Patent application title: Modified Fusion Polypeptides
Inventors:
Richard Ross (Sheffield, GB)
Jon Sayers (Sheffield, GB)
Jon Sayers (Sheffield, GB)
Peter Artymiuk (Sheffield, GB)
Assignees:
ASTERION LIMITED
IPC8 Class: AA61K3816FI
USPC Class:
514 12
Class name: Designated organic active ingredient containing (doai) peptide containing (e.g., protein, peptones, fibrinogen, etc.) doai 25 or more peptide repeating units in known peptide chain structure
Publication date: 2009-09-24
Patent application number: 20090239801
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Modified Fusion Polypeptides
Inventors:
Jon Sayers
Peter Artymiuk
Richard Ross
Agents:
CROWELL & MORING LLP;INTELLECTUAL PROPERTY GROUP
Assignees:
ASTERION LIMITED
Origin: WASHINGTON, DC US
IPC8 Class: AA61K3816FI
USPC Class:
514 12
Abstract:
Chimeric polypeptides wherein the polypeptides comprise a modified binding
domain of growth hormone linked to a receptor binding domain of growth
hormone receptor; and tandems/oligomers of such modified growth hormone
binding domains.Claims:
1. A fusion polypeptide comprising:i) a first modified growth hormone
receptor binding domain of growth hormone wherein said modification is
the addition, deletion or substitution of at least one amino acid
residue; andii) a second modified growth hormone receptor binding domain
of growth hormone wherein said modification is the addition deletion or
substitution of at least one amino acid residue,whereinsaid binding
domains are fused in tandem;the modification is to site 2 in at least one
binding domain of growth hormone, andsaid polypeptide is an antagonist of
growth hormone receptor.
2. A polypeptide according to claim 1, wherein said first and second binding domains are also modified in site 1 of growth hormone.
3. A polypeptide according to claim 1, wherein said first and second binding domains are modified in site 2 of growth hormone.
4. A polypeptide according to claim 1, wherein said modification is to binding domains of both site 1 and site 2 of growth hormone.
5. A polypeptide according to claim 2, wherein said modification comprises at least one amino acid substitution in the growth hormone amino acid sequence of SEQ ID NO:5 selected from the group consisting of: histidine 18 with alanine or aspartic acid; histidine 21 with asparagine; glutamine 22 with alanine; phenylalanine 25 with alanine; aspartic acid 26 with alanine; glutamine 29 with alanine; glutamic acid 167 with alanine; aspartic acid 171 with serine; lysine 172 with serine or alanine; and isoleucine 179 with tyrosine.
6. A polypeptide according to claim 5, wherein said modification consists of the following amino acid substitutions in the growth hormone amino acid sequence of SEQ ID NO:5: histidine 18 aspartic acid; histidine 21 asparagine; arginine 167 asparagine; aspartic acid 171 arginine; glutamic acid 174 serine; and isoleucine 179 threonine.
7. A polypeptide according to claim 5, wherein said modification consists of the following amino acid substitutions in the growth hormone amino acid sequence of SEQ ID NO:5: histidine 18 alanine; glutamine 22 alanine; phenylalanine 25 alanine; aspartic acid 26 alanine; glutamine 29 alanine; glutamic acid 65 alanine; lysine 168 alanine; and glutamic acid 174 alanine.
8. A polypeptide according to claim 1, wherein said site 2 modification is to amino acid residue glycine 120 of the amino acid sequence of SEQ ID NO: 5.
9. A polypeptide according to claim 8, wherein said site 2 modification is a substitution of glycine for an amino acid selected from the group consisting of arginine, alanine, lysine, tryptophan, tyrosine, phenylalanine, and glutamic acid.
10. A polypeptide according to claim 9, wherein said site 2 substitution is glycine 120 for arginine or lysine or alanine.
11. A polypeptide according to claim 1, wherein the first modified binding domain of growth hormone is linked by a linker to the second growth hormone binding domain.
12. A polypeptide according to claim 11, wherein the linker is a polypeptide which comprises 5 to 30 amino acid residues.
13. A polypeptide according to claim 12, wherein the linker comprises 10 to 20 amino acid residues.
14. A polypeptide according to claim 12, wherein the linker comprises at least one copy of the peptide Gly Gly Gly Gly Ser (SEQ ID NO:7).
15. A nucleic acid molecule which encodes a polypeptide according to claim 1.
16. A vector comprising a nucleic acid molecule according to claim 15.
17. A pharmaceutical composition comprising a polypeptide according to claim 1, and a pharmaceutically-acceptable carrier.
18. An isolated cell transformed with the nucleic acid or vector according to claim 15.
19. