcttggt
2700tttggaggtt tctgtggggc tcatcccagg caaagttagt ctgcagaatt aaggaggatt
2760acaagtggga atttgaagag cttttgaaat cctgtggtga gctgtttgat tctttgaatc
2820tgggtcacca ggcgcttttc caagagaagg tcatcaagac tttggatttt tccacaccgg
2880ggcgcgctgc ggctgctgtt gcttttttga gttttataaa ggataaatgg agcgaagaaa
2940cccatctgag cggggggtac ctgctggatt ttctggccat gcatctgtgg agagcggttg
3000tgagacacaa gaatcgcctg ctactgttgt cttccgtccg cccggcgata ataccgacgg
3060aggagcagca gcagcagcag gaggaagcca ggcggcggcg gcaggagcag agcccatgga
3120acccgagagc cggcctggac cctcgggaat gaatgttgta caggtggctg aactgtatcc
3180agaactgaga cgcattttga caattacaga ggatgggcag gggctaaagg gggtaaagag
3240ggagcggggg gcttgtgagg ctacagagga ggctaggaat ctagctttta gcttaatgac
3300cagacaccgt cctgagtgta ttacttttca acagatcaag gataattgcg ctaatgagct
3360tgatctgctg gcgcagaagt attccataga gcagctgacc acttactggc tgcagccagg
3420ggatgatttt gaggaggcta ttagggtata tgcaaaggtg gcacttaggc cagattgcaa
3480gtacaagatc agcaaacttg taaatatcag gaattgttgc tacatttctg ggaacggggc
3540cgaggtggag atagatacgg aggatagggt ggcctttaga tgtagcatga taaatatgtg
3600gccgggggtg cttggcatgg acggggtggt tattatgaat gtaaggttta ctggccccaa
3660ttttagcggt acggttttcc tggccaatac caaccttatc ctacacggtg taagcttcta
3720tgggtttaac aatacctgtg tggaagcctg gaccgatgta agggttcggg gctgtgcctt
3780ttactgctgc tggaaggggg tggtgtgtcg ccccaaaagc agggcttcaa ttaagaaatg
3840cctctttgaa aggtgtacct tgggtatcct gtctgagggt aactccaggg tgcgccacaa
3900tgtggcctcc gactgtggtt gcttcatgct agtgaaaagc gtggctgtga ttaagcataa
3960catggtatgt ggcaactgcg aggacagggc ctctcagatg ctgacctgct cggacggcaa
4020ctgtcacctg ctgaagacca ttcacgtagc cagccactct cgcaaggcct ggccagtgtt
4080tgagcataac atactgaccc gctgttcctt gcatttgggt aacaggaggg gggtgttcct
4140accttaccaa tgcaatttga gtcacactaa gatattgctt gagcccgaga gcatgtccaa
4200ggtgaacctg aacggggtgt ttgacatgac catgaagatc tggaaggtgc tgaggtacga
4260tgagacccgc accaggtgca gaccctgcga gtgtggcggt aaacatatta ggaaccagcc
4320tgtgatgctg gatgtgaccg aggagctgag gcccgatcac ttggtgctgg cctgcacccg
4380cgctgagttt ggctctagcg atgaagatac agattgaggt actgaaatgt gtgggcgtgg
4440cttaagggtg ggaaagaata tataaggtgg gggtcttatg tagttttgta tctgttttgc
4500agcagccgcc gccgccatga gcaccaactc gtttgatgga agcattgtga gctcatattt
4560gacaacgcgc atgcccccat gggccggggt gcgtcagaat gtgatgggct ccagcattga
4620tggtcgcccc gtcctgcccg caaactctac taccttgacc tacgagaccg tgtctggaac
4680gccgttggag actgcagcct ccgccgccgc ttcagccgct gcagccaccg cccgcgggat
4740tgtgactgac tttgctttcc tgagcccgct tgcaagcagt gcagcttccc gttcatccgc
4800ccgcgatgac aagttgacgg ctcttttggc acaattggat tctttgaccc gggaacttaa
4860tgtcgtttct cagcagctgt tggatctgcg ccagcaggtt tctgccctga aggcttcctc
4920ccctcccaat gcggtttaaa acataaataa aaaaccagac tctgtttgga tttggatcaa
4980gcaagtgtct tgctgtctct cgagggatct ttgtgaagga accttacttc tgtggtgtga
5040cataattgga caaactacct acagagattt aaagctctaa ggtaaatata aaatttttaa
5100gtgtataatg tgttaaacta ctgattctaa ttgtttgtgt attttagatt ccaacctatg
5160gaactgatga atgggagcag tggtggaatg cctttaatga ggaaaacctg ttttgctcag
5220aagaaatgcc atctagtgat gatgaggcta ctgctgactc tcaacattct actcctccaa
5280aaaagaagag aaaggtagaa gaccccaagg actttccttc agaattgcta agttttttga
5340gtcatgctgt gtttagtaat agaactcttg cttgctttgc tatttacacc acaaaggaaa
5400aagctgcact gctatacaag aaaattatgg aaaaatattc tgtaaccttt ataagtaggc
5460ataacagtta taatcataac atactgtttt ttcttactcc acacaggcat agagtgtctg
5520ctattaataa ctatgctcaa aaattgtgta cctttagctt tttaatttgt aaaggggtta
5580ataaggaata tttgatgtat agtgccttga ctagagatca taatcagcca taccacattt
5640gtagaggttt tacttgcttt aaaaaacctc ccacacctcc ccctgaacct gaaacataaa
5700atgaatgcaa ttgttgttgt taacttgttt attgcagctt ataatggtta caaataaagc
5760aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg
5820tccaaactca tcaatgtatc ttatcatgtc tggatccggc tgtggaatgt gtgtcagtta
5880gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat
5940tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc
6000atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta
6060actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca
6120gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga
6180ggcctaggct tttgcaaaaa gcttggacac aagacaggct tgcgagatat gtttgagaat
6240accactttat cccgcgtcag ggagaggcag tgcgtaaaaa gacgcggact catgtgaaat
6300actggttttt agtgcgccag atctctataa tctcgcgcaa cctattttcc cctcgaacac
6360tttttaagcc gtagataaac aggctgggac acttcacatg agcgaaaaat acatcgtcac
6420ctgggacatg ttgcagatcc atgcacgtaa actcgcaagc cgactgatgc cttctgaaca
6480atggaaaggc attattgccg taagccgtgg cggtctggta ccgggtgcgt tactggcgcg
6540tgaactgggt attcgtcatg tcgataccgt ttgtatttcc agctacgatc acgacaacca
6600gcgcgagctt aaagtgctga aacgcgcaga aggcgatggc gaaggcttca tcgttattga
6660tgacctggtg gataccggtg gtactgcggt tgcgattcgt gaaatgtatc caaaagcgca
6720ctttgtcacc atcttcgcaa aaccggctgg tcgtccgctg gttgatgact atgttgttga
6780tatcccgcaa gatacctgga ttgaacagcc gtgggatatg ggcgtcgtat tcgtcccgcc
6840aatctccggt cgctaatctt ttcaacgcct ggcactgccg ggcgttgttc tttttaactt
6900caggcgggtt acaatagttt ccagtaagta ttctggaggc tgcatccatg acacaggcaa
6960acctgagcga aaccctgttc aaaccccgct ttaaacatcc tgaaacctcg acgctagtcc
7020gccgctttaa tcacggcgca caaccgcctg tgcagtcggc ccttgatggt aaaaccatcc
7080ctcactggta tcgcatgatt aaccgtctga tgtggatctg gcgcggcatt gacccacgcg
7140aaatcctcga cgtccaggca cgtattgtga tgagcgatgc cgaacgtacc gacgatgatt
7200tatacgatac ggtgattggc taccgtggcg gcaactggat ttatgagtgg gccccggatc
7260tttgtgaagg aaccttactt ctgtggtgtg acataattgg acaaactacc tacagagatt
7320taaagctcta aggtaaatat aaaattttta agtgtataat gtgttaaact actgattcta
7380attgtttgtg tattttagat tccaacctat ggaactgatg aatgggagca gtggtggaat
7440gcctttaatg aggaaaacct gttttgctca gaagaaatgc catctagtga tgatgaggct
7500actgctgact ctcaacattc tactcctcca aaaaagaaga gaaaggtaga agaccccaag
7560gactttcctt cagaattgct aagttttttg agtcatgctg tgtttagtaa tagaactctt
7620gcttgctttg ctatttacac cacaaaggaa aaagctgcac tgctatacaa gaaaattatg
7680gaaaaatatt ctgtaacctt tataagtagg cataacagtt ataatcataa catactgttt
7740tttcttactc cacacaggca tagagtgtct gctattaata actatgctca aaaattgtgt
7800acctttagct ttttaatttg taaaggggtt aataaggaat atttgatgta tagtgccttg
7860actagagatc ataatcagcc ataccacatt tgtagaggtt ttacttgctt taaaaaacct
7920cccacacctc cccctgaacc tgaaacataa aatgaatgca attgttgttg ttaacttgtt
7980tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc
8040atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt
8100ctggatcccc aggaagctcc tctgtgtcct cataaaccct aacctcctct acttgagagg
8160acattccaat cataggctgc ccatccaccc tctgtgtcct cctgttaatt aggtcactta
8220acaaaaagga aattgggtag gggtttttca cagaccgctt tctaagggta attttaaaat
8280atctgggaag tcccttccac tgctgtgttc cagaagtgtt ggtaaacagc ccacaaatgt
8340caacagcaga aacatacaag ctgtcagctt tgcacaaggg cccaacaccc tgctcatcaa
8400gaagcactgt ggttgctgtg ttagtaatgt gcaaaacagg aggcacattt tccccacctg
8460tgtaggttcc aaaatatcta gtgttttcat ttttacttgg atcaggaacc cagcactcca
8520ctggataagc attatcctta tccaaaacag ccttgtggtc agtgttcatc tgctgactgt
8580caactgtagc attttttggg gttacagttt gagcaggata tttggtcctg tagtttgcta
8640acacaccctg cagctccaaa ggttccccac caacagcaaa aaaatgaaaa tttgaccctt
8700gaatgggttt tccagcacca ttttcatgag ttttttgtgt ccctgaatgc aagtttaaca
8760tagcagttac cccaataacc tcagttttaa cagtaacagc ttcccacatc aaaatatttc
8820cacaggttaa gtcctcattt aaattaggca aaggaattct tgaagacgaa agggcctcgt
8880gatacgccta tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg
8940cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa
9000tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa
9060gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct
9120tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg
9180tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg
9240ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt
9300atcccgtgtt gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga
9360cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga
9420attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac
9480gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg
9540ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac
9600gatgcctgca gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct
9660agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct
9720gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg
9780gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat
9840ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg
9900tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat
9960tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct
10020catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa
10080gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa
10140aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc
10200gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta
10260gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct
10320gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg
10380atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag
10440cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc
10500cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg
10560agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt
10620tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg
10680gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca
10740catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg
10800agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc
10860ggaagagcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt cacaccgcat
10920accgcctcag aagccataga gcccaccgca tccccagcat gcctgctatt gtcttcccaa
10980tcctccccct tgctgtcctg ccccacccca ccccccagaa tagaatgaca cctactcaga
11040caatgcgatg caatttcctc attttattag gaaaggacag tgggagtggc accttccagg
11100gtcaaggaag gcacggggga ggggcaaaca acagatggct ggcaactaga aggcacagtc
11160gaggctgatc agcgagctct agcatttagg tgacactata gaatagggcc ctctagatgc
11220atgctcgagc ggccgcttct ttattcttgg gcaatgtatg aaaaagtgta agaggatgtg
11280gcaaatattt cattaatgta gttgtggcca gaccagtccc atgaaaatga catagagtat
11340gcacttggag ttgtgtctcc tgtttcctgt gtaccgttta gtgtaatggt tagtgttaca
11400ggtttagttt tgtctccgtt taagtaaact tgactgacaa tgttactttt ggcagtttta
11460ccgtgagatt ttggataagc tgataggtta ggcataaatc caacagcgtt tgtataggct
11520gtgccttcag taagatctcc atttctaaag ttccaatatt ctgggtccag gaaggaattg
11580tttagtagca ctccattttc gtcaaatctt ataataagat gagcactttg aactgttcca
11640gatattggag ccaaactgcc tttaacagcc aaaactgaaa ctgtagcaag tatttgactg
11700ccacattttg ttaagaccaa agtgagttta gcatctttct ctgcatttag tctacagtta
11760ggagatggag ctggtgtggt ccacaaagtt agcttatcat tatttttgtt tcctactgta
11820atggcacctg tgctgtcaaa actaaggcca gttcctagtt taggaaccat agccttgttt
11880gaatcaaatt ctaggccatg gccaattttt gttttgaggg gatttgtgtt tggtgcatta
11940ggtgaaccaa attcaagccc atctcctgca ttaatggcta tggctgtagc gtcaaacatc
12000aaccccttgg cagtgcttag gttaacctca agctttttgg aattgtttga agctgtaaac
12060aagtaaaggc ctttgttgta gttaatatcc aagttgtggg ctgagtttat aaaaagaggg
12120ccctgtccta gtcttagatt tagttggttt tgagcatcaa acggataact aacatcaagt
12180ataaggcgtc tgttttgaga atcaatcctt agtcctcctg ctacattaag ttgcatattg
12240ccttgtgaat caaaacccaa ggctccagta actttagttt gcaaggaagt attattaata
12300gtcacacctg gaccagttgc tacggtcaaa gtgtttaggt cgtctgttac atgcaaagga
12360gccccgtact ttagtcctag ttttccattt tgtgtataaa tgggctcttt caagtcaatg
12420cccaagctac cagtggcagt agttagaggg ggtgaggcag tgatagtaag ggtactgcta
12480tcggtggtgg tgagggggcc tgatgtttgc agggctagct ttccttctga cactgtgagg
12540ggtccttggg tggcaatgct aagtttggag tcgtgcacgg ttagcggggc ctgtgattgc
12600atggtgagtg tgttgcccgc gaccattaga ggtgcggcgg cagccacagt tagggcttct
12660gaggtaactg tgaggggtgc agatatttcc aggtttatgt ttgacttggt ttttttgaga
12720ggtgggctca cagtggttac attttgggag gtaaggttgc cggcctcgtc cagagagagg
12780ccgttgccca ttttgagcgc aagcatgcca ttggaggtaa ctagaggttc ggataggcgc
12840aaagagagta ccccaggggg actctcttga aacccattgg gggatacaaa gggaggagta
12900agaaaaggca cagttggagg accggtttcc gtgtcatatg gatacacggg gttgaaggta
12960tcttcagacg gtcttgcgcg cttcatcttg gatctcaagc ctgccacacc tcacctcgac
13020catccgccgt ctcaagaccg cctactttaa ttacatcatc agcagcacct ccgccagaaa
13080caaccccgac cgccacccgc tgccgcccgc cacggtgctc agcctacctt gcgactgtga
13140ctggttagac gcctttctcg agaggttttc cgatccggtc gatgcggact cgctcaggtc
13200cctcggtggc ggagtaccgt tcggaggccg acgggtttcc gatccaagag tactggaaag
13260accgcgaaga gtttgtcctc aaccgcgagc ccaacagcga gctcgaattc agatccgagc
13320tcggtaccaa gcttgggtct ccctatagtg agtcgtatta atttcgataa gccagtaagc
13380agtgggttct ctagttagcc agagagctct gcttatatag acctcccacc gtacacgcct
13440accgcccatt tgcgtcaatg gggcggagtt gttacgacat tttggaaagt cccgttgatt
13500ttggtgccaa aacaaactcc cattgacgtc aatggggtgg agacttggaa atccccgtga
13560gtcaaaccgc tatccacgcc cattgatgta ctgccaaaac cgcatcacca tggtaatagc
13620gatgactaat acgtagatgt actgccaagt aggaaagtcc cataaggtca tgtactgggc
13680ataatgccag gcgggccatt taccgtcatt gacgtcaata gggggcgtac ttggcatatg
13740atacacttga tgtactgcca agtgggcagt ttaccgtaaa tagtccaccc attgacgtca
13800atggaaagtc cctattggcg ttactatggg aacatacgtc attattgacg tcaatgggcg
13860ggggtcgttg ggcggtcagc caggcgggcc atttaccgta agttatgtaa cgcggaactc
13920catatatggg ctatgaacta atgaccccgt aattgattac tattaataac tagtcaataa
13980tcaatgtcaa cgcgtatatc tggcccgtac atcgcgaagc agcgcaaaac gcctaaccct
14040aagcagattc ttcatgcaat tgtcggtcaa gccttgcctt gttgtagctt aaattttgct
14100cgcgcactac tcagcgacct ccaacacaca agcagggagc agatactggc ttaactatgc
14160ggcatcagag cagattgtac tgagagtcga ccatagggga tcgggagatc tcccgatccg
14220tctatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc agtatacact
14280ccgctatcgc tacgtgactg ggtcatggct gcgccccgac acccgccaac acccgctgac
14340gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc
14400gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag gcagc
144551610610DNAArtificial SequenceDescription of Artificial Sequence
plasmid 16gacggatcgg gagatccgcg cggtacacag aattcaggag acacaactcc
aagtgcatac 60tctatgtcat tttcatggga ctggtctggc cacaactaca ttaatgaaat
atttgccaca 120tcctcttaca ctttttcata cattgcccaa gaataaagaa tcgtttgtgt
tatgtttcaa 180cgtgtttatt tttcaattgc agaaaatttc aagtcatttt tcattcagta
gtatagcccc 240accaccacat agcttataca gatcaccgta ccttaatcaa actcacagaa
ccctagtatt 300caacctgcca cctccctccc aacacacaga gtacacagtc ctttctcccc
ggctggcctt 360aaaaagcatc atatcatggg taacagacat attcttaggt gttatattcc
acacggtttc 420ctgtcgagcc aaacgctcat cagtgatatt aataaactcc ccgggcagct
cacttaagtt 480catgtcgctg tccagctgct gagccacagg ctgctgtcca acttgcggtt
gcttaacggg 540cggcgaagga gaagtccacg cctacatggg ggtagagtca taatcgtgca
tcaggatagg 600gcggtggtgc tgcagcagcg cgcgaataaa ctgctgccgc cgccgctccg
tcctgcagga 660atacaacatg gcagtggtct cctcagcgat gattcgcacc gcccgcagca
taaggcgcct 720tgtcctccgg gcacagcagc gcaccctgat ctcacttaaa tcagcacagt
aactgcagca 780cagcaccaca atattgttca aaatcccaca gtgcaaggcg ctgtatccaa
agctcatggc 840ggggaccaca gaacccacgt ggccatcata ccacaagcgc aggtagatta
agtggcgacc 900cctcataaac acgctggaca taaacattac ctcttttggc atgttgtaat
tcaccacctc 960ccggtaccat ataaacctct gattaaacat ggcgccatcc accaccatcc
taaaccagct 1020ggccaaaacc tgcccgccgg ctatacactg cagggaaccg ggactggaac
aatgacagtg 1080gagagcccag gactcgtaac catggatcat catgctcgtc atgatatcaa
tgttggcaca 1140acacaggcac acgtgcatac acttcctcag gattacaagc tcctcccgcg
ttagaaccat 1200atcccaggga acaacccatt cctgaatcag cgtaaatccc acactgcagg
gaagacctcg 1260cacgtaactc acgttgtgca ttgtcaaagt gttacattcg ggcagcagcg
gatgatcctc 1320cagtatggta gcgcgggttt ctgtctcaaa aggaggtaga cgatccctac
tgtacggagt 1380gcgccgagac aaccgagatc gtgttggtcg tagtgtcatg ccaaatggaa
cgccggacgt 1440agtcatattt cctgaagcaa aaccaggtgc gggcgtgaca aacagatctg
cgtctccggt 1500ctcgccgctt agatcgctct gtgtagtagt tgtagtatat ccactctctc
aaagcatcca 1560ggcgccccct ggcttcgggt tctatgtaaa ctccttcatg cgccgctgcc
ctgataacat 1620ccaccaccgc agaataagcc acacccagcc aacctacaca ttcgttctgc
gagtcacaca 1680cgggaggagc gggaagagct ggaagaacca tgtttttttt tttattccaa
aagattatcc 1740aaaacctcaa aatgaagatc tattaagtga acgcgctccc ctccggtggc
gtggtcaaac 1800tctacagcca aagaacagat aatggcattt gtaagatgtt gcacaatggc
ttccaaaagg 1860caaacggccc tcacgtccaa gtggacgtaa aggctaaacc cttcagggtg
aatctcctct 1920ataaacattc cagcaccttc aaccatgccc aaataattct catctcgcca
ccttctcaat 1980atatctctaa gcaaatcccg aatattaagt ccggccattg taaaaatctg
ctccagagcg 2040ccctccacct tcagcctcaa gcagcgaatc atgattgcaa aaattcaggt
tcctcacaga 2100cctgtataag attcaaaagc ggaacattaa caaaaatacc gcgatcccgt
aggtcccttc 2160gcagggccag ctgaacataa tcgtgcaggt ctgcacggac cagcgcggcc
acttccccgc 2220caggaacctt gacaaaagaa cccacactga ttatgacacg catactcgga
gctatgctaa 2280ccagcgtagc cccgatgtaa gctttgttgc atgggcggcg atataaaatg
caaggtgctg 2340ctcaaaaaat caggcaaagc ctcgcgcaaa aaagaaagca catcgtagtc
atgctcatgc 2400agataaaggc aggtaagctc cggaaccacc acagaaaaag acaccatttt
tctctcaaac 2460atgtctgcgg gtttctgcat aaacacaaaa taaaataaca aaaaaacatt
taaacattag 2520aagcctgtct tacaacagga aaaacaaccc ttataagcat aagacggact
acggccatgc 2580cggcgtgacc gtaaaaaaac tggtcaccgt gattaaaaag caccaccgac
agctcctcgg 2640tcatgtccgg agtcataatg taagactcgg taaacacatc aggttgattc
atcggtcagt 2700gctaaaaagc gaccgaaata gcccggggga atacataccc gcaggcgtag
agacaacatt 2760acagccccca taggaggtat aacaaaatta ataggagaga aaaacacata
aacacctgaa 2820aaaccctcct gcctaggcaa aatagcaccc tcccgctcca gaacaacata
cagcgcttca 2880cagcggcagc ctaacagtca gccttaccag taaaaaagaa aacctattaa
aaaaacacca 2940ctcgacacgg caccagctca atcagtcaca gtgtaaaaaa gggccaagtg
cagagcgagt 3000atatatagga ctaaaaaatg acgtaacggt taaagtccac aaaaaacacc
cagaaaaccg 3060cacgcgaacc tacgcccaga aacgaaagcc aaaaaaccca caacttcctc
aaatcgtcac 3120ttccgttttc ccacgttacg taacttcccg gatcctctcc cgatccccta
tggtcgactc 3180tcagtacaat ctgctctgat gccgcatagt taagccagta tctgctccct
gcttgtgtgt 3240tggaggtcgc tgagtagtgc gcgagcaaaa tttaagctac aacaaggcaa
ggcttgaccg 3300acaattgcat gaagaatctg cttagggtta ggcgttttgc gctgcttcgc
gatgtacggg 3360ccagatatac gcgttgacat tgattattga ctagttatta atagtaatca
attacggggt 3420cattagttca tagcccatat atggagttcc gcgttacata acttacggta
aatggcccgc 3480ctggctgacc gcccaacgac ccccgcccat tgacgtcaat aatgacgtat
gttcccatag 3540taacgccaat agggactttc cattgacgtc aatgggtgga ctatttacgg
taaactgccc 3600acttggcagt acatcaagtg tatcatatgc caagtacgcc ccctattgac
gtcaatgacg 3660gtaaatggcc cgcctggcat tatgcccagt acatgacctt atgggacttt
cctacttggc 3720agtacatcta cgtattagtc atcgctatta ccatggtgat gcggttttgg
cagtacatca 3780atgggcgtgg atagcggttt gactcacggg gatttccaag tctccacccc
attgacgtca 3840atgggagttt gttttggcac caaaatcaac gggactttcc aaaatgtcgt
aacaactccg 3900ccccattgac gcaaatgggc ggtaggcgtg tacggtggga ggtctatata
agcagagctc 3960tctggctaac tagagaaccc actgcttact ggcttatcga aattaatacg
actcactata 4020gggagaccca agcttggtac cgagctcgga tctgaattcg agctcgctgt
tgggctcgcg 4080gttgaggaca aactcttcgc ggtctttcca gtactcttgg atcggaaacc
cgtcggcctc 4140cgaacggtac tccgccaccg agggacctga gcgagtccgc atcgaccgga
tcggaaaacc 4200tctcgagaaa ggcgtctaac cagtcacagt cgcaaggtag gctgagcacc
gtggcgggcg 4260gcagcgggtg gcggtcgggg ttgtttctgg cggaggtgct gctgatgatg
taattaaagt 4320aggcggtctt gagacggcgg atggtcgagg tgaggtgtgg caggcttgag
atccaagatg 4380aagcgcgcaa gaccgtctga agataccttc aaccccgtgt atccatatga
cacggaaacc 4440ggtcctccaa ctgtgccttt tcttactcct ccctttgtat cccccaatgg
gtttcaagag 4500agtccccctg gggtactctc tttgcgccta tccgaacctc tagttacctc
caatggcatg 4560cttgcgctca aaatgggcaa cggcctctct ctggacgagg ccggcaacct
tacctcccaa 4620aatgtaacca ctgtgagccc acctctcaaa aaaaccaagt caaacataaa
cctggaaata 4680tctgcacccc tcacagttac ctcagaagcc ctaactgtgg ctgccgccgc
acctctaatg 4740gtcgcgggca acacactcac catgcaatca caggccccgc taaccgtgca
cgactccaaa 4800cttagcattg ccacccaagg acccctcaca gtgtcagaag gaaagctagc
cctgcaaaca 4860tcaggccccc tcaccaccac cgatagcagt acccttacta tcactgcctc
accccctcta 4920actactgcca ctggtagctt gggcattgac ttgaaagagc ccatttatac
acaaaatgga 4980aaactaggac taaagtacgg ggctcctttg catgtaacag acgacctaaa
cactttgacc 5040gtagcaactg gtccaggtgt gactattaat aatacttcct tgcaaactaa
agttactgga 5100gccttgggtt ttgattcaca aggcaatatg caacttaatg tagcaggagg
actaaggatt 5160gattctcaaa acagacgcct tatacttgat gttagttatc cgtttgatgc
tcaaaaccaa 5220ctaaatctaa gactaggaca gggccctctt tttataaact cagcccacaa
cttggatatt 5280aactacaaca aaggccttta cttgtttaca gcttcaaaca attccaaaaa
gcttgaggtt 5340aacctaagca ctgccaaggg gttgatgttt gacgctacag ccatagccat
taatgcagga 5400gatgggcttg aatttggttc acctaatgca ccaaacacaa atcccctcaa
aacaaaaatt 5460ggccatggcc tagaatttga ttcaaacaag gctatggttc ctaaactagg
aactggcctt 5520agttttgaca gcacaggtgc cattacagta ggaaacaaaa ataatgataa
gctaactttg 5580tggaccacac cagctccatc tcctaactgt agactaaatg cagagaaaga
tgctaaactc 5640actttggtct taacaaaatg tggcagtcaa atacttgcta cagtttcagt
tttggctgtt 5700aaaggcagtt tggctccaat atctggaaca gttcaaagtg ctcatcttat
tataagattt 5760gacgaaaatg gagtgctact aaacaattcc ttcctggacc cagaatattg
gaactttaga 5820aatggagatc ttactgaagg cacagcctat acaaacgctg ttggatttat
gcctaaccta 5880tcagcttatc caaaatctca cggtaaaact gccaaaagta acattgtcag
tcaagtttac 5940ttaaacggag acaaaactaa acctgtaaca ctaaccatta cactaaacgg
tacacaggaa 6000acaggagaca caactccaag tgcatactct atgtcatttt catgggactg
gtctggccac 6060aactacatta atgaaatatt tgccacatcc tcttacactt tttcatacat
tgcccaagaa 6120taaagaagcg gccgctcgag catgcatcta gagggcccta ttctatagtg
tcacctaaat 6180gctagagctc gctgatcagc ctcgactgtg ccttctagtt gccagccatc
tgttgtttgc 6240ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct
ttcctaataa 6300aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg
gggtggggtg 6360gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg
ggatgcggtg 6420ggctctatgg cttctgaggc ggaaagaacc agctggggct ctagggggta
tccccacgcg 6480ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt
gaccgctaca 6540cttgccagcg ccctagcgcc cgctcctttc gctttcttcc cttcctttct
cgccacgttc 6600gccggctttc cccgtcaagc tctaaatcgg ggcatccctt tagggttccg
atttagtgct 6660ttacggcacc tcgaccccaa aaaacttgat tagggtgatg gttcacgtag
tgggccatcg 6720ccctgataga cggtttttcg ccctttgacg ttggagtcca cgttctttaa
tagtggactc 6780ttgttccaaa ctggaacaac actcaaccct atctcggtct attcttttga
tttataaggg 6840attttgggga tttcggccta ttggttaaaa aatgagctga tttaacaaaa
atttaacgcg 6900aattaattct gtggaatgtg tgtcagttag ggtgtggaaa gtccccaggc
tccccaggca 6960ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg
aaagtcccca 7020ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc
aaccatagtc 7080ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca
ttctccgccc 7140catggctgac taattttttt tatttatgca gaggccgagg ccgcctctgc
ctctgagcta 7200ttccagaagt agtgaggagg cttttttgga ggcctaggct tttgcaaaaa
gctcccggga 7260gcttgtatat ccattttcgg atctgatcaa gagacaggat gaggatcgtt
tcgcatgatt 7320gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct
attcggctat 7380gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct
gtcagcgcag 7440gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga
actgcaggac 7500gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc
tgtgctcgac 7560gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg
gcaggatctc 7620ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc
aatgcggcgg 7680ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca
tcgcatcgag 7740cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga
cgaagagcat 7800caggggctcg cgccagccga actgttcgcc aggctcaagg cgcgcatgcc
cgacggcgag 7860gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga
aaatggccgc 7920ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca
ggacatagcg 7980ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg
cttcctcgtg 8040ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct
tcttgacgag 8100ttcttctgag cgggactctg gggttcgaaa tgaccgacca agcgacgccc
aacctgccat 8160cacgagattt cgattccacc gccgccttct atgaaaggtt gggcttcgga
atcgttttcc 8220gggacgccgg ctggatgatc ctccagcgcg gggatctcat gctggagttc
ttcgcccacc 8280ccaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc
acaaatttca 8340caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc
atcaatgtat 8400cttatcatgt ctgtataccg tcgacctcta gctagagctt ggcgtaatca
tggtcatagc 8460tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga
gccggaagca 8520taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt
gcgttgcgct 8580cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga
atcggccaac 8640gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc
actgactcgc 8700tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg
gtaatacggt 8760tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc
cagcaaaagg 8820ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc
ccccctgacg 8880agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga
ctataaagat 8940accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc
ctgccgctta 9000ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa
tgctcacgct 9060gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg
cacgaacccc 9120ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc
aacccggtaa 9180gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga
gcgaggtatg 9240taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact
agaaggacag 9300tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt
ggtagctctt 9360gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag
cagcagatta 9420cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg
tctgacgctc 9480agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa
aggatcttca 9540cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata
tatgagtaaa 9600cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg
atctgtctat 9660ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata
cgggagggct 9720taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg
gctccagatt 9780tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct
gcaactttat 9840ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt
tcgccagtta 9900atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc
tcgtcgtttg 9960gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga
tcccccatgt 10020tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt
aagttggccg 10080cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc
atgccatccg 10140taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa
tagtgtatgc 10200ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca
catagcagaa 10260ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca
aggatcttac 10320cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct
tcagcatctt 10380ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc
gcaaaaaagg 10440gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa
tattattgaa 10500gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt
tagaaaaata 10560aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc
106101724DNAArtificial SequenceDescription of Artificial
Sequence Primer 17tgtacaccgg atccggcgca cacc
241835DNAArtificial SequenceDescription of Artificial
Sequence Primer 18cacaacgagc tcaattaatt aattgccaca tcctc
35194PRTadenovirus 19Thr Leu Trp Thr 12012PRTadenovirus
20Pro Ser Ala Ser Ala Ser Ala Ser Ala Pro Gly Ser 1 5
102144PRTadenovirus 21Met Lys Arg Ala Arg Pro Ser Glu Asp Thr
Phe Asn Pro Val Tyr Pro 1 5 10
15Tyr Asp Thr Glu Thr Gly Pro Pro Thr Val Pro Phe Leu Thr Pro Pro
20 25 30Phe Val Ser Pro Asn
Gly Phe Gln Glu Ser Pro Pro 35
402243PRTadenovirus 22Met Ala Lys Arg Ala Arg Leu Ser Thr Ser Phe Asn Pro
Val Tyr Pro 1 5 10 15Tyr
Glu Asp Glu Ser Ser Ser Gln His Pro Phe Ile Asn Pro Gly Phe
20 25 30Ile Ser Pro Asp Gly Phe Thr Gln
Ser Pro Asn 35 402343PRTadenovirus 23Met Ser Lys
Arg Leu Arg Val Glu Asp Asp Phe Asn Pro Val Tyr Pro 1 5
10 15Tyr Gly Tyr Ala Arg Asn Gln Asn Ile
Pro Phe Leu Thr Pro Pro Phe 20 25
30Val Ser Ser Asp Gly Phe Lys Asn Phe Pro Pro 35
402442PRTadenovirus 24Met Lys Arg Ala Arg Phe Glu Asp Asp Phe Asn
Pro Val Tyr Pro Tyr 1 5 10
15Glu His Tyr Asn Pro Leu Asp Ile Pro Phe Ile Thr Pro Pro Phe Ala
20 25 30Ser Ser Asn Gly Leu Gln
Glu Lys Pro Pro 35 402542PRTadenovirus 25Met Lys
Arg Thr Arg Ile Glu Asp Asp Phe Asn Pro Val Tyr Pro Tyr 1
5 10 15Asp Thr Ser Ser Thr Pro Ser Ile
Pro Tyr Val Ala Pro Pro Phe Val 20 25
30Ser Ser Asp Gly Leu Gln Glu Asn Pro Pro 35
4026327DNAadenovirus 26agatctgaat tcgagctcgc tgttgggctc gcggttgagg
acaaactctt cgcggtcttt 60ccagtactct tggatcggaa acccgtcggc ctccgaacgg
tactccgcca ccgagggacc 120tgagcgagtc cgcatcgacc ggatcggaaa acctctcgag
aaaggcgtct aaccagtcac 180agtcgcaagg taggctgagc accgtggcgg gcggcagcgg
gtggcggtcg gggttgtttc 240tggcggaggt gctgctgatg atgtaattaa agtaggcggt
cttgagacgg cggatggtcg 300aggtgaggtg tggcaggctt gagatct
3272732480DNAadenovirus 27catcatcaat aatatacctt
attttggatt gaagccaata tgataatgag ggggtggagt 60ttgtgacgtg gcgcggggcg
tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120gatgttgcaa gtgtggcgga
acacatgtaa gcgacggatg tggcaaaagt gacgtttttg 180gtgtgcgccg gtgtacacag
gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240taaatttggg cgtaaccgag
taagatttgg ccattttcgc gggaaaactg aataagagga 300agtgaaatct gaataatttt
gtgttactca tagcgcgtaa tctctagcat cgatgtcgac 360aagcttgaat tcgattaatg
tgagttagct cactcattag gcaccccagg ctttacactt 420tatgcttccg gctcgtatgt
tgtgtggaat tgtgagcgga taacaatttc acacaggaaa 480cagctatgac catgattacg
aattcggcgc agcaccatgg cctgaaataa cctctgaaag 540aggaacttgg ttaggtacct
tctgaggcgg aaagaaccag ctgtggaatg tgtgtcagtt 600agggtgtgga aagtccccag
gctccccagc aggcagaagt atgcaaagca tgcatctcaa 660ttagtcagca accaggtgtg
gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag 720catgcatctc aattagtcag
caaccatagt cccgccccta actccgccca tcccgcccct 780aactccgccc agttccgccc
attctccgcc ccatggctga ctaatttttt ttatttatgc 840agaggccgag gccgcctcgg
cctctgagct attccagaag tagtgaggag gcttttttgg 900aggcctaggc ttttgcaaaa
agcttgggat ctctataatc tcgcgcaacc tattttcccc 960tcgaacactt tttaagccgt
agataaacag gctgggacac ttcacatgag cgaaaaatac 1020atcgtcacct gggacatgtt
gcagatccat gcacgtaaac tcgcaagccg actgatgcct 1080tctgaacaat ggaaaggcat
tattgccgta agccgtggcg gtctggtacc ggtgggtgaa 1140gaccagaaac agcacctcga
actgagccgc gatattgccc agcgtttcaa cgcgctgtat 1200ggcgagatcg atcccgtcgt
tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 1260cttaatcgcc ttgcagcaca
tccccctttc gccagctggc gtaatagcga agaggcccgc 1320accgatcgcc cttcccaaca
gttgcgcagc ctgaatggcg aatggcgctt tgcctggttt 1380ccggcaccag aagcggtgcc
ggaaagctgg ctggagtgcg atcttcctga ggccgatact 1440gtcgtcgtcc cctcaaactg
gcagatgcac ggttacgatg cgcccatcta caccaacgta 1500acctatccca ttacggtcaa
tccgccgttt gttcccacgg agaatccgac gggttgttac 1560tcgctcacat ttaatgttga
tgaaagctgg ctacaggaag gccagacgcg aattattttt 1620gatggcgtta actcggcgtt
tcatctgtgg tgcaacgggc gctgggtcgg ttacggccag 1680gacagtcgtt tgccgtctga
atttgacctg agcgcatttt tacgcgccgg agaaaaccgc 1740ctcgcggtga tggtgctgcg
ttggagtgac ggcagttatc tggaagatca ggatatgtgg 1800cggatgagcg gcattttccg
tgacgtctcg ttgctgcata aaccgactac acaaatcagc 1860gatttccatg ttgccactcg
ctttaatgat gatttcagcc gcgctgtact ggaggctgaa 1920gttcagatgt gcggcgagtt
gcgtgactac ctacgggtaa cagtttcttt atggcagggt 1980gaaacgcagg tcgccagcgg
caccgcgcct ttcggcggtg aaattatcga tgagcgtggt 2040ggttatgccg atcgcgtcac
actacgtctg aacgtcgaaa acccgaaact gtggagcgcc 2100gaaatcccga atctctatcg
tgcggtggtt gaactgcaca ccgccgacgg cacgctgatt 2160gaagcagaag cctgcgatgt
cggtttccgc gaggtgcgga ttgaaaatgg tctgctgctg 2220ctgaacggca agccgttgct
gattcgaggc gttaaccgtc acgagcatca tcctctgcat 2280ggtcaggtca tggatgagca
gacgatggtg caggatatcc tgctgatgaa gcagaacaac 2340tttaacgccg tgcgctgttc
gcattatccg aaccatccgc tgtggtacac gctgtgcgac 2400cgctacggcc tgtatgtggt
ggatgaagcc aatattgaaa cccacggcat ggtgccaatg 2460aatcgtctga ccgatgatcc
gcgctggcta ccggcgatga gcgaacgcgt aacgcgaatg 2520gtgcagcgcg atcgtaatca
cccgagtgtg atcatctggt cgctggggaa tgaatcaggc 2580cacggcgcta atcacgacgc
gctgtatcgc tggatcaaat ctgtcgatcc ttcccgcccg 2640gtgcagtatg aaggcggcgg
agccgacacc acggccaccg atattatttg cccgatgtac 2700gcgcgcgtgg atgaagacca
gcccttcccg gctgtgccga aatggtccat caaaaaatgg 2760ctttcgctac ctggagagac
gcgcccgctg atcctttgcg aatacgccca cgcgatgggt 2820aacagtcttg gcggtttcgc
taaatactgg caggcgtttc gtcagtatcc ccgtttacag 2880ggcggcttcg tctgggactg
ggtggatcag tcgctgatta aatatgatga aaacggcaac 2940ccgtggtcgg cttacggcgg
tgattttggc gatacgccga acgatcgcca gttctgtatg 3000aacggtctgg tctttgccga
ccgcacgccg catccagcgc tgacggaagc aaaacaccag 3060cagcagtttt tccagttccg
tttatccggg caaaccatcg aagtgaccag cgaatacctg 3120ttccgtcata gcgataacga
gctcctgcac tggatggtgg cgctggatgg taagccgctg 3180gcaagcggtg aagtgcctct
ggatgtcgct ccacaaggta aacagttgat tgaactgcct 3240gaactaccgc agccggagag
cgccgggcaa ctctggctca cagtacgcgt agtgcaaccg 3300aacgcgaccg catggtcaga
agccgggcac atcagcgcct ggcagcagtg gcgtctggcg 3360gaaaacctca gtgtgacgct
ccccgccgcg tcccacgcca tcccgcatct gaccaccagc 3420gaaatggatt tttgcatcga
gctgggtaat aagcgttggc aatttaaccg ccagtcaggc 3480tttctttcac agatgtggat
tggcgataaa aaacaactgc tgacgccgct gcgcgatcag 3540ttcacccgtg caccgctgga
taacgacatt ggcgtaagtg aagcgacccg cattgaccct 3600aacgcctggg tcgaacgctg
gaaggcggcg ggccattacc aggccgaagc agcgttgttg 3660cagtgcacgg cagatacact
tgctgatgcg gtgctgatta cgaccgctca cgcgtggcag 3720catcagggga aaaccttatt
tatcagccgg aaaacctacc ggattgatgg tagtggtcaa 3780atggcgatta ccgttgatgt
tgaagtggcg agcgatacac cgcatccggc gcggattggc 3840ctgaactgcc agctggcgca
ggtagcagag cgggtaaact ggctcggatt agggccgcaa 3900gaaaactatc ccgaccgcct
tactgccgcc tgttttgacc gctgggatct gccattgtca 3960gacatgtata ccccgtacgt
cttcccgagc gaaaacggtc tgcgctgcgg gacgcgcgaa 4020ttgaattatg gcccacacca
gtggcgcggc gacttccagt tcaacatcag ccgctacagt 4080caacagcaac tgatggaaac
cagccatcgc catctgctgc acgcggaaga aggcacatgg 4140ctgaatatcg acggtttcca
tatggggatt ggtggcgacg actcctggag cccgtcagta 4200tcggcggaat tccagctgag
cgccggtcgc taccattacc agttggtctg gtgtcaaaaa 4260taataataac cgggcaggcc
atgtctgccc gtatttcgcg taaggaaatc cattatgtac 4320tatttaaaaa acacaaactt
ttggatgttc ggtttattct ttttctttta cttttttatc 4380atgggagcct acttcccgtt
tttcccgatt tggctacatg acatcaacca tatcagcaaa 4440agtgatacgg gtattatttt
tgccgctatt tctctgttct cgctattatt ccaaccgctg 4500tttggtctgc tttctgacaa
actcggaact tgtttattgc agcttataat ggttacaaat 4560aaagcaatag catcacaaat
ttcacaaata aagcattttt ttcactgcat tctagttgtg 4620gtttgtccaa actcatcaat
gtatcttatc atgtctggat ccagatctgg gcgtggctta 4680agggtgggaa agaatatata
aggtgggggt cttatgtagt tttgtatctg ttttgcagca 4740gccgccgccg ccatgagcac
caactcgttt gatggaagca ttgtgagctc atatttgaca 4800acgcgcatgc ccccatgggc
cggggtgcgt cagaatgtga tgggctccag cattgatggt 4860cgccccgtcc tgcccgcaaa
ctctactacc ttgacctacg agaccgtgtc tggaacgccg 4920ttggagactg cagcctccgc
cgccgcttca gccgctgcag ccaccgcccg cgggattgtg 4980actgactttg ctttcctgag
cccgcttgca agcagtgcag cttcccgttc atccgcccgc 5040gatgacaagt tgacggctct
tttggcacaa ttggattctt tgacccggga acttaatgtc 5100gtttctcagc agctgttgga
tctgcgccag caggtttctg ccctgaaggc ttcctcccct 5160cccaatgcgg tttaaaacat
aaataaaaaa ccagactctg tttggatttg gatcaagcaa 5220gtgtcttgct gtctttattt
aggggttttg cgcgcgcggt aggcccggga ccagcggtct 5280cggtcgttga gggtcctgtg
tattttttcc aggacgtggt aaaggtgact ctggatgttc 5340agatacatgg gcataagccc
gtctctgggg tggaggtagc accactgcag agcttcatgc 5400tgcggggtgg tgttgtagat
gatccagtcg tagcaggagc gctgggcgtg gtgcctaaaa 5460atgtctttca gtagcaagct
gattgccagg ggcaggccct tggtgtaagt gtttacaaag 5520cggttaagct gggatgggtg
catacgtggg gatatgagat gcatcttgga ctgtattttt 5580aggttggcta tgttcccagc
catatccctc cggggattca tgttgtgcag aaccaccagc 5640acagtgtatc cggtgcactt
gggaaatttg tcatgtagct tagaaggaaa tgcgtggaag 5700aacttggaga cgcccttgtg
acctccaaga ttttccatgc attcgtccat aatgatggca 5760atgggcccac gggcggcggc
ctgggcgaag atatttctgg gatcactaac gtcatagttg 5820tgttccagga tgagatcgtc
ataggccatt tttacaaagc gcgggcggag ggtgccagac 5880tgcggtataa tggttccatc
cggcccaggg gcgtagttac cctcacagat ttgcatttcc 5940cacgctttga gttcagatgg
ggggatcatg tctacctgcg gggcgatgaa gaaaacggtt 6000tccggggtag gggagatcag
ctgggaagaa agcaggttcc tgagcagctg cgacttaccg 6060cagccggtgg gcccgtaaat
cacacctatt accgggtgca actggtagtt aagagagctg 6120cagctgccgt catccctgag
caggggggcc acttcgttaa gcatgtccct gactcgcatg 6180ttttccctga ccaaatccgc
cagaaggcgc tcgccgccca gcgatagcag ttcttgcaag 6240gaagcaaagt ttttcaacgg
tttgagaccg tccgccgtag gcatgctttt gagcgtttga 6300ccaagcagtt ccaggcggtc
ccacagctcg gtcacctgct ctacggcatc tcgatccagc 6360atatctcctc gtttcgcggg
ttggggcggc tttcgctgta cggcagtagt cggtgctcgt 6420ccagacgggc cagggtcatg
tctttccacg ggcgcagggt cctcgtcagc gtagtctggg 6480tcacggtgaa ggggtgcgct
ccgggctgcg cgctggccag ggtgcgcttg aggctggtcc 6540tgctggtgct gaagcgctgc
cggtcttcgc cctgcgcgtc ggccaggtag catttgacca 6600tggtgtcata gtccagcccc
tccgcggcgt ggcccttggc gcgcagcttg cccttggagg 6660aggcgccgca cgaggggcag
tgcagacttt tgagggcgta gagcttgggc gcgagaaata 6720ccgattccgg ggagtaggca
tccgcgccgc aggccccgca gacggtctcg cattccacga 6780gccaggtgag ctctggccgt
tcggggtcaa aaaccaggtt tcccccatgc tttttgatgc 6840gtttcttacc tctggtttcc
atgagccggt gtccacgctc ggtgacgaaa aggctgtccg 6900tgtccccgta tacagacttg
agaggcctgt cctcgagcgg tgttccgcgg tcctcctcgt 6960atagaaactc ggaccactct
gagacaaagg ctcgcgtcca ggccagcacg aaggaggcta 7020agtgggaggg gtagcggtcg
ttgtccacta gggggtccac tcgctccagg gtgtgaagac 7080acatgtcgcc ctcttcggca
tcaaggaagg tgattggttt gtaggtgtag gccacgtgac 7140cgggtgttcc tgaagggggg
ctataaaagg gggtgggggc gcgttcgtcc tcactctctt 7200ccgcatcgct gtctgcgagg
gccagctgtt ggggtgagta ctccctctga aaagcgggca 7260tgacttctgc gctaagattg
tcagtttcca aaaacgagga ggatttgata ttcacctggc 7320ccgcggtgat gcctttgagg
gtggccgcat ccatctggtc agaaaagaca atctttttgt 7380tgtcaagctt ggtggcaaac
gacccgtaga gggcgttgga cagcaacttg gcgatggagc 7440gcagggtttg gtttttgtcg
cgatcggcgc gctccttggc cgcgatgttt agctgcacgt 7500attcgcgcgc aacgcaccgc
cattcgggaa agacggtggt gcgctcgtcg ggcaccaggt 7560gcacgcgcca accgcggttg
tgcagggtga caaggtcaac gctggtggct acctctccgc 7620gtaggcgctc gttggtccag
cagaggcggc cgcccttgcg cgagcagaat ggcggtaggg 7680ggtctagctg cgtctcgtcc
ggggggtctg cgtccacggt aaagaccccg ggcagcaggc 7740gcgcgtcgaa gtagtctatc
ttgcatcctt gcaagtctag cgcctgctgc catgcgcggg 7800cggcaagcgc gcgctcgtat
gggttgagtg ggggacccca tggcatgggg tgggtgagcg 7860cggaggcgta catgccgcaa
atgtcgtaaa cgtagagggg ctctctgagt attccaagat 7920atgtagggta gcatcttcca
ccgcggatgc tggcgcgcac gtaatcgtat agttcgtgcg 7980agggagcgag gaggtcggga
ccgaggttgc tacgggcggg ctgctctgct cggaagacta 8040tctgcctgaa gatggcatgt
gagttggatg atatggttgg acgctggaag acgttgaagc 8100tggcgtctgt gagacctacc
gcgtcacgca cgaaggaggc gtaggagtcg cgcagcttgt 8160tgaccagctc ggcggtgacc
tgcacgtcta gggcgcagta gtccagggtt tccttgatga 8220tgtcatactt atcctgtccc
ttttttttcc acagctcgcg gttgaggaca aactcttcgc 8280ggtctttcca gtactcttgg
atcggaaacc cgtcggcctc cgaacggtaa gagcctagca 8340tgtagaactg gttgacggcc
tggtaggcgc agcatccctt ttctacgggt agcgcgtatg 8400cctgcgcggc cttccggagc
gaggtgtggg tgagcgcaaa ggtgtccctg accatgactt 8460tgaggtactg gtatttgaag
tcagtgtcgt cgcatccgcc ctgctcccag agcaaaaagt 8520ccgtgcgctt tttggaacgc
ggatttggca gggcgaaggt gacatcgttg aagagtatct 8580ttcccgcgcg aggcataaag
ttgcgtgtga tgcggaaggg tcccggcacc tcggaacggt 8640tgttaattac ctgggcggcg
agcacgatct cgtcaaagcc gttgatgttg tggcccacaa 8700tgtaaagttc caagaagcgc
gggatgccct tgatggaagg caatttttta agttcctcgt 8760aggtgagctc ttcaggggag
ctgagcccgt gctctgaaag ggcccagtct gcaagatgag 8820ggttggaagc gacgaatgag
ctccacaggt cacgggccat tagcatttgc aggtggtcgc 8880gaaaggtcct aaactggcga
cctatggcca ttttttctgg ggtgatgcag tagaaggtaa 8940gcgggtcttg ttcccagcgg
tcccatccaa ggttcgcggc taggtctcgc gcggcagtca 9000ctagaggctc atctccgccg
aacttcatga ccagcatgaa gggcacgagc tgcttcccaa 9060aggcccccat ccaagtatag
gtctctacat cgtaggtgac aaagagacgc tcggtgcgag 9120gatgcgagcc gatcgggaag
aactggatct cccgccacca attggaggag tggctattga 9180tgtggtgaaa gtagaagtcc
ctgcgacggg ccgaacactc gtgctggctt ttgtaaaaac 9240gtgcgcagta ctggcagcgg
tgcacgggct gtacatcctg cacgaggttg acctgacgac 9300cgcgcacaag gaagcagagt
gggaatttga gcccctcgcc tggcgggttt ggctggtggt 9360cttctacttc ggctgcttgt
ccttgaccgt ctggctgctc gaggggagtt acggtggatc 9420ggaccaccac gccgcgcgag
cccaaagtcc agatgtccgc gcgcggcggt cggagcttga 9480tgacaacatc gcgcagatgg
gagctgtcca tggtctggag ctcccgcggc gtcaggtcag 9540gcgggagctc ctgcaggttt
acctcgcata gacgggtcag ggcgcgggct agatccaggt 9600gatacctaat ttccaggggc
tggttggtgg cggcgtcgat ggcttgcaag aggccgcatc 9660cccgcggcgc gactacggta
ccgcgcggcg ggcggtgggc cgcgggggtg tccttggatg 9720atgcatctaa aagcggtgac
gcgggcgagc ccccggaggt agggggggct ccggacccgc 9780cgggagaggg ggcaggggca
cgtcggcgcc gcgcgcgggc aggagctggt gctgcgcgcg 9840taggttgctg gcgaacgcga
cgacgcggcg gttgatctcc tgaatctggc gcctctgcgt 9900gaagacgacg ggcccggtga
gcttgagcct gaaagagagt tcgacagaat caatttcggt 9960gtcgttgacg gcggcctggc
gcaaaatctc ctgcacgtct cctgagttgt cttgataggc 10020gatctcggcc atgaactgct
cgatctcttc ctcctggaga tctccgcgtc cggctcgctc 10080cacggtggcg gcgaggtcgt
tggaaatgcg ggccatgagc tgcgagaagg cgttgaggcc 10140tccctcgttc cagacgcggc
tgtagaccac gcccccttcg gcatcgcggg cgcgcatgac 10200cacctgcgcg agattgagct
ccacgtgccg ggcgaagacg gcgtagtttc gcaggcgctg 10260aaagaggtag ttgagggtgg
tggcggtgtg ttctgccacg aagaagtaca taacccagcg 10320tcgcaacgtg gattcgttga
tatcccccaa ggcctcaagg cgctccatgg cctcgtagaa 10380gtccacggcg aagttgaaaa
actgggagtt gcgcgccgac acggttaact cctcctccag 10440aagacggatg agctcggcga
cagtgtcgcg cacctcgcgc tcaaaggcta caggggcctc 10500ttcttcttct tcaatctcct
cttccataag ggcctcccct tcttcttctt ctggcggcgg 10560tgggggaggg gggacacggc
ggcgacgacg gcgcaccggg aggcggtcga caaagcgctc 10620gatcatctcc ccgcggcgac
ggcgcatggt ctcggtgacg gcgcggccgt tctcgcgggg 10680gcgcagttgg aagacgccgc
ccgtcatgtc ccggttatgg gttggcgggg ggctgccatg 10740cggcagggat acggcgctaa
cgatgcatct caacaattgt tgtgtaggta ctccgccgcc 10800gagggacctg agcgagtccg
catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 10860ccagtcacag tcgcaaggta
ggctgagcac cgtggcgggc ggcagcgggc ggcggtcggg 10920gttgtttctg gcggaggtgc
tgctgatgat gtaattaaag taggcggtct tgagacggcg 10980gatggtcgac agaagcacca
tgtccttggg tccggcctgc tgaatgcgca ggcggtcggc 11040catgccccag gcttcgtttt
gacatcggcg caggtctttg tagtagtctt gcatgagcct 11100ttctaccggc acttcttctt
ctccttcctc ttgtcctgca tctcttgcat ctatcgctgc 11160ggcggcggcg gagtttggcc
gtaggtggcg ccctcttcct cccatgcgtg tgaccccgaa 11220gcccctcatc ggctgaagca
gggctaggtc ggcgacaacg cgctcggcta atatggcctg 11280ctgcacctgc gtgagggtag
actggaagtc atccatgtcc acaaagcggt ggtatgcgcc 11340cgtgttgatg gtgtaagtgc
agttggccat aacggaccag ttaacggtct ggtgacccgg 11400ctgcgagagc tcggtgtacc
tgagacgcga gtaagccctc gagtcaaata cgtagtcgtt 11460gcaagtccgc accaggtact
ggtatcccac caaaaagtgc ggcggcggct ggcggtagag 11520gggccagcgt agggtggccg
gggctccggg ggcgagatct tccaacataa ggcgatgata 11580tccgtagatg tacctggaca
tccaggtgat gccggcggcg gtggtggagg cgcgcggaaa 11640gtcgcggacg cggttccaga
tgttgcgcag cggcaaaaag tgctccatgg tcgggacgct 11700ctggccggtc aggcgcgcgc
aatcgttgac gctctagacc gtgcaaaagg agagcctgta 11760agcgggcact cttccgtggt
ctggtggata aattcgcaag ggtatcatgg cggacgaccg 11820gggttcgagc cccgtatccg
gccgtccgcc gtgatccatg cggttaccgc ccgcgtgtcg 11880aacccaggtg tgcgacgtca
gacaacgggg gagtgctcct tttggcttcc ttccaggcgc 11940ggcggctgct gcgctagctt
ttttggccac tggccgcgcg cagcgtaagc ggttaggctg 12000gaaagcgaaa gcattaagtg
gctcgctccc tgtagccgga gggttatttt ccaagggttg 12060agtcgcggga cccccggttc
gagtctcgga ccggccggac tgcggcgaac gggggtttgc 12120ctccccgtca tgcaagaccc
cgcttgcaaa ttcctccgga aacagggacg agcccctttt 12180ttgcttttcc cagatgcatc
cggtgctgcg gcagatgcgc ccccctcctc agcagcggca 12240agagcaagag cagcggcaga
catgcagggc accctcccct cctcctaccg cgtcaggagg 12300ggcgacatcc gcggttgacg
cggcagcaga tggtgattac gaacccccgc ggcgccgggc 12360ccggcactac ctggacttgg
aggagggcga gggcctggcg cggctaggag cgccctctcc 12420tgagcggtac ccaagggtgc
agctgaagcg tgatacgcgt gaggcgtacg tgccgcggca 12480gaacctgttt cgcgaccgcg
agggagagga gcccgaggag atgcgggatc gaaagttcca 12540cgcagggcgc gagctgcggc
atggcctgaa tcgcgagcgg ttgctgcgcg aggaggactt 12600tgagcccgac gcgcgaaccg
ggattagtcc cgcgcgcgca cacgtggcgg ccgccgacct 12660ggtaaccgca tacgagcaga
cggtgaacca ggagattaac tttcaaaaaa gctttaacaa 12720ccacgtgcgt acgcttgtgg
cgcgcgagga ggtggctata ggactgatgc atctgtggga 12780ctttgtaagc gcgctggagc
aaaacccaaa tagcaagccg ctcatggcgc agctgttcct 12840tatagtgcag cacagcaggg
acaacgaggc attcagggat gcgctgctaa acatagtaga 12900gcccgagggc cgctggctgc
tcgatttgat aaacatcctg cagagcatag tggtgcagga 12960gcgcagcttg agcctggctg
acaaggtggc cgccatcaac tattccatgc ttagcctggg 13020caagttttac gcccgcaaga
tataccatac cccttacgtt cccatagaca aggaggtaaa 13080gatcgagggg ttctacatgc
gcatggcgct gaaggtgctt accttgagcg acgacctggg 13140cgtttatcgc aacgagcgca
tccacaaggc cgtgagcgtg agccggcggc gcgagctcag 13200cgaccgcgag ctgatgcaca
gcctgcaaag ggccctggct ggcacgggca gcggcgatag 13260agaggccgag tcctactttg
acgcgggcgc tgacctgcgc tgggccccaa gccgacgcgc 13320cctggaggca gctggggccg
gacctgggct ggcggtggca cccgcgcgcg ctggcaacgt 13380cggcggcgtg gaggaatatg
acgaggacga tgagtacgag ccagaggacg gcgagtacta 13440agcggtgatg tttctgatca
gatgatgcaa gacgcaacgg acccggcggt gcgggcggcg 13500ctgcagagcc agccgtccgg
ccttaactcc acggacgact ggcgccaggt catggaccgc 13560atcatgtcgc tgactgcgcg
caatcctgac gcgttccggc agcagccgca ggccaaccgg 13620ctctccgcaa ttctggaagc
ggtggtcccg gcgcgcgcaa accccacgca cgagaaggtg 13680ctggcgatcg taaacgcgct
ggccgaaaac agggccatcc ggcccgacga ggccggcctg 13740gtctacgacg cgctgcttca
gcgcgtggct cgttacaaca gcggcaacgt gcagaccaac 13800ctggaccggc tggtggggga
tgtgcgcgag gccgtggcgc agcgtgagcg cgcgcagcag 13860cagggcaacc tgggctccat
ggttgcacta aacgccttcc tgagtacaca gcccgccaac 13920gtgccgcggg gacaggagga
ctacaccaac tttgtgagcg cactgcggct aatggtgact 13980gagacaccgc aaagtgaggt
gtaccagtct gggccagact attttttcca gaccagtaga 14040caaggcctgc agaccgtaaa
cctgagccag gctttcaaaa acttgcaggg gctgtggggg 14100gtgcgggctc ccacaggcga
ccgcgcgacc gtgtctagct tgctgacgcc caactcgcgc 14160ctgttgctgc tgctaatagc
gcccttcacg gacagtggca gcgtgtcccg ggacacatac 14220ctaggtcact tgctgacact
gtaccgcgag gccataggtc aggcgcatgt ggacgagcat 14280actttccagg agattacaag
tgtcagccgc gcgctggggc aggaggacac gggcagcctg 14340gaggcaaccc taaactacct
gctgaccaac cggcggcaga agatcccctc gttgcacagt 14400ttaaacagcg aggaggagcg
cattttgcgc tacgtgcagc agagcgtgag ccttaacctg 14460atgcgcgacg gggtaacgcc
cagcgtggcg ctggacatga ccgcgcgcaa catggaaccg 14520ggcatgtatg cctcaaaccg
gccgtttatc aaccgcctaa tggactactt gcatcgcgcg 14580gccgccgtga accccgagta
tttcaccaat gccatcttga acccgcactg gctaccgccc 14640cctggtttct acaccggggg
attcgaggtg cccgagggta acgatggatt cctctgggac 14700gacatagacg acagcgtgtt
ttccccgcaa ccgcagaccc tgctagagtt gcaacagcgc 14760gagcaggcag aggcggcgct
gcgaaaggaa agcttccgca ggccaagcag cttgtccgat 14820ctaggcgctg cggccccgcg
gtcagatgct agtagcccat ttccaagctt gatagggtct 14880cttaccagca ctcgcaccac
ccgcccgcgc ctgctgggcg aggaggagta cctaaacaac 14940tcgctgctgc agccgcagcg
cgaaaaaaac ctgcctccgg catttcccaa caacgggata 15000gagagcctag tggacaagat
gagtagatgg aagacgtacg cgcaggagca cagggacgtg 15060ccaggcccgc gcccgcccac
ccgtcgtcaa aggcacgacc gtcagcgggg tctggtgtgg 15120gaggacgatg actcggcaga
cgacagcagc gtcctggatt tgggagggag tggcaacccg 15180tttgcgcacc ttcgccccag
gctggggaga atgttttaaa aaaaaaaaag catgatgcaa 15240aataaaaaac tcaccaaggc
catggcaccg agcgttggtt ttcttgtatt ccccttagta 15300tgcggcgcgc ggcgatgtat
gaggaaggtc ctcctccctc ctacgagagt gtggtgagcg 15360cggcgccagt ggcggcggcg
ctgggttctc ccttcgatgc tcccctggac ccgccgtttg 15420tgcctccgcg gtacctgcgg
cctaccgggg ggagaaacag catccgttac tctgagttgg 15480cacccctatt cgacaccacc
cgtgtgtacc tggtggacaa caagtcaacg gatgtggcat 15540ccctgaacta ccagaacgac
cacagcaact ttctgaccac ggtcattcaa aacaatgact 15600acagcccggg ggaggcaagc
acacagacca tcaatcttga cgaccggtcg cactggggcg 15660gcgacctgaa aaccatcctg
cataccaaca tgccaaatgt gaacgagttc atgtttacca 15720ataagtttaa ggcgcgggtg
atggtgtcgc gcttgcctac taaggacaat caggtggagc 15780tgaaatacga gtgggtggag
ttcacgctgc ccgagggcaa ctactccgag accatgacca 15840tagaccttat gaacaacgcg
atcgtggagc actacttgaa agtgggcaga cagaacgggg 15900ttctggaaag cgacatcggg
gtaaagtttg acacccgcaa cttcagactg gggtttgacc 15960ccgtcactgg tcttgtcatg
cctggggtat atacaaacga agccttccat ccagacatca 16020ttttgctgcc aggatgcggg
gtggacttca cccacagccg cctgagcaac ttgttgggca 16080tccgcaagcg gcaacccttc
caggagggct ttaggatcac ctacgatgat ctggagggtg 16140gtaacattcc cgcactgttg
gatgtggacg cctaccaggc gagcttgaaa gatgacaccg 16200aacagggcgg gggtggcgca
ggcggcagca acagcagtgg cagcggcgcg gaagagaact 16260ccaacgcggc agccgcggca
atgcagccgg tggaggacat gaacgatcat gccattcgcg 16320gcgacacctt tgccacacgg
gctgaggaga agcgcgctga ggccgaagca gcggccgaag 16380ctgccgcccc cgctgcgcaa
cccgaggtcg agaagcctca gaagaaaccg gtgatcaaac 16440ccctgacaga ggacagcaag
aaacgcagtt acaacctaat aagcaatgac agcaccttca 16500cccagtaccg cagctggtac
cttgcataca actacggcga ccctcagacc ggaatccgct 16560catggaccct gctttgcact
cctgacgtaa cctgcggctc ggagcaggtc tactggtcgt 16620tgccagacat gatgcaagac
cccgtgacct tccgctccac gcgccagatc agcaactttc 16680cggtggtggg cgccgagctg
ttgcccgtgc actccaagag cttctacaac gaccaggccg 16740tctactccca actcatccgc
cagtttacct ctctgaccca cgtgttcaat cgctttcccg 16800agaaccagat tttggcgcgc
ccgccagccc ccaccatcac caccgtcagt gaaaacgttc 16860ctgctctcac agatcacggg
acgctaccgc tgcgcaacag catcggagga gtccagcgag 16920tgaccattac tgacgccaga
cgccgcacct gcccctacgt ttacaaggcc ctgggcatag 16980tctcgccgcg cgtcctatcg
agccgcactt tttgagcaag catgtccatc cttatatcgc 17040ccagcaataa cacaggctgg
ggcctgcgct tcccaagcaa gatgtttggc ggggccaaga 17100agcgctccga ccaacaccca
gtgcgcgtgc gcgggcacta ccgcgcgccc tggggcgcgc 17160acaaacgcgg ccgcactggg
cgcaccaccg tcgatgacgc catcgacgcg gtggtggagg 17220aggcgcgcaa ctacacgccc
acgccgccac cagtgtccac agtggacgcg gccattcaga 17280ccgtggtgcg cggagcccgg
cgctatgcta aaatgaagag acggcggagg cgcgtagcac 17340gtcgccaccg ccgccgaccc
ggcactgccg cccaacgcgc ggcggcggcc ctgcttaacc 17400gcgcacgtcg caccggccga
cgggcggcca tgcgggccgc tcgaaggctg gccgcgggta 17460ttgtcactgt gccccccagg
tccaggcgac gagcggccgc cgcagcagcc gcggccatta 17520gtgctatgac tcagggtcgc
aggggcaacg tgtattgggt gcgcgactcg gttagcggcc 17580tgcgcgtgcc cgtgcgcacc
cgccccccgc gcaactagat tgcaagaaaa aactacttag 17640actcgtactg ttgtatgtat
ccagcggcgg cggcgcgcaa cgaagctatg tccaagcgca 17700aaatcaaaga agagatgctc
caggtcatcg cgccggagat ctatggcccc ccgaagaagg 17760aagagcagga ttacaagccc
cgaaagctaa agcgggtcaa aaagaaaaag aaagatgatg 17820atgatgaact tgacgacgag
gtggaactgc tgcacgctac cgcgcccagg cgacgggtac 17880agtggaaagg tcgacgcgta
aaacgtgttt tgcgacccgg caccaccgta gtctttacgc 17940ccggtgagcg ctccacccgc
acctacaagc gcgtgtatga tgaggtgtac ggcgacgagg 18000acctgcttga gcaggccaac
gagcgcctcg gggagtttgc ctacggaaag cggcataagg 18060acatgctggc gttgccgctg
gacgagggca acccaacacc tagcctaaag cccgtaacac 18120tgcagcaggt gctgcccgcg
cttgcaccgt ccgaagaaaa gcgcggccta aagcgcgagt 18180ctggtgactt ggcacccacc
gtgcagctga tggtacccaa gcgccagcga ctggaagatg 18240tcttggaaaa aatgaccgtg
gaacctgggc tggagcccga ggtccgcgtg cggccaatca 18300agcaggtggc gccgggactg
ggcgtgcaga ccgtggacgt tcagataccc actaccagta 18360gcaccagtat tgccaccgcc
acagagggca tggagacaca aacgtccccg gttgcctcag 18420cggtggcgga tgccgcggtg
caggcggtcg ctgcggccgc gtccaagacc tctacggagg 18480tgcaaacgga cccgtggatg
tttcgcgttt cagccccccg gcgcccgcgc ggttcgagga 18540agtacggcgc cgccagcgcg
ctactgcccg aatatgccct acatccttcc attgcgccta 18600cccccggcta tcgtggctac
acctaccgcc ccagaagacg agcaactacc cgacgccgaa 18660ccaccactgg aacccgccgc
cgccgtcgcc gtcgccagcc cgtgctggcc ccgatttccg 18720tgcgcagggt ggctcgcgaa
ggaggcagga ccctggtgct gccaacagcg cgctaccacc 18780ccagcatcgt ttaaaagccg
gtctttgtgg ttcttgcaga tatggccctc acctgccgcc 18840tccgtttccc ggtgccggga
ttccgaggaa gaatgcaccg taggaggggc atggccggcc 18900acggcctgac gggcggcatg
cgtcgtgcgc accaccggcg gcggcgcgcg tcgcaccgtc 18960gcatgcgcgg cggtatcctg
cccctcctta ttccactgat cgccgcggcg attggcgccg 19020tgcccggaat tgcatccgtg
gccttgcagg cgcagagaca ctgattaaaa acaagttgca 19080tgtggaaaaa tcaaaataaa
aagtctggac tctcacgctc gcttggtcct gtaactattt 19140tgtagaatgg aagacatcaa
ctttgcgtct ctggccccgc gacacggctc gcgcccgttc 19200atgggaaact ggcaagatat
cggcaccagc aatatgagcg gtggcgcctt cagctggggc 19260tcgctgtgga gcggcattaa
aaatttcggt tccaccgtta agaactatgg cagcaaggcc 19320tggaacagca gcacaggcca
gatgctgagg gataagttga aagagcaaaa tttccaacaa 19380aaggtggtag atggcctggc
ctctggcatt agcggggtgg tggacctggc caaccaggca 19440gtgcaaaata agattaacag
taagcttgat ccccgccctc ccgtagagga gcctccaccg 19500gccgtggaga cagtgtctcc
agaggggcgt ggcgaaaagc gtccgcgccc cgacagggaa 19560gaaactctgg tgacgcaaat
agacgagcct ccctcgtacg aggaggcact aaagcaaggc 19620ctgcccacca cccgtcccat
cgcgcccatg gctaccggag tgctgggcca gcacacaccc 19680gtaacgctgg acctgcctcc
ccccgccgac acccagcaga aacctgtgct gccaggcccg 19740accgccgttg ttgtaacccg
tcctagccgc gcgtccctgc gccgcgccgc cagcggtccg 19800cgatcgttgc ggcccgtagc
cagtggcaac tggcaaagca cactgaacag catcgtgggt 19860ctgggggtgc aatccctgaa
gcgccgacga tgcttctgaa tagctaacgt gtcgtatgtg 19920tgtcatgtat gcgtccatgt
cgccgccaga ggagctgctg agccgccgcg cgcccgcttt 19980ccaagatggc taccccttcg
atgatgccgc agtggtctta catgcacatc tcgggccagg 20040acgcctcgga gtacctgagc
cccgggctgg tgcagtttgc ccgcgccacc gagacgtact 20100tcagcctgaa taacaagttt
agaaacccca cggtggcgcc tacgcacgac gtgaccacag 20160accggtccca gcgtttgacg
ctgcggttca tccctgtgga ccgtgaggat actgcgtact 20220cgtacaaggc gcggttcacc
ctagctgtgg gtgataaccg tgtgctggac atggcttcca 20280cgtactttga catccgcggc
gtgctggaca ggggccctac ttttaagccc tactctggca 20340ctgcctacaa cgccctggct
cccaagggtg ccccaaatcc ttgcgaatgg gatgaagctg 20400ctactgctct tgaaataaac
ctagaagaag aggacgatga caacgaagac gaagtagacg 20460agcaagctga gcagcaaaaa
actcacgtat ttgggcaggc gccttattct ggtataaata 20520ttacaaagga gggtattcaa
ataggtgtcg aaggtcaaac acctaaatat gccgataaaa 20580catttcaacc tgaacctcaa
ataggagaat ctcagtggta cgaaactgaa attaatcatg 20640cagctgggag agtccttaaa
aagactaccc caatgaaacc atgttacggt tcatatgcaa 20700aacccacaaa tgaaaatgga
gggcaaggca ttcttgtaaa gcaacaaaat ggaaagctag 20760aaagtcaagt ggaaatgcaa
tttttctcaa ctactgaggc gaccgcaggc aatggtgata 20820acttgactcc taaagtggta
ttgtacagtg aagatgtaga tatagaaacc ccagacactc 20880atatttctta catgcccact
attaaggaag gtaactcacg agaactaatg ggccaacaat 20940ctatgcccaa caggcctaat
tacattgctt ttagggacaa ttttattggt ctaatgtatt 21000acaacagcac gggtaatatg
ggtgttctgg cgggccaagc atcgcagttg aatgctgttg 21060tagatttgca agacagaaac
acagagcttt cataccagct tttgcttgat tccattggtg 21120atagaaccag gtacttttct
atgtggaatc aggctgttga cagctatgat ccagatgtta 21180gaattattga aaatcatgga
actgaagatg aacttccaaa ttactgcttt ccactgggag 21240gtgtgattaa tacagagact
cttaccaagg taaaacctaa aacaggtcag gaaaatggat 21300gggaaaaaga tgctacagaa
ttttcagata aaaatgaaat aagagttgga aataattttg 21360ccatggaaat caatctaaat
gccaacctgt ggagaaattt cctgtactcc aacatagcgc 21420tgtatttgcc cgacaagcta
aagtacagtc cttccaacgt aaaaatttct gataacccaa 21480acacctacga ctacatgaac
aagcgagtgg tggctcccgg gttagtggac tgctacatta 21540accttggagc acgctggtcc
cttgactata tggacaacgt caacccattt aaccaccacc 21600gcaatgctgg cctgcgctac
cgctcaatgt tgctgggcaa tggtcgctat gtgcccttcc 21660acatccaggt gcctcagaag
ttctttgcca ttaaaaacct ccttctcctg ccgggctcat 21720acacctacga gtggaacttc
aggaaggatg ttaacatggt tctgcagagc tccctaggaa 21780atgacctaag ggttgacgga
gccagcatta agtttgatag catttgcctt tacgccacct 21840tcttccccat ggcccacaac
accgcctcca cgcttgaggc catgcttaga aacgacacca 21900acgaccagtc ctttaacgac
tatctctccg ccgccaacat gctctaccct atacccgcca 21960acgctaccaa cgtgcccata
tccatcccct cccgcaactg ggcggctttc cgcggctggg 22020ccttcacgcg ccttaagact
aaggaaaccc catcactggg ctcgggctac gacccttatt 22080acacctactc tggctctata
ccctacctag atggaacctt ttacctcaac cacaccttta 22140agaaggtggc cattaccttt
gactcttctg tcagctggcc tggcaatgac cgcctgctta 22200cccccaacga gtttgaaatt
aagcgctcag ttgacgggga gggttacaac gttgcccagt 22260gtaacatgac caaagactgg
ttcctggtac aaatgctagc taactacaac attggctacc 22320agggcttcta tatcccagag
agctacaagg accgcatgta ctccttcttt agaaacttcc 22380agcccatgag ccgtcaggtg
gtggatgata ctaaatacaa ggactaccaa caggtgggca 22440tcctacacca acacaacaac
tctggatttg ttggctacct tgcccccacc atgcgcgaag 22500gacaggccta ccctgctaac
ttcccctatc cgcttatagg caagaccgca gttgacagca 22560ttacccagaa aaagtttctt
tgcgatcgca ccctttggcg catcccattc tccagtaact 22620ttatgtccat gggcgcactc
acagacctgg gccaaaacct tctctacgcc aactccgccc 22680acgcgctaga catgactttt
gaggtggatc ccatggacga gcccaccctt ctttatgttt 22740tgtttgaagt ctttgacgtg
gtccgtgtgc accggccgca ccgcggcgtc atcgaaaccg 22800tgtacctgcg cacgcccttc
tcggccggca acgccacaac ataaagaagc aagcaacatc 22860aacaacagct gccgccatgg
gctccagtga gcaggaactg aaagccattg tcaaagatct 22920tggttgtggg ccatattttt
tgggcaccta tgacaagcgc tttccaggct ttgtttctcc 22980acacaagctc gcctgcgcca
tagtcaatac ggccggtcgc gagactgggg gcgtacactg 23040gatggccttt gcctggaacc
cgcactcaaa aacatgctac ctctttgagc cctttggctt 23100ttctgaccag cgactcaagc
aggtttacca gtttgagtac gagtcactcc tgcgccgtag 23160cgccattgct tcttcccccg
accgctgtat aacgctggaa aagtccaccc aaagcgtaca 23220ggggcccaac tcggccgcct
gtggactatt ctgctgcatg tttctccacg cctttgccaa 23280ctggccccaa actcccatgg
atcacaaccc caccatgaac cttattaccg gggtacccaa 23340ctccatgctc aacagtcccc
aggtacagcc caccctgcgt cgcaaccagg aacagctcta 23400cagcttcctg gagcgccact
cgccctactt ccgcagccac agtgcgcaga ttaggagcgc 23460cacttctttt tgtcacttga
aaaacatgta aaaataatgt actagagaca ctttcaataa 23520aggcaaatgc ttttatttgt
acactctcgg gtgattattt acccccaccc ttgccgtctg 23580cgccgtttaa aaatcaaagg
ggttctgccg cgcatcgcta tgcgccactg gcagggacac 23640gttgcgatac tggtgtttag
tgctccactt aaactcaggc acaaccatcc gcggcagctc 23700ggtgaagttt tcactccaca
ggctgcgcac catcaccaac gcgtttagca ggtcgggcgc 23760cgatatcttg aagtcgcagt
tggggcctcc gccctgcgcg cgcgagttgc gatacacagg 23820gttgcagcac tggaacacta
tcagcgccgg gtggtgcacg ctggccagca cgctcttgtc 23880ggagatcaga tccgcgtcca
ggtcctccgc gttgctcagg gcgaacggag tcaactttgg 23940tagctgcctt cccaaaaagg
gcgcgtgccc aggctttgag ttgcactcgc accgtagtgg 24000catcaaaagg tgaccgtgcc
cggtctgggc gttaggatac agcgcctgca taaaagcctt 24060gatctgctta aaagccacct
gagcctttgc gccttcagag aagaacatgc cgcaagactt 24120gccggaaaac tgattggccg
gacaggccgc gtcgtgcacg cagcaccttg cgtcggtgtt 24180ggagatctgc accacatttc
ggccccaccg gttcttcacg atcttggcct tgctagactg 24240ctccttcagc gcgcgctgcc
cgttttcgct cgtcacatcc atttcaatca cgtgctcctt 24300atttatcata atgcttccgt
gtagacactt aagctcgcct tcgatctcag cgcagcggtg 24360cagccacaac gcgcagcccg
tgggctcgtg atgcttgtag gtcacctctg caaacgactg 24420caggtacgcc tgcaggaatc
gccccatcat cgtcacaaag gtcttgttgc tggtgaaggt 24480cagctgcaac ccgcggtgct
cctcgttcag ccaggtcttg catacggccg ccagagcttc 24540cacttggtca ggcagtagtt
tgaagttcgc ctttagatcg ttatccacgt ggtacttgtc 24600catcagcgcg cgcgcagcct
ccatgccctt ctcccacgca gacacgatcg gcacactcag 24660cgggttcatc accgtaattt
cactttccgc ttcgctgggc tcttcctctt cctcttgcgt 24720ccgcatacca cgcgccactg
ggtcgtcttc attcagccgc cgcactgtgc gcttacctcc 24780tttgccatgc ttgattagca
ccggtgggtt gctgaaaccc accatttgta gcgccacatc 24840ttctctttct tcctcgctgt
ccacgattac ctctggtgat ggcgggcgct cgggcttggg 24900agaagggcgc ttctttttct
tcttgggcgc aatggccaaa tccgccgccg aggtcgatgg 24960ccgcgggctg ggtgtgcgcg
gcaccagcgc gtcttgtgat gagtcttcct cgtcctcgga 25020ctcgatacgc cgcctcatcc
gcttttttgg gggcgcccgg ggaggcggcg gcgacgggga 25080cggggacgac acgtcctcca
tggttggggg acgtcgcgcc gcaccgcgtc cgcgctcggg 25140ggtggtttcg cgctgctcct
cttcccgact ggccatttcc ttctcctata ggcagaaaaa 25200gatcatggag tcagtcgaga
agaaggacag cctaaccgcc ccctctgagt tcgccaccac 25260cgcctccacc gatgccgcca
acgcgcctac caccttcccc gtcgaggcac ccccgcttga 25320ggaggaggaa gtgattatcg
agcaggaccc aggttttgta agcgaagacg acgaggaccg 25380ctcagtacca acagaggata
aaaagcaaga ccaggacaac gcagaggcaa acgaggaaca 25440agtcgggcgg ggggacgaaa
ggcatggcga ctacctagat gtgggagacg acgtgctgtt 25500gaagcatctg cagcgccagt
gcgccattat ctgcgacgcg ttgcaagagc gcagcgatgt 25560gcccctcgcc atagcggatg
tcagccttgc ctacgaacgc cacctattct caccgcgcgt 25620accccccaaa cgccaagaaa
acggcacatg cgagcccaac ccgcgcctca acttctaccc 25680cgtatttgcc gtgccagagg
tgcttgccac ctatcacatc tttttccaaa actgcaagat 25740acccctatcc tgccgtgcca
accgcagccg agcggacaag cagctggcct tgcggcaggg 25800cgctgtcata cctgatatcg
cctcgctcaa cgaagtgcca aaaatctttg agggtcttgg 25860acgcgacgag aagcgcgcgg
caaacgctct gcaacaggaa aacagcgaaa atgaaagtca 25920ctctggagtg ttggtggaac
tcgagggtga caacgcgcgc ctagccgtac taaaacgcag 25980catcgaggtc acccactttg
cctacccggc acttaaccta ccccccaagg tcatgagcac 26040agtcatgagt gagctgatcg
tgcgccgtgc gcagcccctg gagagggatg caaatttgca 26100agaacaaaca gaggagggcc
tacccgcagt tggcgacgag cagctagcgc gctggcttca 26160aacgcgcgag cctgccgact
tggaggagcg acgcaaacta atgatggccg cagtgctcgt 26220taccgtggag cttgagtgca
tgcagcggtt ctttgctgac ccggagatgc agcgcaagct 26280agaggaaaca ttgcactaca
cctttcgaca gggctacgta cgccaggcct gcaagatctc 26340caacgtggag ctctgcaacc
tggtctccta ccttggaatt ttgcacgaaa accgccttgg 26400gcaaaacgtg cttcattcca
cgctcaaggg cgaggcgcgc cgcgactacg tccgcgactg 26460cgtttactta tttctatgct
acacctggca gacggccatg ggcgtttggc agcagtgctt 26520ggaggagtgc aacctcaagg
agctgcagaa actgctaaag caaaacttga aggacctatg 26580gacggccttc aacgagcgct
ccgtggccgc gcacctggcg gacatcattt tccccgaacg 26640cctgcttaaa accctgcaac
agggtctgcc agacttcacc agtcaaagca tgttgcagaa 26700ctttaggaac tttatcctag
agcgctcagg aatcttgccc gccacctgct gtgcacttcc 26760tagcgacttt gtgcccatta
agtaccgcga atgccctccg ccgctttggg gccactgcta 26820ccttctgcag ctagccaact
accttgccta ccactctgac ataatggaag acgtgagcgg 26880tgacggtcta ctggagtgtc
actgtcgctg caacctatgc accccgcacc gctccctggt 26940ttgcaattcg cagctgctta
acgaaagtca aattatcggt acctttgagc tgcagggtcc 27000ctcgcctgac gaaaagtccg
cggctccggg gttgaaactc actccggggc tgtggacgtc 27060ggcttacctt cgcaaatttg
tacctgagga ctaccacgcc cacgagatta ggttctacga 27120agaccaatcc cgcccgccaa
atgcggagct taccgcctgc gtcattaccc agggccacat 27180tcttggccaa ttgcaagcca
tcaacaaagc ccgccaagag tttctgctac gaaagggacg 27240gggggtttac ttggaccccc
agtccggcga ggagctcaac ccaatccccc cgccgccgca 27300gccctatcag cagcagccgc
gggcccttgc ttcccaggat ggcacccaaa aagaagctgc 27360agctgccgcc gccacccacg
gacgaggagg aatactggga cagtcaggca gaggaggttt 27420tggacgagga ggaggaggac
atgatggaag actgggagag cctagacgag gaagcttccg 27480aggtcgaaga ggtgtcagac
gaaacaccgt caccctcggt cgcattcccc tcgccggcgc 27540cccagaaatc ggcaaccggt
tccagcatgg ctacaacctc cgctcctcag gcgccgccgg 27600cactgcccgt tcgccgaccc
aaccgtagat gggacaccac tggaaccagg gccggtaagt 27660ccaagcagcc gccgccgtta
gcccaagagc aacaacagcg ccaaggctac cgctcatggc 27720gcgggcacaa gaacgccata
gttgcttgct tgcaagactg tgggggcaac atctccttcg 27780cccgccgctt tcttctctac
catcacggcg tggccttccc ccgtaacatc ctgcattact 27840accgtcatct ctacagccca
tactgcaccg gcggcagcgg cagcggcagc aacagcagcg 27900gccacacaga agcaaaggcg
accggatagc aagactctga caaagcccaa gaaatccaca 27960gcggcggcag cagcaggagg
aggagcgctg cgtctggcgc ccaacgaacc cgtatcgacc 28020cgcgagctta gaaacaggat
ttttcccact ctgtatgcta tatttcaaca gagcaggggc 28080caagaacaag agctgaaaat
aaaaaacagg tctctgcgat ccctcacccg cagctgcctg 28140tatcacaaaa gcgaagatca
gcttcggcgc acgctggaag acgcggaggc tctcttcagt 28200aaatactgcg cgctgactct
taaggactag tttcgcgccc tttctcaaat ttaagcgcga 28260aaactacgtc atctccagcg
gccacacccg gcgccagcac ctgtcgtcag cgccattatg 28320agcaaggaaa ttcccacgcc
ctacatgtgg agttaccagc cacaaatggg acttgcggct 28380ggagctgccc aagactactc
aacccgaata aactacatga gcgcgggacc ccacatgata 28440tcccgggtca acggaatccg
cgcccaccga aaccgaattc tcttggaaca ggcggctatt 28500accaccacac ctcgtaataa
ccttaatccc cgtagttggc ccgctgccct ggtgtaccag 28560gaaagtcccg ctcccaccac
tgtggtactt cccagagacg cccaggccga agttcagatg 28620actaactcag gggcgcagct
tgcgggcggc tttcgtcaca gggtgcggtc gcccgggcag 28680ggtataactc acctgacaat
cagagggcga ggtattcagc tcaacgacga gtcggtgagc 28740tcctcgcttg gtctccgtcc
ggacgggaca tttcagatcg gcggcgccgg ccgtccttca 28800ttcacgcctc gtcaggcaat
cctaactctg cagacctcgt cctctgagcc gcgctctgga 28860ggcattggaa ctctgcaatt
tattgaggag tttgtgccat cggtctactt taaccccttc 28920tcgggacctc ccggccacta
tccggatcaa tttattccta actttgacgc ggtaaaggac 28980tcggcggacg gctacgactg
aatgttaagt ggagaggcag agcaactgcg cctgaaacac 29040ctggtccact gtcgccgcca
caagtgcttt gcccgcgact ccggtgagtt ttgctacttt 29100gaattgcccg aggatcatat
cgagggcccg gcgcacggcg tccggcttac cgcccaggga 29160gagcttgccc gtagcctgat
tcgggagttt acccagcgcc ccctgctagt tgagcgggac 29220aggggaccct gtgttctcac
tgtgatttgc aactgtccta accttggatt acatcaagat 29280ttaattaatt gccacatcct
cttacacttt ttcatacatt gcccaagaat aaagaatcgt 29340ttgtgttatg tttcaacgtg
tttatttttc aattgcagaa aatttcaagt catttttcat 29400tcagtagtat agccccacca
ccacatagct tatacagatc accgtacctt aatcaaactc 29460acagaaccct agtattcaac
ctgccacctc cctcccaaca cacagagtac acagtccttt 29520ctccccggct ggccttaaaa
agcatcatat catgggtaac agacatattc ttaggtgtta 29580tattccacac ggtttcctgt
cgagccaaac gctcatcagt gatattaata aactccccgg 29640gcagctcact taagttcatg
tcgctgtcca gctgctgagc cacaggctgc tgtccaactt 29700gcggttgctt aacgggcggc
gaaggagaag tccacgccta catgggggta gagtcataat 29760cgtgcatcag gatagggcgg
tggtgctgca gcagcgcgcg aataaactgc tgccgccgcc 29820gctccgtcct gcaggaatac
aacatggcag tggtctcctc agcgatgatt cgcaccgccc 29880gcagcataag gcgccttgtc
ctccgggcac agcagcgcac cctgatctca cttaaatcag 29940cacagtaact gcagcacagc
accacaatat tgttcaaaat cccacagtgc aaggcgctgt 30000atccaaagct catggcgggg
accacagaac ccacgtggcc atcataccac aagcgcaggt 30060agattaagtg gcgacccctc
ataaacacgc tggacataaa cattacctct tttggcatgt 30120tgtaattcac cacctcccgg
taccatataa acctctgatt aaacatggcg ccatccacca 30180ccatcctaaa ccagctggcc
aaaacctgcc cgccggctat acactgcagg gaaccgggac 30240tggaacaatg acagtggaga
gcccaggact cgtaaccatg gatcatcatg ctcgtcatga 30300tatcaatgtt ggcacaacac
aggcacacgt gcatacactt cctcaggatt acaagctcct 30360cccgcgttag aaccatatcc
cagggaacaa cccattcctg aatcagcgta aatcccacac 30420tgcagggaag acctcgcacg
taactcacgt tgtgcattgt caaagtgtta cattcgggca 30480gcagcggatg atcctccagt
atggtagcgc gggtttctgt ctcaaaagga ggtagacgat 30540ccctactgta cggagtgcgc
cgagacaacc gagatcgtgt tggtcgtagt gtcatgccaa 30600atggaacgcc ggacgtagtc
atatttcctg aagcaaaacc aggtgcgggc gtgacaaaca 30660gatctgcgtc tccggtctcg
ccgcttagat cgctctgtgt agtagttgta gtatatccac 30720tctctcaaag catccaggcg
ccccctggct tcgggttcta tgtaaactcc ttcatgcgcc 30780gctgccctga taacatccac
caccgcagaa taagccacac ccagccaacc tacacattcg 30840ttctgcgagt cacacacggg
aggagcggga agagctggaa gaaccatgtt ttttttttta 30900ttccaaaaga ttatccaaaa
cctcaaaatg aagatctatt aagtgaacgc gctcccctcc 30960ggtggcgtgg tcaaactcta
cagccaaaga acagataatg gcatttgtaa gatgttgcac 31020aatggcttcc aaaaggcaaa
cggccctcac gtccaagtgg acgtaaaggc taaacccttc 31080agggtgaatc tcctctataa
acattccagc accttcaacc atgcccaaat aattctcatc 31140tcgccacctt ctcaatatat
ctctaagcaa atcccgaata ttaagtccgg ccattgtaaa 31200aatctgctcc agagcgccct
ccaccttcag cctcaagcag cgaatcatga ttgcaaaaat 31260tcaggttcct cacagacctg
tataagattc aaaagcggaa cattaacaaa aataccgcga 31320tcccgtaggt cccttcgcag
ggccagctga acataatcgt gcaggtctgc acggaccagc 31380gcggccactt ccccgccagg
aaccttgaca aaagaaccca cactgattat gacacgcata 31440ctcggagcta tgctaaccag
cgtagccccg atgtaagctt tgttgcatgg gcggcgatat 31500aaaatgcaag gtgctgctca
aaaaatcagg caaagcctcg cgcaaaaaag aaagcacatc 31560gtagtcatgc tcatgcagat
aaaggcaggt aagctccgga accaccacag aaaaagacac 31620catttttctc tcaaacatgt
ctgcgggttt ctgcataaac acaaaataaa ataacaaaaa 31680aacatttaaa cattagaagc
ctgtcttaca acaggaaaaa caacccttat aagcataaga 31740cggactacgg ccatgccggc
gtgaccgtaa aaaaactggt caccgtgatt aaaaagcacc 31800accgacagct cctcggtcat
gtccggagtc ataatgtaag actcggtaaa cacatcaggt 31860tgattcatcg gtcagtgcta
aaaagcgacc gaaatagccc gggggaatac atacccgcag 31920gcgtagagac aacattacag
cccccatagg aggtataaca aaattaatag gagagaaaaa 31980cacataaaca cctgaaaaac
cctcctgcct aggcaaaata gcaccctccc gctccagaac 32040aacatacagc gcttcacagc
ggcagcctaa cagtcagcct taccagtaaa aaagaaaacc 32100tattaaaaaa acaccactcg
acacggcacc agctcaatca gtcacagtgt aaaaaagggc 32160caagtgcaga gcgagtatat
ataggactaa aaaatgacgt aacggttaaa gtccacaaaa 32220aacacccaga aaaccgcacg
cgaacctacg cccagaaacg aaagccaaaa aacccacaac 32280ttcctcaaat cgtcacttcc
gttttcccac gttacgtaac ttcccatttt aagaaaacta 32340caattcccaa cacatacaag
ttactccgcc ctaaaaccta cgtcacccgc cccgttccca 32400cgccccgcgc cacgtcacaa
actccacccc ctcattatca tattggcttc aatccaaaat 32460aaggtatatt attgatgatg
324802825DNAArtificial
SequenceDescription of Artificial Sequence primer 28ctcaacaatt gtggatccgt
actcc 252925DNAArtificial
SequenceDescription of Artificial Sequence primer 29gtgctcagca gatcttgcga
ctgtg 253025DNAArtificial
SequenceDescription of Artificial Sequence primer 30ggcgcgttcg gatccactct
cttcc 253128DNAArtificial
SequenceDescription of Artificial Sequence primer 31ctacatgcta ggcagatctc
gttcggag 28321240DNAadenovirus
32ggatccactc tcttccgcat cgctgtctgc gagggccagc tgttggggtg agtactccct
60ctgaaaagcg ggcatgactt ctgcgctaag attgtcagtt tccaaaaacg aggaggattt
120gatattcacc tggcccgcgg tgatgccttt gagggtggcc gcatccatct ggtcagaaaa
180gacaatcttt ttgttgtcaa gcttggtggc aaacgacccg tagagggcgt tggacagcaa
240cttggcgatg gagcgcaggg tttggttttt gtcgcgatcg gcgcgctcct tggccgcgat
300gtttagctgc acgtattcgc gcgcaacgca ccgccattcg ggaaagacgg tggtgcgctc
360gtcgggcacc aggtgcacgc gccaaccgcg gttgtgcagg gtgacaaggt caacgctggt
420ggctacctct ccgcgtaggc gctcgttggt ccagcagagg cggccgccct tgcgcgagca
480gaatggcggt agggggtcta gctgcgtctc gtccgggggg tctgcgtcca cggtaaagac
540cccgggcagc aggcgcgcgt cgaagtagtc tatcttgcat ccttgcaagt ctagcgcctg
600ctgccatgcg cgggcggcaa gcgcgcgctc gtatgggttg agtgggggac cccatggcat
660ggggtgggtg agcgcggagg cgtacatgcc gcaaatgtcg taaacgtaga ggggctctct
720gagtattcca agatatgtag ggtagcatct tccaccgcgg atgctggcgc gcacgtaatc
780gtatagttcg tgcgagggag cgaggaggtc gggaccgagg ttgctacggg cgggctgctc
840tgctcggaag actatctgcc tgaagatggc atgtgagttg gatgatatgg ttggacgctg
900gaagacgttg aagctggcgt ctgtgagacc taccgcgtca cgcacgaagg aggcgtagga
960gtcgcgcagc ttgttgacca gctcggcggt gacctgcacg tctagggcgc agtagtccag
1020ggtttccttg atgatgtcat acttatcctg tccctttttt ttccacagct cgcggttgag
1080gacaaactct tcgcggtctt tccagtactc ttggatcgga aacccgtcgg cctccgaacg
1140agatccgtac tccgccgccg agggacctga gcgagtccgc atcgaccgga tcggaaaacc
1200tctcgagaaa ggcgtctaac cagtcacagt cgcaagatct
12403325DNAArtificial SequenceDescription of Artificial Sequence primer
33ggcgcgttcg gatccactct cttcc
253420DNAArtificial SequenceDescription of Artificial Sequence primer
34gggagtagat ctcccaacag
203524DNAArtificial SequenceDescription of Artificial Sequence primer
35cccttttttt tggatccctc gcgg
243628DNAArtificial SequenceDescription of Artificial Sequence primer
36ctacatgcta ggcagatctc gttcggag
283726DNAArtificial SequenceDescription of Artificial Sequence primer
37ctcaacaatt gttggatccg tactcc
263825DNAArtificial SequenceDescription of Artificial Sequence primer
38gtgctcagca gatcttgcga ctgtg
253925DNAArtificial SequenceDescription of Artificial Sequence primer
39ggcgcgttcg gatccactct cttcc
254028DNAArtificial SequenceDescription of Artificial Sequence primer
40ctacatgcta ggcagatctc gttcggag
284124DNAArtificial SequenceDescription of Artificial Sequence primer
41cccttttttt tggatccctc gcgg
244225DNAArtificial SequenceDescription of Artificial Sequence primer
42gtgctcagca gatcttgcga ctgtg
25438383DNAArtificial SequenceDescription of Artificial Sequence plasmid
43gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg
60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata
300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
420attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt
480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca
600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc
900gagctcggat ccactctctt ccgcatcgct gtctgcgagg gccagctgtt ggggtgagta
960ctccctctga aaagcgggca tgacttctgc gctaagattg tcagtttcca aaaacgagga
1020ggatttgata ttcacctggc ccgcggtgat gcctttgagg gtggccgcat ccatctggtc
1080agaaaagaca atctttttgt tgtcaagctt ggtggcaaac gacccgtaga gggcgttgga
1140cagcaacttg gcgatggagc gcagggtttg gtttttgtcg cgatcggcgc gctccttggc
1200cgcgatgttt agctgcacgt attcgcgcgc aacgcaccgc cattcgggaa agacggtggt
1260gcgctcgtcg ggcaccaggt gcacgcgcca accgcggttg tgcagggtga caaggtcaac
1320gctggtggct acctctccgc gtaggcgctc gttggtccag cagaggcggc cgcccttgcg
1380cgagcagaat ggcggtaggg ggtctagctg cgtctcgtcc ggggggtctg cgtccacggt
1440aaagaccccg ggcagcaggc gcgcgtcgaa gtagtctatc ttgcatcctt gcaagtctag
1500cgcctgctgc catgcgcggg cggcaagcgc gcgctcgtat gggttgagtg ggggacccca
1560tggcatgggg tgggtgagcg cggaggcgta catgccgcaa atgtcgtaaa cgtagagggg
1620ctctctgagt attccaagat atgtagggta gcatcttcca ccgcggatgc tggcgcgcac
1680gtaatcgtat agttcgtgcg agggagcgag gaggtcggga ccgaggttgc tacgggcggg
1740ctgctctgct cggaagacta tctgcctgaa gatggcatgt gagttggatg atatggttgg
1800acgctggaag acgttgaagc tggcgtctgt gagacctacc gcgtcacgca cgaaggaggc
1860gtaggagtcg cgcagcttgt tgaccagctc ggcggtgacc tgcacgtcta gggcgcagta
1920gtccagggtt tccttgatga tgtcatactt atcctgtccc ttttttttcc acagctcgcg
1980gttgaggaca aactcttcgc ggtctttcca gtactcttgg atcggaaacc cgtcggcctc
2040cgaacgagat ccgtactccg ccgccgaggg acctgagcga gtccgcatcg accggatcgg
2100aaaacctctc gagaaaggcg tctaaccagt cacagtcgca agatccaaga tgaagcgcgc
2160aagaccgtct gaagatacct tcaaccccgt gtatccatat gacacggaaa ccggtcctcc
2220aactgtgcct tttcttactc ctccctttgt atcccccaat gggtttcaag agagtccccc
2280tggggtactc tctttgcgcc tatccgaacc tctagttacc tccaatggca tgcttgcgct
2340caaaatgggc aacggcctct ctctggacga ggccggcaac cttacctccc aaaatgtaac
2400cactgtgagc ccacctctca aaaaaaccaa gtcaaacata aacctggaaa tatctgcacc
2460cctcacagtt acctcagaag ccctaactgt ggctgccgcc gcacctctaa tggtcgcggg
2520caacacactc accatgcaat cacaggcccc gctaaccgtg cacgactcca aacttagcat
2580tgccacccaa ggacccctca cagtgtcaga aggaaagcta gccctgcaaa catcaggccc
2640cctcaccacc accgatagca gtacccttac tatcactgcc tcaccccctc taactactgc
2700cactggtagc ttgggcattg acttgaaaga gcccatttat acacaaaatg gaaaactagg
2760actaaagtac ggggctcctt tgcatgtaac agacgaccta aacactttga ccgtagcaac
2820tggtccaggt gtgactatta ataatacttc cttgcaaact aaagttactg gagccttggg
2880ttttgattca caaggcaata tgcaacttaa tgtagcagga ggactaagga ttgattctca
2940aaacagacgc cttatacttg atgttagtta tccgtttgat gctcaaaacc aactaaatct
3000aagactagga cagggccctc tttttataaa ctcagcccac aacttggata ttaactacaa
3060caaaggcctt tacttgttta cagcttcaaa caattccaaa aagcttgagg ttaacctaag
3120cactgccaag gggttgatgt ttgacgctac agccatagcc attaatgcag gagatgggct
3180tgaatttggt tcacctaatg caccaaacac aaatcccctc aaaacaaaaa ttggccatgg
3240cctagaattt gattcaaaca aggctatggt tcctaaacta ggaactggcc ttagttttga
3300cagcacaggt gccattacag taggaaacaa aaataatgat aagctaactt tgtggaccac
3360accagctcca tctcctaact gtagactaaa tgcagagaaa gatgctaaac tcactttggt
3420cttaacaaaa tgtggcagtc aaatacttgc tacagtttca gttttggctg ttaaaggcag
3480tttggctcca atatctggaa cagttcaaag tgctcatctt attataagat ttgacgaaaa
3540tggagtgcta ctaaacaatt ccttcctgga cccagaatat tggaacttta gaaatggaga
3600tcttactgaa ggcacagcct atacaaacgc tgttggattt atgcctaacc tatcagctta
3660tccaaaatct cacggtaaaa ctgccaaaag taacattgtc agtcaagttt acttaaacgg
3720agacaaaact aaacctgtaa cactaaccat tacactaaac ggtacacagg aaacaggaga
3780cacaactcca agtgcatact ctatgtcatt ttcatgggac tggtctggcc acaactacat
3840taatgaaata tttgccacat cctcttacac tttttcatac attgcccaag aataaaagaa
3900gcggccgctc gagcatgcat ctagagggcc ctattctata gtgtcaccta aatgctagag
3960ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc
4020ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg
4080aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg
4140acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta
4200tggcttctga ggcggaaaga accagctggg gctctagggg gtatccccac gcgccctgta
4260gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca
4320gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct
4380ttccccgtca agctctaaat cggggcatcc ctttagggtt ccgatttagt gctttacggc
4440acctcgaccc caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat
4500agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc
4560aaactggaac aacactcaac cctatctcgg tctattcttt tgatttataa gggattttgg
4620ggatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaattaat
4680tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca ggctccccag gcaggcagaa
4740gtatgcaaag catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc
4800cagcaggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc
4860taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct
4920gactaatttt ttttatttat gcagaggccg aggccgcctc tgcctctgag ctattccaga
4980agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagctcccg ggagcttgta
5040tatccatttt cggatctgat caagagacag gatgaggatc gtttcgcatg attgaacaag
5100atggattgca cgcaggttct ccggccgctt gggtggagag gctattcggc tatgactggg
5160cacaacagac aatcggctgc tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc
5220cggttctttt tgtcaagacc gacctgtccg gtgccctgaa tgaactgcag gacgaggcag
5280cgcggctatc gtggctggcc acgacgggcg ttccttgcgc agctgtgctc gacgttgtca
5340ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc ggggcaggat ctcctgtcat
5400ctcaccttgc tcctgccgag aaagtatcca tcatggctga tgcaatgcgg cggctgcata
5460cgcttgatcc ggctacctgc ccattcgacc accaagcgaa acatcgcatc gagcgagcac
5520gtactcggat ggaagccggt cttgtcgatc aggatgatct ggacgaagag catcaggggc
5580tcgcgccagc cgaactgttc gccaggctca aggcgcgcat gcccgacggc gaggatctcg
5640tcgtgaccca tggcgatgcc tgcttgccga atatcatggt ggaaaatggc cgcttttctg
5700gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta tcaggacata gcgttggcta
5760cccgtgatat tgctgaagag cttggcggcg aatgggctga ccgcttcctc gtgctttacg
5820gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg ccttcttgac gagttcttct
5880gagcgggact ctggggttcg aaatgaccga ccaagcgacg cccaacctgc catcacgaga
5940tttcgattcc accgccgcct tctatgaaag gttgggcttc ggaatcgttt tccgggacgc
6000cggctggatg atcctccagc gcggggatct catgctggag ttcttcgccc accccaactt
6060gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa
6120agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca
6180tgtctgtata ccgtcgacct ctagctagag cttggcgtaa tcatggtcat agctgtttcc
6240tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg
6300taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc
6360cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg
6420gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc
6480ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac
6540agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa
6600ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca
6660caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
6720gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
6780cctgtccgcc tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta
6840tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca
6900gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga
6960cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
7020tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg
7080tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg
7140caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag
7200aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa
7260cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
7320ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc
7380tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc
7440atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc
7500tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc
7560aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc
7620catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt
7680gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc
7740ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa
7800aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt
7860atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg
7920cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc
7980gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa
8040agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt
8100gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt
8160caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag
8220ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta
8280tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat
8340aggggttccg cgcacatttc cccgaaaagt gccacctgac gtc
8383447960DNAArtificial SequenceDescription of Artificial Sequence
plasmid 44gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc
tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct
gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg
aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg
cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat
agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg
cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata
gggactttcc 420attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta
catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc
gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac
gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga
tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg
ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg
caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact
agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa
gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atccactctc ttccgcatcg
ctgtctgcga 960gggccagctg ttggggtgag tactccctct gaaaagcggg catgacttct
gcgctaagat 1020tgtcagtttc caaaaacgag gaggatttga tattcacctg gcccgcggtg
atgcctttga 1080gggtggccgc atccatctgg tcagaaaaga caatcttttt gttgtcaagc
ttggtggcaa 1140acgacccgta gagggcgttg gacagcaact tggcgatgga gcgcagggtt
tggtttttgt 1200cgcgatcggc gcgctccttg gccgcgatgt ttagctgcac gtattcgcgc
gcaacgcacc 1260gccattcggg aaagacggtg gtgcgctcgt cgggcaccag gtgcacgcgc
caaccgcggt 1320tgtgcagggt gacaaggtca acgctggtgg ctacctctcc gcgtaggcgc
tcgttggtcc 1380agcagaggcg gccgcccttg cgcgagcaga atggcggtag ggggtctagc
tgcgtctcgt 1440ccggggggtc tgcgtccacg gtaaagaccc cgggcagcag gcgcgcgtcg
aagtagtcta 1500tcttgcatcc ttgcaagtct agcgcctgct gccatgcgcg ggcggcaagc
gcgcgctcgt 1560atgggttgag tgggggaccc catggcatgg ggtgggtgag cgcggaggcg
tacatgccgc 1620aaatgtcgta aacgtagagg ggctctctga gtattccaag atatgtaggg
tagcatcttc 1680caccgcggat gctggcgcgc acgtaatcgt atagttcgtg cgagggagcg
aggaggtcgg 1740gaccgaggtt gctacgggcg ggctgctctg ctcggaagac tatctgcctg
aagatggcat 1800gtgagttgga tgatatggtt ggacgctgga agacgttgaa gctggcgtct
gtgagaccta 1860ccgcgtcacg cacgaaggag gcgtaggagt cgcgcagctt gttgaccagc
tcggcggtga 1920cctgcacgtc tagggcgcag tagtccaggg tttccttgat gatgtcatac
ttatcctgtc 1980cctttttttt ccacagctcg cggttgagga caaactcttc gcggtctttc
cagtactctt 2040ggatcggaaa cccgtcggcc tccgaacgag atccgtactc cgccgccgag
ggacctgagc 2100gagtccgcat cgaccggatc ggaaaacctc tcgagaaagg cgtctaacca
gtcacagtcg 2160caagatccaa gatgaagcgc gcaagaccgt ctgaagatac cttcaacccc
gtgtatccat 2220atgacacgga aaccggtcct ccaactgtgc cttttcttac tcctcccttt
gtatccccca 2280atgggtttca agagagtccc cctggggtac tctctttgcg cctatccgaa
cctctagtta 2340cctccaatgg catgcttgcg ctcaaaatgg gcaacggcct ctctctggac
gaggccggca 2400accttacctc ccaaaatgta accactgtga gcccacctct caaaaaaacc
aagtcaaaca 2460taaacctgga aatatctgca cccctcacag ttacctcaga agccctaact
gtggctgccg 2520ccgcacctct aatggtcgcg ggcaacacac tcaccatgca atcacaggcc
ccgctaaccg 2580tgcacgactc caaacttagc attgccaccc aaggacccct cacagtgtca
gaaggaaagc 2640tagccctgca aacatcaggc cccctcacca ccaccgatag cagtaccctt
actatcactg 2700cctcaccccc tctaactact gccactggta gcttgggcat tgacttgaaa
gagcccattt 2760atacacaaaa tggaaaacta ggactaaagt acggggctcc tttgcatgta
acagacgacc 2820taaacacttt gaccgtagca actggtccag gtgtgactat taataatact
tccttgcaaa 2880ctaaagttac tggagccttg ggttttgatt cacaaggcaa tatgcaactt
aatgtagcag 2940gaggactaag gattgattct caaaacagac gccttatact tgatgttagt
tatccgtttg 3000atgctcaaaa ccaactaaat ctaagactag gacagggccc tctttttata
aactcagccc 3060acaacttgga tattaactac aacaaaggcc tttacttgtt tacagcttca
aacaattcca 3120aaaagcttga ggttaaccta agcactgcca aggggttgat gtttgacgct
acagccatag 3180ccattaatgc aggagatggg cttgaatttg gttcacctaa tgcaccaaac
acaaatcccc 3240tcaaaacaaa aattggccat ggcctagaat ttgattcaaa caaggctatg
gttcctaaac 3300taggaactgg ccttagtttt gacagcacag gtgccattac agtaggaaac
aaaaataatg 3360ataagctaac tttgtggacc acaccagctc catctcctaa ctgtagacta
aatgcagaga 3420aagatgctaa actcactttg gtcttaacaa aatgtggcag tcaaatactt
gctacagttt 3480cagttttggc tgttaaaggc agtttggctc caatatctgg aacagttcaa
agtgctcatc 3540ttattataag atttgacgaa aatggagtgc tactaaacaa ttccttcctg
gacccagaat 3600attggaactt tagaaatgga gatcttactg aaggcacagc ctatacaaac
gctgttggat 3660ttatgcctaa cctatcagct tatccaaaat ctcacggtaa aactgccaaa
agtaacattg 3720tcagtcaagt ttacttaaac ggagacaaaa ctaaacctgt aacactaacc
attacactaa 3780acggtacaca ggaaacagga gacacaactc caagtgcata ctctatgtca
ttttcatggg 3840actggtctgg ccacaactac attaatgaaa tatttgccac atcctcttac
actttttcat 3900acattgccca agaataaaag aagcggccgc tcgagtctag agggcccgtt
taaacccgct 3960gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc
tcccccgtgc 4020cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat
gaggaaattg 4080catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg
caggacagca 4140agggggagga ttgggaagac aatagcaggc atgctgggga tgcggtgggc
tctatggctt 4200ctgaggcgga aagaaccagc tggggctcta gggggtatcc ccacgcgccc
tgtagcggcg 4260cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt
gccagcgccc 4320tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc
ggctttcccc 4380gtcaagctct aaatcggggc atccctttag ggttccgatt tagtgcttta
cggcacctcg 4440accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc
tgatagacgg 4500tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg
ttccaaactg 4560gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt
ttggggattt 4620cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat
taattctgtg 4680gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccaggcaggc
agaagtatgc 4740aaagcatgca tctcaattag tcagcaacca ggtgtggaaa gtccccaggc
tccccagcag 4800gcagaagtat gcaaagcatg catctcaatt agtcagcaac catagtcccg
cccctaactc 4860cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat
ggctgactaa 4920ttttttttat ttatgcagag gccgaggccg cctctgcctc tgagctattc
cagaagtagt 4980gaggaggctt ttttggaggc ctaggctttt gcaaaaagct cccgggagct
tgtatatcca 5040ttttcggatc tgatcagcac gtgttgacaa ttaatcatcg gcatagtata
tcggcatagt 5100ataatacgac aaggtgagga actaaaccat ggccaagttg accagtgccg
ttccggtgct 5160caccgcgcgc gacgtcgccg gagcggtcga gttctggacc gaccggctcg
ggttctcccg 5220ggacttcgtg gaggacgact tcgccggtgt ggtccgggac gacgtgaccc
tgttcatcag 5280cgcggtccag gaccaggtgg tgccggacaa caccctggcc tgggtgtggg
tgcgcggcct 5340ggacgagctg tacgccgagt ggtcggaggt cgtgtccacg aacttccggg
acgcctccgg 5400gccggccatg accgagatcg gcgagcagcc gtgggggcgg gagttcgccc
tgcgcgaccc 5460ggccggcaac tgcgtgcact tcgtggccga ggagcaggac tgacacgtgc
tacgagattt 5520cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc
gggacgccgg 5580ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc
ccaacttgtt 5640tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca
caaataaagc 5700atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat
cttatcatgt 5760ctgtataccg tcgacctcta gctagagctt ggcgtaatca tggtcatagc
tgtttcctgt 5820gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca
taaagtgtaa 5880agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct
cactgcccgc 5940tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac
gcgcggggag 6000aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc
tgcgctcggt 6060cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt
tatccacaga 6120atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg
ccaggaaccg 6180taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg
agcatcacaa 6240aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat
accaggcgtt 6300tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta
ccggatacct 6360gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct
gtaggtatct 6420cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
ccgttcagcc 6480cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa
gacacgactt 6540atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg
taggcggtgc 6600tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag
tatttggtat 6660ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt
gatccggcaa 6720acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta
cgcgcagaaa 6780aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc
agtggaacga 6840aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca
cctagatcct 6900tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa
cttggtctga 6960cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat
ttcgttcatc 7020catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct
taccatctgg 7080ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt
tatcagcaat 7140aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat
ccgcctccat 7200ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta
atagtttgcg 7260caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg
gtatggcttc 7320attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt
tgtgcaaaaa 7380agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg
cagtgttatc 7440actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg
taagatgctt 7500ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc
ggcgaccgag 7560ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa
ctttaaaagt 7620gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac
cgctgttgag 7680atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt
ttactttcac 7740cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg
gaataagggc 7800gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa
gcatttatca 7860gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata
aacaaatagg 7920ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc
79604530DNAArtificial SequenceDescription of Artificial
Sequence primer 45atgggatcca agatgaagcg cgcaagaccg
304630DNAArtificial SequenceDescription of Artificial
Sequence primer 46cactatagcg gccgcattct cagtcatctt
30477989DNAArtificial SequenceDescription of Artificial
Sequence plasmid 47gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc
tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct
gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg
aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg
cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat
agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg
cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata
gggactttcc 420attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta
catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc
gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac
gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga
tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg
ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg
caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact
agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa
gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atccactctc ttccgcatcg
ctgtctgcga 960gggccagctg ttggggtgag tactccctct gaaaagcggg catgacttct
gcgctaagat 1020tgtcagtttc caaaaacgag gaggatttga tattcacctg gcccgcggtg
atgcctttga 1080gggtggccgc atccatctgg tcagaaaaga caatcttttt gttgtcaagc
ttggtggcaa 1140acgacccgta gagggcgttg gacagcaact tggcgatgga gcgcagggtt
tggtttttgt 1200cgcgatcggc gcgctccttg gccgcgatgt ttagctgcac gtattcgcgc
gcaacgcacc 1260gccattcggg aaagacggtg gtgcgctcgt cgggcaccag gtgcacgcgc
caaccgcggt 1320tgtgcagggt gacaaggtca acgctggtgg ctacctctcc gcgtaggcgc
tcgttggtcc 1380agcagaggcg gccgcccttg cgcgagcaga atggcggtag ggggtctagc
tgcgtctcgt 1440ccggggggtc tgcgtccacg gtaaagaccc cgggcagcag gcgcgcgtcg
aagtagtcta 1500tcttgcatcc ttgcaagtct agcgcctgct gccatgcgcg ggcggcaagc
gcgcgctcgt 1560atgggttgag tgggggaccc catggcatgg ggtgggtgag cgcggaggcg
tacatgccgc 1620aaatgtcgta aacgtagagg ggctctctga gtattccaag atatgtaggg
tagcatcttc 1680caccgcggat gctggcgcgc acgtaatcgt atagttcgtg cgagggagcg
aggaggtcgg 1740gaccgaggtt gctacgggcg ggctgctctg ctcggaagac tatctgcctg
aagatggcat 1800gtgagttgga tgatatggtt ggacgctgga agacgttgaa gctggcgtct
gtgagaccta 1860ccgcgtcacg cacgaaggag gcgtaggagt cgcgcagctt gttgaccagc
tcggcggtga 1920cctgcacgtc tagggcgcag tagtccaggg tttccttgat gatgtcatac
ttatcctgtc 1980cctttttttt ccacagctcg cggttgagga caaactcttc gcggtctttc
cagtactctt 2040ggatcggaaa cccgtcggcc tccgaacgag atccgtactc cgccgccgag
ggacctgagc 2100gagtccgcat cgaccggatc ggaaaacctc tcgagaaagg cgtctaacca
gtcacagtcg 2160caagatccaa gatgaagcgc gcaagaccgt ctgaagatac cttcaacccc
gtgtatccat 2220atgacacgga aaccggtcct ccaactgtgc cttttcttac tcctcccttt
gtatccccca 2280atgggtttca agagagtccc cctggggtac tctctttgcg cctatccgaa
cctctagtta 2340cctccaatgg catgcttgcg ctcaaaatgg gcaacggcct ctctctggac
gaggccggca 2400accttacctc ccaaaatgta accactgtga gcccacctct caaaaaaacc
aagtcaaaca 2460taaacctgga aatatctgca cccctcacag ttacctcaga agccctaact
gtggctgccg 2520ccgcacctct aatggtcgcg ggcaacacac tcaccatgca atcacaggcc
ccgctaaccg 2580tgcacgactc caaacttagc attgccaccc aaggacccct cacagtgtca
gaaggaaagc 2640tagccctgca aacatcaggc cccctcacca ccaccgatag cagtaccctt
actatcactg 2700cctcaccccc tctaactact gccactggta gcttgggcat tgacttgaaa
gagcccattt 2760atacacaaaa tggaaaacta ggactaaagt acggggctcc tttgcatgta
acagacgacc 2820taaacacttt gaccgtagca actggtccag gtgtgactat taataatact
tccttgcaaa 2880ctaaagttac tggagccttg ggttttgatt cacaaggcaa tatgcaactt
aatgtagcag 2940gaggactaag gattgattct caaaacagac gccttatact tgatgttagt
tatccgtttg 3000atgctcaaaa ccaactaaat ctaagactag gacagggccc tctttttata
aactcagccc 3060acaacttgga tattaactac aacaaaggcc tttacttgtt tacagcttca
aacaattcca 3120aaaagcttga ggttaaccta agcactgcca aggggttgat gtttgacgct
acagccatag 3180ccattaatgc aggagatggg cttgaatttg gttcacctaa tgcaccaaac
acaaatcccc 3240tcaaaacaaa aattggccat ggcctagaat ttgattcaaa caaggctatg
gttcctaaac 3300taggaactgg ccttagtttt gacagcacag gtgccattac agtaggaaac
aaaaataatg 3360ataagctaac tttgtggacc ggtccaaaac cagaagccaa ctgcataatt
gaatacggga 3420aacaaaaccc agatagcaaa ctaactttaa tccttgtaaa aaatggagga
attgttaatg 3480gatatgtaac gctaatggga gcctcagact acgttaacac cttatttaaa
aacaaaaatg 3540tctccattaa tgtagaacta tactttgatg ccactggtca tatattacca
gactcatctt 3600ctcttaaaac agatctagaa ctaaaataca agcaaaccgc tgactttagt
gcaagaggtt 3660ttatgccaag tactacagcg tatccatttg tccttcctaa tgcgggaaca
cataatgaaa 3720attatatttt tggtcaatgc tactacaaag caagcgatgg tgcccttttt
ccgttggaag 3780ttactgttat gcttaataaa cgcctgccag atagtcgcac atcctatgtt
atgacttttt 3840tatggtcctt gaatgctggt ctagctccag aaactactca ggcaaccctc
ataacctccc 3900catttacctt ttcctatatt agagaagatg actgattttt aagaagcggc
cgctcgagtc 3960tagagggccc gtttaaaccc gctgatcagc ctcgactgtg ccttctagtt
gccagccatc 4020tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc
ccactgtcct 4080ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt
ctattctggg 4140gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca
ggcatgctgg 4200ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc snccntagct
ggggctctag 4260ggggtatccc cacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg
tggttacgcg 4320cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt
tcttcccttc 4380ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcggggca
tccctttagg 4440gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg
gtgatggttc 4500acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg
agtccacgtt 4560ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct
cggtctattc 4620ttttgattta taagggattt tggggatttc ggcctattgg ttaaaaaatg
agctgattta 4680acaaaaattt aacgcgaatt aattctgtgg aatgtgtgtc agttagggtg
tggaaagtcc 4740ccaggctccc caggcaggca gaagtatgca aagcatgcat ctcaattagt
cagcaaccag 4800gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc
atctcaatta 4860gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc
cgcccagttc 4920cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg
ccgaggccgc 4980ctctgcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc
taggcttttg 5040caaaaagctc ccgggagctt gtatatccat tttcggatct gatcagcacg
tgttgacaat 5100taatcatcgg catagtatat cggcatagta taatacgaca aggtgaggaa
ctaaaccatg 5160gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg
agcggtcgag 5220ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt
cgccggtgtg 5280gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt
gccggacaac 5340accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg
gtcggaggtc 5400gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg
cgagcagccg 5460tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt
cgtggccgag 5520gagcaggact gacacgtgct acgagatttc gattccaccg ccgccttcta
tgaaaggttg 5580ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg
ggatctcatg 5640ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta
caaataaagc 5700aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag
ttgtggtttg 5760tccaaactca tcaatgtatc ttatcatgtc tgtataccgt cgacctctag
ctagagcttg 5820gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac
aattccacac 5880aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt
gagctaactc 5940acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc
gtgccagctg 6000cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg
ctcttccgct 6060tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
atcagctcac 6120tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
gaacatgtga 6180gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
gtttttccat 6240aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
gtggcgaaac 6300ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
gcgctctcct 6360gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg
aagcgtggcg 6420ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg
ctccaagctg 6480ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
taactatcgt 6540cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
tggtaacagg 6600attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg
gcctaactac 6660ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt
taccttcgga 6720aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
tggttttttt 6780gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc
tttgatcttt 6840tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt
ggtcatgaga 6900ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt
taaatcaatc 6960taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag
tgaggcacct 7020atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt
cgtgtagata 7080actacgatac gggagggctt accatctggc cccagtgctg caatgatacc
gcgagaccca 7140cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc
cgagcgcaga 7200agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg
ggaagctaga 7260gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac
aggcatcgtg 7320gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg
atcaaggcga 7380gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc
tccgatcgtt 7440gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact
gcataattct 7500cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc
aaccaagtca 7560ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat
acgggataat 7620accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc
ttcggggcga 7680aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac
tcgtgcaccc 7740aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa
aacaggaagg 7800caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact
catactcttc 7860ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg
atacatattt 7920gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg
aaaagtgcca 7980cctgacgtc
7989487607DNAArtificial SequenceDescription of Artificial
Sequence plasmid 48tctagaagat ccgctgtaca ggatgttcta gctactttat tagatccgct
gtacaggatg 60ttctagctac tttattagat ccgctgtaca ggatgttcta gctactttat
tagatccgct 120gtacaggatg ttctagctac tttattagat ccgtgtacag gatgttctag
ctactttatt 180agatcgatct cctggccgtt cggggtcaaa aaccaggttt ggctataaaa
gggggtgggg 240gcgcgttcgt cctcactctc ttccgcatcg ctgtctgcga gggccaggat
cgatcctgag 300aacttcaggg tgagtttggg gacccttgat tgttctttct ttttcgctat
tgtaaaattc 360atgttatatg gagggggcaa agttttcagg gtgttgttta gaatgggaag
atgtcccttg 420tatcaccatg gaccctcatg ataattttgt ttctttcact ttctactctg
ttgacaacca 480ttgtctcctc ttattttctt ttcattttct gtaacttttt cgttaaactt
tagcttgcat 540ttgtaacgaa tttttaaatt cacttttgtt tatttgtcag attgtaagta
ctttctctaa 600tcactttttt ttcaaggcaa tcagggtata ttatattgta cttcagcaca
gttttagaga 660acaattgtta taattaaatg ataaggtaga atatttctgc atataaattc
tggctggcgt 720ggaaatattc ttattggtag aaacaactac atcctggtca tcatcctgcc
tttctcttta 780tggttacaat gatatacact gtttgagatg aggataaaat actctgagtc
caaaccgggc 840ccctctgcta accatgttca tgccttcttc tttttcctac agctcctggg
caacgtgctg 900gttattgtgc tgtctcatca ttttggcaaa gaattagatc taagcttctg
cagctcgagg 960actcggtcga ctgaaaatga gacatattat ctgccacgga ggtgttatta
ccgaagaaat 1020ggccgccagt cttttggacc agctgatcga agaggtactg gctgataatc
ttccacctcc 1080tagccatttt gaaccaccta cccttcacga actgtatgat ttagacgtga
cggcccccga 1140agatcccaac gaggaggcgg tttcgcagat ttttcccgac tctgtaatgt
tggcggtgca 1200ggaagggatt gacttactca cttttccgcc ggcgcccggt tctccggagc
cgcctcacct 1260ttcccggcag cccgagcagc cggagcagag agccttgggt ccggtttcta
tgccaaacct 1320tgtaccggag gtgatcgatc ttacctgcca cgaggctggc tttccaccca
gtgacgacga 1380ggatgaagag ggtgaggagt ttgtgttaga ttatgtggag caccccgggc
acggttgcag 1440gtcttgtcat tatcaccgga ggaatacggg ggacccagat attatgtgtt
cgctttgcta 1500tatgaggacc tgtggcatgt ttgtctacag taagtgaaaa ttatgggcag
tgggtgatag 1560agtggtgggt ttggtgtggt aatttttttt ttaattttta cagttttgtg
gtttaaagaa 1620ttttgtattg tgattttttt aaaaggtcct gtgtctgaac ctgagcctga
gcccgagcca 1680gaaccggagc ctgcaagacc tacccgccgt cctaaaatgg cgcctgctat
cctgagacgc 1740ccgacatcac ctgtgtctag agaatgcaat agtagtacgg atagctgtga
ctccggtcct 1800tctaacacac ctcctgagat acacccggtg gtcccgctgt gccccattaa
accagttgcc 1860gtgagagttg gtgggcgtcg ccaggctgtg gaatgtatcg aggacttgct
taacgagcct 1920gggcaacctt tggacttgag ctgtaaacgc cccaggccat aaggtgtaaa
cctgtgattg 1980cgtgtgtggt taacgccttt gtttgctgaa tgagttgatg taagtttaat
aaagggtgag 2040ataatgttta acttgcatgg cgtgttaaat ggggcggggc ttaaagggta
tataatgcgc 2100cgtgggctaa tcttggttac atctgacctc atggaggctt gggagtgttt
ggaagatttt 2160tctgctgtgc gtaacttgct ggaacagagc tctaacagta cctcttggtt
ttggaggttt 2220ctgtggggct catcccaggc aaagttagtc tgcagaatta aggaggatta
caagtgggaa 2280tttgaagagc ttttgaaatc ctgtggtgag ctgtttgatt ctttgaatct
gggtcaccag 2340gcgcttttcc aagagaaggt catcaagact ttggattttt ccacaccggg
gcgcgctgcg 2400gctgctgttg cttttttgag ttttataaag gataaatgga gcgaagaaac
ccatctgagc 2460ggggggtacc tgctggattt tctggccatg catctgtgga gagcggttgt
gagacacaag 2520aatcgcctgc tactgttgtc ttccgtccgc ccggcgataa taccgacgga
ggagcagcag 2580cagcagcagg aggaagccag gcggcggcgg caggagcaga gcccatggaa
cccgagagcc 2640ggcctggacc ctcgggaatg aatgttgtac aggtggctga actgtatcca
gaactgagac 2700gcattttgac aattacagag gatgggcagg ggctaaaggg ggtaaagagg
gagcgggggg 2760cttgtgaggc tacagaggag gctaggaatc tagcttttag cttaatgacc
agacaccgtc 2820ctgagtgtat tacttttcaa cagatcaagg ataattgcgc taatgagctt
gatctgctgg 2880cgcagaagta ttccatagag cagctgacca cttactggct gcagccaggg
gatgattttg 2940aggaggctat tagggtatat gcaaaggtgg cacttaggcc agattgcaag
tacaagatca 3000gcaaacttgt aaatatcagg aattgttgct acatttctgg gaacggggcc
gaggtggaga 3060tagatacgga ggatagggtg gcctttagat gtagcatgat aaatatgtgg
ccgggggtgc 3120ttggcatgga cggggtggtt attatgaatg taaggtttac tggccccaat
tttagcggta 3180cggttttcct ggccaatacc aaccttatcc tacacggtgt aagcttctat
gggtttaaca 3240atacctgtgt ggaagcctgg accgatgtaa gggttcgggg ctgtgccttt
tactgctgct 3300ggaagggggt ggtgtgtcgc cccaaaagca gggcttcaat taagaaatgc
ctctttgaaa 3360ggtgtacctt gggtatcctg tctgagggta actccagggt gcgccacaat
gtggcctccg 3420actgtggttg cttcatgcta gtgaaaagcg tggctgtgat taagcataac
atggtatgtg 3480gcaactgcga ggacagggcc tctcagatgc tgacctgctc ggacggcaac
tgtcacctgc 3540tgaagaccat tcacgtagcc agccactctc gcaaggcctg gccagtgttt
gagcataaca 3600tactgacccg ctgttccttg catttgggta acaggagggg ggtgttccta
ccttaccaat 3660gcaatttgag tcacactaag atattgcttg agcccgagag catgtccaag
gtgaacctga 3720acggggtgtt tgacatgacc atgaagatct ggaaggtgct gaggtacgat
gagacccgca 3780ccaggtgcag accctgcgag tgtggcggta aacatattag gaaccagcct
gtgatgctgg 3840atgtgaccga ggagctgagg cccgatcact tggtgctggc ctgcacccgc
gctgagtttg 3900gctctagcga tgaagataca gattgaggta ctgaaatgtg tgggcgtggc
ttaagggtgg 3960gaaagaatat ataaggtggg ggtcttatgt agttttgtat ctgttttgca
gcagccgccg 4020ccgccatgag caccaactcg tttgatggaa gcattgtgag ctcatatttg
acaacgcgca 4080tgcccccatg ggccggggtg cgtcagaatg tgatgggctc cagcattgat
ggtcgccccg 4140tcctgcccgc aaactctact accttgacct acgagaccgt gtctggaacg
ccgttggaga 4200ctgcagcctc cgccgccgct tcagccgctg cagccaccgc ccgcgggatt
gtgactgact 4260ttgctttcct gagcccgctt gcaagcagtg cagcttcccg ttcatccgcc
cgcgatgaca 4320agttgacggc tcttttggca caattggatt ctttgacccg ggaacttaat
gtcgtttctc 4380agcagctgtt ggatctgcgc cagcaggttt ctgccctgaa ggcttcctcc
cctcccaatg 4440cggtttaaaa cataaataaa aaaccagact ctgtttggat ttggatcaag
caagtgtctt 4500gctgtctcag ctgactgctt aagtcgcaag ccgaattgga tccaattcgg
atcgatctta 4560ttaaagcaga acttgtttat tgcagcttat aatggttaca aataaagcaa
tagcatcaca 4620aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc
caaactcatc 4680aatgtatctt atcatgtctg gtcgactcta gactcttccg cttcctcgct
cactgactcg 4740ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc
ggtaatacgg 4800ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg
ccagcaaaag 4860gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg
cccccctgac 4920gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg
actataaaga 4980taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac
cctgccgctt 5040accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca
tagctcacgc 5100tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt
gcacgaaccc 5160cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc
caacccggta 5220agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag
agcgaggtat 5280gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac
tagaaggaca 5340gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt
tggtagctct 5400tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa
gcagcagatt 5460acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg
gtctgacgct 5520cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa
aaggatcttc 5580acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat
atatgagtaa 5640acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc
gatctgtcta 5700tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat
acgggagggc 5760ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc
ggctccagat 5820ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc
tgcaacttta 5880tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag
ttcgccagtt 5940aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg
ctcgtcgttt 6000ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg
atcccccatg 6060ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag
taagttggcc 6120gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt
catgccatcc 6180gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga
atagtgtatg 6240cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc
acatagcaga 6300actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc
aaggatctta 6360ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc
ttcagcatct 6420tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc
cgcaaaaaag 6480ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca
atattattga 6540agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat
ttagaaaaat 6600aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt
ctaagaaacc 6660attattatca tgacattaac ctataaaaat aggcgtatca cgaggcccct
ttcgtctcgc 6720gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga
cggtcacagc 6780ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag
cgggtgttgg 6840cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga
gagtgcacca 6900tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca
ggaaattgta 6960agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc
attttttaac 7020caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga
gatagggttg 7080agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc
caacgtcaaa 7140gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc
ctaatcaagt 7200tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag
cccccgattt 7260agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa
agcgaaagga 7320gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac
cacacccgcc 7380gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg
caactgttgg 7440gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg
gggatgtgct 7500gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg
taaaacgacg 7560gccagtgaat tgtaatacga ctcactatag ggcgaattaa ttcgggg
76074911600DNAArtificial SequenceDescription of Artificial
Sequence plasmid 49gaattccgca ttgcagagat attgtattta agtgcctagc tcgatacaat
aaacgccatt 60tgaccattca ccacattggt gtgcacctcc aagcttgggc agaaatggtt
gaactcccga 120gagtgtccta cacctagggg agaagcagcc aaggggttgt ttcccaccaa
ggacgacccg 180tctgcgcaca aacggatgag cccatcagac aaagacatat tcattctctg
ctgcaaactt 240ggcatagctc tgctttgcct ggggctattg ggggaagttg cggttcgtgc
tcgcagggct 300ctcacccttg actcttttaa tagctcttct gtgcaagatt acaatctaaa
caattcggag 360aactcgacct tcctcctgag gcaaggacca cagccaactt cctcttacaa
gccgcatcga 420ttttgtcctt cagaaataga aataagaatg cttgctaaaa attatatttt
taccaataag 480accaatccaa taggtagatt attagttact atgttaagaa atgaatcatt
atcttttagt 540actattttta ctcaaattca gaagttagaa atgggaatag aaaatagaaa
gagacgctca 600acctcaattg aagaacaggt gcaaggacta ttgaccacag gcctagaagt
aaaaaaggga 660aaaaagagtg tttttgtcaa aataggagac aggtggtggc aaccagggac
ttatagggga 720ccttacatct acagaccaac agatgccccc ttaccatata caggaagata
tgacttaaat 780tgggataggt gggttacagt caatggctat aaagtgttat atagatccct
cccttttcgt 840gaaagactcg ccagagctag acctccttgg tgtatgttgt ctcaagaaga
aaaagacgac 900atgaaacaac aggtacatga ttatatttat ctaggaacag gaatgcactt
ttggggaaag 960attttccata ccaaggaggg gacagtggct ggactaatag aacattattc
tgcaaaaact 1020catggcatga gttattatga atagccttta ttggcccaac cttgcggttc
ccagggctta 1080agtaagtttt tggttacaaa ctgttcttaa aacgaggatg tgagacaagt
ggtttcctga 1140cttggtttgg tatcaaaggt tctgatctga gctctgagtg ttctattttc
ctatgttctt 1200ttggaattta tccaaatctt atgtaaatgc ttatgtaaac caagatataa
aagagtgctg 1260attttttgag taaacttgca acagtcctaa cattcacctc ttgtgtgttt
gtgtctgttc 1320gccatcccgt ctccgctcgt cacttatcct tcactttcca gagggtcccc
ccgcagaccc 1380cggcgaccct caggtcggcc gactgcggca gctggcgccc gaacagggac
cctcggataa 1440gtgacccttg tctctatttc tactatttgg tgtttgtctt gtattgtctc
tttcttgtct 1500ggctatcatc acaagagcgg aacggactca ccatagggac caagctagcg
cttctcgtcg 1560cgtccaagac cctcaaagat ttttggcact tcgttgagcg aggcgatatc
aggtatgaca 1620gcgccctgcc gcaaggccag ctgcttgtcc gctcggctgc ggttggcacg
gcaggatagg 1680ggtatcttgc agttttggaa aaagatgtga taggtggcaa gcacctctgg
cacggcaaat 1740acggggtaga agttgaggcg cgggttgggc tcgcatgtgc cgttttcttg
gcgtttgggg 1800ggtacgcgcg gtgagaatag gtggcgttcg taggcaaggc tgacatccgc
tatggcgagg 1860ggcacatcgc tgcgctcttg caacgcgtcg cagataatgg cgcactggcg
ctgcagatgc 1920ttcaacagca cgtcgtctcc cacatctagg tagtcgccat gcctttcgtc
cccccgcccg 1980acttgttcct cgtttgcctc tgcgttgtcc tggtcttgct ttttatcctc
tgttggtact 2040gagcggtcct cgtcgtcttc gcttacaaaa cctgggtcct gctcgataat
cacttcctcc 2100tcctcaagcg ggggtgcctc gacggggaag gtggtaggcg cgttggcggc
atcggtggag 2160gcggtggtgg cgaactcaga gggggcggtt aggctgtcct tcttctcgac
tgactccatg 2220atctttttct gcctatagga gaaggaaatg gccagtcggg aagaggagca
gcgcgaaacc 2280acccccgagc gcggacgcgg tgcggcgcga cgtcccccaa ccatggagga
cgtgtcgtcc 2340ccgtccccgt cgccgccgcc tccccgggcg cccccaaaaa agcggatgag
gcggcgtatc 2400gagtccgagg acgaggaaga ctcatcacaa gacgcgctgg tgccgcgcac
acccagcccg 2460cggccatcga cctcggcggc ggatttggcc attgcgccca agaagaaaaa
gaagcgccct 2520tctcccaagc ccgagcgccc gccatcacca gaggtaatcg tggacagcga
ggaagaaaga 2580gaagatgtgg cgctacaaat ggtgggtttc agcaacccac cggtgctaat
caagcatggc 2640aaaggaggta agcgcacagt gcggcggctg aatgaagacg acccagtggc
gcgtggtatg 2700cggacgcaag aggaagagga agagcccagc gaagcggaaa gtgaaattac
ggtgatgaac 2760ccgctgagtg tgccgatcgt gtctgcgtgg gagaagggca tggaggctgc
gcgcgcgctg 2820atggacaagt accacgtgga taacgatcta aaggcgaact tcaaactact
gcctgaccaa 2880gtggaagctc tggcggccgt atgcaagacc tggctgaacg aggagcaccg
cgggttgcag 2940ctgaccttca ccagcaacaa gacctttgtg acgatgatgg ggcgattcct
gcaggcgtac 3000ctgcagtcgt ttgcagaggt gacctacaag catcacgagc ccacgggctg
cgcgttgtgg 3060ctgcaccgct gcgctgagat cgaaggcgag cttaagtgtc tacacggaag
cattatgata 3120aataaggagc acgtgattga aatggatgtg acgagcgaaa acgggcagcg
cgcgctgaag 3180gagcagtcta gcaaggccaa gatcgtgaag aaccggtggg gccgaaatgt
ggtgcagatc 3240tccaacaccg acgcaaggtg ctgcgtgcac gacgcggcct gtccggccaa
tcagttttcc 3300ggcaagtctt gcggcatgtt cttctctgaa ggcgcaaagg ctcaggtggc
ttttaagcag 3360atcaaggctt ttatgcaggc gctgtatcct aacgcccaga ccgggcacgg
tcaccttttg 3420atgccactac ggtgcgagtg caactcaaag cctgggcacg cgcccttttt
gggaaggcag 3480ctaccaaagt tgactccgtt cgccctgagc aacgcggagg acctggacgc
ggatctgatc 3540tccgacaaga gcgtgctggc cagcgtgcac cacccggcgc tgatagtgtt
ccagtgctgc 3600aaccctgtgt atcgcaactc gcgcgcgcag ggcggaggcc ccaactgcga
cttcaagata 3660tcggcgcccg acctgctaaa cgcgttggtg atggtgcgca gcctgtggag
tgaaaacttc 3720accgagctgc cgcggatggt tgtgcctgag tttaagtgga gcactaaaca
ccagtatcgc 3780aacgtgtccc tgccagtggc gcatagcgat gcgcggcaga acccctttga
tttttaaacg 3840gcgcagacgg caagggtggg ggtaaataat cacccgagag tgtacaaata
aaagcatttg 3900cctttattga aagtgtctct agtacattat ttttacatgt ttttcaagtg
acaaaaagaa 3960gtggcgctcc taatctgcgc actgtggctg cggaagtagg gcgagtggcg
ctccaggaag 4020ctgtagagct gttcctggtt gcgacgcagg gtgggctgta cctggggact
gttgagcatg 4080gagttgggta ccccggtaat aaggttcatg gtggggttgt gatccatggg
agtttggggc 4140cagttggcaa aggcgtggag aaacatgcag cagaatagtc cacaggcggc
cgagttgggc 4200ccctgtacgc tttgggtgga cttttccagc gttatacagc ggtcggggga
agaagcaatg 4260gcgctacggc gcaggagtga ctcgtactca aactggtaaa cctgcttgag
tcgctggtca 4320gaaaagccaa agggctcaaa gaggtagcat gtttttgagt gcgggttcca
ggcaaaggcc 4380atccagtgta cgcccccagt ctcgcgaccg gccgtattga ctatggcgca
ggcgagcttg 4440tgtggagaaa caaagcctgg aaagcgcttg tcataggtgc ccaaaaaata
tggcccacaa 4500ccaagatctt tgacaatggc tttcagttcc tgctcactgg agcccatggc
ggcagctgtt 4560gttgatgttg cttgcttctt tatgttgtgg cgttgccggc cgagaagggc
gtgcgcaggt 4620acacggtttc gatgacgccg cggtgcggcc ggtgcacacg gaccacgtca
aagacttcaa 4680acaaaacata aagaagggtg ggctcgtcca tgggatccat atatagggcc
cgggttataa 4740ttacctcagg tcgacctcga gggatctttg tgaaggaacc ttacttctgt
ggtgtgacat 4800aattggacaa actacctaca gagatttaaa gctctaaggt aaatataaaa
tttttaagtg 4860tataatgtgt taaactactg attctaattg tttgtgtatt ttagattcca
acctatggaa 4920ctgatgaatg ggagcagtgg tggaatgcct ttaatgagga aaacctgttt
tgctcagaag 4980aaatgccatc tagtgatgat gaggctactg ctgactctca acattctact
cctccaaaaa 5040agaagagaaa ggtagaagac cccaaggact ttccttcaga attgctaagt
tttttgagtc 5100atgctgtgtt tagtaataga actcttgctt gctttgctat ttacaccaca
aaggaaaaag 5160ctgcactgct atacaagaaa attatggaaa aatattctgt aacctttata
agtaggcata 5220acagttataa tcataacata ctgttttttc ttactccaca caggcataga
gtgtctgcta 5280ttaataacta tgctcaaaaa ttgtgtacct ttagcttttt aatttgtaaa
ggggttaata 5340aggaatattt gatgtatagt gccttgacta gagatcataa tcagccatac
cacatttgta 5400gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa
acataaaatg 5460aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa
ataaagcaat 5520agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg
tggtttgtcc 5580aaactcatca atgtatctta tcatgtctgg atccggctgt ggaatgtgtg
tcagttaggg 5640tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca
tctcaattag 5700tcagcaacca ggtgtggaaa gtccccaggc tccccagcag gcagaagtat
gcaaagcatg 5760catctcaatt agtcagcaac catagtcccg cccctaactc cgcccatccc
gcccctaact 5820ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat
ttatgcagag 5880gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt
ttttggaggc 5940ctaggctttt gcaaaaagct tcacgctgcc gcaagcactc agggcgcaag
ggctgctaaa 6000ggaagcggaa cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg
atgaatgtca 6060gctactgggc tatctggaca agggaaaacg caagcgcaaa gagaaagcag
gtagcttgca 6120gtgggcttac atggcgatag ctagactggg cggttttatg gacagcaagc
gaaccggaat 6180tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac
tggatggctt 6240tcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag
acaggatgag 6300gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc
gcttgggtgg 6360agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat
gccgccgtgt 6420tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg
tccggtgccc 6480tgaatgaact gcaggacgag gcagcgcggc tatcgtggct ggccacgacg
ggcgttcctt 6540gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta
ttgggcgaag 6600tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta
tccatcatgg 6660ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc
gaccaccaag 6720cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc
gatcaggatg 6780atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg
ctcaaggcgc 6840gcatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg
ccgaatatca 6900tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt
gtggcggacc 6960gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc
ggcgaatggg 7020ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc
atcgccttct 7080atcgccttct tgacgagttc ttctgagcgg gactctgggg ttcgaaatga
ccgaccaagc 7140gacgcccaac ctgccatcac gagatttcga ttccaccgcc gccttctatg
aaaggttggg 7200cttcggaatc gttttccggg acgccggctg gatgatcctc cagcgcgggg
atctcatgct 7260ggagttcttc gcccaccccg ggctcgatcc cctcgcgagt tggttcagct
gctgcctgag 7320gctggacgac ctcgcggagt tctaccggca gtgcaaatcc gtcggcatcc
aggaaaccag 7380cagcggctat ccgcgcatcc atgcccccga actgcaggag tggggaggca
cgatggccgc 7440tttggtcccg gatctttgtg aaggaacctt acttctgtgg tgtgacataa
ttggacaaac 7500tacctacaga gatttaaagc tctaaggtaa atataaaatt tttaagtgta
taatgtgtta 7560aactactgat tctaattgtt tgtgtatttt agattccaac ctatggaact
gatgaatggg 7620agcagtggtg gaatgccttt aatgaggaaa acctgttttg ctcagaagaa
atgccatcta 7680gtgatgatga ggctactgct gactctcaac attctactcc tccaaaaaag
aagagaaagg 7740tagaagaccc caaggacttt ccttcagaat tgctaagttt tttgagtcat
gctgtgttta 7800gtaatagaac tcttgcttgc tttgctattt acaccacaaa ggaaaaagct
gcactgctat 7860acaagaaaat tatggaaaaa tattctgtaa cctttataag taggcataac
agttataatc 7920ataacatact gttttttctt actccacaca ggcatagagt gtctgctatt
aataactatg 7980ctcaaaaatt gtgtaccttt agctttttaa tttgtaaagg ggttaataag
gaatatttga 8040tgtatagtgc cttgactaga gatcataatc agccatacca catttgtaga
ggttttactt 8100gctttaaaaa acctcccaca cctccccctg aacctgaaac ataaaatgaa
tgcaattgtt 8160gttgttaact tgtttattgc agcttataat ggttacaaat aaagcaatag
catcacaaat 8220ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa
actcatcaat 8280gtatcttatc atgtctggat ccccaggaag ctcctctgtg tcctcataaa
ccctaacctc 8340ctctacttga gaggacattc caatcatagg ctgcccatcc accctctgtg
tcctcctgtt 8400aattaggtca cttaacaaaa aggaaattgg gtaggggttt ttcacagacc
gctttctaag 8460ggtaatttta aaatatctgg gaagtccctt ccactgctgt gttccagaag
tgttggtaaa 8520cagcccacaa atgtcaacag cagaaacata caagctgtca gctttgcaca
agggcccaac 8580accctgctca tcaagaagca ctgtggttgc tgtgttagta atgtgcaaaa
caggaggcac 8640attttcccca cctgtgtagg ttccaaaata tctagtgttt tcatttttac
ttggatcagg 8700aacccagcac tccactggat aagcattatc cttatccaaa acagccttgt
ggtcagtgtt 8760catctgctga ctgtcaactg tagcattttt tggggttaca gtttgagcag
gatatttggt 8820cctgtagttt gctaacacac cctgcagctc caaaggttcc ccaccaacag
caaaaaaatg 8880aaaatttgac ccttgaatgg gttttccagc accattttca tgagtttttt
gtgtccctga 8940atgcaagttt aacatagcag ttaccccaat aacctcagtt ttaacagtaa
cagcttccca 9000catcaaaata tttccacagg ttaagtcctc atttaaatta ggcaaaggaa
ttcttgaaga 9060cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat
aatggtttct 9120tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg
tttatttttc 9180taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat
gcttcaataa 9240tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat
tccctttttt 9300gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt
aaaagatgct 9360gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag
cggtaagatc 9420cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa
agttctgcta 9480tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc aactcggtcg
ccgcatacac 9540tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct
tacggatggc 9600atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac
tgcggccaac 9660ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca
caacatgggg 9720gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat
accaaacgac 9780gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact
attaactggc 9840gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc
ggataaagtt 9900gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga
taaatctgga 9960gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg
taagccctcc 10020cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg
aaatagacag 10080atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca
agtttactca 10140tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta
ggtgaagatc 10200ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca
ctgagcgtca 10260gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg
cgtaatctgc 10320tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga
tcaagagcta 10380ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa
tactgtcctt 10440ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc
tacatacctc 10500gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg
tcttaccggg 10560ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac
ggggggttcg 10620tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct
acagcgtgag 10680ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc
ggtaagcggc 10740agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg
gtatctttat 10800agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg
ctcgtcaggg 10860gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct
ggccttttgc 10920tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga
taaccgtatt 10980accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg
cagcgagtca 11040gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca
tctgtgcggt 11100atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc
atagttaagc 11160cagtatctgc tccctgcttg tgtgttggag gtcgctgagt agtgcgcgag
caaaatttaa 11220gctacaacaa ggcaaggctt gaccgacaat tgcatgaaga atctgcttag
ggttaggcgt 11280tttgcgctgc ttcgcgatgt acgggccaga tatacgcgta tctgagggga
ctagggtgtg 11340tttaggcgaa aagcggggct tcggttgtac gcggttagga gtcccctcag
gatatagtag 11400tttcgctttt gcatagggag ggggaaatgt agtcttatgc aatacacttg
tagtcttgca 11460acatggtaac gatgagttag caacatgcct tacaaggaga gaaaaagcac
cgtgcatgcc 11520gattggtgga agtaaggtgg tacgatcgtg ccttattagg aaggcaacag
acgggtctga 11580catggattgg acgaaccact
11600508238DNAArtificial SequenceDescription of Artificial
Sequence plasmid 50gcggccgcca tcatcaataa tataccttat tttggattga agccaatatg
ataatgaggg 60ggtggagttt gtgacgtggc gcggggcgtg ggaacggggc gggtgacgta
gtagtgtggc 120ggaagtgtga tgttgcaagt gtggcggaac acatgtaagc gacggatgtg
gcaaaagtga 180cgtttttggt gtgcgccggt gtacacagga agtgacaatt ttcgcgcggt
tttaggcgga 240tgttgtagta aatttgggcg taaccgagta agatttggcc attttcgcgg
gaaaactgaa 300taagaggaag tgaaatctga ataattttgt gttactcata gcgcgtaata
tttgtctagg 360gccgcgggga ctttgaccgt ttacgtggag actcgcccag ggcgcgcccc
gatgtacggg 420ccagatatac gcgtatctga ggggactagg gtgtgtttag gcgaaaagcg
gggcttcggt 480tgtacgcggt taggagtccc ctcaggatat agtagtttcg cttttgcata
gggaggggga 540aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga
gttagcaaca 600tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa
ggtggtacga 660tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa
ccactgaatt 720ccgcattgca gagatattgt atttaagtgc ctagctcgat acaataaacg
ccatttgacc 780attcaccaca ttggtgtgca cctccggccc atatggccac tctcttccgc
atcgctgtct 840gcgggggcca gctgttgggc tcgcggttga ggacaaactc ttcgcggtct
ttccagtact 900cttggatcgg aaacccgtcg gcctccgaac ggtactccgc cgccgaggga
cctgagcgag 960tccgcatcga ccggatcgga aaacctctcg agaaaggcgt gtaaccagtc
acagtcgctc 1020tagaactagt ggatcccccg ggctgcagga attcgatgat cttggtggcg
tgaaactccc 1080gcacctcttt ggcaagcgcc ttgtagaagc gcgtatggct tcgtacccct
gccatcaaca 1140cgcgtctgcg ttcgaccagg ctgcgcgttc tcgcggccat agcaaccgac
gtacggcgtt 1200gcgccctcgc cggcagcaag aagccacgga agtccgcctg gagcagaaaa
tgcccacgct 1260actgcgggtt tatatagacg gtcctcacgg gatggggaaa accaccacca
cgcaactgct 1320ggtggccctg ggttcgcgcg acgatatcgt ctacgtaccc gagccgatga
cttactggca 1380ggtgctgggg gcttccgaga caatcgcgaa catctacacc acacaacacc
gcctcgacca 1440gggtgagata tcggccgggg acgcggcggt ggtaatgaca agcgcccaga
taacaatggg 1500catgccttat gccgtgaccg acgccgttct ggctcctcat gtcggggggg
aggctgggag 1560ttcacatgcc ccgcccccgg ccctcaccct catcttcgac cgccatccca
tcgccgccct 1620cctgtgctac ccggccgcgc gataccttat gggcagcatg accccccagg
ccgtgctggc 1680gttcgtggcc ctcatcccgc cgaccttgcc cggcacaaac atcgtgttgg
gggcccttcc 1740ggaggacaga cacatcgacc gcctggccaa acgccagcgc cccggcgagc
ggcttgacct 1800ggctatgctg gccgcgattc gccgcgttta cgggctgctt gccaatacgg
tgcggtatct 1860gcagggcggc gggtcgtggt gggaggattg gggacagctt tcggggacgg
ccgtgccgcc 1920ccagggtgcc gagccccaga gcaacgcggg cccacgaccc catatcgggg
acacgttatt 1980taccctgttt cgggcccccg agttgctggc ccccaacggc gacctgtata
acgtgtttgc 2040ctgggccttg gacgtcttgg ccaaacgcct ccgtcccatg cacgtcttta
tcctggatta 2100cgaccaatcg cccgccggct gccgggacgc cctgctgcaa cttacctccg
ggatggtcca 2160gacccacgtc accaccccag gctccatacc gacgatctgc gacctggcgc
gcacgtttgc 2220ccgggagatg ggggaggcta actgactcga gaagcttggg cccatcgatc
aagcttatcg 2280ataccgtcga aacttgttta ttgcagctta taatggttac aaataaagca
atagcatcac 2340aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt
ccaaactcat 2400caatgtatct tatcatgtct ggatccgacc tcggatctgg aaggtgctga
ggtacgatga 2460gacccgcacc aggtgcagac cctgcgagtg tggcggtaaa catattagga
accagcctgt 2520gatgctggat gtgaccgagg agctgaggcc cgatcacttg gtgctggcct
gcacccgcgc 2580tgagtttggc tctagcgatg aagatacaga ttgaggtact gaaatgtgtg
ggcgtggctt 2640aagggtggga aagaatatat aaggtggggg tcttatgtag ttttgtatct
gttttgcagc 2700agccgccgcc gccatgagca ccaactcgtt tgatggaagc attgtgagct
catatttgac 2760aacgcgcatg cccccatggg ccggggtgcg tcagaatgtg atgggctcca
gcattgatgg 2820tcgccccgtc ctgcccgcaa actctactac cttgacctac gagaccgtgt
ctggaacgcc 2880gttggagact gcagcctccg ccgccgcttc agccgctgca gccaccgccc
gcgggattgt 2940gactgacttt gctttcctga gcccgcttgc aagcagtgca gcttcccgtt
catccgcccg 3000cgatgacaag ttgacggctc ttttggcaca attggattct ttgacccggg
aacttaatgt 3060cgtttctcag cagctgttgg atctgcgcca gcaggtttct gccctgaagg
cttcctcccc 3120tcccaatgcg gtttaaaaca taaataaaaa accagactct gtttggattt
ggatcaagca 3180agtgtcttgc tgtctttatt taggggtttt gcgcgcgcgg taggcccggg
accagcggtc 3240tcggtcgttg agggtcctgt gtattttttc caggacgtgg taaaggtgac
tctggatgtt 3300cagatacatg ggcataagcc cgtctctggg gtggaggtag caccactgca
gagcttcatg 3360ctgcggggtg gtgttgtaga tgatccagtc gtagcaggag cgctgggcgt
ggtgcctaaa 3420aatgtctttc agtagcaagc tgattgccag gggcaggccc ttggtgtaag
tgtttacaaa 3480gcggttaagc tgggatgggt gcatacgtgg ggatatgaga tgcatcttgg
actgtatttt 3540taggttggct atgttcccag ccatatccct ccggggattc atgttgtgca
gaaccaccag 3600cacagtgtat ccggtgcact tgggaaattt gtcatgtagc ttagaaggaa
atgcgtggaa 3660gaacttggag acgcccttgt gacctccaag attttccatg cattcgtcca
taatgatggc 3720aatgggccca cgggcggcgg cctgggcgaa gatatttctg ggatcactaa
cgtcatagtt 3780gtgttccagg atgagatcgt cataggccat ttttacaaag cgcgggcgga
gggtgccaga 3840ctgcggtata atggttccat ccggcccagg ggcgtagtta ccctcacaga
tttgcatttc 3900ccacgctttg agttcagatg gggggatcat gtctacctgc ggggcgatga
agaaaacggt 3960ttccggggta ggggagatca gctgggaaga aagcaggttc ctgagcagct
gcgacttacc 4020gcagccggtg ggcccgtaaa tcacacctat taccggctgc aactggtagt
taagagagct 4080gcagctgccg tcatccctga gcaggggggc cacttcgtta agcatgtccc
tgactcgcat 4140gttttccctg accaaatccg ccagaaggcg ctcgccgccc agcgatagca
gttcttgcaa 4200ggaagcaaag tttttcaacg gtttgagacc gtccgccgta ggcatgcttt
tgagcgtttg 4260accaagcagt tccaggcggt cccacagctc ggtcacctgc tctacggcat
ctcgatccag 4320catatctcct cgtttcgcgg gttggggcgg ctttcgctgt acggcagtag
tcggtgctcg 4380tccagacggg ccagggtcat gtctttccac gggcgcaggg tcctcgtcag
cgtagtctgg 4440gtcacggtga aggggtgcgc tccgggctgc gcgctggcca gggtgcgctt
gaggctggtc 4500ctgctggtgc tgaagcgctg ccggtcttcg ccctgcgcgt cggccaggta
gcatttgacc 4560atggtgtcat agtccagccc ctccgcggcg tggcccttgg cgcgcagctt
gcccttggag 4620gaggcgccgc acgaggggca gtgcagactt ttgagggcgt agagcttggg
cgcgagaaat 4680accgattccg gggagtaggc atccgcgccg caggccccgc agacggtctc
gcattccacg 4740agccaggtga gctctggccg ttcggggtca aaaaccaggt ttcccccatg
ctttttgatg 4800cgtttcttac ctctggtttc catgagccgg tgtccacgct cggtgacgaa
aaggctgtcc 4860gtgtccccgt atacagactt gagaggcctg tcctcgagcg gtgttccgcg
gtcctcctcg 4920tatagaaact cggaccactc tgagacaaag gctcgcgtcc aggccagcac
gaaggaggct 4980aagtgggagg ggtagcggtc gttgtccact agggggtcca ctcgctccag
ggtgtgaaga 5040cacatgtcgc cctcttcggc atcaaggaag gtgattggtt tgtaggtgta
ggccacgtga 5100ccgggtgttc ctgaaggggg gctataaaag ggggtggggg cgcgttcgtc
ctcactctct 5160tccgcatcgc tgtctgcgag ggccagctgt tggggtgagt actccctctg
aaaagcgggc 5220atgacttctg cgctaagatt gtcagtttcc aaaaacgagg aggatttgat
attcacctgg 5280cccgcggtga tgcctttgag ggtggccgca tccatctggt cagaaaagac
aatctttttg 5340ttgtcaagct tcgagggggg gcccggtacc cagcttttgt tccctttagt
gagggttaat 5400tgcgcgcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt
atccgctcac 5460aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
cctaatgagt 5520gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg
gaaacctgtc 5580gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc
gtattgggcg 5640ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
ggcgagcggt 5700atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
acgcaggaaa 5760gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
cgttgctggc 5820gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
caagtcagag 5880gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
gctccctcgt 5940gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
tcccttcggg 6000aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
aggtcgttcg 6060ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
ccttatccgg 6120taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
cagcagccac 6180tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
tgaagtggtg 6240gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
tgaagccagt 6300taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
ctggtagcgg 6360tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
aagaagatcc 6420tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
aagggatttt 6480ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
aatgaagttt 6540taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
gcttaatcag 6600tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
gactccccgt 6660cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
caatgatacc 6720gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
ccggaagggc 6780cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
attgttgccg 6840ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
ccattgctac 6900aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
gttcccaacg 6960atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
ccttcggtcc 7020tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
tggcagcact 7080gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
gtgagtactc 7140aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
cggcgtcaat 7200acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
gaaaacgttc 7260ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
tgtaacccac 7320tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
ggtgagcaaa 7380aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
gttgaatact 7440catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
tcatgagcgg 7500atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
catttccccg 7560aaaagtgcca cctgacgcgc cctgtagcgg cgcattaagc gcggcgggtg
tggtggttac 7620gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg
ctttcttccc 7680ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg
ggctcccttt 7740agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt
agggtgatgg 7800ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt
tggagtccac 7860gttctttaat agtggactct tgttccaaac tggaacaaca ctcaacccta
tctcggtcta 7920ttcttttgat ttataaggga ttttgcgatt tcggcctatt ggttaaaaaa
tgagctgatt 7980taacaaaaat ttaacgcgaa ttttaacaaa atattaacgc ttacaatttc
cattcgccat 8040tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta
ttacgccagc 8100tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg
ttttcccagt 8160cacgacgttg taaaacgacg gccagtgagc gcgcgtaata cgactcacta
tagggcgaat 8220tggagctcca ccgcggtg
82385111DNAadenovirus 51cgcggatccc g
115226DNAArtificial SequenceDescription of
Artificial Sequence primer 52ctgacaaact cagatcttgt ttattg
265321DNAArtificial SequenceDescription of
Artificial Sequence primer 53gtcgactcta gaggatccag a
215430DNAArtificial SequenceDescription of
Artificial Sequence primer 54ccggactcta gatggcaacc atggcgctac
305531DNAArtificial SequenceDescription of
Artificial Sequence primer 55ggaggggaag cttggccctc agccagcctc t
315648DNAArtificial SequenceDescription of
Artificial Sequence primer 56tgtcttggat ccaagatgaa gcgcgcccgc cccagcgaag
atgacttc 485728DNAArtificial SequenceDescription of
Artificial Sequence primer 57aaacacggcg gccgctcttt cattcttg
285825DNAArtificial SequenceDescription of
Artificial Sequence primer 58cgcgctgact cttaggacta gtttc
255937DNAArtificial SequenceDescription of
Artificial Sequence primer 59gcgcttaatt aacatcatca ataatatacc ttatttt
376024DNAArtificial SequenceDescription of
Artificial Sequence primer 60tgaagcgcgc aagaccgtct gaag
246128DNAArtificial SequenceDescription of
Artificial Sequence primer 61cataacactg cagattcttt attcttgg
286247DNAArtificial SequenceDescription of
Artificial Sequence primer 62ggtacacagg aaacaggagg ttccggaggt ggaggagaca
caactcc 47636PRTArtificial SequenceDescription of
Artificial Sequence synthetic peptide 63Gly Gly Ser Gly Gly Gly 1
5647231DNAArtificial SequenceDescription of Artificial
Sequence plasmid 64ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg cgagcaaaat
ttaagctaca 60acaaggcaag gcttgaccga caattgcatg aagaatctgc ttagggttag
gcgttttgcg 120ctgcttcgcg atgtacgggc cagatatacg cgttgacatt gattattgac
tagttattaa 180tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
cgttacataa 240cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
gacgtcaata 300atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
atgggtggac 360tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
aagtacgccc 420cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
catgacctta 480tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
catggtgatg 540cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
atttccaagt 600ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
ggactttcca 660aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
acggtgggag 720gtctatataa gcagagctct ctggctaact agagaaccca ctgcttactg
gcttatcgaa 780attaatacga ctcactatag ggagacccaa gctggctagc gtttaaactt
aagcttggta 840ccgagctcgg atccactctc ttccgcatcg ctgtctgcga gggccagctg
ttggggtgag 900tactccctct gaaaagcggg catgacttct gcgctaagat tgtcagtttc
caaaaacgag 960gaggatttga tattcacctg gcccgcggtg atgcctttga gggtggccgc
atccatctgg 1020tcagaaaaga caatcttttt gttgtcaagc ttggtggcaa acgacccgta
gagggcgttg 1080gacagcaact tggcgatgga gcgcagggtt tggtttttgt cgcgatcggc
gcgctccttg 1140gccgcgatgt ttagctgcac gtattcgcgc gcaacgcacc gccattcggg
aaagacggtg 1200gtgcgctcgt cgggcaccag gtgcacgcgc caaccgcggt tgtgcagggt
gacaaggtca 1260acgctggtgg ctacctctcc gcgtaggcgc tcgttggtcc agcagaggcg
gccgcccttg 1320cgcgagcaga atggcggtag ggggtctagc tgcgtctcgt ccggggggtc
tgcgtccacg 1380gtaaagaccc cgggcagcag gcgcgcgtcg aagtagtcta tcttgcatcc
ttgcaagtct 1440agcgcctgct gccatgcgcg ggcggcaagc gcgcgctcgt atgggttgag
tgggggaccc 1500catggcatgg ggtgggtgag cgcggaggcg tacatgccgc aaatgtcgta
aacgtagagg 1560ggctctctga gtattccaag atatgtaggg tagcatcttc caccgcggat
gctggcgcgc 1620acgtaatcgt atagttcgtg cgagggagcg aggaggtcgg gaccgaggtt
gctacgggcg 1680ggctgctctg ctcggaagac tatctgcctg aagatggcat gtgagttgga
tgatatggtt 1740ggacgctgga agacgttgaa gctggcgtct gtgagaccta ccgcgtcacg
cacgaaggag 1800gcgtaggagt cgcgcagctt gttgaccagc tcggcggtga cctgcacgtc
tagggcgcag 1860tagtccaggg tttccttgat gatgtcatac ttatcctgtc cctttttttt
ccacagctcg 1920cggttgagga caaactcttc gcggtctttc cagtactctt ggatcggaaa
cccgtcggcc 1980tccgaacgag atccgtactc cgccgccgag ggacctgagc gagtccgcat
cgaccggatc 2040ggaaaacctc tcgagaaagg cgtctaacca gtcacagtcg caagatccaa
gatgaagcgc 2100gcccgcccca gcgaagatga cttcaacccc gtctacccct atggctacgc
gcggaatcag 2160aatatcccct tcctcactcc cccctttgtc tcctccgatg gattcaaaaa
cttcccccct 2220ggggtactgt cactcaaact ggctgatcca atcaccatta ccaatgggga
tgtatccctc 2280aaggtgggag gtggtctcac tttgcaagat ggaagcctaa ctgtaaaccc
taaggctcca 2340ctgcaagtta atactgataa aaaacttgag cttgcatatg ataatccatt
tgaaagtagt 2400gctaataaac ttagtttaaa agtaggacat ggattaaaag tattagatga
aaaaagtgct 2460gcggggttaa aagatttaat tggcaaactt gtggttttaa caggaaaagg
aataggcact 2520gaaaatttag aaaatacaga tggtagcagc agaggaattg gtataaatgt
aagagcaaga 2580gaagggttga catttgacaa tgatggatac ttggtagcat ggaacccaaa
gtatgacacg 2640cgcacacttt ggacaacacc agacacatct ccaaactgca caattgctca
agataaggac 2700tctaaactca ctttggtact tacaaagtgt ggaagtcaaa tattagctaa
tgtgtctttg 2760attgtggtcg caggaaagta ccacatcata aataataaga caaatccaaa
aataaaaagt 2820tttactatta aactgctatt taataagaac ggagtgcttt tagacaactc
aaatcttgga 2880aaagcttatt ggaactttag aagtggaaat tccaatgttt cgacagctta
tgaaaaagca 2940attggtttta tgcctaattt ggtagcgtat ccaaaaccca gtaattctaa
aaaatatgca 3000agagacatag tttatggaac tatatatctt ggtggaaaac ctgatcagcc
agcagtcatt 3060aaaactacct ttaaccaaga aactggatgt gaatactcta tcacatttaa
ctttagttgg 3120tccaaaacct atgaaaatgt tgaatttgaa accacctctt ttaccttctc
ctatattgcc 3180caagaatgaa agagcggccg ctcgagtcta gagggcccgt ttaaacccgc
tgatcagcct 3240cgactgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg
ccttccttga 3300ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt
gcatcgcatt 3360gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc
aagggggagg 3420attgggaaga caatagcagg catgctgggg atgcggtggg ctctatggct
tctgaggcgg 3480aaagaaccag ctggggctct agggggtatc cccacgcgcc ctgtagcggc
gcattaagcg 3540cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc
ctagcgcccg 3600ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc
cgtcaagctc 3660taaatcgggg catcccttta gggttccgat ttagtgcttt acggcacctc
gaccccaaaa 3720aacttgatta gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg
gtttttcgcc 3780ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact
ggaacaacac 3840tcaaccctat ctcggtctat tcttttgatt tataagggat tttggggatt
tcggcctatt 3900ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttaattctgt
ggaatgtgtg 3960tcagttaggg tgtggaaagt ccccaggctc cccaggcagg cagaagtatg
caaagcatgc 4020atctcaatta gtcagcaacc aggtgtggaa agtccccagg ctccccagca
ggcagaagta 4080tgcaaagcat gcatctcaat tagtcagcaa ccatagtccc gcccctaact
ccgcccatcc 4140cgcccctaac tccgcccagt tccgcccatt ctccgcccca tggctgacta
atttttttta 4200tttatgcaga ggccgaggcc gcctctgcct ctgagctatt ccagaagtag
tgaggaggct 4260tttttggagg cctaggcttt tgcaaaaagc tcccgggagc ttgtatatcc
attttcggat 4320ctgatcagca cgtgttgaca attaatcatc ggcatagtat atcggcatag
tataatacga 4380caaggtgagg aactaaacca tggccaagtt gaccagtgcc gttccggtgc
tcaccgcgcg 4440cgacgtcgcc ggagcggtcg agttctggac cgaccggctc gggttctccc
gggacttcgt 4500ggaggacgac ttcgccggtg tggtccggga cgacgtgacc ctgttcatca
gcgcggtcca 4560ggaccaggtg gtgccggaca acaccctggc ctgggtgtgg gtgcgcggcc
tggacgagct 4620gtacgccgag tggtcggagg tcgtgtccac gaacttccgg gacgcctccg
ggccggccat 4680gaccgagatc ggcgagcagc cgtgggggcg ggagttcgcc ctgcgcgacc
cggccggcaa 4740ctgcgtgcac ttcgtggccg aggagcagga ctgacacgtg ctacgagatt
tcgattccac 4800cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg
gctggatgat 4860cctccagcgc ggggatctca tgctggagtt cttcgcccac cccaacttgt
ttattgcagc 4920ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag
catttttttc 4980actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg
tctgtatacc 5040gtcgacctct agctagagct tggcgtaatc atggtcatag ctgtttcctg
tgtgaaattg 5100ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta
aagcctgggg 5160tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg
ctttccagtc 5220gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga
gaggcggttt 5280gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg
tcgttcggct 5340gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag
aatcagggga 5400taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc
gtaaaaaggc 5460cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca
aaaatcgacg 5520ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt
ttccccctgg 5580aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc
tgtccgcctt 5640tctcccttcg ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc
tcagttcggt 5700gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc
ccgaccgctg 5760cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact
tatcgccact 5820ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg
ctacagagtt 5880cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta
tctgcgctct 5940gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca
aacaaaccac 6000cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa
aaaaaggatc 6060tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg
aaaactcacg 6120ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc
ttttaaatta 6180aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg
acagttacca 6240atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat
ccatagttgc 6300ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg
gccccagtgc 6360tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa
taaaccagcc 6420agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca
tccagtctat 6480taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc
gcaacgttgt 6540tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt
cattcagctc 6600cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa
aagcggttag 6660ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat
cactcatggt 6720tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct
tttctgtgac 6780tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga
gttgctcttg 6840cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag
tgctcatcat 6900tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga
gatccagttc 6960gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca
ccagcgtttc 7020tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg
cgacacggaa 7080atgttgaata ctcatactct tcctttttca atattattga agcatttatc
agggttattg 7140tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag
gggttccgcg 7200cacatttccc cgaaaagtgc cacctgacgt c
7231658484DNAArtificial SequenceDescription of Artificial
Sequence plasmid 65ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg cgagcaaaat
ttaagctaca 60acaaggcaag gcttgaccga caattgcatg aagaatctgc ttagggttag
gcgttttgcg 120ctgcttcgcg atgtacgggc cagatatacg cgttgacatt gattattgac
tagttattaa 180tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
cgttacataa 240cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
gacgtcaata 300atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
atgggtggac 360tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
aagtacgccc 420cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
catgacctta 480tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
catggtgatg 540cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
atttccaagt 600ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
ggactttcca 660aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
acggtgggag 720gtctatataa gcagagctct ctggctaact agagaaccca ctgcttactg
gcttatcgaa 780attaatacga ctcactatag ggagacccaa gctggctagc gtttaaactt
aagcttggta 840ccgagctcgg atccactctc ttccgcatcg ctgtctgcga gggccagctg
ttggggtgag 900tactccctct gaaaagcggg catgacttct gcgctaagat tgtcagtttc
caaaaacgag 960gaggatttga tattcacctg gcccgcggtg atgcctttga gggtggccgc
atccatctgg 1020tcagaaaaga caatcttttt gttgtcaagc ttggtggcaa acgacccgta
gagggcgttg 1080gacagcaact tggcgatgga gcgcagggtt tggtttttgt cgcgatcggc
gcgctccttg 1140gccgcgatgt ttagctgcac gtattcgcgc gcaacgcacc gccattcggg
aaagacggtg 1200gtgcgctcgt cgggcaccag gtgcacgcgc caaccgcggt tgtgcagggt
gacaaggtca 1260acgctggtgg ctacctctcc gcgtaggcgc tcgttggtcc agcagaggcg
gccgcccttg 1320cgcgagcaga atggcggtag ggggtctagc tgcgtctcgt ccggggggtc
tgcgtccacg 1380gtaaagaccc cgggcagcag gcgcgcgtcg aagtagtcta tcttgcatcc
ttgcaagtct 1440agcgcctgct gccatgcgcg ggcggcaagc gcgcgctcgt atgggttgag
tgggggaccc 1500catggcatgg ggtgggtgag cgcggaggcg tacatgccgc aaatgtcgta
aacgtagagg 1560ggctctctga gtattccaag atatgtaggg tagcatcttc caccgcggat
gctggcgcgc 1620acgtaatcgt atagttcgtg cgagggagcg aggaggtcgg gaccgaggtt
gctacgggcg 1680ggctgctctg ctcggaagac tatctgcctg aagatggcat gtgagttgga
tgatatggtt 1740ggacgctgga agacgttgaa gctggcgtct gtgagaccta ccgcgtcacg
cacgaaggag 1800gcgtaggagt cgcgcagctt gttgaccagc tcggcggtga cctgcacgtc
tagggcgcag 1860tagtccaggg tttccttgat gatgtcatac ttatcctgtc cctttttttt
ccacagctcg 1920cggttgagga caaactcttc gcggtctttc cagtactctt ggatcggaaa
cccgtcggcc 1980tccgaacgag atccgtactc cgccgccgag ggacctgagc gagtccgcat
cgaccggatc 2040ggaaaacctc tcgagaaagg cgtctaacca gtcacagtcg caagatccaa
gatgaagcgc 2100gcaagaccgt ctgaagatac cttcaacccc gtgtatccat atgacacgga
aaccggtcct 2160ccaactgtgc cttttcttac tcctcccttt gtatccccca atgggtttca
agagagtccc 2220cctggggtac tctctttgcg cctatccgaa cctctagtta cctccaatgg
catgcttgcg 2280ctcaaaatgg gcaacggcct ctctctggac gaggccggca accttacctc
ccaaaatgta 2340accactgtga gcccacctct caaaaaaacc aagtcaaaca taaacctgga
aatatctgca 2400cccctcacag ttacctcaga agccctaact gtggctgccg ccgcacctct
aatggtcgcg 2460ggcaacacac tcaccatgca atcacaggcc ccgctaaccg tgcacgactc
caaacttagc 2520attgccaccc aaggacccct cacagtgtca gaaggaaagc tagccctgca
aacatcaggc 2580cccctcacca ccaccgatag cagtaccctt actatcactg cctcaccccc
tctaactact 2640gccactggta gcttgggcat tgacttgaaa gagcccattt atacacaaaa
tggaaaacta 2700ggactaaagt acggggctcc tttgcatgta acagacgacc taaacacttt
gaccgtagca 2760actggtccag gtgtgactat taataatact tccttgcaaa ctaaagttac
tggagccttg 2820ggttttgatt cacaaggcaa tatgcaactt aatgtagcag gaggactaag
gattgattct 2880caaaacagac gccttatact tgatgttagt tatccgtttg atgctcaaaa
ccaactaaat 2940ctaagactag gacagggccc tctttttata aactcagccc acaacttgga
tattaactac 3000aacaaaggcc tttacttgtt tacagcttca aacaattcca aaaagcttga
ggttaaccta 3060agcactgcca aggggttgat gtttgacgct acagccatag ccattaatgc
aggagatggg 3120cttgaatttg gttcacctaa tgcaccaaac acaaatcccc tcaaaacaaa
aattggccat 3180ggcctagaat ttgattcaaa caaggctatg gttcctaaac taggaactgg
ccttagtttt 3240gacagcacag gtgccattac agtaggaaac aaaaataatg ataagctaac
tttgtggacc 3300acaccagctc catctcctaa ctgtagacta aatgcagaga aagatgctaa
actcactttg 3360gtcttaacaa aatgtggcag tcaaatactt gctacagttt cagttttggc
tgttaaaggc 3420agtttggctc caatatctgg aacagttcaa agtgctcatc ttattataag
atttgacgaa 3480aatggagtgc tactaaacaa ttccttcctg gacccagaat attggaactt
tagaaatgga 3540gatcttactg aaggcacagc ctatacaaac gctgttggat ttatgcctaa
cctatcagct 3600tatccaaaat ctcacggtaa aactgccaaa agtaacattg tcagtcaagt
ttacttaaac 3660ggagacaaaa ctaaacctgt aacactaacc attacactaa acggtacaca
ggaaacagga 3720gacacaactc caagtgcata ctctatgtca ttttcatggg actggtctgg
ccacaactac 3780attaatgaaa tatttgccac atcctcttac actttttcat acattgccca
agaataaaag 3840aagcggccgc tcgagtctag cgataatcaa cctctggatt acaaaatttg
tgaaagattg 3900actggtattc ttaactatgt tgctcctttt acgctatgtg gatacgctgc
tttaatgcct 3960ttgtatcatg ctattgcttc ccgtatggct ttcattttct cctccttgta
taaatcctgg 4020ttgctgtctc tttatgagga gttgtggccc gttgtcaggc aacgtggcgt
ggtgtgcact 4080gtgtttgctg acgcaacccc cactggttgg ggcattgcca ccacctgtca
gctcctttcc 4140gggactttcg ctttccccct ccctattgcc acggcggaac tcatcgccgc
ctgccttgcc 4200cgctgctgga caggggctcg gctgttgggc actgacaatt ccgtggtgtt
gtcggggaag 4260ctgacgtcct ttccatggct gctcgcctgt gttgccacct ggattctgcg
cgggacgtcc 4320ttctgctacg tcccttcggc cctcaatcca gcggaccttc cttcccgcgg
cctgctgccg 4380gctctgcggc ctcttccgcg tcttcgcctt cgccctcaga cgagtcggat
ctccctttgg 4440gccgcctccc cgcctgatcg ctagagggcc cgtttaaacc cgctgatcag
cctcgactgt 4500gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct
tgaccctgga 4560aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc
attgtctgag 4620taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg
aggattggga 4680agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg
cggaaagaac 4740cagctggggc tctagggggt atccccacgc gccctgtagc ggcgcattaa
gcgcggcggg 4800tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc
ccgctccttt 4860cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag
ctctaaatcg 4920gggcatccct ttagggttcc gatttagtgc tttacggcac ctcgacccca
aaaaacttga 4980ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc
gccctttgac 5040gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa
cactcaaccc 5100tatctcggtc tattcttttg atttataagg gattttgggg atttcggcct
attggttaaa 5160aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt
gtgtcagtta 5220gggtgtggaa agtccccagg ctccccaggc aggcagaagt atgcaaagca
tgcatctcaa 5280ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa
gtatgcaaag 5340catgcatctc aattagtcag caaccatagt cccgccccta actccgccca
tcccgcccct 5400aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt
ttatttatgc 5460agaggccgag gccgcctctg cctctgagct attccagaag tagtgaggag
gcttttttgg 5520aggcctaggc ttttgcaaaa agctcccggg agcttgtata tccattttcg
gatctgatca 5580gcacgtgttg acaattaatc atcggcatag tatatcggca tagtataata
cgacaaggtg 5640aggaactaaa ccatggccaa gttgaccagt gccgttccgg tgctcaccgc
gcgcgacgtc 5700gccggagcgg tcgagttctg gaccgaccgg ctcgggttct cccgggactt
cgtggaggac 5760gacttcgccg gtgtggtccg ggacgacgtg accctgttca tcagcgcggt
ccaggaccag 5820gtggtgccgg acaacaccct ggcctgggtg tgggtgcgcg gcctggacga
gctgtacgcc 5880gagtggtcgg aggtcgtgtc cacgaacttc cgggacgcct ccgggccggc
catgaccgag 5940atcggcgagc agccgtgggg gcgggagttc gccctgcgcg acccggccgg
caactgcgtg 6000cacttcgtgg ccgaggagca ggactgacac gtgctacgag atttcgattc
caccgccgcc 6060ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg ccggctggat
gatcctccag 6120cgcggggatc tcatgctgga gttcttcgcc caccccaact tgtttattgc
agcttataat 6180ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt
ttcactgcat 6240tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctgtat
accgtcgacc 6300tctagctaga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa
ttgttatccg 6360ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg
gggtgcctaa 6420tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca
gtcgggaaac 6480ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg
tttgcgtatt 6540gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg
gctgcggcga 6600gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg
ggataacgca 6660ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa
ggccgcgttg 6720ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg
acgctcaagt 6780cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc
tggaagctcc 6840ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc
ctttctccct 6900tcgggaagcg tggcgctttc tcaatgctca cgctgtaggt atctcagttc
ggtgtaggtc 6960gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg
ctgcgcctta 7020tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc
actggcagca 7080gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga
gttcttgaag 7140tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc
tctgctgaag 7200ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac
caccgctggt 7260agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg
atctcaagaa 7320gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc
acgttaaggg 7380attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa
ttaaaaatga 7440agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta
ccaatgctta 7500atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt
tgcctgactc 7560cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag
tgctgcaatg 7620ataccgcgag acccacgctc accggctcca gatttatcag caataaacca
gccagccgga 7680agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc
tattaattgt 7740tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt
tgttgccatt 7800gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag
ctccggttcc 7860caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt
tagctccttc 7920ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat
ggttatggca 7980gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt
gactggtgag 8040tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc
ttgcccggcg 8100tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat
cattggaaaa 8160cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag
ttcgatgtaa 8220cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt
ttctgggtga 8280gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg
gaaatgttga 8340atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta
ttgtctcatg 8400agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc
gcgcacattt 8460ccccgaaaag tgccacctga cgtc
84846653DNAArtificial SequenceDescription of Artificial
Sequence primer 66gtcactcgag gactcggtcg actgaaaatg agacatatta tctgccacgg
acc 536736DNAArtificial SequenceDescription of Artificial
Sequence primer 67cgagatcgat cacctccggt acaaggtttg gcatag
366837DNAArtificial SequenceDescription of Artificial
Sequence primer 68catgaagatc tggaaggtgc tgaggtacga tgagacc
376951DNAArtificial SequenceDescription of Artificial
Sequence primer 69gcgacttaag cagtcagctg agacagcaag acacttgctt gatccaaatc
c 517038DNAArtificial SequenceDescription of Artificial
Sequence primer 70cacgaattcg tcagcgcttc tcgtcgcgtc caagaccc
387132DNAArtificial SequenceDescription of Artificial
Sequence primer 71caccccgggg aggcggcggc gacggggacg gg
327230DNAArtificial SequenceDescription of Artificial
Sequence oligonucleotide 72atgggatcca agatgaagcg cgcaagaccg
307330DNAArtificial SequenceDescription of
Artificial Sequence oligonucleotide 73cataacctgc aggattcttt
attcttgggc 307447DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide
74ggtacacagg aaacaggagg ttccggaggt ggaggagaca caactcc
477530DNAArtificial SequenceDescription of Artificial Sequence primer
75atgggatcca agatgaagcg cgcaagaccg
307630DNAArtificial SequenceDescription of Artificial Sequence primer
76cactatagcg gccgcattct cagtcatctt
30
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: