Patent application title: GDC-1 GENES CONFERRING HERBICIDE RESISTANCE
Inventors:
Philip E. Hammer (Cary, NC, US)
Todd K. Hinson (Rougemont, NC, US)
Todd K. Hinson (Rougemont, NC, US)
Brian Carr (Raleigh, NC, US)
Nicholas B. Duck (Apex, NC, US)
Assignees:
ATHENIX CORPORATION
IPC8 Class: AC12N1560FI
USPC Class:
800278
Class name: Multicellular living organisms and unmodified parts thereof and related processes method of introducing a polynucleotide molecule into or rearrangement of genetic material within a plant or plant part
Publication date: 2009-06-11
Patent application number: 20090151018
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: GDC-1 GENES CONFERRING HERBICIDE RESISTANCE
Inventors:
Nicholas B. Duck
Philip E. Hammer
Brian Carr
Todd K. Hinson
Agents:
ALSTON & BIRD LLP
Assignees:
Athenix Corporation
Origin: CHARLOTTE, NC US
IPC8 Class: AC12N1560FI
USPC Class:
800278
Abstract:
Compositions and methods for conferring herbicide resistance to plants,
plant cells, tissues and seeds are provided. Compositions comprising a
coding sequence for a polypeptide that confers resistance or tolerance to
glyphosate herbicides are provided. The coding sequences can be used in
DNA constructs or expression cassettes for transformation and expression
in plants. Compositions also comprise transformed plants, plant cells,
tissues, and seeds. In particular, isolated nucleic acid molecules
corresponding to glyphosate resistant nucleic acid sequences are
provided. Additionally, amino acid sequences corresponding to the
polynucleotides are encompassed. In particular, the present invention
provides for isolated nucleic acid molecules comprising nucleotide
sequences encoding an amino acid sequence shown in SEQ ID NO:3, 6, 8, 11,
19, or 21, or a nucleotide sequence set forth in SEQ ID NO:1, 2, 4, 5, 7,
9, 10, 18, or 20, as well as variants and fragments thereof.Claims:
1. An isolated nucleic acid molecule selected from the group consisting
of:a) a nucleic acid molecule comprising the nucleotide sequence of SEQ
ID NO:1, 2, 4, 5, 9, 10, 18, or 20;b) a nucleic acid molecule which
encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:3,
6, 11, 19, or 21;c) a nucleic acid molecule comprising a nucleotide
sequence encoding a polypeptide having at least 95% amino acid sequence
identity to the amino acid sequence of SEQ ID NO:3, 6, 11, 19, or 21,
wherein said polypeptide has glyphosate resistance and decarboxylase
activity; andd) a complement of any of a)-c).
2. The isolated nucleic acid molecule of claim 1, wherein said nucleotide sequence is a synthetic sequence that has been designed for expression in a plant.
3. The nucleic acid molecule of claim 2, wherein said synthetic sequence has an increased GC content relative to the GC content of SEQ ID NO: 1, 2, 4, 5, 9, 10, 18, or 20.
4. A vector comprising the nucleic acid molecule of claim 1.
5. The vector of claim 4, further comprising a nucleic acid molecule encoding a heterologous polypeptide.
6. A host cell that contains the vector of claim 4.
7. The host cell of claim 6 that is a bacterial host cell.
8. The host cell of claim 6 that is a plant cell.
9. A transgenic plant comprising the host cell of claim 8.
10. The plant of claim 9, wherein said plant is selected from the group consisting of maize, sorghum, wheat, sunflower, tomato, crucifers, peppers, potato, cotton, rice, soybean, sugarbeet, sugarcane, tobacco, barley, and oilseed rape.
11. A transgenic seed comprising the nucleic acid molecule of claim 1.
12. An isolated polypeptide selected from the group consisting of:a) a polypeptide comprising the amino acid sequence of SEQ NO:3, 6, 11, 19, or 21;b) a polypeptide encoded by the nucleotide sequence of SEQ ID NO:1, 2, 4, 5, 9, 10, 18, or 20; andc) a polypeptide comprising an amino acid sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO:3, 6, 11, 19, or 21, wherein said polypeptide has glyphosate resistance and decarboxylase activity.
13. The polypeptide of claim 12 further comprising a heterologous amino acid sequence.
14. A method for producing a polypeptide with glyphosate resistance activity, comprising culturing the host cell of claim 6 under conditions in which a nucleic acid molecule encoding the polypeptide is expressed.
15. A method for conferring resistance to glyphosate in a plant, said method comprising transforming said plant with a DNA construct, said construct comprising a promoter that drives expression in a plant cell operably linked with a nucleotide sequence at least 95% identical to the nucleotide sequence of SEQ ID NO:3, 6, 11, 19, or 21, and regenerating a transformed plant, wherein said nucleotide sequence encodes a polypeptide that has glyphosate resistance and decarboxylase activity.
16. A plant having stably incorporated into its genome a DNA construct comprising a nucleotide sequence that encodes a protein having glyphosate resistance activity, wherein said nucleotide sequence is selected from the group consisting of:a) the nucleotide sequence of SEQ ID NO:1, 2, 4, 5, 9, 10, 18, or 20;b) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:3, 6, 11, 19, or 21; andc) a nucleotide sequence encoding a polypeptide having at least 95% amino acid sequence identity to the amino acid sequence of SEQ ID NO:3, 6, 11, 19, or 21, wherein said polypeptide has glyphosate resistance and decarboxylase activity; wherein said nucleotide sequence is operably linked to a promoter that drives expression of a coding sequence in a plant cell.
17. A plant cell having stably incorporated into its genome a DNA construct comprising a nucleotide sequence that encodes a protein having herbicide resistance activity, wherein said nucleotide sequence is selected from the group consisting of:a) the nucleotide sequence of SEQ ID NO:1, 2, 4, 5, 9, 10, 18, or 20;b) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:3, 6, 11, 19, or 21; andc) a nucleotide sequence encoding a polypeptide having at least 95% amino acid sequence identity to the amino acid sequence of SEQ ID NO:3, 6, 11, 19, or 21, wherein said polypeptide has glyphosate resistance and decarboxylase activity; wherein said nucleotide sequence is operably linked to a promoter that drives expression of a coding sequence in a plant cell.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001]This application is a continuation of copending U.S. patent application Ser. No. 11/185,342, filed Jul. 20, 2005, which is a continuation-in-part of U.S. patent application Ser. No. 10/796,953, filed Mar. 10, 2004, now abandoned, which claims the benefit of U.S. Provisional Application Ser. No. 60/453,237, filed Mar. 10, 2003, each of which is hereby incorporated in its entirety by reference herein.
REFERENCE TO SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS-WEB
[0002]The official copy of the sequence listing is submitted concurrently with the specification as an ASCII formatted text file via EFS-Web, with a file name of "367460_SequenceListing.txt", a creation date of Jan. 31, 2009, and a size of 96 kilobytes. The sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
FIELD OF THE INVENTION
[0003]This invention provides novel genes encoding herbicide resistance, which are useful in plant biology, crop breeding, and plant cell culture.
BACKGROUND OF THE INVENTION
[0004]N-phosphonomethylglycine, commonly referred to as glyphosate, is an important agronomic chemical. Glyphosate inhibits the enzyme that converts phosphoenolpyruvic acid (PEP) and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid. Inhibition of this enzyme (5-enolpyruvylshikimate-3-phosphate synthase; referred to herein as "EPSP synthase") kills plant cells by shutting down the shikimate pathway, thereby inhibiting aromatic acid biosynthesis.
[0005]Since glyphosate-class herbicides inhibit aromatic amino acid biosynthesis, they not only kill plant cells, but are also toxic to bacterial cells. Glyphosate inhibits many bacterial EPSP synthases, and thus is toxic to these bacteria. However, certain bacterial EPSP synthases may have a high tolerance to glyphosate.
[0006]Plant cells resistant to glyphosate toxicity can be produced by transforming plant cells to express glyphosate-resistant EPSP synthases. A mutated EPSP synthase from Salmonella typhimurium strain CT7 confers glyphosate resistance in bacterial cells, and confers glyphosate resistance on plant cells (U.S. Pat. Nos. 4,535,060, 4,769,061, and 5,094,945). Thus, there is a precedent for use of glyphosate-resistant bacterial EPSP synthases to confer glyphosate resistance upon plant cells.
[0007]An alternative method to generate target genes resistant to a toxin (such as an herbicide) is to identify and develop enzymes that result in detoxification of the toxin to an inactive or less active form. This can be accomplished by identifying enzymes that encode resistance to the toxin in a toxin-sensitive test organism, such as a bacterium.
[0008]Castle et al (WO 02/36782 A2) describe proteins (glyphosate N-acetyltransferases) that are described as modifying glyphosate by acetylation of a secondary amine to yield N-acetylglyphosate.
[0009]Barry et al (U.S. Pat. No. 5,463,175) describes genes encoding an oxidoreductase (GOX), and states that GOX proteins degrade glyphosate by removing the phosphonate residue to yield amino methyl phosphonic acid (AMPA). This suggests that glyphosate resistance can also be conferred, at least partially, by removal of the phosphonate group from glyphosate. However, the resulting compound (AMPA) appears to provide reduced but measurable toxicity upon plant cells. Barry describes the effect of AMPA accumulation on plant cells as resulting in effects including chlorosis of leaves, infertility, stunted growth, and death. Barry (U.S. Pat. No. 6,448,476) describes plant cells expressing an AMPA-N-acetyltransferase (phnO) to detoxify AMPA.
[0010]Phosphonates, such as glyphosate, can also be degraded by cleavage of C--P bond by a C--P lyase. Wacket et al. (1987) J. Bacteriol. 169:710-717 described strains that utilize glyphosate as a sole phosphate source. Kishore et al. (1987) J. Biol. Chem. 262:12164-12168 and Shinabarger et al. (1986) J. Bacteriol. 168:702-707 describe degradation of glyphosate by C--P Lyase to yield glycine and inorganic phosphate.
[0011]While several strategies are available for detoxification of toxins, such as the herbicide glyphosate, as described above, new activities capable of degrading glyphosate are useful. Novel genes and genes conferring glyphosate resistance by novel mechanisms of action would be of additional usefulness. Single genes conferring glyphosate resistance by formation of non-toxic products would be especially useful.
[0012]Thus, novel genes encoding resistance to herbicides are needed.
SUMMARY OF INVENTION
[0013]Compositions and methods for conferring herbicide resistance to plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a polypeptide that confers resistance or tolerance to glyphosate herbicides are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants. Compositions also comprise transformed plants, plant cells, tissues, and seeds.
[0014]In particular, isolated nucleic acid molecules corresponding to glyphosate resistance-conferring nucleic acid sequences are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding an amino acid sequence shown in SEQ ID NO:3, 6, 8, 11, 19, or 21, or a nucleotide sequence set forth in SEQ ID NO:1, 2, 4, 5, 7, 9, 10, 18, or 20, as well as variants and fragments thereof. Nucleotide sequences that are complementary to a nucleotide sequence of the invention, or that hybridize to a sequence of the invention are also encompassed.
DESCRIPTION OF FIGURES
[0015]FIG. 1 is a diagram that shows GDC-1 (full), GDC-1 (23), GDC-1 (35), GDC-1 (59), and GDC-1 (35H3mut), as well as the location of the TPP binding domains and the location (X) of a mutation.
[0016]FIG. 2 shows an alignment of the predicted proteins resulting from translation of the clones GDC-1 (full) (SEQ ID NO:19), GDC-1 (23) (SEQ ID NO:6), GDC-1 (35) (SEQ ID NO:8), and GDC-1 (59) (SEQ ID NO:11).
[0017]FIG. 3 shows an alignment of GDC-1 protein (SEQ ID NO:19) to pyruvate decarboxylase of Saccharomyces cerevesiae (SEQ ID NO:13), a putative indole-3-pyruvate decarboxylase from Salmonella typhimurium (SEQ ID NO:14), pyruvate decarboxylase (EC 4.1.1.1) from Zymomonas mobilis (SEQ ID NO:15), acetolactate synthase from Saccharomyces cerevesiae (SEQ ID NO:16), and acetolactate synthase from Magnaporthe grisea (SEQ ID NO:17). The alignment shows the most highly conserved amino acid residues highlighted in black, and highly conserved amino acid residues highlighted in gray.
DETAILED DESCRIPTION
[0018]The present invention is drawn to compositions and methods for regulating resistance in organisms, particularly in plants or plant cells. The methods involve transforming organisms with nucleotide sequences encoding a glyphosate resistance protein of the invention. In particular, the nucleotide sequences of the invention are useful for preparing plants that show increased tolerance to the herbicide glyphosate. Thus, transformed plants, plant cells, plant tissues and seeds are provided. Compositions include nucleic acids and proteins relating to glyphosate tolerance in plants as well as transformed plants, plant tissues and seeds. More particularly, nucleotide sequences encoding all or part of the "glyphosate resistance-conferring decarboxylase" gene GDC-1 and the amino acid sequences of the proteins encoded thereby are disclosed. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other glyphosate resistance genes, as selectable markers, and the like.
DEFINITIONS
[0019]"Glyphosate" includes any herbicidal form of N-phosphonomethylglycine (including any salt thereof) and other forms that result in the production of the glyphosate anion in planta.
[0020]"Glyphosate (or herbicide) resistance-conferring decarboxylase" or "GDC" includes a DNA segment that encodes all or part of a glyphosate (or herbicide) resistance protein. This includes DNA segments that are capable of expressing a protein that confers glyphosate (herbicide) resistance to a cell.
[0021]An "herbicide resistance protein" or a protein resulting from expression of an "herbicide resistance-encoding nucleic acid molecule" includes proteins that confer upon a cell the ability to tolerate a higher concentration of an herbicide than cells that do not express the protein, or to tolerate a certain concentration of an herbicide for a longer time than cells that do not express the protein.
[0022]A "glyphosate resistance protein" includes a protein that confers upon a cell the ability to tolerate a higher concentration of glyphosate than cells that do not express the protein, or to tolerate a certain concentration of glyphosate for a longer time than cells that do not express the protein. By "tolerate" or "tolerance" is intended either to survive, or to carry out essential cellular functions, such as protein synthesis and respiration, in a manner that is not readily discernable from untreated cells.
[0023]By "decarboxylase" is intended a protein, or a gene encoding a protein, whose catalytic mechanism can include cleavage and release of a carboxylic acid. This includes enzymes that liberate CO2, such as pyruvate decarboxlyases, acetolactate synthases, and orthinine decarboxylases, as well as enzymes that liberate larger carboxylic acids. "Decarboxylase" includes proteins that utilize thiamine pyrophoshate as a cofactor in enzymatic catalysis. Many such decarbolyases also utilize other cofactors, such as FAD.
[0024]By "TPP-binding domain" is intended a region of conserved amino acids present in enzymes that are capable of utilizing TPP as a cofactor.
[0025]"Plant tissue" includes all known forms of plants, including undifferentiated tissue (e.g. callus), suspension culture cells, protoplasts, plant cells including leaf cells, root cells and phloem cells, plant seeds, pollen, propagules, embryos and the like.
[0026]"Plant expression cassette" includes DNA constructs that are capable of resulting in the expression of a protein from an open reading frame in a plant cell. Typically these contain a promoter and a coding sequence. Often, such constructs will also contain a 3' untranslated region. Such constructs may contain a `signal sequence` or `leader sequence` to facilitate co-translational or post-translational transport of the peptide to certain intracellular structures such as the chloroplast (or other plastid), endoplasmic reticulum, or Golgi apparatus.
[0027]"Signal sequence" includes sequences that are known or suspected to result in cotranslational or post-translational peptide transport across the cell membrane. In eukaryotes, this typically involves secretion into the Golgi apparatus, with some resulting glycosylation.
[0028]"Leader sequence" includes any sequence that when translated, results in an amino acid sequence sufficient to trigger co-translational transport of the peptide chain to a sub-cellular organelle. Thus, this includes leader sequences targeting transport and/or glycosylation by passage into the endoplasmic reticulum, passage to vacuoles, plastids including chloroplasts, mitochondria, and the like.
[0029]"Plant transformation vector" includes DNA molecules that are necessary for efficient transformation of a plant cell. Such a molecule may consist of one or more plant expression cassettes, and may be organized into more than one `vector` DNA molecule. For example, binary vectors are plant transformation vectors that utilize two non-contiguous DNA vectors to encode all requisite cis- and trans-acting functions for transformation of plant cells (Hellens and Mullineaux (2000) Trends in Plant Science 5:446-451).
[0030]"Vector" refers to a nucleic acid construct designed for transfer between different host cells. "Expression vector" refers to a vector that has the ability to incorporate, integrate and express heterologous DNA sequences or fragments in a foreign cell.
[0031]"Transgenic plants" or "transformed plants" or "stably transformed plants or cells or tissues" refers to plants that have incorporated or integrated exogenous or endogenous nucleic acid sequences or DNA fragments or chimeric nucleic acid sequences or fragments.
[0032]"Heterologous" generally refers to the nucleic acid sequences that are not endogenous to the cell or part of the native genome in which they are present, and have been added to the cell by infection, transfection, microinjection, electroporation, microprojection, or the like.
[0033]"Promoter" refers to a nucleic acid sequence that functions to direct transcription of a downstream coding sequence. The promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed "control sequences") are necessary for the expression of a DNA sequence of interest.
[0034]Provided here is a novel isolated gene that confers resistance to glyphosate. Also provided are amino acid sequences of the GDC-1 protein. The protein resulting from translation of this gene allows cells to function in the presence of concentrations of glyphosate that are otherwise toxic to cells, including plant cells and bacterial cells.
[0035]An "isolated" or "purified" nucleic acid molecule or protein, or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Preferably, an "isolated" nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For purposes of the invention, "isolated" when used to refer to nucleic acid molecules excludes isolated chromosomes. For example, in various embodiments, the isolated glyphosate resistance-encoding nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flanks the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. A glyphosate resistance protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, or 5% (by dry weight) of non-glyphosate resistance protein (also referred to herein as a "contaminating protein"). Various aspects of the invention are described in further detail in the following subsections.
Isolated Nucleic Acid Molecules, and Variants and Fragments Thereof
[0036]One aspect of the invention pertains to isolated nucleic acid molecules comprising nucleotide sequences encoding glyphosate resistance proteins and polypeptides or biologically active portions thereof, as well as nucleic acid molecules sufficient for use as hybridization probes to identify glyphosate resistance-encoding nucleic acids. As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.
[0037]Nucleotide sequences encoding the proteins of the present invention include the sequences set forth in SEQ ID NOS:1, 2, 18, and 20, and complements thereof. By "complement" is intended a nucleotide sequence that is sufficiently complementary to a given nucleotide sequence such that it can hybridize to the given nucleotide sequence to thereby form a stable duplex. The corresponding amino acid sequences for the glyphosate resistance proteins encoded by the nucleotide sequences are set forth in SEQ ID NOS:3, 19, and 21. The invention also encompasses nucleic acid molecules comprising nucleotide sequences encoding partial-length glyphosate resistance proteins, including the sequences set forth in SEQ ID NOS:4, 5, 7, 9, and 10, and complements thereof. The corresponding amino acid sequences for the glyphosate resistance proteins encoded by these partial-length nucleotide sequences are set forth in SEQ ID NOS:6, 8, and 11.
[0038]Nucleic acid molecules that are fragments of these glyphosate resistance-encoding nucleotide sequences are also encompassed by the present invention. By "fragment" is intended a portion of the nucleotide sequence encoding a glyphosate resistance protein. A fragment of a nucleotide sequence may encode a biologically active portion of a glyphosate resistance protein, or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. Nucleic acid molecules that are fragments of a glyphosate resistance nucleotide sequence comprise at least about 15, 20, 50, 75, 100, 200, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200 nucleotides, or up to the number of nucleotides present in a full-length glyphosate resistance-encoding nucleotide sequence disclosed herein (for example, 2210 nucleotides for SEQ ID NO:1) depending upon the intended use.
[0039]Fragments of the nucleotide sequences of the present invention generally will encode protein fragments that retain the biological activity of the full-length glyphosate resistance protein; i.e., glyphosate resistance activity. By "retains glyphosate resistance activity" is intended that the fragment will have at least about 30%, preferably at least about 50%, more preferably at least about 70%, even more preferably at least about 80% of the glyphosate resistance activity of the full-length glyphosate resistance protein disclosed herein as SEQ ID NO:19. Methods for measuring glyphosate resistance activity are well known in the art. See, for example, U.S. Pat. Nos. 4,535,060, and 5,188,642, each of which are herein incorporated by reference in their entirety.
[0040]A fragment of a glyphosate resistance-encoding nucleotide sequence that encodes a biologically active portion of a protein of the invention will encode at least about 15, 25, 30, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, or 550 contiguous amino acids, or up to the total number of amino acids present in a full-length glyphosate resistance protein of the invention (for example, 575 amino acids for SEQ ID NO:3).
[0041]Preferred glyphosate resistance proteins of the present invention are encoded by a nucleotide sequence sufficiently identical to the nucleotide sequence of SEQ ID NO:1, 2, 4, 5, 7, 9, 10, 18, or 20. The term "sufficiently identical is intended an amino acid or nucleotide sequence that has at least about 60% or 65% sequence identity, preferably about 70% or 75% sequence identity, more preferably about 80% or 85% sequence identity, most preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity compared to a reference sequence using one of the alignment programs described herein using standard parameters. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like.
[0042]To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity=number of identical positions/total number of positions (e.g., overlapping positions)×100). In one embodiment, the two sequences are the same length. The percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.
[0043]The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A nonlimiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12, to obtain nucleotide sequences homologous to GDC-like nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTX program, score=50, wordlength=3, to obtain amino acid sequences homologous to glyphosate resistance protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., BLASTX and BLASTN) can be used. See www.ncbi.nlm.nih.gov. Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the ClustalW algorithm (Higgins et al. (1994) Nucleic Acids Res. 22:4673-4680). ClustalW compares sequences and aligns the entirety of the amino acid or DNA sequence, and thus can provide data about the sequence conservation of the entire amino acid sequence. The ClustalW algorithm is used in several commercially available DNA/amino acid analysis software packages, such as the ALIGNX module of the vector NTi Program Suite (Informax, Inc). After alignment of amino acid sequences with ClustalW, the percent amino acid identity can be assessed. A non-limiting example of a software program useful for analysis of ClustalW alignments is GeneDoc®. Genedoc® (Karl Nicholas) allows assessment of amino acid (or DNA) similarity and identity between multiple proteins. Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (1988) CABIOS 4:11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package (available from Accelrys, Inc., 9865 Scranton Rd., San Diego, Calif., USA). When utilizing the ALIGN program for comparing amino acid sequences, a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
[0044]A preferred program is GAP version 10, which used the algorithm of Needleman and Wunsch (1970) supra. GAP Version 10 may be used with the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 Scoring Matrix. Equivalent programs may also be used. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
[0045]The invention also encompasses variant nucleic acid molecules. "Variants" of the glyphosate resistance-encoding nucleotide sequences include those sequences that encode the glyphosate resistance proteins disclosed herein but that differ conservatively because of the degeneracy of the genetic code, as well as those that are sufficiently identical as discussed above. Naturally occurring allelic variants can be identified with the use of well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant nucleotide sequences also include synthetically derived nucleotide sequences that have been generated, for example, by using site-directed mutagenesis but which still encode the glyphosate resistance proteins disclosed in the present invention as discussed below. Variant proteins encompassed by the present invention are biologically active, that is they retain the desired biological activity of the native protein, that is, glyphosate resistance activity. By "retains glyphosate resistance activity" is intended that the variant will have at least about 30%, preferably at least about 50%, more preferably at least about 70%, even more preferably at least about 80% of the glyphosate resistance activity of the native protein. Methods for measuring glyphosate resistance activity are well known in the art. See, for example, U.S. Pat. Nos. 4,535,060, and 5,188,642, each of which are herein incorporated by reference in their entirety.
[0046]The skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequences of the invention thereby leading to changes in the amino acid sequence of the encoded glyphosate resistance proteins, without altering the biological activity of the proteins. Thus, variant isolated nucleic acid molecules can be created by introducing one or more nucleotide substitutions, additions, or deletions into the corresponding nucleotide sequence disclosed herein, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Such variant nucleotide sequences are also encompassed by the present invention.
[0047]For example, conservative amino acid substitutions may be made at one or more predicted, preferably nonessential amino acid residues. A "nonessential" amino acid residue is a residue that can be altered from the wild-type sequence of a glyphosate resistance protein without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Amino acid substitutions may be made in nonconserved regions that retain function. In general, such substitutions would not be made for conserved amino acid residues, or for amino acid residues residing within a conserved motif, where such residues are essential for protein activity. Examples of residues that are conserved and that may be essential for protein activity include, for example, residues that are identical between all proteins contained in the alignment of FIG. 3. However, one of skill in the art would understand that functional variants may have minor conserved or nonconserved alterations in the conserved residues.
[0048]Alternatively, variant nucleotide sequences can be made by introducing mutations randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for ability to confer glyphosate resistance activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly, and the activity of the protein can be determined using standard assay techniques.
[0049]Using methods such as PCR, hybridization, and the like corresponding glyphosate resistance sequences can be identified, such sequences having substantial identity to the sequences of the invention. See, for example, Sambrook J., and Russell, D. W. (2001) Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) and Innis, et al. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, NY).
[0050]In a hybridization method, all or part of the glyphosate resistance nucleotide sequence can be used to screen cDNA or genomic libraries. Methods for construction of such cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook and Russell, 2001. The so-called hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P, or any other detectable marker, such as other radioisotopes, a fluorescent compound, an enzyme, or an enzyme co-factor. Probes for hybridization can be made by labeling synthetic oligonucleotides based on the known glyphosate resistance-encoding nucleotide sequence disclosed herein. Degenerate primers designed on the basis of conserved nucleotides or amino acid residues in the nucleotide sequence or encoded amino acid sequence can additionally be used. The probe typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably at least about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, or 400 consecutive nucleotides of glyphosate resistance-encoding nucleotide sequence of the invention or a fragment or variant thereof. Preparation of Probes for Hybridization is Generally Known in the Art and is Disclosed in Sambrook and Russell, 2001 and Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.), both of which are herein incorporated by reference.
[0051]For example, an entire glyphosate resistance sequence disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding glyphosate resistance sequences and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique and are preferably at least about 10 nucleotides in length, and most preferably at least about 20 nucleotides in length. Such probes may be used to amplify corresponding glyphosate resistance sequences from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
[0052]Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent hybridization conditions" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.
[0053]Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
[0054]Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm=81.5° C.+16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≧90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 110° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
Isolated Proteins and Variants and Fragments Thereof
[0055]Glyphosate resistance proteins are also encompassed within the present invention. By "glyphosate resistance protein" is intended a protein having the amino acid sequence set forth in SEQ ID NO:3, 19, or 21. Fragments, biologically active portions, and variants thereof are also provided, and may be used to practice the methods of the present invention.
[0056]"Fragments" or "biologically active portions" include polypeptide fragments comprising a portion of an amino acid sequence encoding a glyphosate resistance protein as set forth in SEQ ID NO:3, 19, or 21, and that retains glyphosate resistance activity. A biologically active portion of a glyphosate resistance protein can be a polypeptide that is, for example, 10, 25, 50, 100 or more amino acids in length. Such biologically active portions can be prepared by recombinant techniques and evaluated for glyphosate resistance activity. Methods for measuring glyphosate resistance activity are well known in the art. See, for example, U.S. Pat. Nos. 4,535,060, and 5,188,642, each of which are herein incorporated by reference in their entirety. As used here, a fragment comprises at least 8 contiguous amino acids of SEQ ID NO:3, 19, or 21. The invention encompasses other fragments, however, such as any fragment in the protein greater than about 10, 20, 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 amino acids.
[0057]By "variants" is intended proteins or polypeptides having an amino acid sequence that is at least about 60%, 65%, preferably about 70%, 75%, more preferably, 80%, 85%, most preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO:3, 6, 8, 11, 19, or 21. Variants also include polypeptides encoded by a nucleic acid molecule that hybridizes to the nucleic acid molecule of SEQ ID NO:1, 2, 4, 5, 7, 9, 10, 18, or 21, or a complement thereof, under stringent conditions. Variants include polypeptides that differ in amino acid sequence due to mutagenesis. Variant proteins encompassed by the present invention are biologically active, that is they continue to possess the desired biological activity of the native protein, that is, retaining glyphosate resistance activity. Methods for measuring glyphosate resistance activity are well known in the art. See, for example, U.S. Pat. Nos. 4,535,060, and 5,188,642, each of which are herein incorporated by reference in their entirety.
Altered or Improved Variants
[0058]It is recognized that DNA sequences of GDC-1 may be altered by various methods, and that these alterations may result in DNA sequences encoding proteins with amino acid sequences different than that encoded by GDC-1. This protein may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the GDC-1 protein can be prepared by mutations in the DNA. This may also be accomplished by one of several forms of mutagenesis and/or in directed evolution. In some aspects, the changes encoded in the amino acid sequence will not substantially affect the function of the protein. Such variants will possess the desired glyphosate resistance activity. However, it is understood that the ability of GDC-1 to confer glyphosate resistance may be improved by the use of such techniques upon the compositions of this invention. For example, one may express GDC-1 in host cells that exhibit high rates of base misincorporation during DNA replication, such as XL-1 Red (Stratagene). After propagation in such strains, one can isolate the GDC-1 DNA (for example by preparing plasmid DNA, or by amplifying by PCR and cloning the resulting PCR fragment into a vector), culture the GDC-1 mutations in a non-mutagenic strain, and identify mutated GDC-1 genes with improved resistance to glyphosate, for example by growing cells in increasing concentrations of glyphosate and testing for clones that confer ability to tolerate increased concentrations of glyphosate.
[0059]Alternatively, alterations may be made to the protein sequence of many proteins at the amino or carboxy terminus without substantially affecting activity. This can include insertions, deletions, or alterations introduced by modern molecular methods, such as PCR, including PCR amplifications that alter or extend the protein coding sequence by virtue of inclusion of amino acid encoding sequences in the oligonucleotides utilized in the PCR amplification. Alternatively, the protein sequences added can include entire protein-coding sequences, such as those used commonly in the art to generate protein fusions. Such fusion proteins are often used to (1) increase expression of a protein of interest (2) introduce a binding domain, enzymatic activity, or epitope to facilitate either protein purification, protein detection, or other experimental uses known in the art (3) target secretion or translation of a protein to a subcellular organelle, such as the periplasmic space of Gram-negative bacteria, or the endoplasmic reticulum of eukaryotic cells, the latter of which often results in glycosylation of the protein.
[0060]Variant nucleotide and amino acid sequences of the present invention also encompass sequences derived from mutagenic and recombinogenic procedures such as DNA shuffling. With such a procedure, one or more different glyphosate resistance protein coding regions can be used to create a new glyphosate resistance protein possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shuffled between the glyphosate resistance gene of the invention and other known glyphosate resistance genes to obtain a new gene coding for a protein with an improved property of interest, such as an increased glyphosate resistance activity. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391:288-291; and U.S. Pat. Nos. 5,605,793 and 5,837,458.
Transformation of Bacterial or Plant Cells
[0061]In one aspect of the invention, the GDC-1 gene is useful as a marker to assess transformation of bacterial or plant cells. Transformation of bacterial cells is accomplished by one of several techniques known in the art, not limited to electroporation, or chemical transformation (See for example Ausubel (ed.), Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (1994)). Markers conferring resistance to toxic substances are useful in identifying transformed cells (having taken up and expressed the test DNA) from non-transformed cells (those not containing or not expressing the test DNA). By engineering GDC-1 to be (1) expressed from a bacterial promoter known to stimulate transcription in the organism to be tested, (2) properly translated to generate an intact GDC-1 peptide, and (3) placing the cells in an otherwise toxic concentration of glyphosate, one can identify cells that have been transformed with DNA by virtue of their resistance to glyphosate.
[0062]Transformation of plant cells can be accomplished in similar fashion. First, one engineers the GDC-1 gene in a way that allows its expression in plant cells. The glyphosate resistance sequences of the invention may be provided in expression cassettes for expression in the plant of interest. The cassette will include 5' and 3' regulatory sequences operably linked to a sequence of the invention. By "operably linked" is intended a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. The organization of such constructs is well known in the art.
[0063]Such an expression cassette is provided with a plurality of restriction sites for insertion of the glyphosate resistance sequence to be under the transcriptional regulation of the regulatory regions. The expression cassette will include in the 5'-3' direction of transcription, a transcriptional and translational initiation region (i.e., a promoter), a DNA sequence of the invention, and a transcriptional and translational termination region (i.e., termination region) functional in plants. The promoter may be native or analogous, or foreign or heterologous, to the plant host and/or to the DNA sequence of the invention. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. Where the promoter is "native" or "homologous" to the plant host, it is intended that the promoter is found in the native plant into which the promoter is introduced. Where the promoter is "foreign" or "heterologous" to the DNA sequence of the invention, it is intended that the promoter is not the native or naturally occurring promoter for the operably linked DNA sequence of the invention.
[0064]The termination region may be native with the transcriptional initiation region, may be native with the operably-linked DNA sequence of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous to the promoter, the DNA sequence of interest, the plant host, or any combination thereof). Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acid Res. 15:9627-9639.
[0065]Where appropriate, the gene(s) may be optimized for increased expression in the transformed host cell. That is, the genes can be synthesized using host cell-preferred codons for improved expression, or may be synthesized using codons at a host-preferred codon usage frequency. Generally, the GC content of the gene will be increased. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage. Methods are known in the art for synthesizing host-preferred genes. See, for example, U.S. Pat. Nos. 6,320,100; 6,075,185; 5,380,831; and 5,436,391, U.S. Published Application Nos. 20040005600 and 20010003849, and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.
[0066]In some instances, it may be useful to engineer the gene such that the resulting peptide is secreted, or otherwise targeted within the plant cell. For example, the gene can be engineered to contain a signal peptide to facilitate transfer of the peptide to the endoplasmic reticulum. It may also be preferable to engineer the plant expression cassette to contain an intron, such that mRNA processing of the intron is required for expression. In one embodiment, the nucleic acids of interest are targeted to the chloroplast for expression. In this manner, where the nucleic acid of interest is not directly inserted into the chloroplast, the expression cassette will additionally contain a nucleic acid encoding a transit peptide to direct the gene product of interest to the chloroplasts. Such transit peptides are known in the art. See, for example, Von Heijne et al. (1991) Plant Mol. Biol. Rep. 9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550; Della-Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al. (1993) Biochem. Biophys. Res. Commun. 196:1414-1421; and Shah et al. (1986) Science 233:478-481.
[0067]Methods for transformation of chloroplasts are known in the art. See, for example, Svab et al. (1990) Proc. Natl. Acad. Sci. USA 87:8526-8530; Svab and Maliga (1993) Proc. Natl. Acad. Sci. USA 90:913-917; Svab and Maliga (1993) EMBO J. 12:601-606. The method relies on particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination. Additionally, plastid transformation can be accomplished by transactivation of a silent plastid-borne transgene by tissue-preferred expression of a nuclear-encoded and plastid-directed RNA polymerase. Such a system has been reported in McBride et al. (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.
[0068]The nucleic acids of interest to be targeted to the chloroplast may be optimized for expression in the chloroplast to account for differences in codon usage between the plant nucleus and this organelle. In this manner, the nucleic acids of interest may be synthesized using chloroplast-preferred codons. See, for example, U.S. Pat. No. 5,380,831, herein incorporated by reference.
[0069]Typically this `plant expression cassette` will be inserted into a `plant transformation vector`. This plant transformation vector may be comprised of one or more DNA vectors needed for achieving plant transformation. For example, it is a common practice in the art to utilize plant transformation vectors that are comprised of more than one contiguous DNA segment. These vectors are often referred to in the art as `binary vectors`. Binary vectors as well as vectors with helper plasmids are most often used for Agrobacterium-mediated transformation, where the size and complexity of DNA segments needed to achieve efficient transformation is quite large, and it is advantageous to separate functions onto separate DNA molecules. Binary vectors typically contain a plasmid vector that contains the cis-acting sequences required for T-DNA transfer (such as left border and right border), a selectable marker that is engineered to be capable of expression in a plant cell, and a `gene of interest` (a gene engineered to be capable of expression in a plant cell for which generation of transgenic plants is desired). Also present on this plasmid vector are sequences required for bacterial replication. The cis-acting sequences are arranged in a fashion to allow efficient transfer into plant cells and expression therein. For example, the selectable marker gene and the gene of interest are located between the left and right borders. Often a second plasmid vector contains the trans-acting factors that mediate T-DNA transfer from Agrobacterium to plant cells. This plasmid often contains the virulence functions (Vir genes) that allow infection of plant cells by Agrobacterium, and transfer of DNA by cleavage at border sequences and vir-mediated DNA transfer, as in understood in the art (Hellens and Mullineaux (2000) Trends in Plant Science 5:446-451). Several types of Agrobacterium strains (e.g. LBA4404, GV3101, EHA101, EHA105, etc.) can be used for plant transformation. The second plasmid vector is not necessary for transforming the plants by other methods such as microprojection, microinjection, electroporation, polyethelene glycol, etc. Many types of vectors can be used to transform plant cells for achieving glyphosate resistance.
[0070]In general, plant transformation methods involve transferring heterologous DNA into target plant cells (e.g. immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.), followed by applying a maximum threshold level of appropropriate selection (depending on the selectable marker gene and in this case "glyphosate") to recover the transformed plant cells from a group of untransformed cell mass. Explants are typically transferred to a fresh supply of the same medium and cultured routinely. Subsequently, the transformed cells are differentiated into shoots after placing on regeneration medium supplemented with a maximum threshold level of selecting agent (e.g. "glyphosate"). The shoots are then transferred to a selective rooting medium for recovering rooted shoot or plantlet. The transgenic plantlet then grow into mature plant and produce fertile seeds (e.g. Hiei et al. (1994) The Plant Journal 6:271-282; Ishida et al. (1996) Nature Biotechnology 14:745-750). Explants are typically transferred to a fresh supply of the same medium and cultured routinely. A general description of the techniques and methods for generating transgenic plants are found in Ayres and Park (1994) Critical Reviews in Plant Science 13:219-239 and Bommineni and Jauhar (1997) Maydica 42:107-120. Since the transformed material contains many cells; both transformed and non-transformed cells are present in any piece of subjected target callus or tissue or group of cells. The ability to kill non-transformed cells and allow transformed cells to proliferate results in transformed plant cultures. Often, the ability to remove non-transformed cells is a limitation to rapid recovery of transformed plant cells and successful generation of transgenic plants.
[0071]Generation of transgenic plants may be performed by one of several methods, including but not limited to introduction of heterologous DNA by Agrobacterium into plant cells (Agrobacterium-mediated transformation). Bombardment of plant cells with heterologous foreign DNA adhered to particles including aerosol beam transformation (U.S. Published Application No. 20010026941; U.S. Pat. No. 4,945,050; International Publication No. WO 91/00915; U.S. Published Application No. 2002015066), and various other non-particle direct-mediated methods (e.g. Hiei et al. (1994) The Plant Journal 6:271-282; Ishida et al. (1996) Nature Biotechnology 14:745-750; Ayres and Park (1994) Critical Reviews in Plant Science 13:219-239; Bommineni and Jauhar (1997) Maydica 42:107-120) to transfer DNA.
[0072]Following integration of heterologous foreign DNA into plant cells, one then applies a maximum threshold level of glyphosate in the medium to kill the untransformed cells and separate and proliferate the putatively transformed cells that survive from this selection treatment by transferring regularly to a fresh medium. By continuous passage and challenge with glyphosate, one identifies and proliferates the cells that are transformed with the plasmid vector. Then molecular and biochemical methods will be used for confirming the presence of the integrated heterologous gene of interest in the genome of transgenic plant.
[0073]The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as "transgenic seed") having a nucleotide construct of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.
Evaluation of Plant Transformation
[0074]Following introduction of heterologous foreign DNA into plant cells, the transformation or integration of heterologous gene in the plant genome is confirmed by various methods such as analysis of nucleic acids, proteins and metabolites associated with the integrated gene.
PCR Analysis: PCR analysis is a rapid method to screen transformed cells, tissue or shoots for the presence of incorporated gene at the earlier stage before transplanting into the soil (Sambrook and Russell, 2001). PCR is carried out using oligonucleotide primers specific to the gene of interest or Agrobacterium vector background, etc.Southern Analysis Plant transformation is confirmed by Southern blot analysis of genomic DNA (Sambrook and Russell, 2001). In general, total DNA is extracted from the transformant, digested with appropriate restriction enzymes, fractionated in an agarose gel and transferred to a nitrocellulose or nylon membrane. The membrane or "blot" then is probed with, for example, radiolabeled 32P target DNA fragment to confirm the integration of introduced gene in the plant genome according to standard techniques (Sambrook and Russell, 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.Northern Analysis: RNA is isolated from specific tissues of transformant, fractionated in a formaldehyde agarose gel, blotted onto a nylon filter according to standard procedures that are routinely used in the art (Sambrook, J., and Russell, D. W. 2001. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Expression of RNA encoded by GDC-1 is then tested by hybridizing the filter to a radioactive probe derived from a GDC, by methods known in the art (Sambrook and Russell, 2001)Western blot and Biochemical assays: Western blot and biochemical assays and the like may be carried out on the transgenic plants to determine the presence of protein encoded by the glyphosate resistance gene by standard procedures (Sambrook, J., and Russell, D. W. 2001. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) using antibodies that bind to one or more epitopes present on the glyphosate resistance protein.
Transgenic Plants
[0075]In another aspect of the invention, one may generate transgenic plants expressing GDC-1 that are more resistant to high concentrations of glyphosate than non-transformed plants. Methods described above by way of example may be utilized to generate transgenic plants, but the manner in which the transgenic plant cells are generated is not critical to this invention. Methods known or described in the art such as Agrobacterium-mediated transformation, biolistic transformation, and non-particle-mediated methods may be used at the discretion of the experimenter. Plants expressing GDC-1 may be isolated by common methods described in the art, for example by transformation of callus, selection of transformed callus, and regeneration of fertile plants from such transgenic callus. In such process, GDC-1 may be used as selectable marker. Alternatively, one may use any gene as a selectable marker so long as its expression in plant cells confers ability to identify or select for transformed cells. Genes known to function effectively as selectable markers in plant transformation are well known in the art.
[0076]The following examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
Example 1
Isolation of ATX6394
[0077]Glyphosate-resistant fungi were isolated by plating samples of soil on Enriched Minimal Media (EMM) containing glyphosate as the sole source of phosphorus. Since EMM contains no aromatic amino acids, a strain must be resistant to glyphosate in order to grow on this media.
[0078]Two grams of soil was suspended in approximately 30 ml of water, and sonicated for 30 seconds in an Aquasonic sonicator water bath. The sample was vortexed for 5 seconds and permitted to settle for 60 seconds. This process was repeated 3 times. 100 μl of this suspension was added to 2 ml of Enriched Minimal Media II (EMM II) supplemented with 4 mM glyphosate (pH 6.0) EMMII contains Solution A (In 900 mls: 10 g sucrose (or other carbon source), 2 g NaNO3, 1.0 ml 0.8 M MgSO4, 1.0 ml 0.1 M CaCl2, 1.0 ml Trace Elements Solution (In 100 ml of 1000× solution: 0.1 g FeSO4.7H2O, 0.5 mg CuSO4.5H2O, 1.0 mg H3BO3, 1.0 mg MnSO4.5H2O, 7.0 mg ZnSO4.7H2O, 1.0 mg MoO3, 4.0 g KCl)) and Solution B (In 100 mls: 0.21 g Na2HPO4, 0.09 g NaH2PO4, pH 7.0). The culture was shaken on a tissue culture roller drum for eight days at 21° C. and then transferred into 2 ml of fresh EMMII containing 4 mM glyphosate as the only phosphorus source. After five days, the culture was plated onto solid media by streaking a 1 μl loop onto the surface of agar plate containing EMMII agar containing 5 mM glyphosate as the sole phosphorus source. The plate was sealed with parafilm and incubated until suitable growth was attained. Fresh plates were inoculated by agar plugs to isolate the fungus into pure culture.
[0079]One particular strain, designated ATX6394, was selected due to its ability to grow in the presence of high glyphosate concentrations.
Example 2
Construction of cDNA Library from Strain ATX6394
[0080]ATX6394 was grown in (liquid media L+phosphorous) containing 5 mM glyphosate, and total RNA was isolated using Trizol reagent (Invitrogen). poly(A)+ mRNA was isolated from total RNA using Poly(A) Purist mRNA Purification kit (Ambion). cDNA was synthesized from polyA+ mRNA using ZAP cDNA Synthesis kit from Stratagene, and cloned into the lambda Zap II expression vector (Stratagene).
Example 3
In Vivo Excision of cDNA Clones
[0081]The ATX6394 cDNA library was excised in bulk as per manufacturers protocol (Stratagene), transfected into the SOLR strain of E. coli (Stratagene), plated directly onto M9 minimal media plates containing thiamine, proline, ampicillin and 5 mM glyphosate and incubated at 37° C. (M9 media contains 30 g Na2HPO4, 15 g KH2PO4, 5 g NH4Cl, 2.5 g NaCl, and 15 mg CaCl2).
Example 4
Identification of cDNA Clones Conferring Glyphosate Resistance in E. coli
[0082]Following 2 days growth, 51 colonies had grown in the presence of 5 mM glyphosate, and these clones were selected for further study. Plasmid DNA from 48 of the 51 positive clones was isolated and transformed into the alternate host strain XL-1 Blue MRF' (Stratagene) and plasmid DNA was prepared for sequencing.
[0083]We determined the DNA sequence of 48 clones conferring glyphosate resistance (5 mM). Three clones (#23, 35, 59) were found to represent the same open reading frame. Therefore we designated this open reading frame GDC-1. The nucleotide sequences of clones #23, 35, and 59 are provided in SEQ ID NOS:4, 7, and 9 respectively.
Example 5
Isolation of Full-Length GDC-1 Construct (GDC-1 (Full))
[0084]Comparison of GDC-1 (29) GDC-1(35) and GDC-1 (59) suggested that these clones did not represent the entire cDNA for the GDC-1 mRNA. To generate a full length GDC-1 clone, we performed 5' RACE using the SMART RACE cDNA Amplification kit (BD Biosciences) to amplify the 5' end of the GDC-1 from ATX6394 poly(A)+ mRNA. Oligo [SMARTgrg3.rev 5'TCCCAGATGCCAAAGTTGGCTGTTCCAGTC 3']; SEQ ID NO:12 was derived from the sequence of GDC-1 (#35). We cut the resultant PCR product with HindIII and ligated this to the existing GDC-1(59) cDNA in pBluescript to generate the full length cDNA, referred to herein as GDC-1(full). The DNA sequence of GDC-1 (full) was determined, and found to contain a complete protein-coding region. This coding region is referred to herein as GDC-1. Amino acid sequences resulting from the translation of the GDC-1 gene are provided in SEQ ID NOS:3, 19, and 21.
[0085]GDC1(59) consists of amino acid residues 118 to 575 of GDC-1(full) (SEQ ID NO:19). GDC1(35) consists of amino acid residues 331 to 556 of GDC-1(full) (SEQ ID NO:19). GDC1(23) consists of amino acid residues 379 to 575 of GDC-1(full) (SEQ ID NO:19).
Example 6
Disruption of GDC-10RF Eliminates Glyphosate Resistance
[0086]To confirm that GDC-10RF is responsible for conferring glyphosate resistance, we engineered a mutant of GDC1(35), and tested its ability to confer glyphosate resistance. The GDC1(35) construct contains a single recognition site for HindIII restriction enzyme. GDC1(35) was digested with the restriction enzyme Hind III, and the resulting recessed 3' ends extended by incubating with T4 DNA polymerase and dNTPs, as known in the art (Sambrook). The resulting molecules were then religated using T4 DNA ligase (Maniatis). The religated molecules were identified by min-prep of transformed clones, and the DNA was sequenced. The resulting clone, GDC1(35-H3mut), contains a four nucleotide insertion in the GDC-1 open reading frame. This four nucleotide insertion leads to the premature termination of translation of the GDC1(35) protein at a premature stop codon at nucleotides 1451-1453 of GDC-1 full length sequence.
TABLE-US-00001 TABLE 1 Glyphosate resistance of GDC-1(35) and the mutant GDC-1 (35-H3mut) M9 media + Amp + 10 mM Glyphosate Vector (pBluescript SK+) - GDC-1(35) +++ GDC-1(35-H3mut) -
Example 7
GDC-1 Does Not Complement an aroA Mutation in E. coli
[0087]The E. coli aroA gene codes for EPSP synthase, the target enzyme for glyphosate. EPSP synthase catalyzes the sixth step in the biosynthesis of aromatic amino acids in microbes and plants. aroA mutants that lack an EPSP synthase do not grow on minimal media that lacks aromatic amino acids (Pittard and Wallace (1966) J. Bacteriol. 91:1494-508), but can grow in rich media, such as LB. However, genes encoding EPSPS activity can restore the ability to grow on glyphosate upon aroA mutant E. coli strains. Thus, a test for genetic complementation of an aroA mutant is a highly sensitive method to test if a gene is capable of functioning as an EPSPS in E. coli. Such tests for gene function by genetic complementation are known in the art.
[0088]A deletion of the aroA gene was created in E. coli XL-1 MRF' (Stratagene) by PCR/recombination methods known in the art and outlined by Datsenko and Wanner, (2000) Proc. Natl. Acad. Sci. USA 97:6640-6645. This system is based on the Red system that allows for chromosomal disruptions of targeted sequences. A large portion (1067 nt of the 1283 nt) of the aroA coding region was disrupted by the engineered deletion. The presence of the deletion was confirmed by PCR with several sets of oligonucleotides, and by the appearance of an aroA phenotype in the strain, referred to herein as `ΔaroA`. ΔaroA grows on LB media (which contains all amino acids) and grows on M63 media supplemented with phenylalanine, tryptophan, and tyrosine, but does not grow on M63 minimal media (which lacks aromatic amino acids). These results indicate that ΔaroA exhibits an aroA phenotype.
[0089]The ability of an EPSPS to complement the mutant phenotype of ΔaroA was confirmed. Clone pAX482, an E. coli expression vector containing the wild-type E. coli aroA gene, was transformed into ΔaroA, and transformed cells were selected. These cells (containing a functional aroA gene residing on a plasmid) were then plated on LB media, M63, and M63 with amino acid supplements. Where the ΔaroA mutant strain grew only on LB and M63 supplemented with aromatic amino acids, ΔaroA cells containing the functional aroA gene on a plasmid grew on all three media types.
[0090]In order to determine whether or not GDC-1 could confer complementation, plasmid pAX472, the expression vector containing GDC-1, was transformed into ΔaroA and plated on the same three types of media. Cells transformed with pAX472 were able to grow on M63 media supplemented with phenylalanine, tryptophan, and tyrosine and LB media but they were not able to grow on M63 alone. Thus, GDC-1 was not capable of complementing the aroA mutation, and thus GDC-1 is not EPSP synthase.
Example 8
GDC-1 is a TPP-Binding Decarboxylase
[0091]The predicted amino acid sequence of GDC-1 was compared to the non-redundant database of sequences maintained by the National Center for Biotechnology Information (NCBI), using the BLAST2 algorithm (Altschul et al. (1990) J. Mol. Biol. 215:403-410; Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402; Gish and States (1993) Nature Genet. 3:266-272). Comparison of GDC-1 with public DNA and amino acid databases, such as the non-redundant database of GenBank, the Swissprot database, and the `pat` database of GenBank show that GDC-1 encodes a novel protein. Results from a BLAST search of the NCBI nr database are shown in Table 2. The sequences obtained using the Genbank Accession Nos. provided are herein incorporated by reference in their entirety. The results of BLAST searches identified homology between the predicted GDC-1 open reading frame (SEQ ID NO:3) and several known proteins. The highest scoring amino acid sequences from this search were aligned with GDC-1 using ClustalW algorithm (Higgins et al. (1994) Nucleic Acids Res. 22:4673-4680) [as incorporated into the program ALIGNX module of the vector NTi Program Suite, Informax, Inc.]. After alignment with ClustalW, the percent amino acid identity was assessed. The protein encoded by GDC-1 has homology to several members of the fungal pyruvate decarboxylase enzyme family. The highest protein homology identified is the Aspergillus oryzae pyruvate decarboxylase (pdcA) gene. GDC-1 also shares homology with indole-3 pyruvate decarboxylases, found in bacteria such as Salmonella typhimurium. A similar search of the patent database at NCBI also identifies proteins with homology to GDC-1, though proteins identified in this search are less related to GDC-1. The percent amino acid identity of GDC-1 with members of these protein classes is shown in Table 3.
[0092]Further analysis of GDC-1 sequence shows that GDC-1 contains conserved domains characteristic of proteins that utilize Thiamine Pyrophosphate (TPP) as a cofactor. These domains are collectively and singly referred to as a "TPP binding domain". Analysis of GDC-1 sequence shows that amino acids 13-187 of SEQ ID NOS:3, 19, and 21 constitute an N-terminal domain of TPP-binding domain, amino acids 375-547 of SEQ ID NOS:3, 19, and 21 constitute a central domain of TPP-binding domain, and amino acids 209-348 of SEQ ID NOS:3, 19, and 21 constitute a C-terminal domain of TPP-binding domain. It is understood that these amino acid coordinates are only approximations of the location of such domains as judged by homology with known TPP binding proteins, and are not limiting to the invention. An alignment of GDC-1 with other known TPP-binding proteins is shown in FIG. 3.
TABLE-US-00002 TABLE 2 High scoring open reading frames from BLAST search of NCBI nr database Genbank Accession No. Organism Gene Description gi|4323052|gb|AF098293.1|AF098293 Aspergillus oryzae pyruvate decarboxylase (pdcA) gi|2160687|gb|U73194.1|ENU73194 Emericella nidulans pyruvate decarboxylase (pdcA) gi|25992751|gb|AF545432.1| Candida glabrata pyruvate decarboxylase (PDC) gi|4115|emb|X55905.1|SCPDC6 Saccharomyces PDC6 gene for pyruvate cerivisiae decarboxylase gi|173308|gb|L09727.1|YSKPDC1A Kluyveromyces pyruvate decarboxylase marxianus (PDC1) gi|535343|gb|U13635.1|HUU13635 Hanseniaspora pyruvate decarboxylase uvarum (PDC) gi|4113|emb|X15668.1|SCPDC5 Saccharomyces PDC5 gene for pyruvate cerivisiae decarboxylase (EC4.1.1.1.) gi|452688|emb|X77316.1|SCPDC1A Saccharomyces PDC1 cerivisiae
TABLE-US-00003 TABLE 3 Percent identity of GDC-1 to related proteins from various fungi and bacteria % Amino Acid Organism Gene Product Identity Aspergillus oryzae Pyruvate decarboxylase 58% Emericalla nidulans Pyruvate decarboxylase 56% Candida glabrata Pyruvate decarboxylase 49% Kluyveromyces marxianus Pyruvate decarboxylase 47% Saccharomyces cerevisiae Pyruvate decarboxylase PDC1 46% Saccharomyces cerevisiae Pyruvate decarboxylase PDC5 47% Saccharomyces cerevisiae Pyruvate decarboxylase PDC6 47% Pichia Stipitis Pyruvate decarboxylase PDC2 45% Salmonella typhimurium Indole-3 pyruvate decarboxylase 33% Neurospora crassa Pyruvate decarboxylase 28% Nicotiana tabacum Pyruvate decarboxylase 28% Zymomonas mobilis Pyruvate decarboxylase 27%
Example 9
Engineering GDC-1 for Expression in E. coli
[0093]An E. coli strain expressing GDC-1 was engineered into a customized expression vector (pAX481). pAX481 contains the pBR322 origin of replication, a chloramphenicol acetyl transferase gene (for selection and maintenance of the plasmid), the lacI gene, the Ptac promoter and the rrnB transcriptional terminator. The GDC-1 open reading frame was amplified by PCR using a high fidelity DNA polymerase, as known in the art. The oligonucleotides for PCR amplification of GDC-1 were designed to place the ATG start site of the gene at the proper distance from the ribosome binding site of pAX481.
[0094]The GDC-1 PCR product was cloned into the expression vector pAX481 and transformed into E. coli XL1 Blue MRF' to yield the plasmid pAX472. GDC-1 positive clones were identified by standard methods known in the art. The sequence of pAX472 was confirmed by DNA sequence analysis as known in the art.
Example 10
Purification of GDC-1 Expressed as a 6×His-Tagged Protein in E. coli
[0095]The GDC-1 coding region (1,728 nucleotides) was amplified by PCR using ProofStart® DNA polymerase. Oligonucleotides used to prime PCR were designed to introduce restriction enzyme recognition sites near the 5' and 3' ends of the resulting PCR product. The resulting PCR product was digested with BamH I and Sal I. BamH I cleaved the PCR product at the 5' end, and Sal I cleaved the PCR product at the 3' end. The digested product was cloned into the 6×His-tag expression vector pQE-30 (Qiagen), prepared by digestion with BamH I and Sal I. The resulting clone, pAX623, contained GDC-1 in the same translational reading frame as, and immediately C-terminal to, the 6×His tag of pQE-30. General strategies for generating such clones, and for expressing proteins containing 6×His-tag are well known in the art.
[0096]The ability of this clone to confer glyphosate resistance was confirmed by plating cells of pAX623 onto M63 media containing 5 mM glyphosate. pAX623-containing cells gave rise to colonies, where cells containing the vector alone gave no colonies.
[0097]GDC-1 protein from pAX623-containing cells was isolated by expression of GDC-1-6×His-tagged protein in E. coli, and the resulting protein purified using Ni-NTA Superflow Resin (Qiagen) as per manufacturer's instructions.
Example 11
Assay of GDC-1 Pyruvate Decarboxylase Activity
[0098]100 ng of GDC-1 protein was tested for activity in a standard pyruvate decarboxylase assay (Gounaris et al. (1971) J. of Biol. Chem. 246:1302-1309). This assay is a coupled reaction, wherein the first step the pyruvate decarboxylase (PDC) converts pyruvate to acetaldehyde and CO2. The acetaldehyde produced in this reaction is a substrate for alcohol dehydrogenase, which converts acetaldehyde and β-NADH to ethanol and β-NAD. Thus, PDC activity is detected by virtue of utilization of β-NADH as decrease in absorbance at 340 nM in a spectrophotometer. GDC-1 as well as a control enzyme (pyruvate decarboxylase, Sigma) were tested in this assay. GDC-1 showed activity as a pyruvate decarboxylase, and the reaction rate correlated with the concentration of pyruvate in the assay.
Example 12
Engineering GDC-1 for Plant Transformation
[0099]The GDC-1 open reading frame (ORF) was amplified by PCR from a full-length cDNA template. HindIII restriction sites were added to each end of the ORF during PCR. Additionally, the nucleotide sequence ACC was added immediately 5' to the start codon of the gene to increase translational efficiency (Kozak (1987) Nucleic Acids Research 15:8125-8148; Joshi (1987) Nucleic Acids Research 15:6643-6653). The PCR product was cloned and sequenced, using techniques well known in the art, to ensure that no mutations were introduced during PCR.
[0100]The plasmid containing the GDC-1 PCR product was partially digested with Hind III and the 1.7 kb Hind III fragment containing the intact ORF was isolated. (GDC-1 contains an internal Hind III site in addition to the sites added by PCR.) This fragment was cloned into the Hind III site of plasmid pAX200, a plant expression vector containing the rice actin promoter (McElroy et al. (1991) Mol. Gen. Genet. 231:150-160) and the PinII terminator (An et al. (1989) The Plant Cell 1:115-122). The promoter--gene--terminator fragment from this intermediate plasmid was subcloned into Xho I site of plasmid pSB11 (Japan Tobacco, Inc.) to form the plasmid pAX810. pAX810 is organized such that the 3.45 kb DNA fragment containing the promoter--GDC-1--terminator construct may be excised from pAX810 by double digestion with KpnI and XbaI for transformation into plants using aerosol beam injection. The structure of pAX810 was verified by restriction digests and gel electrophoresis and by sequencing across the various cloning junctions.
[0101]Plasmid pAX810 was mobilized into Agrobacterium tumifaciens strain LBA4404 which also harbored the plasmid pSB1 (Japan Tobacco, Inc.), using triparental mating procedures well known in the art, and plated on media containing spectinomycin. Plasmid pAX810 carries spectinomycin resistance but is a narrow host range plasmid and cannot replicate in Agrobacterium. Spectinomycin resistant colonies arise when pAX810 integrates into the broad host range plasmid pSB1 through homologous recombination. The cointegrate product of pSB1 and pAX810 was named pAX204 and was verified by Southern hybridization (data not shown). The Agrobacterium strain harboring pAX204 was used to transform maize by the PureIntro method (Japan Tobacco).
Example 13
Transformation of GDC-1 into Plant Cells
[0102]Maize ears are collected 8-12 days after pollination. Embryos are isolated from the ears, and those embryos 0.8-1.5 mm in size are used for transformation. Embryos are plated scutellum side-up on a suitable incubation media, such as DN62A5S media (3.98 g/L N6 Salts; 1 mL/L (of 1000× Stock) N6 Vitamins; 800 mg/L L-Asparagine; 100 mg/L Myo-inositol; 1.4 g/L L-Proline; 100 mg/L Casaminoacids; 50 g/L sucrose; 1 mL/L (of 1 mg/mL Stock) 2,4-D). However, media and salts other than DN62A5S are suitable and are known in the art. Embryos are incubated overnight at 25° C. in the dark.
[0103]The resulting explants are transferred to mesh squares (30-40 per plate), transferred onto osmotic media for 30-45 minutes, and then transferred to a beaming plate (see, for example, PCT Publication No. WO/0138514 and U.S. Pat. No. 5,240,842).
[0104]DNA constructs designed to express GDC-1 in plant cells are accelerated into plant tissue using an aerosol beam accelerator, using conditions essentially as described in PCT Publication No. WO/0138514. After beaming, embryos are incubated for 30 min on osmotic media, and placed onto incubation media overnight at 25° C. in the dark. To avoid unduly damaging beamed explants, they are incubated for at least 24 hours prior to transfer to recovery media. Embryos are then spread onto recovery period media, for 5 days, 25° C. in the dark, then transferred to a selection media. Explants are incubated in selection media for up to eight weeks, depending on the nature and characteristics of the particular selection utilized. After the selection period, the resulting callus is transferred to embryo maturation media, until the formation of mature somatic embryos is observed. The resulting mature somatic embryos are then placed under low light, and the process of regeneration is initiated by methods known in the art. The resulting shoots are allowed to root on rooting media, and the resulting plants are transferred to nursery pots and propagated as transgenic plants.
Materials
TABLE-US-00004 [0105]DN62A5S Media Components per liter Source Chu'S N6 Basal Salt Mixture 3.98 g/L Phytotechnology Labs (Prod. No. C 416) Chu's N6 Vitamin Solution 1 mL/L (of Phytotechnology Labs (Prod. No. C 149) 1000x Stock) L-Asparagine 800 mg/L Phytotechnology Labs Myo-inositol 100 mg/L Sigma L-Proline 1.4 g/L Phytotechnology Labs Casaminoacids 100 mg/L Fisher Scientific Sucrose 50 g/L Phytotechnology Labs 2,4-D (Prod. No. D-7299) 1 mL/L (of Sigma 1 mg/mL Stock)
[0106]Adjust the pH of the solution to pH to 5.8 with 1N KOH/1N KCl, add Gelrite (Sigma) to 3 g/L, and autoclave. After cooling to 50° C., add 2 ml/L of a 5 mg/ml stock solution of Silver Nitrate (Phytotechnology Labs). Recipe yields about 20 plates.
Example 14
Transformation of GDC-1 into Plant Cells by Agrobacterium-Mediated Transformation
[0107]Ears are collected 8-12 days after pollination. Embryos are isolated from the ears, and those embryos 0.8-1.5 mm in size are used for transformation. Embryos are plated scutellum side-up on a suitable incubation media, and incubated overnight at 25° C. in the dark. However, it is not necessary per se to incubate the embryos overnight. Embryos are contacted with an Agrobacterium strain containing the appropriate vectors for Ti plasmid mediated transfer for 5-10 min, and then plated onto co-cultivation media for 3 days (25° C. in the dark). After co-cultivation, explants are transferred to recovery period media for five days (at 25° C. in the dark). Explants are incubated in selection media for up to eight weeks, depending on the nature and characteristics of the particular selection utilized. After the selection period, the resulting callus is transferred to embryo maturation media, until the formation of mature somatic embryos is observed. The resulting mature somatic embryos are then placed under low light, and the process of regeneration is initiated as known in the art. The resulting shoots are allowed to root on rooting media, and the resulting plants are transferred to nursery pots and propagated as transgenic plants.
[0108]All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0109]Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
Sequence CWU
1
2112210DNAUnknownCDS(224)...(1951)Fungal isolate from soil sample
1acgcggggtg cccacggaca acaattccct taggattatc tcctgtattg aatacactct
60actttgcaac tttacctatt attcgacttt cttttagagg agcagcattg tcatcattac
120ctgcccctcc atctgatacc taccttacat tgtcgccaac acacctataa gccataatat
180accgactcaa agcaaaccac gcccattgtt tgattgttta atc atg gcc agc atc
235Met Ala Ser Ile1aac atc agg gtg cag aat ctc gag caa ccc atg gac gtt
gcc gag tat 283Asn Ile Arg Val Gln Asn Leu Glu Gln Pro Met Asp Val
Ala Glu Tyr5 10 15
20ctt ttt cgg cgt ctc cac gaa atc ggc att cgc tcc atc cac ggt ctt
331Leu Phe Arg Arg Leu His Glu Ile Gly Ile Arg Ser Ile His Gly Leu25
30 35cca ggc gat tac aac ctt ctt gcc ctc gac
tat ttg cca tca tgt ggc 379Pro Gly Asp Tyr Asn Leu Leu Ala Leu Asp
Tyr Leu Pro Ser Cys Gly40 45 50ctg aga
tgg gtt ggc agc gtc aac gaa ctc aat gct gct tat gct gct 427Leu Arg
Trp Val Gly Ser Val Asn Glu Leu Asn Ala Ala Tyr Ala Ala55
60 65gat ggc tat gcc cgc gtc aag cag atg gga gct ctc
atc acc act ttt 475Asp Gly Tyr Ala Arg Val Lys Gln Met Gly Ala Leu
Ile Thr Thr Phe70 75 80gga gtg gga gag
ctc tca gcc atc aat ggc gtt gcc ggt gcc ttt tcg 523Gly Val Gly Glu
Leu Ser Ala Ile Asn Gly Val Ala Gly Ala Phe Ser85 90
95 100gaa cac gtc cca gtc gtt cac att gtt
ggc tgc cct tcc act gtc tcg 571Glu His Val Pro Val Val His Ile Val
Gly Cys Pro Ser Thr Val Ser105 110 115cag
cga aac ggc atg ctc ctc cac cac acg ctt gga aac ggc gac ttc 619Gln
Arg Asn Gly Met Leu Leu His His Thr Leu Gly Asn Gly Asp Phe120
125 130aac atc ttt gcc aac atg agc gct caa atc tct
tgc gaa gtg gcc aag 667Asn Ile Phe Ala Asn Met Ser Ala Gln Ile Ser
Cys Glu Val Ala Lys135 140 145ctc acc aac
cct gcc gaa att gcg acc cag atc gac cat gcc ctc cgc 715Leu Thr Asn
Pro Ala Glu Ile Ala Thr Gln Ile Asp His Ala Leu Arg150
155 160gtt tgc ttc att cgt tct cgg ccc gtc tac atc atg
ctt ccc acc gat 763Val Cys Phe Ile Arg Ser Arg Pro Val Tyr Ile Met
Leu Pro Thr Asp165 170 175
180atg gtc cag gcc aaa gta gaa ggt gcc aga ctc aag gaa cca att gac
811Met Val Gln Ala Lys Val Glu Gly Ala Arg Leu Lys Glu Pro Ile Asp185
190 195ttg tcg gag cct cca aat gat ccc gag
aaa gaa gca tac gtc gtt gac 859Leu Ser Glu Pro Pro Asn Asp Pro Glu
Lys Glu Ala Tyr Val Val Asp200 205 210gtt
gtc ctc aag tay ctc cgt gct gca aag aac ccc gtc atc ctt gtc 907Val
Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro Val Ile Leu Val215
220 225gat gct tgt gct atc cgt cat cgt gtt ctt gat
gag gtt cat gat ctc 955Asp Ala Cys Ala Ile Arg His Arg Val Leu Asp
Glu Val His Asp Leu230 235 240atc gaa aag
aca aac ctc cct gtc ttt gtc act cct atg ggc aaa ggt 1003Ile Glu Lys
Thr Asn Leu Pro Val Phe Val Thr Pro Met Gly Lys Gly245
250 255 260gct gtt aac gaa gaa cac ccg
aca tat ggt ggt gtc tat gcc ggt gac 1051Ala Val Asn Glu Glu His Pro
Thr Tyr Gly Gly Val Tyr Ala Gly Asp265 270
275ggc tca cat ccg cct caa gtt aag gac atg gtt gag tct tct gat ttg
1099Gly Ser His Pro Pro Gln Val Lys Asp Met Val Glu Ser Ser Asp Leu280
285 290ata ttg aca atc ggt gct ctc aag agc
gac ttc aac act gct ggc ttc 1147Ile Leu Thr Ile Gly Ala Leu Lys Ser
Asp Phe Asn Thr Ala Gly Phe295 300 305tct
tac cgt acc tca cag ctg aac acg att gat cta cac agc gac cac 1195Ser
Tyr Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu His Ser Asp His310
315 320tgc att gtc aaa tac tcg aca tat cca ggt gtc
cag atg agg ggt gtg 1243Cys Ile Val Lys Tyr Ser Thr Tyr Pro Gly Val
Gln Met Arg Gly Val325 330 335
340ctg cga caa gtg att aag cag ctc gat gca tct gag atc aac gct cag
1291Leu Arg Gln Val Ile Lys Gln Leu Asp Ala Ser Glu Ile Asn Ala Gln345
350 355cca gcg cca gtc gtc gag aat gaa gtt
gcc aaa aac cga gat aac tca 1339Pro Ala Pro Val Val Glu Asn Glu Val
Ala Lys Asn Arg Asp Asn Ser360 365 370ccc
gtc att aca caa gct ttc ttc tgg ccg cgc gtg gga gag ttc ctg 1387Pro
Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val Gly Glu Phe Leu375
380 385aag aag aac gac atc gtc att acc gag act gga
aca gcc aac ttt ggc 1435Lys Lys Asn Asp Ile Val Ile Thr Glu Thr Gly
Thr Ala Asn Phe Gly390 395 400atc tgg gat
act aag ttt ccc tct ggc gtt act gcg ctt tct cag gtc 1483Ile Trp Asp
Thr Lys Phe Pro Ser Gly Val Thr Ala Leu Ser Gln Val405
410 415 420ctt tgg gga agc att ggt tgg
tcc gtt ggt gcc tgc caa gga gcc gtt 1531Leu Trp Gly Ser Ile Gly Trp
Ser Val Gly Ala Cys Gln Gly Ala Val425 430
435ctt gca gcc gcc gat gac aac agc gat cgc aga act atc ctc ttt gtt
1579Leu Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr Ile Leu Phe Val440
445 450ggt gat ggc tca ttc cag ctc act gct
caa gaa ttg agc aca atg att 1627Gly Asp Gly Ser Phe Gln Leu Thr Ala
Gln Glu Leu Ser Thr Met Ile455 460 465cgt
ctc aag ctg aag ccc atc atc ttt gtc atc tgc aac gat ggc ttt 1675Arg
Leu Lys Leu Lys Pro Ile Ile Phe Val Ile Cys Asn Asp Gly Phe470
475 480acc att gaa cga ttc att cac ggc atg gaa gcc
gag tac aac gac atc 1723Thr Ile Glu Arg Phe Ile His Gly Met Glu Ala
Glu Tyr Asn Asp Ile485 490 495
500gca aat tgg gac ttc aag gct ctg gtt gac gtc ttt ggc ggc tct aag
1771Ala Asn Trp Asp Phe Lys Ala Leu Val Asp Val Phe Gly Gly Ser Lys505
510 515acg gcc aag aag ttc gcc gtc aag acc
aag gac gag ctg gac agc ctt 1819Thr Ala Lys Lys Phe Ala Val Lys Thr
Lys Asp Glu Leu Asp Ser Leu520 525 530ctc
aca gac cct acc ttt aac gcc gca gaa tgc ctc cag ttt gtc gag 1867Leu
Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu Gln Phe Val Glu535
540 545cta tat atg ccc aaa gaa gat gct cct cga gca
ttg atc atg act gca 1915Leu Tyr Met Pro Lys Glu Asp Ala Pro Arg Ala
Leu Ile Met Thr Ala550 555 560gaa gct agc
gcg agg aac aat gcc aag aca gag taa agtggactgt 1961Glu Ala Ser
Ala Arg Asn Asn Ala Lys Thr Glu *565 570
575catgaaggcc gatttaccac ctcataaatt gtaatagacc tgatacacat agatcaaggc
2021aggtaccgat cattaatcaa gcaggtttgg atggggaagg attttgaaaa tgaggaaacg
2081atgggatgat atttggaata actggccatt attttgagta cttataaaca aatttgaagt
2141tcaatttttt ttcaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
2201aaaaaaaaa
221021725DNAUnknownCDS(1)...(1725)Fungal isolate from soil sample 2atg
gcc agc atc aac atc agg gtg cag aat ctc gag caa ccc atg gac 48Met
Ala Ser Ile Asn Ile Arg Val Gln Asn Leu Glu Gln Pro Met Asp1
5 10 15gtt gcc gag tat ctt ttt cgg
cgt ctc cac gaa atc ggc att cgc tcc 96Val Ala Glu Tyr Leu Phe Arg
Arg Leu His Glu Ile Gly Ile Arg Ser20 25
30atc cac ggt ctt cca ggc gat tac aac ctt ctt gcc ctc gac tat ttg
144Ile His Gly Leu Pro Gly Asp Tyr Asn Leu Leu Ala Leu Asp Tyr Leu35
40 45cca tca tgt ggc ctg aga tgg gtt ggc agc
gtc aac gaa ctc aat gct 192Pro Ser Cys Gly Leu Arg Trp Val Gly Ser
Val Asn Glu Leu Asn Ala50 55 60gct tat
gct gct gat ggc tat gcc cgc gtc aag cag atg gga gct ctc 240Ala Tyr
Ala Ala Asp Gly Tyr Ala Arg Val Lys Gln Met Gly Ala Leu65
70 75 80atc acc act ttt gga gtg gga
gag ctc tca gcc atc aat ggc gtt gcc 288Ile Thr Thr Phe Gly Val Gly
Glu Leu Ser Ala Ile Asn Gly Val Ala85 90
95ggt gcc ttt tcg gaa cac gtc cca gtc gtt cac att gtt ggc tgc cct
336Gly Ala Phe Ser Glu His Val Pro Val Val His Ile Val Gly Cys Pro100
105 110tcc act gtc tcg cag cga aac ggc atg
ctc ctc cac cac acg ctt gga 384Ser Thr Val Ser Gln Arg Asn Gly Met
Leu Leu His His Thr Leu Gly115 120 125aac
ggc gac ttc aac atc ttt gcc aac atg agc gct caa atc tct tgc 432Asn
Gly Asp Phe Asn Ile Phe Ala Asn Met Ser Ala Gln Ile Ser Cys130
135 140gaa gtg gcc aag ctc acc aac cct gcc gaa att
gcg acc cag atc gac 480Glu Val Ala Lys Leu Thr Asn Pro Ala Glu Ile
Ala Thr Gln Ile Asp145 150 155
160cat gcc ctc cgc gtt tgc ttc att cgt tct cgg ccc gtc tac atc atg
528His Ala Leu Arg Val Cys Phe Ile Arg Ser Arg Pro Val Tyr Ile Met165
170 175ctt ccc acc gat atg gtc cag gcc aaa
gta gaa ggt gcc aga ctc aag 576Leu Pro Thr Asp Met Val Gln Ala Lys
Val Glu Gly Ala Arg Leu Lys180 185 190gaa
cca att gac ttg tcg gag cct cca aat gat ccc gag aaa gaa gca 624Glu
Pro Ile Asp Leu Ser Glu Pro Pro Asn Asp Pro Glu Lys Glu Ala195
200 205tac gtc gtt gac gtt gtc ctc aag tay ctc cgt
gct gca aag aac ccc 672Tyr Val Val Asp Val Val Leu Lys Tyr Leu Arg
Ala Ala Lys Asn Pro210 215 220gtc atc ctt
gtc gat gct tgt gct atc cgt cat cgt gtt ctt gat gag 720Val Ile Leu
Val Asp Ala Cys Ala Ile Arg His Arg Val Leu Asp Glu225
230 235 240gtt cat gat ctc atc gaa aag
aca aac ctc cct gtc ttt gtc act cct 768Val His Asp Leu Ile Glu Lys
Thr Asn Leu Pro Val Phe Val Thr Pro245 250
255atg ggc aaa ggt gct gtt aac gaa gaa cac ccg aca tat ggt ggt gtc
816Met Gly Lys Gly Ala Val Asn Glu Glu His Pro Thr Tyr Gly Gly Val260
265 270tat gcc ggt gac ggc tca cat ccg cct
caa gtt aag gac atg gtt gag 864Tyr Ala Gly Asp Gly Ser His Pro Pro
Gln Val Lys Asp Met Val Glu275 280 285tct
tct gat ttg ata ttg aca atc ggt gct ctc aag agc gac ttc aac 912Ser
Ser Asp Leu Ile Leu Thr Ile Gly Ala Leu Lys Ser Asp Phe Asn290
295 300act gct ggc ttc tct tac cgt acc tca cag ctg
aac acg att gat cta 960Thr Ala Gly Phe Ser Tyr Arg Thr Ser Gln Leu
Asn Thr Ile Asp Leu305 310 315
320cac agc gac cac tgc att gtc aaa tac tcg aca tat cca ggt gtc cag
1008His Ser Asp His Cys Ile Val Lys Tyr Ser Thr Tyr Pro Gly Val Gln325
330 335atg agg ggt gtg ctg cga caa gtg att
aag cag ctc gat gca tct gag 1056Met Arg Gly Val Leu Arg Gln Val Ile
Lys Gln Leu Asp Ala Ser Glu340 345 350atc
aac gct cag cca gcg cca gtc gtc gag aat gaa gtt gcc aaa aac 1104Ile
Asn Ala Gln Pro Ala Pro Val Val Glu Asn Glu Val Ala Lys Asn355
360 365cga gat aac tca ccc gtc att aca caa gct ttc
ttc tgg ccg cgc gtg 1152Arg Asp Asn Ser Pro Val Ile Thr Gln Ala Phe
Phe Trp Pro Arg Val370 375 380gga gag ttc
ctg aag aag aac gac atc gtc att acc gag act gga aca 1200Gly Glu Phe
Leu Lys Lys Asn Asp Ile Val Ile Thr Glu Thr Gly Thr385
390 395 400gcc aac ttt ggc atc tgg gat
act aag ttt ccc tct ggc gtt act gcg 1248Ala Asn Phe Gly Ile Trp Asp
Thr Lys Phe Pro Ser Gly Val Thr Ala405 410
415ctt tct cag gtc ctt tgg gga agc att ggt tgg tcc gtt ggt gcc tgc
1296Leu Ser Gln Val Leu Trp Gly Ser Ile Gly Trp Ser Val Gly Ala Cys420
425 430caa gga gcc gtt ctt gca gcc gcc gat
gac aac agc gat cgc aga act 1344Gln Gly Ala Val Leu Ala Ala Ala Asp
Asp Asn Ser Asp Arg Arg Thr435 440 445atc
ctc ttt gtt ggt gat ggc tca ttc cag ctc act gct caa gaa ttg 1392Ile
Leu Phe Val Gly Asp Gly Ser Phe Gln Leu Thr Ala Gln Glu Leu450
455 460agc aca atg att cgt ctc aag ctg aag ccc atc
atc ttt gtc atc tgc 1440Ser Thr Met Ile Arg Leu Lys Leu Lys Pro Ile
Ile Phe Val Ile Cys465 470 475
480aac gat ggc ttt acc att gaa cga ttc att cac ggc atg gaa gcc gag
1488Asn Asp Gly Phe Thr Ile Glu Arg Phe Ile His Gly Met Glu Ala Glu485
490 495tac aac gac atc gca aat tgg gac ttc
aag gct ctg gtt gac gtc ttt 1536Tyr Asn Asp Ile Ala Asn Trp Asp Phe
Lys Ala Leu Val Asp Val Phe500 505 510ggc
ggc tct aag acg gcc aag aag ttc gcc gtc aag acc aag gac gag 1584Gly
Gly Ser Lys Thr Ala Lys Lys Phe Ala Val Lys Thr Lys Asp Glu515
520 525ctg gac agc ctt ctc aca gac cct acc ttt aac
gcc gca gaa tgc ctc 1632Leu Asp Ser Leu Leu Thr Asp Pro Thr Phe Asn
Ala Ala Glu Cys Leu530 535 540cag ttt gtc
gag cta tat atg ccc aaa gaa gat gct cct cga gca ttg 1680Gln Phe Val
Glu Leu Tyr Met Pro Lys Glu Asp Ala Pro Arg Ala Leu545
550 555 560atc atg act gca gaa gct agc
gcg agg aac aat gcc aag aca gag 1725Ile Met Thr Ala Glu Ala Ser
Ala Arg Asn Asn Ala Lys Thr Glu565 570
5753575PRTUnknownFungal isolate from soil sample 3Met Ala Ser Ile Asn Ile
Arg Val Gln Asn Leu Glu Gln Pro Met Asp1 5
10 15Val Ala Glu Tyr Leu Phe Arg Arg Leu His Glu Ile
Gly Ile Arg Ser20 25 30Ile His Gly Leu
Pro Gly Asp Tyr Asn Leu Leu Ala Leu Asp Tyr Leu35 40
45Pro Ser Cys Gly Leu Arg Trp Val Gly Ser Val Asn Glu Leu
Asn Ala50 55 60Ala Tyr Ala Ala Asp Gly
Tyr Ala Arg Val Lys Gln Met Gly Ala Leu65 70
75 80Ile Thr Thr Phe Gly Val Gly Glu Leu Ser Ala
Ile Asn Gly Val Ala85 90 95Gly Ala Phe
Ser Glu His Val Pro Val Val His Ile Val Gly Cys Pro100
105 110Ser Thr Val Ser Gln Arg Asn Gly Met Leu Leu His
His Thr Leu Gly115 120 125Asn Gly Asp Phe
Asn Ile Phe Ala Asn Met Ser Ala Gln Ile Ser Cys130 135
140Glu Val Ala Lys Leu Thr Asn Pro Ala Glu Ile Ala Thr Gln
Ile Asp145 150 155 160His
Ala Leu Arg Val Cys Phe Ile Arg Ser Arg Pro Val Tyr Ile Met165
170 175Leu Pro Thr Asp Met Val Gln Ala Lys Val Glu
Gly Ala Arg Leu Lys180 185 190Glu Pro Ile
Asp Leu Ser Glu Pro Pro Asn Asp Pro Glu Lys Glu Ala195
200 205Tyr Val Val Asp Val Val Leu Lys Tyr Leu Arg Ala
Ala Lys Asn Pro210 215 220Val Ile Leu Val
Asp Ala Cys Ala Ile Arg His Arg Val Leu Asp Glu225 230
235 240Val His Asp Leu Ile Glu Lys Thr Asn
Leu Pro Val Phe Val Thr Pro245 250 255Met
Gly Lys Gly Ala Val Asn Glu Glu His Pro Thr Tyr Gly Gly Val260
265 270Tyr Ala Gly Asp Gly Ser His Pro Pro Gln Val
Lys Asp Met Val Glu275 280 285Ser Ser Asp
Leu Ile Leu Thr Ile Gly Ala Leu Lys Ser Asp Phe Asn290
295 300Thr Ala Gly Phe Ser Tyr Arg Thr Ser Gln Leu Asn
Thr Ile Asp Leu305 310 315
320His Ser Asp His Cys Ile Val Lys Tyr Ser Thr Tyr Pro Gly Val Gln325
330 335Met Arg Gly Val Leu Arg Gln Val Ile
Lys Gln Leu Asp Ala Ser Glu340 345 350Ile
Asn Ala Gln Pro Ala Pro Val Val Glu Asn Glu Val Ala Lys Asn355
360 365Arg Asp Asn Ser Pro Val Ile Thr Gln Ala Phe
Phe Trp Pro Arg Val370 375 380Gly Glu Phe
Leu Lys Lys Asn Asp Ile Val Ile Thr Glu Thr Gly Thr385
390 395 400Ala Asn Phe Gly Ile Trp Asp
Thr Lys Phe Pro Ser Gly Val Thr Ala405 410
415Leu Ser Gln Val Leu Trp Gly Ser Ile Gly Trp Ser Val Gly Ala Cys420
425 430Gln Gly Ala Val Leu Ala Ala Ala Asp
Asp Asn Ser Asp Arg Arg Thr435 440 445Ile
Leu Phe Val Gly Asp Gly Ser Phe Gln Leu Thr Ala Gln Glu Leu450
455 460Ser Thr Met Ile Arg Leu Lys Leu Lys Pro Ile
Ile Phe Val Ile Cys465 470 475
480Asn Asp Gly Phe Thr Ile Glu Arg Phe Ile His Gly Met Glu Ala
Glu485 490 495Tyr Asn Asp Ile Ala Asn Trp
Asp Phe Lys Ala Leu Val Asp Val Phe500 505
510Gly Gly Ser Lys Thr Ala Lys Lys Phe Ala Val Lys Thr Lys Asp Glu515
520 525Leu Asp Ser Leu Leu Thr Asp Pro Thr
Phe Asn Ala Ala Glu Cys Leu530 535 540Gln
Phe Val Glu Leu Tyr Met Pro Lys Glu Asp Ala Pro Arg Ala Leu545
550 555 560Ile Met Thr Ala Glu Ala
Ser Ala Arg Asn Asn Ala Lys Thr Glu565 570
5754835DNAUnknownCDS(3)...(596)Fungal isolate from soil sample 4ct ttc
ttc tgg ccg cgc gtg gga gag ttc ctg aag aag aac gac atc 47Phe Phe
Trp Pro Arg Val Gly Glu Phe Leu Lys Lys Asn Asp Ile1 5
10 15gtc att acc gag act gga aca gcc aac
ttt ggc atc tgg gat act aag 95Val Ile Thr Glu Thr Gly Thr Ala Asn
Phe Gly Ile Trp Asp Thr Lys20 25 30ttt
ccc tct ggc gtt act gcg ctt tct cag gtc ctt tgg gga agc att 143Phe
Pro Ser Gly Val Thr Ala Leu Ser Gln Val Leu Trp Gly Ser Ile35
40 45ggt tgg tcc gtt ggt gcc tgc caa gga gcc gtt
ctt gca gcc gcc gat 191Gly Trp Ser Val Gly Ala Cys Gln Gly Ala Val
Leu Ala Ala Ala Asp50 55 60gac aac agc
gat cgc aga act atc ctc ttt gtt ggt gat ggc tca ttc 239Asp Asn Ser
Asp Arg Arg Thr Ile Leu Phe Val Gly Asp Gly Ser Phe65 70
75cag ctc act gct caa gaa ttg agc aca atg att cgt ctc
aag ctg aag 287Gln Leu Thr Ala Gln Glu Leu Ser Thr Met Ile Arg Leu
Lys Leu Lys80 85 90
95ccc atc atc ttt gtc atc tgc aac gat ggc ttt acc att gaa cga ttc
335Pro Ile Ile Phe Val Ile Cys Asn Asp Gly Phe Thr Ile Glu Arg Phe100
105 110att cac ggc atg gaa gcc gag tac aac
gac atc gca aat tgg gac ttc 383Ile His Gly Met Glu Ala Glu Tyr Asn
Asp Ile Ala Asn Trp Asp Phe115 120 125aag
gct ctg gtt gac gtc ttt ggc ggc tct aag acg gcc aag aag ttc 431Lys
Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr Ala Lys Lys Phe130
135 140gcc gtc aag acc aag gac gag ctg gac agc ctt
ctc aca gac cct acc 479Ala Val Lys Thr Lys Asp Glu Leu Asp Ser Leu
Leu Thr Asp Pro Thr145 150 155ttt aac gcc
gca gaa tgc ctc cag ttt gtc gag cta tat atg ccc aaa 527Phe Asn Ala
Ala Glu Cys Leu Gln Phe Val Glu Leu Tyr Met Pro Lys160
165 170 175gaa gat gct cct cga gca ttg
atc atg act gca gaa gct agc gcg agg 575Glu Asp Ala Pro Arg Ala Leu
Ile Met Thr Ala Glu Ala Ser Ala Arg180 185
190aac aat gcc aag aca gag taa agtggactgt catgaaggcc gatttaccac
626Asn Asn Ala Lys Thr Glu *195ctcataaatt gtaatagacc tgatacacat
agatcaaggc aggtaccgat cattaatcaa 686gcaggtttgg atggggaagg attttgaaaa
tgaggaaacg atgggatgat atttggaata 746actggccatt attttgagta cttataaaca
aatttgaagt tcaatttttt ttcaaaaaaa 806aaaaaaaaaa aaaaaaaaaa aaaaaaaaa
8355591DNAUnknownCDS(1)...(591)Fungal
isolate from soil sample 5ttc ttc tgg ccg cgc gtg gga gag ttc ctg aag aag
aac gac atc gtc 48Phe Phe Trp Pro Arg Val Gly Glu Phe Leu Lys Lys
Asn Asp Ile Val1 5 10
15att acc gag act gga aca gcc aac ttt ggc atc tgg gat act aag ttt
96Ile Thr Glu Thr Gly Thr Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe20
25 30ccc tct ggc gtt act gcg ctt tct cag gtc
ctt tgg gga agc att ggt 144Pro Ser Gly Val Thr Ala Leu Ser Gln Val
Leu Trp Gly Ser Ile Gly35 40 45tgg tcc
gtt ggt gcc tgc caa gga gcc gtt ctt gca gcc gcc gat gac 192Trp Ser
Val Gly Ala Cys Gln Gly Ala Val Leu Ala Ala Ala Asp Asp50
55 60aac agc gat cgc aga act atc ctc ttt gtt ggt gat
ggc tca ttc cag 240Asn Ser Asp Arg Arg Thr Ile Leu Phe Val Gly Asp
Gly Ser Phe Gln65 70 75
80ctc act gct caa gaa ttg agc aca atg att cgt ctc aag ctg aag ccc
288Leu Thr Ala Gln Glu Leu Ser Thr Met Ile Arg Leu Lys Leu Lys Pro85
90 95atc atc ttt gtc atc tgc aac gat ggc ttt
acc att gaa cga ttc att 336Ile Ile Phe Val Ile Cys Asn Asp Gly Phe
Thr Ile Glu Arg Phe Ile100 105 110cac ggc
atg gaa gcc gag tac aac gac atc gca aat tgg gac ttc aag 384His Gly
Met Glu Ala Glu Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys115
120 125gct ctg gtt gac gtc ttt ggc ggc tct aag acg gcc
aag aag ttc gcc 432Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr Ala
Lys Lys Phe Ala130 135 140gtc aag acc aag
gac gag ctg gac agc ctt ctc aca gac cct acc ttt 480Val Lys Thr Lys
Asp Glu Leu Asp Ser Leu Leu Thr Asp Pro Thr Phe145 150
155 160aac gcc gca gaa tgc ctc cag ttt gtc
gag cta tat atg ccc aaa gaa 528Asn Ala Ala Glu Cys Leu Gln Phe Val
Glu Leu Tyr Met Pro Lys Glu165 170 175gat
gct cct cga gca ttg atc atg act gca gaa gct agc gcg agg aac 576Asp
Ala Pro Arg Ala Leu Ile Met Thr Ala Glu Ala Ser Ala Arg Asn180
185 190aat gcc aag aca gag
591Asn Ala Lys Thr Glu1956197PRTUnknownFungal
isolate from soil sample 6Phe Phe Trp Pro Arg Val Gly Glu Phe Leu Lys Lys
Asn Asp Ile Val1 5 10
15Ile Thr Glu Thr Gly Thr Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe20
25 30Pro Ser Gly Val Thr Ala Leu Ser Gln Val
Leu Trp Gly Ser Ile Gly35 40 45Trp Ser
Val Gly Ala Cys Gln Gly Ala Val Leu Ala Ala Ala Asp Asp50
55 60Asn Ser Asp Arg Arg Thr Ile Leu Phe Val Gly Asp
Gly Ser Phe Gln65 70 75
80Leu Thr Ala Gln Glu Leu Ser Thr Met Ile Arg Leu Lys Leu Lys Pro85
90 95Ile Ile Phe Val Ile Cys Asn Asp Gly Phe
Thr Ile Glu Arg Phe Ile100 105 110His Gly
Met Glu Ala Glu Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys115
120 125Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr Ala
Lys Lys Phe Ala130 135 140Val Lys Thr Lys
Asp Glu Leu Asp Ser Leu Leu Thr Asp Pro Thr Phe145 150
155 160Asn Ala Ala Glu Cys Leu Gln Phe Val
Glu Leu Tyr Met Pro Lys Glu165 170 175Asp
Ala Pro Arg Ala Leu Ile Met Thr Ala Glu Ala Ser Ala Arg Asn180
185 190Asn Ala Lys Thr
Glu1957678DNAUnknownCDS(1)...(678)Fungal isolate from soil sample 7aca
tat cca ggt gtc cag atg agg ggt gtg ctg cga caa gtg att aag 48Thr
Tyr Pro Gly Val Gln Met Arg Gly Val Leu Arg Gln Val Ile Lys1
5 10 15cag ctc gat gca tct gag atc
aac gct cag cca gcg cca gtc gtc gag 96Gln Leu Asp Ala Ser Glu Ile
Asn Ala Gln Pro Ala Pro Val Val Glu20 25
30aat gaa gtt gcc aaa aac cga gat aac tca ccc gtc att aca caa gct
144Asn Glu Val Ala Lys Asn Arg Asp Asn Ser Pro Val Ile Thr Gln Ala35
40 45ttc ttc tgg ccg cgc gtg gga gag ttc ctg
aag aag aac gac atc gtc 192Phe Phe Trp Pro Arg Val Gly Glu Phe Leu
Lys Lys Asn Asp Ile Val50 55 60att acc
gag act gga aca gcc aac ttt ggc atc tgg gat act aag ttt 240Ile Thr
Glu Thr Gly Thr Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe65
70 75 80ccc tct ggc gtt act gcg ctt
tct cag gtc ctt tgg gga agc att ggt 288Pro Ser Gly Val Thr Ala Leu
Ser Gln Val Leu Trp Gly Ser Ile Gly85 90
95tgg tcc gtt ggt gcc tgc caa gga gcc gtt ctt gca gcc gcc gat gac
336Trp Ser Val Gly Ala Cys Gln Gly Ala Val Leu Ala Ala Ala Asp Asp100
105 110aac agc gat cgc aga act atc ctc ttt
gtt ggt gat ggc tca ttc cag 384Asn Ser Asp Arg Arg Thr Ile Leu Phe
Val Gly Asp Gly Ser Phe Gln115 120 125ctc
act gct caa gaa ttg agc aca atg att cgt ctc aag ctg aag ccc 432Leu
Thr Ala Gln Glu Leu Ser Thr Met Ile Arg Leu Lys Leu Lys Pro130
135 140atc atc ttt gtc atc tgc aac gat ggc ttt acc
att gaa cga ttc att 480Ile Ile Phe Val Ile Cys Asn Asp Gly Phe Thr
Ile Glu Arg Phe Ile145 150 155
160cac ggc atg gaa gcc gag tac aac gac atc gca aat tgg gac ttc aag
528His Gly Met Glu Ala Glu Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys165
170 175gct ctg gtt gac gtc ttt ggc ggc tct
aag acg gcc aag aag ttc gcc 576Ala Leu Val Asp Val Phe Gly Gly Ser
Lys Thr Ala Lys Lys Phe Ala180 185 190gtc
aag acc aag gac gag ctg gac agc ctt ctc aca gac cct acc ttt 624Val
Lys Thr Lys Asp Glu Leu Asp Ser Leu Leu Thr Asp Pro Thr Phe195
200 205aac gcc gca gaa tgc ctc cag ttt gtc gag cta
tat atg ccc aaa gaa 672Asn Ala Ala Glu Cys Leu Gln Phe Val Glu Leu
Tyr Met Pro Lys Glu210 215 220gat gct
678Asp
Ala2258226PRTUnknownFungal isolate from soil sample 8Thr Tyr Pro Gly Val
Gln Met Arg Gly Val Leu Arg Gln Val Ile Lys1 5
10 15Gln Leu Asp Ala Ser Glu Ile Asn Ala Gln Pro
Ala Pro Val Val Glu20 25 30Asn Glu Val
Ala Lys Asn Arg Asp Asn Ser Pro Val Ile Thr Gln Ala35 40
45Phe Phe Trp Pro Arg Val Gly Glu Phe Leu Lys Lys Asn
Asp Ile Val50 55 60Ile Thr Glu Thr Gly
Thr Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe65 70
75 80Pro Ser Gly Val Thr Ala Leu Ser Gln Val
Leu Trp Gly Ser Ile Gly85 90 95Trp Ser
Val Gly Ala Cys Gln Gly Ala Val Leu Ala Ala Ala Asp Asp100
105 110Asn Ser Asp Arg Arg Thr Ile Leu Phe Val Gly Asp
Gly Ser Phe Gln115 120 125Leu Thr Ala Gln
Glu Leu Ser Thr Met Ile Arg Leu Lys Leu Lys Pro130 135
140Ile Ile Phe Val Ile Cys Asn Asp Gly Phe Thr Ile Glu Arg
Phe Ile145 150 155 160His
Gly Met Glu Ala Glu Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys165
170 175Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr
Ala Lys Lys Phe Ala180 185 190Val Lys Thr
Lys Asp Glu Leu Asp Ser Leu Leu Thr Asp Pro Thr Phe195
200 205Asn Ala Ala Glu Cys Leu Gln Phe Val Glu Leu Tyr
Met Pro Lys Glu210 215 220Asp
Ala22591636DNAUnknownCDS(1)...(1377)Fungal isolate from soil sample 9cga
aac ggc atg ctc ctc cac cac acg ctt gga aac ggc gac ttc aac 48Arg
Asn Gly Met Leu Leu His His Thr Leu Gly Asn Gly Asp Phe Asn1
5 10 15atc ttt gcc aac atg agc gct
caa atc tct tgc gaa gtg gcc aag ctc 96Ile Phe Ala Asn Met Ser Ala
Gln Ile Ser Cys Glu Val Ala Lys Leu20 25
30acc aac cct gcc gaa att gcg acc cag atc gac cat gcc ctc cgc gtt
144Thr Asn Pro Ala Glu Ile Ala Thr Gln Ile Asp His Ala Leu Arg Val35
40 45tgc ttc att cgt tct cgg ccc gtc tac atc
atg ctt ccc acc gat atg 192Cys Phe Ile Arg Ser Arg Pro Val Tyr Ile
Met Leu Pro Thr Asp Met50 55 60gtc cag
gcc aaa gta gaa ggt gcc aga ctc aag gaa cca att gac ttg 240Val Gln
Ala Lys Val Glu Gly Ala Arg Leu Lys Glu Pro Ile Asp Leu65
70 75 80tcg gag cct cca aat gat ccc
gag aaa gaa gca tac gtc gtt gac gtt 288Ser Glu Pro Pro Asn Asp Pro
Glu Lys Glu Ala Tyr Val Val Asp Val85 90
95gtc ctc aag tac ctc cgt gct gca aag aac ccc gtc atc ctt gtc gat
336Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro Val Ile Leu Val Asp100
105 110gct tgt gct atc cgt cat cgt gtt ctt
gat gag gtt cat gat ctc atc 384Ala Cys Ala Ile Arg His Arg Val Leu
Asp Glu Val His Asp Leu Ile115 120 125gaa
aag aca aac ctc cct gtc ttt gtc act cct atg ggc aaa ggt gct 432Glu
Lys Thr Asn Leu Pro Val Phe Val Thr Pro Met Gly Lys Gly Ala130
135 140gtt aac gaa gaa cac ccg aca tat ggt ggt gtc
tat gcc ggt gac ggc 480Val Asn Glu Glu His Pro Thr Tyr Gly Gly Val
Tyr Ala Gly Asp Gly145 150 155
160tca cat ccg cct caa gtt aag gac atg gtt gag tct tct gat ttg ata
528Ser His Pro Pro Gln Val Lys Asp Met Val Glu Ser Ser Asp Leu Ile165
170 175ttg aca atc ggt gct ctc aag agc gac
ttc aac act gct ggc ttc tct 576Leu Thr Ile Gly Ala Leu Lys Ser Asp
Phe Asn Thr Ala Gly Phe Ser180 185 190tac
cgt acc tca cag ctg aac acg att gat cta cac agc gac cac tgc 624Tyr
Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu His Ser Asp His Cys195
200 205att gtc aaa tac tcg aca tat cca ggt gtc cag
atg agg ggt gtg ctg 672Ile Val Lys Tyr Ser Thr Tyr Pro Gly Val Gln
Met Arg Gly Val Leu210 215 220cga caa gtg
att aag cag ctc gat gca tct gag atc aac gct cag cca 720Arg Gln Val
Ile Lys Gln Leu Asp Ala Ser Glu Ile Asn Ala Gln Pro225
230 235 240gcg cca gtc gtc gag aat gaa
gtt gcc aaa aac cga gat aac tca ccc 768Ala Pro Val Val Glu Asn Glu
Val Ala Lys Asn Arg Asp Asn Ser Pro245 250
255gtc att aca caa gct ttc ttc tgg ccg cgc gtg gga gag ttc ctg aag
816Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val Gly Glu Phe Leu Lys260
265 270aag aac gac atc gtc att acc gag act
gga aca gcc aac ttt ggc atc 864Lys Asn Asp Ile Val Ile Thr Glu Thr
Gly Thr Ala Asn Phe Gly Ile275 280 285tgg
gat act aag ttt ccc tct ggc gtt act gcg ctt tct cag gtc ctt 912Trp
Asp Thr Lys Phe Pro Ser Gly Val Thr Ala Leu Ser Gln Val Leu290
295 300tgg gga agc att ggt tgg tcc gtt ggt gcc tgc
caa gga gcc gtt ctt 960Trp Gly Ser Ile Gly Trp Ser Val Gly Ala Cys
Gln Gly Ala Val Leu305 310 315
320gca gcc gcc gat gac aac agc gat cgc aga act atc ctc ttt gtt ggt
1008Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr Ile Leu Phe Val Gly325
330 335gat ggc tca ttc cag ctc act gct caa
gaa ttg agc aca atg att cgt 1056Asp Gly Ser Phe Gln Leu Thr Ala Gln
Glu Leu Ser Thr Met Ile Arg340 345 350ctc
aag ctg aag ccc atc atc ttt gtc atc tgc aac gat ggc ttt acc 1104Leu
Lys Leu Lys Pro Ile Ile Phe Val Ile Cys Asn Asp Gly Phe Thr355
360 365att gaa cga ttc att cac ggc atg gaa gcc gag
tac aac gac atc gca 1152Ile Glu Arg Phe Ile His Gly Met Glu Ala Glu
Tyr Asn Asp Ile Ala370 375 380aat tgg gac
ttc aag gct ctg gtt gac gtc ttt ggc ggc tct aag acg 1200Asn Trp Asp
Phe Lys Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr385
390 395 400gcc aag aag ttc gcc gtc aag
acc aag gac gag ctg gac agc ctt ctc 1248Ala Lys Lys Phe Ala Val Lys
Thr Lys Asp Glu Leu Asp Ser Leu Leu405 410
415aca gac cct acc ttt aac gcc gca gaa tgc ctc cag ttt gtc gag cta
1296Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu Gln Phe Val Glu Leu420
425 430tat atg ccc aaa gaa gat gct cct cga
gca ttg atc atg act gca gaa 1344Tyr Met Pro Lys Glu Asp Ala Pro Arg
Ala Leu Ile Met Thr Ala Glu435 440 445gct
agc gcg agg aac aat gcc aag aca gag taa agtggactgt catgaaggcc 1397Ala
Ser Ala Arg Asn Asn Ala Lys Thr Glu *450 455gatttaccac
ctcataaatt gtaatagacc tgatacacat agatcaaggc aggtaccgat 1457cattaatcaa
gcaggtttgg atggggaagg attttgaaaa tgaggaaacg atgggatgat 1517atttggaata
actggccatt attttgagta cttataaaca aatttgaagt tcaatttttt 1577ttcaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaa
1636101374DNAUnknownCDS(1)...(1374)Fungal isolate from soil sample 10cga
aac ggc atg ctc ctc cac cac acg ctt gga aac ggc gac ttc aac 48Arg
Asn Gly Met Leu Leu His His Thr Leu Gly Asn Gly Asp Phe Asn1
5 10 15atc ttt gcc aac atg agc gct
caa atc tct tgc gaa gtg gcc aag ctc 96Ile Phe Ala Asn Met Ser Ala
Gln Ile Ser Cys Glu Val Ala Lys Leu20 25
30acc aac cct gcc gaa att gcg acc cag atc gac cat gcc ctc cgc gtt
144Thr Asn Pro Ala Glu Ile Ala Thr Gln Ile Asp His Ala Leu Arg Val35
40 45tgc ttc att cgt tct cgg ccc gtc tac atc
atg ctt ccc acc gat atg 192Cys Phe Ile Arg Ser Arg Pro Val Tyr Ile
Met Leu Pro Thr Asp Met50 55 60gtc cag
gcc aaa gta gaa ggt gcc aga ctc aag gaa cca att gac ttg 240Val Gln
Ala Lys Val Glu Gly Ala Arg Leu Lys Glu Pro Ile Asp Leu65
70 75 80tcg gag cct cca aat gat ccc
gag aaa gaa gca tac gtc gtt gac gtt 288Ser Glu Pro Pro Asn Asp Pro
Glu Lys Glu Ala Tyr Val Val Asp Val85 90
95gtc ctc aag tac ctc cgt gct gca aag aac ccc gtc atc ctt gtc gat
336Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro Val Ile Leu Val Asp100
105 110gct tgt gct atc cgt cat cgt gtt ctt
gat gag gtt cat gat ctc atc 384Ala Cys Ala Ile Arg His Arg Val Leu
Asp Glu Val His Asp Leu Ile115 120 125gaa
aag aca aac ctc cct gtc ttt gtc act cct atg ggc aaa ggt gct 432Glu
Lys Thr Asn Leu Pro Val Phe Val Thr Pro Met Gly Lys Gly Ala130
135 140gtt aac gaa gaa cac ccg aca tat ggt ggt gtc
tat gcc ggt gac ggc 480Val Asn Glu Glu His Pro Thr Tyr Gly Gly Val
Tyr Ala Gly Asp Gly145 150 155
160tca cat ccg cct caa gtt aag gac atg gtt gag tct tct gat ttg ata
528Ser His Pro Pro Gln Val Lys Asp Met Val Glu Ser Ser Asp Leu Ile165
170 175ttg aca atc ggt gct ctc aag agc gac
ttc aac act gct ggc ttc tct 576Leu Thr Ile Gly Ala Leu Lys Ser Asp
Phe Asn Thr Ala Gly Phe Ser180 185 190tac
cgt acc tca cag ctg aac acg att gat cta cac agc gac cac tgc 624Tyr
Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu His Ser Asp His Cys195
200 205att gtc aaa tac tcg aca tat cca ggt gtc cag
atg agg ggt gtg ctg 672Ile Val Lys Tyr Ser Thr Tyr Pro Gly Val Gln
Met Arg Gly Val Leu210 215 220cga caa gtg
att aag cag ctc gat gca tct gag atc aac gct cag cca 720Arg Gln Val
Ile Lys Gln Leu Asp Ala Ser Glu Ile Asn Ala Gln Pro225
230 235 240gcg cca gtc gtc gag aat gaa
gtt gcc aaa aac cga gat aac tca ccc 768Ala Pro Val Val Glu Asn Glu
Val Ala Lys Asn Arg Asp Asn Ser Pro245 250
255gtc att aca caa gct ttc ttc tgg ccg cgc gtg gga gag ttc ctg aag
816Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val Gly Glu Phe Leu Lys260
265 270aag aac gac atc gtc att acc gag act
gga aca gcc aac ttt ggc atc 864Lys Asn Asp Ile Val Ile Thr Glu Thr
Gly Thr Ala Asn Phe Gly Ile275 280 285tgg
gat act aag ttt ccc tct ggc gtt act gcg ctt tct cag gtc ctt 912Trp
Asp Thr Lys Phe Pro Ser Gly Val Thr Ala Leu Ser Gln Val Leu290
295 300tgg gga agc att ggt tgg tcc gtt ggt gcc tgc
caa gga gcc gtt ctt 960Trp Gly Ser Ile Gly Trp Ser Val Gly Ala Cys
Gln Gly Ala Val Leu305 310 315
320gca gcc gcc gat gac aac agc gat cgc aga act atc ctc ttt gtt ggt
1008Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr Ile Leu Phe Val Gly325
330 335gat ggc tca ttc cag ctc act gct caa
gaa ttg agc aca atg att cgt 1056Asp Gly Ser Phe Gln Leu Thr Ala Gln
Glu Leu Ser Thr Met Ile Arg340 345 350ctc
aag ctg aag ccc atc atc ttt gtc atc tgc aac gat ggc ttt acc 1104Leu
Lys Leu Lys Pro Ile Ile Phe Val Ile Cys Asn Asp Gly Phe Thr355
360 365att gaa cga ttc att cac ggc atg gaa gcc gag
tac aac gac atc gca 1152Ile Glu Arg Phe Ile His Gly Met Glu Ala Glu
Tyr Asn Asp Ile Ala370 375 380aat tgg gac
ttc aag gct ctg gtt gac gtc ttt ggc ggc tct aag acg 1200Asn Trp Asp
Phe Lys Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr385
390 395 400gcc aag aag ttc gcc gtc aag
acc aag gac gag ctg gac agc ctt ctc 1248Ala Lys Lys Phe Ala Val Lys
Thr Lys Asp Glu Leu Asp Ser Leu Leu405 410
415aca gac cct acc ttt aac gcc gca gaa tgc ctc cag ttt gtc gag cta
1296Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu Gln Phe Val Glu Leu420
425 430tat atg ccc aaa gaa gat gct cct cga
gca ttg atc atg act gca gaa 1344Tyr Met Pro Lys Glu Asp Ala Pro Arg
Ala Leu Ile Met Thr Ala Glu435 440 445gct
agc gcg agg aac aat gcc aag aca gag 1374Ala
Ser Ala Arg Asn Asn Ala Lys Thr Glu450
45511458PRTUnknownFungal isolate from soil sample 11Arg Asn Gly Met Leu
Leu His His Thr Leu Gly Asn Gly Asp Phe Asn1 5
10 15Ile Phe Ala Asn Met Ser Ala Gln Ile Ser Cys
Glu Val Ala Lys Leu20 25 30Thr Asn Pro
Ala Glu Ile Ala Thr Gln Ile Asp His Ala Leu Arg Val35 40
45Cys Phe Ile Arg Ser Arg Pro Val Tyr Ile Met Leu Pro
Thr Asp Met50 55 60Val Gln Ala Lys Val
Glu Gly Ala Arg Leu Lys Glu Pro Ile Asp Leu65 70
75 80Ser Glu Pro Pro Asn Asp Pro Glu Lys Glu
Ala Tyr Val Val Asp Val85 90 95Val Leu
Lys Tyr Leu Arg Ala Ala Lys Asn Pro Val Ile Leu Val Asp100
105 110Ala Cys Ala Ile Arg His Arg Val Leu Asp Glu Val
His Asp Leu Ile115 120 125Glu Lys Thr Asn
Leu Pro Val Phe Val Thr Pro Met Gly Lys Gly Ala130 135
140Val Asn Glu Glu His Pro Thr Tyr Gly Gly Val Tyr Ala Gly
Asp Gly145 150 155 160Ser
His Pro Pro Gln Val Lys Asp Met Val Glu Ser Ser Asp Leu Ile165
170 175Leu Thr Ile Gly Ala Leu Lys Ser Asp Phe Asn
Thr Ala Gly Phe Ser180 185 190Tyr Arg Thr
Ser Gln Leu Asn Thr Ile Asp Leu His Ser Asp His Cys195
200 205Ile Val Lys Tyr Ser Thr Tyr Pro Gly Val Gln Met
Arg Gly Val Leu210 215 220Arg Gln Val Ile
Lys Gln Leu Asp Ala Ser Glu Ile Asn Ala Gln Pro225 230
235 240Ala Pro Val Val Glu Asn Glu Val Ala
Lys Asn Arg Asp Asn Ser Pro245 250 255Val
Ile Thr Gln Ala Phe Phe Trp Pro Arg Val Gly Glu Phe Leu Lys260
265 270Lys Asn Asp Ile Val Ile Thr Glu Thr Gly Thr
Ala Asn Phe Gly Ile275 280 285Trp Asp Thr
Lys Phe Pro Ser Gly Val Thr Ala Leu Ser Gln Val Leu290
295 300Trp Gly Ser Ile Gly Trp Ser Val Gly Ala Cys Gln
Gly Ala Val Leu305 310 315
320Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr Ile Leu Phe Val Gly325
330 335Asp Gly Ser Phe Gln Leu Thr Ala Gln
Glu Leu Ser Thr Met Ile Arg340 345 350Leu
Lys Leu Lys Pro Ile Ile Phe Val Ile Cys Asn Asp Gly Phe Thr355
360 365Ile Glu Arg Phe Ile His Gly Met Glu Ala Glu
Tyr Asn Asp Ile Ala370 375 380Asn Trp Asp
Phe Lys Ala Leu Val Asp Val Phe Gly Gly Ser Lys Thr385
390 395 400Ala Lys Lys Phe Ala Val Lys
Thr Lys Asp Glu Leu Asp Ser Leu Leu405 410
415Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu Gln Phe Val Glu Leu420
425 430Tyr Met Pro Lys Glu Asp Ala Pro Arg
Ala Leu Ile Met Thr Ala Glu435 440 445Ala
Ser Ala Arg Asn Asn Ala Lys Thr Glu450
4551230DNAUnknownCDS(1)...(30)Oligonucleotide used for PCR amplification
of GDC-1 12tcc cag atg cca aag ttg gct gtt cca gtc
30Ser Gln Met Pro Lys Leu Ala Val Pro Val1 5
1013563PRTSaccharomyces cerevisiae 13Met Ser Glu Ile Thr
Leu Gly Lys Tyr Leu Phe Glu Arg Leu Lys Gln1 5
10 15Val Asn Val Asn Thr Val Phe Gly Leu Pro Gly
Asp Phe Asn Leu Ser20 25 30Leu Leu Asp
Lys Ile Tyr Glu Val Glu Gly Met Arg Trp Ala Gly Asn35 40
45Ala Asn Glu Leu Asn Ala Arg Tyr Ala Ala Asp Gly Tyr
Ala Arg Ile50 55 60Lys Gly Met Ser Cys
Ile Ile Thr Thr Phe Gly Val Gly Glu Leu Ser65 70
75 80Ala Leu Asn Gly Ile Ala Gly Ser Tyr Ala
Glu His Val Gly Val Leu85 90 95His Val
Val Gly Val Pro Ser Ile Ser Ser Gln Ala Lys Gln Leu Leu100
105 110Leu His His Thr Leu Gly Asn Gly Asp Phe Thr Val
Phe His Arg Met115 120 125Ser Ala Asn Ile
Ser Glu Thr Thr Ala Met Ile Thr Asp Ile Cys Thr130 135
140Ala Pro Ala Glu Ile Asp Arg Cys Ile Arg Thr Thr Tyr Val
Thr Gln145 150 155 160Arg
Pro Val Tyr Leu Gly Leu Pro Ala Asn Leu Val Asp Leu Asn Val165
170 175Pro Ala Lys Leu Leu Gln Thr Pro Ile Asp Met
Ser Leu Lys Pro Asn180 185 190Asp Ala Glu
Ser Glu Lys Glu Val Ile Asp Thr Ile Leu Val Leu Ala195
200 205Lys Asp Ala Lys Asn Pro Val Ile Leu Ala Asp Ala
Cys Cys Ser Arg210 215 220His Asp Val Lys
Ala Glu Thr Lys Lys Leu Ile Asp Leu Thr Gln Phe225 230
235 240Pro Ala Phe Val Thr Pro Met Gly Lys
Gly Ser Ile Ser Glu Gln His245 250 255Pro
Arg Tyr Gly Gly Val Tyr Val Gly Thr Leu Ser Lys Pro Glu Val260
265 270Lys Glu Ala Val Glu Ser Ala Asp Leu Ile Leu
Ser Val Gly Ala Leu275 280 285Leu Ser Asp
Phe Asn Thr Gly Ser Phe Ser Tyr Ser Tyr Lys Thr Lys290
295 300Asn Ile Val Glu Phe His Ser Asp His Met Lys Ile
Arg Asn Ala Thr305 310 315
320Phe Pro Gly Val Gln Met Lys Phe Val Leu Gln Lys Leu Leu Thr Asn325
330 335Ile Ala Asp Ala Ala Lys Gly Tyr Lys
Pro Val Ala Val Pro Ala Arg340 345 350Thr
Pro Ala Asn Ala Ala Val Pro Ala Ser Thr Pro Leu Lys Gln Glu355
360 365Trp Met Trp Asn Gln Leu Gly Asn Phe Leu Gln
Glu Gly Asp Val Val370 375 380Ile Ala Glu
Thr Gly Thr Ser Ala Phe Gly Ile Asn Gln Thr Thr Phe385
390 395 400Pro Asn Asn Thr Tyr Gly Ile
Ser Gln Val Leu Trp Gly Ser Ile Gly405 410
415Phe Thr Thr Gly Ala Thr Leu Gly Ala Ala Phe Ala Ala Glu Glu Ile420
425 430Asp Pro Lys Lys Arg Val Ile Leu Phe
Ile Gly Asp Gly Ser Leu Gln435 440 445Leu
Thr Val Gln Glu Ile Ser Thr Met Ile Arg Trp Gly Leu Lys Pro450
455 460Tyr Leu Phe Val Leu Asn Asn Asp Gly Tyr Thr
Ile Glu Lys Leu Ile465 470 475
480His Gly Pro Lys Ala Gln Tyr Asn Glu Ile Gln Gly Trp Asp His
Leu485 490 495Ser Leu Leu Pro Thr Phe Gly
Ala Lys Asp Tyr Glu Thr His Arg Val500 505
510Ala Thr Thr Gly Glu Trp Asp Lys Leu Thr Gln Asp Lys Ser Phe Asn515
520 525Asp Asn Ser Lys Ile Arg Met Ile Glu
Val Met Leu Pro Val Phe Asp530 535 540Ala
Pro Gln Asn Leu Val Glu Gln Ala Lys Leu Thr Ala Ala Thr Asn545
550 555 560Ala Lys
Gln14550PRTSalmonella typhimurium 14Met Gln Asn Pro Tyr Thr Val Ala Asp
Tyr Leu Leu Asp Arg Leu Ala1 5 10
15Gly Cys Gly Ile Gly His Leu Phe Gly Val Pro Gly Asp Tyr Asn
Leu20 25 30Gln Phe Leu Asp His Val Ile
Asp His Pro Thr Leu Arg Trp Val Gly35 40
45Cys Ala Asn Glu Leu Asn Ala Ala Tyr Ala Ala Asp Gly Tyr Ala Arg50
55 60Met Ser Gly Ala Gly Ala Leu Leu Thr Thr
Phe Gly Val Gly Glu Leu65 70 75
80Ser Ala Ile Asn Gly Ile Ala Gly Ser Tyr Ala Glu Tyr Val Pro
Val85 90 95Leu His Ile Val Gly Ala Pro
Cys Ser Ala Ala Gln Gln Arg Gly Glu100 105
110Leu Met His His Thr Leu Gly Asp Gly Asp Phe Arg His Phe Tyr Arg115
120 125Met Ser Gln Ala Ile Ser Ala Ala Ser
Ala Ile Leu Asp Glu Gln Asn130 135 140Ala
Cys Phe Glu Ile Asp Arg Val Leu Gly Glu Met Leu Ala Ala Arg145
150 155 160Arg Pro Gly Tyr Ile Met
Leu Pro Ala Asp Val Ala Lys Lys Thr Ala165 170
175Ile Pro Pro Thr Gln Ala Leu Ala Leu Pro Val His Glu Ala Gln
Ser180 185 190Gly Val Glu Thr Ala Phe Arg
Tyr His Ala Arg Gln Cys Leu Met Asn195 200
205Ser Arg Arg Ile Ala Leu Leu Ala Asp Phe Leu Ala Gly Arg Phe Gly210
215 220Leu Arg Pro Leu Leu Gln Arg Trp Met
Ala Glu Thr Pro Ile Ala His225 230 235
240Ala Thr Leu Leu Met Gly Lys Gly Leu Phe Asp Glu Gln His
Pro Asn245 250 255Phe Val Gly Thr Tyr Ser
Ala Gly Ala Ser Ser Lys Glu Val Arg Gln260 265
270Ala Ile Glu Asp Ala Asp Arg Val Ile Cys Val Gly Thr Arg Phe
Val275 280 285Asp Thr Leu Thr Ala Gly Phe
Thr Gln Gln Leu Pro Ala Glu Arg Thr290 295
300Leu Glu Ile Gln Pro Tyr Ala Ser Arg Ile Gly Glu Thr Trp Phe Asn305
310 315 320Leu Pro Met Ala
Gln Ala Val Ser Thr Leu Arg Glu Leu Cys Leu Glu325 330
335Cys Ala Phe Ala Pro Pro Pro Thr Arg Ser Ala Gly Gln Pro
Val Arg340 345 350Ile Asp Lys Gly Glu Leu
Thr Gln Glu Ser Phe Trp Gln Thr Leu Gln355 360
365Gln Tyr Leu Lys Pro Gly Asp Ile Ile Leu Val Asp Gln Gly Thr
Ala370 375 380Ala Phe Gly Ala Ala Ala Leu
Ser Leu Pro Asp Gly Ala Glu Val Val385 390
395 400Leu Gln Pro Leu Trp Gly Ser Ile Gly Tyr Ser Leu
Pro Ala Ala Phe405 410 415Gly Ala Gln Thr
Ala Cys Pro Asp Arg Arg Val Ile Leu Ile Ile Gly420 425
430Asp Gly Ala Ala Gln Leu Thr Ile Gln Glu Met Gly Ser Met
Leu Arg435 440 445Asp Gly Gln Ala Pro Val
Ile Leu Leu Leu Asn Asn Asp Gly Tyr Thr450 455
460Val Glu Arg Ala Ile His Gly Ala Ala Gln Arg Tyr Asn Asp Ile
Ala465 470 475 480Ser Trp
Asn Trp Thr Gln Ile Pro Pro Ala Leu Asn Ala Ala Gln Gln485
490 495Ala Glu Cys Trp Arg Val Thr Gln Ala Ile Gln Leu
Ala Glu Val Leu500 505 510Glu Arg Leu Ala
Arg Pro Gln Arg Leu Ser Phe Ile Glu Val Met Leu515 520
525Pro Lys Ala Asp Leu Pro Glu Leu Leu Arg Thr Val Thr Arg
Ala Leu530 535 540Glu Ala Arg Asn Gly
Gly545 55015568PRTZymomonas mobilis 15Met Ser Tyr Thr Val
Gly Thr Tyr Leu Ala Glu Arg Leu Val Gln Ile1 5
10 15Gly Leu Lys His His Phe Ala Val Ala Gly Asp
Tyr Asn Leu Val Leu20 25 30Leu Asp Asn
Leu Leu Leu Asn Lys Asn Met Glu Gln Val Tyr Cys Cys35 40
45Asn Glu Leu Asn Cys Gly Phe Ser Ala Glu Gly Tyr Ala
Arg Ala Lys50 55 60Gly Ala Ala Ala Ala
Val Val Thr Tyr Ser Val Gly Ala His Ser Ala65 70
75 80Phe Asp Ala Ile Gly Gly Ala Tyr Ala Glu
Asn Leu Pro Val Ile Leu85 90 95Ile Ser
Gly Ala Pro Asn Asn Asn Asp His Ala Ala Gly His Val Leu100
105 110His His Ala Leu Gly Lys Thr Asp Tyr His Tyr Gln
Leu Glu Met Ala115 120 125Lys Asn Ile Thr
Ala Ala Ala Glu Ala Ile Tyr Thr Pro Glu Glu Ala130 135
140Pro Ala Lys Ile Asp His Val Ile Lys Thr Ala Leu Ala Lys
Lys Lys145 150 155 160Pro
Val Tyr Leu Glu Ile Ala Cys Asn Ile Ala Ser Met Pro Cys Ala165
170 175Ala Pro Gly Pro Ala Ser Ala Leu Phe Asn Asp
Glu Ala Ser Asp Glu180 185 190Ala Ser Leu
Asn Ala Ala Val Asp Glu Thr Leu Lys Phe Ile Ala Asn195
200 205Arg Asp Lys Val Ala Val Leu Val Gly Ser Lys Leu
Arg Ala Ala Gly210 215 220Ala Glu Glu Ala
Ala Val Lys Phe Thr Asp Ala Leu Gly Gly Ala Val225 230
235 240Ala Thr Met Ala Ala Ala Lys Ser Phe
Phe Pro Glu Glu Asn Pro His245 250 255Tyr
Ile Gly Thr Ser Trp Gly Glu Val Ser Tyr Pro Gly Val Glu Lys260
265 270Thr Met Lys Glu Ala Asp Ala Val Ile Ala Leu
Ala Pro Val Phe Asn275 280 285Asp Tyr Ser
Thr Thr Gly Trp Thr Asp Ile Pro Asp Pro Lys Lys Leu290
295 300Val Leu Ala Glu Pro Arg Ser Val Val Val Arg Arg
Ile Arg Phe Pro305 310 315
320Ser Val His Leu Lys Asp Tyr Leu Thr Arg Leu Ala Gln Lys Val Ser325
330 335Lys Lys Thr Gly Ser Leu Asp Phe Phe
Lys Ser Leu Asn Ala Gly Glu340 345 350Leu
Lys Lys Ala Ala Pro Ala Asp Pro Ser Ala Pro Leu Val Asn Ala355
360 365Glu Ile Ala Arg Gln Val Glu Ala Leu Leu Thr
Pro Asn Thr Thr Val370 375 380Ile Ala Glu
Thr Gly Asp Ser Trp Phe Asn Ala Gln Arg Met Lys Leu385
390 395 400Pro Asn Gly Ala Arg Val Glu
Tyr Glu Met Gln Trp Gly His Ile Gly405 410
415Trp Ser Val Pro Ala Ala Phe Gly Tyr Ala Val Gly Ala Pro Glu Arg420
425 430Arg Asn Ile Leu Met Val Gly Asp Gly
Ser Phe Gln Leu Thr Ala Gln435 440 445Glu
Val Ala Gln Met Val Arg Leu Lys Leu Pro Val Ile Ile Phe Leu450
455 460Ile Asn Asn Tyr Gly Tyr Thr Ile Glu Val Met
Ile His Asp Gly Pro465 470 475
480Tyr Asn Asn Ile Lys Asn Trp Asp Tyr Ala Gly Leu Met Glu Val
Phe485 490 495Asn Gly Asn Gly Gly Tyr Asp
Ser Gly Ala Ala Lys Gly Leu Lys Ala500 505
510Lys Thr Gly Gly Glu Leu Ala Glu Ala Ile Lys Val Ala Leu Ala Asn515
520 525Thr Asp Gly Pro Thr Leu Ile Glu Cys
Phe Ile Gly Arg Glu Asp Cys530 535 540Thr
Glu Glu Leu Val Lys Trp Gly Lys Arg Val Ala Ala Ala Asn Ser545
550 555 560Arg Lys Pro Val Asn Lys
Leu Leu56516687PRTSaccharomyces cerevisiae 16Met Ile Arg Gln Ser Thr Leu
Lys Asn Phe Ala Ile Lys Arg Cys Phe1 5 10
15Gln His Ile Ala Tyr Arg Asn Thr Pro Ala Met Arg Ser
Val Ala Leu20 25 30Ala Gln Arg Phe Tyr
Ser Ser Ser Ser Arg Tyr Tyr Ser Ala Ser Pro35 40
45Leu Pro Ala Ser Lys Arg Pro Glu Pro Ala Pro Ser Phe Asn Val
Asp50 55 60Pro Leu Glu Gln Pro Ala Glu
Pro Ser Lys Leu Ala Lys Lys Leu Arg65 70
75 80Ala Glu Pro Asp Met Asp Thr Ser Phe Val Gly Leu
Thr Gly Gly Gln85 90 95Ile Phe Asn Glu
Met Met Ser Arg Gln Asn Val Asp Thr Val Phe Gly100 105
110Tyr Pro Gly Gly Ala Ile Leu Pro Val Tyr Asp Ala Ile His
Asn Ser115 120 125Asp Lys Phe Asn Phe Val
Leu Pro Lys His Glu Gln Gly Ala Gly His130 135
140Met Ala Glu Gly Tyr Ala Arg Ala Ser Gly Lys Pro Gly Val Val
Leu145 150 155 160Val Thr
Ser Gly Pro Gly Ala Thr Asn Val Val Thr Pro Met Ala Asp165
170 175Ala Phe Ala Asp Gly Ile Pro Met Val Val Phe Thr
Gly Gln Val Pro180 185 190Thr Ser Ala Ile
Gly Thr Asp Ala Phe Gln Glu Ala Asp Val Val Gly195 200
205Ile Ser Arg Ser Cys Thr Lys Trp Asn Val Met Val Lys Ser
Val Glu210 215 220Glu Leu Pro Leu Arg Ile
Asn Glu Ala Phe Glu Ile Ala Thr Ser Gly225 230
235 240Arg Pro Gly Pro Val Leu Val Asp Leu Pro Lys
Asp Val Thr Ala Ala245 250 255Ile Leu Arg
Asn Pro Ile Pro Thr Lys Thr Thr Leu Pro Ser Asn Ala260
265 270Leu Asn Gln Leu Thr Ser Arg Ala Gln Asp Glu Phe
Val Met Gln Ser275 280 285Ile Asn Lys Ala
Ala Asp Leu Ile Asn Leu Ala Lys Lys Pro Val Leu290 295
300Tyr Val Gly Ala Gly Ile Leu Asn His Ala Asp Gly Pro Arg
Leu Leu305 310 315 320Lys
Glu Leu Ser Asp Arg Ala Gln Ile Pro Val Thr Thr Thr Leu Gln325
330 335Gly Leu Gly Ser Phe Asp Gln Glu Asp Pro Lys
Ser Leu Asp Met Leu340 345 350Gly Met His
Gly Cys Ala Thr Ala Asn Leu Ala Val Gln Asn Ala Asp355
360 365Leu Ile Ile Ala Val Gly Ala Arg Phe Asp Asp Arg
Val Thr Gly Asn370 375 380Ile Ser Lys Phe
Ala Pro Glu Ala Arg Arg Ala Ala Ala Glu Gly Arg385 390
395 400Gly Gly Ile Ile His Phe Glu Val Ser
Pro Lys Asn Ile Asn Lys Val405 410 415Val
Gln Thr Gln Ile Ala Val Glu Gly Asp Ala Thr Thr Asn Leu Gly420
425 430Lys Met Met Ser Lys Ile Phe Pro Val Lys Glu
Arg Ser Glu Trp Phe435 440 445Ala Gln Ile
Asn Lys Trp Lys Lys Glu Tyr Pro Tyr Ala Tyr Met Glu450
455 460Glu Thr Pro Gly Ser Lys Ile Lys Pro Gln Thr Val
Ile Lys Lys Leu465 470 475
480Ser Lys Val Ala Asn Asp Thr Gly Arg His Val Ile Val Thr Thr Gly485
490 495Val Gly Gln His Gln Met Trp Ala Ala
Gln His Trp Thr Trp Arg Asn500 505 510Pro
His Thr Phe Ile Thr Ser Gly Gly Leu Gly Thr Met Gly Tyr Gly515
520 525Leu Pro Ala Ala Ile Gly Ala Gln Val Ala Lys
Pro Glu Ser Leu Val530 535 540Ile Asp Ile
Asp Gly Asp Ala Ser Phe Asn Met Thr Leu Thr Glu Leu545
550 555 560Ser Ser Ala Val Gln Ala Gly
Thr Pro Val Lys Ile Leu Ile Leu Asn565 570
575Asn Glu Glu Gln Gly Met Val Thr Gln Trp Gln Ser Leu Phe Tyr Glu580
585 590His Arg Tyr Ser His Thr His Gln Leu
Asn Pro Asp Phe Ile Lys Leu595 600 605Ala
Glu Ala Met Gly Leu Lys Gly Leu Arg Val Lys Lys Gln Glu Glu610
615 620Leu Asp Ala Lys Leu Lys Glu Phe Val Ser Thr
Lys Gly Pro Val Leu625 630 635
640Leu Glu Val Glu Val Asp Lys Lys Val Pro Val Leu Pro Met Val
Ala645 650 655Gly Gly Ser Gly Leu Asp Glu
Phe Ile Asn Phe Asp Pro Glu Val Glu660 665
670Arg Gln Gln Thr Glu Leu Arg His Lys Arg Thr Gly Gly Lys His675
680 68517686PRTMagnaporthe grisea 17Met Leu Arg
Thr Val Gly Arg Lys Ala Leu Arg Gly Ser Ser Lys Gly1 5
10 15Cys Ser Arg Thr Ile Ser Thr Leu Lys
Pro Ala Thr Ala Thr Ile Ala20 25 30Lys
Pro Gly Ser Arg Thr Leu Ser Thr Pro Ala Thr Ala Thr Ala Thr35
40 45Ala Pro Arg Thr Lys Pro Ser Ala Ser Phe Asn
Ala Arg Arg Asp Pro50 55 60Gln Pro Leu
Val Asn Pro Arg Ser Gly Glu Ala Asp Glu Ser Phe Ile65 70
75 80Gly Lys Thr Gly Gly Glu Ile Phe
His Glu Met Met Leu Arg Gln Asn85 90
95Val Lys His Ile Phe Gly Tyr Pro Gly Gly Ala Ile Leu Pro Val Phe100
105 110Asp Ala Ile Tyr Asn Ser Lys His Ile Asp
Phe Val Leu Pro Lys His115 120 125Glu Gln
Gly Ala Gly His Met Ala Glu Gly Tyr Ala Arg Ala Ser Gly130
135 140Lys Pro Gly Val Val Leu Val Thr Ser Gly Pro Gly
Ala Thr Asn Val145 150 155
160Ile Thr Pro Met Ala Asp Ala Leu Ala Asp Gly Thr Pro Leu Val Val165
170 175Phe Ser Gly Gln Val Val Thr Ser Asp
Ile Gly Ser Asp Ala Phe Gln180 185 190Glu
Ala Asp Val Ile Gly Ile Ser Arg Ser Cys Thr Lys Trp Asn Val195
200 205Met Val Lys Ser Ala Asp Glu Leu Pro Arg Arg
Ile Asn Glu Ala Phe210 215 220Glu Ile Ala
Thr Ser Gly Arg Pro Gly Pro Val Leu Val Asp Pro Ala225
230 235 240Lys Asp Val Thr Ala Ser Val
Leu Arg Arg Ala Ile Pro Thr Glu Thr245 250
255Ser Ile Pro Ser Ile Ser Ala Ala Ala Arg Ala Val Gln Glu Ala Gly260
265 270Arg Lys Gln Leu Glu His Ser Ile Lys
Arg Val Ala Asp Leu Val Asn275 280 285Ile
Ala Lys Lys Pro Val Ile Tyr Ala Gly Gln Gly Val Ile Leu Ser290
295 300Glu Gly Gly Val Glu Leu Leu Lys Ala Leu Ala
Asp Lys Ala Ser Ile305 310 315
320Pro Val Thr Thr Thr Leu His Gly Leu Gly Ala Phe Asp Glu Leu
Asp325 330 335Glu Lys Ala Leu His Met Leu
Gly Met His Gly Ser Ala Tyr Ala Asn340 345
350Met Ser Met Gln Glu Ala Asp Leu Ile Ile Ala Leu Gly Gly Arg Phe355
360 365Asp Asp Arg Val Thr Gly Ser Ile Pro
Lys Phe Ala Pro Ala Ala Lys370 375 380Leu
Ala Ala Ala Glu Gly Arg Gly Gly Ile Val His Phe Glu Ile Met385
390 395 400Pro Lys Asn Ile Asn Lys
Val Val Gln Ala Thr Glu Ala Ile Glu Gly405 410
415Asp Val Ala Ser Asn Leu Lys Leu Leu Leu Pro Lys Ile Glu Gln
Arg420 425 430Ser Met Thr Asp Arg Lys Glu
Trp Phe Asp Gln Ile Lys Glu Trp Lys435 440
445Glu Lys Trp Pro Leu Ser His Tyr Glu Arg Ala Glu Arg Ser Gly Leu450
455 460Ile Lys Pro Gln Thr Leu Ile Glu Glu
Leu Ser Asn Leu Thr Ala Asp465 470 475
480Arg Lys Asp Met Thr Tyr Ile Thr Thr Gly Val Gly Gln His
Gln Met485 490 495Trp Thr Ala Gln His Phe
Arg Trp Arg His Pro Arg Ser Met Ile Thr500 505
510Ser Gly Gly Leu Gly Thr Met Gly Tyr Gly Leu Pro Ala Ala Ile
Gly515 520 525Ala Lys Val Ala Arg Pro Asp
Ala Leu Val Ile Asp Ile Asp Gly Asp530 535
540Ala Ser Phe Asn Met Thr Leu Thr Glu Leu Ser Thr Ala Ala Gln Phe545
550 555 560Asn Ile Gly Val
Lys Val Ile Val Leu Asn Asn Glu Glu Gln Gly Met565 570
575Val Thr Gln Trp Gln Asn Leu Phe Tyr Glu Asp Arg Tyr Ser
His Thr580 585 590His Gln Arg Asn Pro Asp
Phe Met Lys Leu Ala Asp Ala Met Asp Val595 600
605Gln His Arg Arg Val Ser Lys Pro Asp Asp Val Gly Asp Ala Leu
Thr610 615 620Trp Leu Ile Asn Thr Asp Gly
Pro Ala Leu Leu Glu Val Met Thr Asp625 630
635 640Lys Lys Val Pro Val Leu Pro Met Val Pro Gly Gly
Asn Gly Leu His645 650 655Glu Phe Ile Thr
Phe Asp Ala Ser Lys Asp Lys Gln Arg Arg Glu Leu660 665
670Met Arg Ala Arg Thr Asn Gly Leu His Gly Arg Thr Ala
Val675 680 685181728DNAUnknownFungal
isolate from soil sample 18atg gcc agc atc aac atc agg gtg cag aat ctc
gag caa ccc atg gac 48Met Ala Ser Ile Asn Ile Arg Val Gln Asn Leu
Glu Gln Pro Met Asp1 5 10
15gtt gcc gag tat ctt ttc cgg cgt ctc cac gaa atc ggc att cgc tcc
96Val Ala Glu Tyr Leu Phe Arg Arg Leu His Glu Ile Gly Ile Arg Ser20
25 30atc cac ggt ctt cca ggc gat tac aac cct
ctt gcc ctc gac tat ttg 144Ile His Gly Leu Pro Gly Asp Tyr Asn Pro
Leu Ala Leu Asp Tyr Leu35 40 45cca tca
tgt ggc ctg aga tgg gtt ggc agc gtc aac gaa ctc aat gct 192Pro Ser
Cys Gly Leu Arg Trp Val Gly Ser Val Asn Glu Leu Asn Ala50
55 60gct tat gct gct gat ggc tat gcc cgc gtc aag cag
atg gga gct ctc 240Ala Tyr Ala Ala Asp Gly Tyr Ala Arg Val Lys Gln
Met Gly Ala Leu65 70 75
80atc acc act ttt gga gtg gga gag ctc tca gcc atc aat ggc gtt gcc
288Ile Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Ile Asn Gly Val Ala85
90 95ggt gcc ttt tcg gaa cac gtc cca gtc gtt
cac att gtt ggc tgc cct 336Gly Ala Phe Ser Glu His Val Pro Val Val
His Ile Val Gly Cys Pro100 105 110tcc act
gcc tcg cag cga aac ggc atg ctc ctc cac cac acg ctt gga 384Ser Thr
Ala Ser Gln Arg Asn Gly Met Leu Leu His His Thr Leu Gly115
120 125aac ggc gac ttc aac atc ttt gcc aac atg agc gct
caa atc tct tgc 432Asn Gly Asp Phe Asn Ile Phe Ala Asn Met Ser Ala
Gln Ile Ser Cys130 135 140gaa gtg gcc aag
ctc acc aac cct gcc gaa att gcg acc cag atc gac 480Glu Val Ala Lys
Leu Thr Asn Pro Ala Glu Ile Ala Thr Gln Ile Asp145 150
155 160cat gcc ctc cgc gtt tgc ttc att cgt
tct cgg ccc gtc tac atc atg 528His Ala Leu Arg Val Cys Phe Ile Arg
Ser Arg Pro Val Tyr Ile Met165 170 175ctt
ccc acc gat atg gtc cag gcc aaa gta gaa ggt gcc aga ctc aag 576Leu
Pro Thr Asp Met Val Gln Ala Lys Val Glu Gly Ala Arg Leu Lys180
185 190gaa cca att gac ttg tcg gag cct cca aat gat
ccc gag aaa gaa gca 624Glu Pro Ile Asp Leu Ser Glu Pro Pro Asn Asp
Pro Glu Lys Glu Ala195 200 205tac gtc gtt
gac gtt gtc ctc aag tac ctc cgt gct gca aag aac ccc 672Tyr Val Val
Asp Val Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro210
215 220gtc atc ctt gtc gat gct tgt gct atc cgt cat cgt
gtt ctt gat gag 720Val Ile Leu Val Asp Ala Cys Ala Ile Arg His Arg
Val Leu Asp Glu225 230 235
240gtt cat gat ctc atc gaa aag aca aac ctc ccc gtc ttt gtc act cct
768Val His Asp Leu Ile Glu Lys Thr Asn Leu Pro Val Phe Val Thr Pro245
250 255atg ggc aaa ggt gct gtt aac gaa gaa
cac ccg aca tat ggt ggt gtc 816Met Gly Lys Gly Ala Val Asn Glu Glu
His Pro Thr Tyr Gly Gly Val260 265 270tat
gcc ggt gac ggc tca cat ccg cct caa gtt aag gac atg gtt gag 864Tyr
Ala Gly Asp Gly Ser His Pro Pro Gln Val Lys Asp Met Val Glu275
280 285tct tct gat ttg ata ttg aca atc ggt gct ctc
aag agc gac ttc aac 912Ser Ser Asp Leu Ile Leu Thr Ile Gly Ala Leu
Lys Ser Asp Phe Asn290 295 300act gct ggc
ttc tct tac cgt acc tca cag ctg aac acg att gat cta 960Thr Ala Gly
Phe Ser Tyr Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu305
310 315 320cac agc gac cac tgc att gtc
aaa tac tcg aca tat cca ggt gtc cag 1008His Ser Asp His Cys Ile Val
Lys Tyr Ser Thr Tyr Pro Gly Val Gln325 330
335atg agg ggt gtg ctg cga caa gtg att aag cag ctc gat gca tct gag
1056Met Arg Gly Val Leu Arg Gln Val Ile Lys Gln Leu Asp Ala Ser Glu340
345 350atc aac gct cag cca gcg cca gtc gtc
gag aat gaa gtt gcc aaa aac 1104Ile Asn Ala Gln Pro Ala Pro Val Val
Glu Asn Glu Val Ala Lys Asn355 360 365cga
gat aac tca ccc gtc att aca caa gct ttc ttc tgg ccg cgc gtg 1152Arg
Asp Asn Ser Pro Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val370
375 380gga gag ttc ctg aag aag aac gac atc gtc att
acc gag act gga aca 1200Gly Glu Phe Leu Lys Lys Asn Asp Ile Val Ile
Thr Glu Thr Gly Thr385 390 395
400gcc aac ttt ggc atc tgg gat act aag ttt ccc tct ggc gtt act gcg
1248Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe Pro Ser Gly Val Thr Ala405
410 415ctt tct cag gtc ctt tgg gga agc att
ggt tgg tcc gtt ggt gcc tgc 1296Leu Ser Gln Val Leu Trp Gly Ser Ile
Gly Trp Ser Val Gly Ala Cys420 425 430caa
gga gcc gtt ctt gca gcc gcc gat gac aac agc gat cgc aga act 1344Gln
Gly Ala Val Leu Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr435
440 445atc ctc ttt gtt ggt gat ggc tca ttc cag ctc
act gct caa gaa ttg 1392Ile Leu Phe Val Gly Asp Gly Ser Phe Gln Leu
Thr Ala Gln Glu Leu450 455 460agc aca atg
att cgt ctc aag ctg aag ccc atc atc ttt gtc atc tgc 1440Ser Thr Met
Ile Arg Leu Lys Leu Lys Pro Ile Ile Phe Val Ile Cys465
470 475 480aac gat ggc ttt acc att gaa
cga ttc att cac ggc atg gaa gcc gag 1488Asn Asp Gly Phe Thr Ile Glu
Arg Phe Ile His Gly Met Glu Ala Glu485 490
495tac aac gac atc gca aat tgg gac ttc aag gct ctg gtt gac gtc ttt
1536Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys Ala Leu Val Asp Val Phe500
505 510ggc ggc tct aag acg gcc aag aag ttc
gcc gtc aag acc aag gac gag 1584Gly Gly Ser Lys Thr Ala Lys Lys Phe
Ala Val Lys Thr Lys Asp Glu515 520 525ctg
gac agc ctt ctc aca gac cct acc ttt aac gcc gca gaa tgc ctc 1632Leu
Asp Ser Leu Leu Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu530
535 540cag ttt gtc gag cta tat atg ccc aaa gaa gat
gct cct cga gca ttg 1680Gln Phe Val Glu Leu Tyr Met Pro Lys Glu Asp
Ala Pro Arg Ala Leu545 550 555
560atc atg acg gca gaa gct agc gcg agg aac aat gcc aag aca gag taa
1728Ile Met Thr Ala Glu Ala Ser Ala Arg Asn Asn Ala Lys Thr Glu *565
570 57519575PRTUnknownFungal isolate from
soil sample 19Met Ala Ser Ile Asn Ile Arg Val Gln Asn Leu Glu Gln Pro Met
Asp1 5 10 15Val Ala Glu
Tyr Leu Phe Arg Arg Leu His Glu Ile Gly Ile Arg Ser20 25
30Ile His Gly Leu Pro Gly Asp Tyr Asn Pro Leu Ala Leu
Asp Tyr Leu35 40 45Pro Ser Cys Gly Leu
Arg Trp Val Gly Ser Val Asn Glu Leu Asn Ala50 55
60Ala Tyr Ala Ala Asp Gly Tyr Ala Arg Val Lys Gln Met Gly Ala
Leu65 70 75 80Ile Thr
Thr Phe Gly Val Gly Glu Leu Ser Ala Ile Asn Gly Val Ala85
90 95Gly Ala Phe Ser Glu His Val Pro Val Val His Ile
Val Gly Cys Pro100 105 110Ser Thr Ala Ser
Gln Arg Asn Gly Met Leu Leu His His Thr Leu Gly115 120
125Asn Gly Asp Phe Asn Ile Phe Ala Asn Met Ser Ala Gln Ile
Ser Cys130 135 140Glu Val Ala Lys Leu Thr
Asn Pro Ala Glu Ile Ala Thr Gln Ile Asp145 150
155 160His Ala Leu Arg Val Cys Phe Ile Arg Ser Arg
Pro Val Tyr Ile Met165 170 175Leu Pro Thr
Asp Met Val Gln Ala Lys Val Glu Gly Ala Arg Leu Lys180
185 190Glu Pro Ile Asp Leu Ser Glu Pro Pro Asn Asp Pro
Glu Lys Glu Ala195 200 205Tyr Val Val Asp
Val Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro210 215
220Val Ile Leu Val Asp Ala Cys Ala Ile Arg His Arg Val Leu
Asp Glu225 230 235 240Val
His Asp Leu Ile Glu Lys Thr Asn Leu Pro Val Phe Val Thr Pro245
250 255Met Gly Lys Gly Ala Val Asn Glu Glu His Pro
Thr Tyr Gly Gly Val260 265 270Tyr Ala Gly
Asp Gly Ser His Pro Pro Gln Val Lys Asp Met Val Glu275
280 285Ser Ser Asp Leu Ile Leu Thr Ile Gly Ala Leu Lys
Ser Asp Phe Asn290 295 300Thr Ala Gly Phe
Ser Tyr Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu305 310
315 320His Ser Asp His Cys Ile Val Lys Tyr
Ser Thr Tyr Pro Gly Val Gln325 330 335Met
Arg Gly Val Leu Arg Gln Val Ile Lys Gln Leu Asp Ala Ser Glu340
345 350Ile Asn Ala Gln Pro Ala Pro Val Val Glu Asn
Glu Val Ala Lys Asn355 360 365Arg Asp Asn
Ser Pro Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val370
375 380Gly Glu Phe Leu Lys Lys Asn Asp Ile Val Ile Thr
Glu Thr Gly Thr385 390 395
400Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe Pro Ser Gly Val Thr Ala405
410 415Leu Ser Gln Val Leu Trp Gly Ser Ile
Gly Trp Ser Val Gly Ala Cys420 425 430Gln
Gly Ala Val Leu Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr435
440 445Ile Leu Phe Val Gly Asp Gly Ser Phe Gln Leu
Thr Ala Gln Glu Leu450 455 460Ser Thr Met
Ile Arg Leu Lys Leu Lys Pro Ile Ile Phe Val Ile Cys465
470 475 480Asn Asp Gly Phe Thr Ile Glu
Arg Phe Ile His Gly Met Glu Ala Glu485 490
495Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys Ala Leu Val Asp Val Phe500
505 510Gly Gly Ser Lys Thr Ala Lys Lys Phe
Ala Val Lys Thr Lys Asp Glu515 520 525Leu
Asp Ser Leu Leu Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu530
535 540Gln Phe Val Glu Leu Tyr Met Pro Lys Glu Asp
Ala Pro Arg Ala Leu545 550 555
560Ile Met Thr Ala Glu Ala Ser Ala Arg Asn Asn Ala Lys Thr Glu565
570 575201728DNAUnknownFungal isolate from
soil sample 20atg gcc agc atc aac atc agg gtg cag aat ctc gag caa ccc atg
gac 48Met Ala Ser Ile Asn Ile Arg Val Gln Asn Leu Glu Gln Pro Met
Asp1 5 10 15gtt gcc gag
tat ctt ttc cgg cgt ctc cac gaa atc ggc att cgc tcc 96Val Ala Glu
Tyr Leu Phe Arg Arg Leu His Glu Ile Gly Ile Arg Ser20 25
30atc cac ggt ctt cca ggc gat tac aac ctt ctt gcc ctc
gac tat ttg 144Ile His Gly Leu Pro Gly Asp Tyr Asn Leu Leu Ala Leu
Asp Tyr Leu35 40 45cca tca tgt ggc ctg
aga tgg gtt ggc agc gtc aac gaa ctc aat gct 192Pro Ser Cys Gly Leu
Arg Trp Val Gly Ser Val Asn Glu Leu Asn Ala50 55
60gct tat gct gct gat ggc tat gcc cgc gtc aag cag atg gga gct
ctc 240Ala Tyr Ala Ala Asp Gly Tyr Ala Arg Val Lys Gln Met Gly Ala
Leu65 70 75 80atc acc
act ttt gga gtg gga gag ctc tca gcc atc aat ggc gtt gcc 288Ile Thr
Thr Phe Gly Val Gly Glu Leu Ser Ala Ile Asn Gly Val Ala85
90 95ggt gcc ttt tcg gaa cac gtc cca gtc gtt cac att
gtt ggc tgc cct 336Gly Ala Phe Ser Glu His Val Pro Val Val His Ile
Val Gly Cys Pro100 105 110tcc act gcc tcg
cag cga aac ggc atg ctc ctc cac cac acg ctt gga 384Ser Thr Ala Ser
Gln Arg Asn Gly Met Leu Leu His His Thr Leu Gly115 120
125aac ggc gac ttc aac atc ttt gcc aac atg agc gct caa atc
tct tgc 432Asn Gly Asp Phe Asn Ile Phe Ala Asn Met Ser Ala Gln Ile
Ser Cys130 135 140gaa gtg gcc aag ctc acc
aac cct gcc gaa att gcg acc cag atc gac 480Glu Val Ala Lys Leu Thr
Asn Pro Ala Glu Ile Ala Thr Gln Ile Asp145 150
155 160cat gcc ctc cgc gtt tgc ttc att cgt tct cgg
ccc gtc tac atc atg 528His Ala Leu Arg Val Cys Phe Ile Arg Ser Arg
Pro Val Tyr Ile Met165 170 175ctt ccc acc
gat atg gtc cag gcc aaa gta gaa ggt gcc aga ctc aag 576Leu Pro Thr
Asp Met Val Gln Ala Lys Val Glu Gly Ala Arg Leu Lys180
185 190gaa cca att gac ttg tcg gag cct cca aat gat ccc
gag aaa gaa gca 624Glu Pro Ile Asp Leu Ser Glu Pro Pro Asn Asp Pro
Glu Lys Glu Ala195 200 205tac gtc gtt gac
gtt gtc ctc aag tac ctc cgt gct gca aag aac ccc 672Tyr Val Val Asp
Val Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro210 215
220gtc atc ctt gtc gat gct tgt gct atc cgt cat cgt gtt ctt
gat gag 720Val Ile Leu Val Asp Ala Cys Ala Ile Arg His Arg Val Leu
Asp Glu225 230 235 240gtt
cat gat ctc atc gaa aag aca aac ctc ccc gtc ttt gtc act cct 768Val
His Asp Leu Ile Glu Lys Thr Asn Leu Pro Val Phe Val Thr Pro245
250 255atg ggc aaa ggt gct gtt aac gaa gaa cac ccg
aca tat ggt ggt gtc 816Met Gly Lys Gly Ala Val Asn Glu Glu His Pro
Thr Tyr Gly Gly Val260 265 270tat gcc ggt
gac ggc tca cat ccg cct caa gtt aag gac atg gtt gag 864Tyr Ala Gly
Asp Gly Ser His Pro Pro Gln Val Lys Asp Met Val Glu275
280 285tct tct gat ttg ata ttg aca atc ggt gct ctc aag
agc gac ttc aac 912Ser Ser Asp Leu Ile Leu Thr Ile Gly Ala Leu Lys
Ser Asp Phe Asn290 295 300act gct ggc ttc
tct tac cgt acc tca cag ctg aac acg att gat cta 960Thr Ala Gly Phe
Ser Tyr Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu305 310
315 320cac agc gac cac tgc att gtc aaa tac
tcg aca tat cca ggt gtc cag 1008His Ser Asp His Cys Ile Val Lys Tyr
Ser Thr Tyr Pro Gly Val Gln325 330 335atg
agg ggt gtg ctg cga caa gtg att aag cag ctc gat gca tct gag 1056Met
Arg Gly Val Leu Arg Gln Val Ile Lys Gln Leu Asp Ala Ser Glu340
345 350atc aac gct cag cca gcg cca gtc gtc gag aat
gaa gtt gcc aaa aac 1104Ile Asn Ala Gln Pro Ala Pro Val Val Glu Asn
Glu Val Ala Lys Asn355 360 365cga gat aac
tca ccc gtc att aca caa gct ttc ttc tgg ccg cgc gtg 1152Arg Asp Asn
Ser Pro Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val370
375 380gga gag ttc ctg aag aag aac gac atc gtc att acc
gag act gga aca 1200Gly Glu Phe Leu Lys Lys Asn Asp Ile Val Ile Thr
Glu Thr Gly Thr385 390 395
400gcc aac ttt ggc atc tgg gat act aag ttt ccc tct ggc gtt act gcg
1248Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe Pro Ser Gly Val Thr Ala405
410 415ctt tct cag gtc ctt tgg gga agc att
ggt tgg tcc gtt ggt gcc tgc 1296Leu Ser Gln Val Leu Trp Gly Ser Ile
Gly Trp Ser Val Gly Ala Cys420 425 430caa
gga gcc gtt ctt gca gcc gcc gat gac aac agc gat cgc aga act 1344Gln
Gly Ala Val Leu Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr435
440 445atc ctc ttt gtt ggt gat ggc tca ttc cag ctc
act gct caa gaa ttg 1392Ile Leu Phe Val Gly Asp Gly Ser Phe Gln Leu
Thr Ala Gln Glu Leu450 455 460agc aca atg
att cgt ctc aag ctg aag ccc atc atc ttt gtc atc tgc 1440Ser Thr Met
Ile Arg Leu Lys Leu Lys Pro Ile Ile Phe Val Ile Cys465
470 475 480aac gat ggc ttt acc att gaa
cga ttc att cac ggc atg gaa gcc gag 1488Asn Asp Gly Phe Thr Ile Glu
Arg Phe Ile His Gly Met Glu Ala Glu485 490
495tac aac gac atc gca aat tgg gac ttc aag gct ctg gtt gac gtc ttt
1536Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys Ala Leu Val Asp Val Phe500
505 510ggc ggc tct aag acg gcc aag aag ttc
gcc gtc aag acc aag gac gag 1584Gly Gly Ser Lys Thr Ala Lys Lys Phe
Ala Val Lys Thr Lys Asp Glu515 520 525ctg
gac agc ctt ctc aca gac cct acc ttt aac gcc gca gaa tgc ctc 1632Leu
Asp Ser Leu Leu Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu530
535 540cag ttt gtc gag cta tat atg ccc aaa gaa gat
gct cct cga gca ttg 1680Gln Phe Val Glu Leu Tyr Met Pro Lys Glu Asp
Ala Pro Arg Ala Leu545 550 555
560atc atg acg gca gaa gct agc gcg agg aac aat gcc aag aca gag taa
1728Ile Met Thr Ala Glu Ala Ser Ala Arg Asn Asn Ala Lys Thr Glu *565
570 57521575PRTUnknownFungal isolate from
soil sample 21Met Ala Ser Ile Asn Ile Arg Val Gln Asn Leu Glu Gln Pro Met
Asp1 5 10 15Val Ala Glu
Tyr Leu Phe Arg Arg Leu His Glu Ile Gly Ile Arg Ser20 25
30Ile His Gly Leu Pro Gly Asp Tyr Asn Leu Leu Ala Leu
Asp Tyr Leu35 40 45Pro Ser Cys Gly Leu
Arg Trp Val Gly Ser Val Asn Glu Leu Asn Ala50 55
60Ala Tyr Ala Ala Asp Gly Tyr Ala Arg Val Lys Gln Met Gly Ala
Leu65 70 75 80Ile Thr
Thr Phe Gly Val Gly Glu Leu Ser Ala Ile Asn Gly Val Ala85
90 95Gly Ala Phe Ser Glu His Val Pro Val Val His Ile
Val Gly Cys Pro100 105 110Ser Thr Ala Ser
Gln Arg Asn Gly Met Leu Leu His His Thr Leu Gly115 120
125Asn Gly Asp Phe Asn Ile Phe Ala Asn Met Ser Ala Gln Ile
Ser Cys130 135 140Glu Val Ala Lys Leu Thr
Asn Pro Ala Glu Ile Ala Thr Gln Ile Asp145 150
155 160His Ala Leu Arg Val Cys Phe Ile Arg Ser Arg
Pro Val Tyr Ile Met165 170 175Leu Pro Thr
Asp Met Val Gln Ala Lys Val Glu Gly Ala Arg Leu Lys180
185 190Glu Pro Ile Asp Leu Ser Glu Pro Pro Asn Asp Pro
Glu Lys Glu Ala195 200 205Tyr Val Val Asp
Val Val Leu Lys Tyr Leu Arg Ala Ala Lys Asn Pro210 215
220Val Ile Leu Val Asp Ala Cys Ala Ile Arg His Arg Val Leu
Asp Glu225 230 235 240Val
His Asp Leu Ile Glu Lys Thr Asn Leu Pro Val Phe Val Thr Pro245
250 255Met Gly Lys Gly Ala Val Asn Glu Glu His Pro
Thr Tyr Gly Gly Val260 265 270Tyr Ala Gly
Asp Gly Ser His Pro Pro Gln Val Lys Asp Met Val Glu275
280 285Ser Ser Asp Leu Ile Leu Thr Ile Gly Ala Leu Lys
Ser Asp Phe Asn290 295 300Thr Ala Gly Phe
Ser Tyr Arg Thr Ser Gln Leu Asn Thr Ile Asp Leu305 310
315 320His Ser Asp His Cys Ile Val Lys Tyr
Ser Thr Tyr Pro Gly Val Gln325 330 335Met
Arg Gly Val Leu Arg Gln Val Ile Lys Gln Leu Asp Ala Ser Glu340
345 350Ile Asn Ala Gln Pro Ala Pro Val Val Glu Asn
Glu Val Ala Lys Asn355 360 365Arg Asp Asn
Ser Pro Val Ile Thr Gln Ala Phe Phe Trp Pro Arg Val370
375 380Gly Glu Phe Leu Lys Lys Asn Asp Ile Val Ile Thr
Glu Thr Gly Thr385 390 395
400Ala Asn Phe Gly Ile Trp Asp Thr Lys Phe Pro Ser Gly Val Thr Ala405
410 415Leu Ser Gln Val Leu Trp Gly Ser Ile
Gly Trp Ser Val Gly Ala Cys420 425 430Gln
Gly Ala Val Leu Ala Ala Ala Asp Asp Asn Ser Asp Arg Arg Thr435
440 445Ile Leu Phe Val Gly Asp Gly Ser Phe Gln Leu
Thr Ala Gln Glu Leu450 455 460Ser Thr Met
Ile Arg Leu Lys Leu Lys Pro Ile Ile Phe Val Ile Cys465
470 475 480Asn Asp Gly Phe Thr Ile Glu
Arg Phe Ile His Gly Met Glu Ala Glu485 490
495Tyr Asn Asp Ile Ala Asn Trp Asp Phe Lys Ala Leu Val Asp Val Phe500
505 510Gly Gly Ser Lys Thr Ala Lys Lys Phe
Ala Val Lys Thr Lys Asp Glu515 520 525Leu
Asp Ser Leu Leu Thr Asp Pro Thr Phe Asn Ala Ala Glu Cys Leu530
535 540Gln Phe Val Glu Leu Tyr Met Pro Lys Glu Asp
Ala Pro Arg Ala Leu545 550 555
560Ile Met Thr Ala Glu Ala Ser Ala Arg Asn Asn Ala Lys Thr Glu565
570 575
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: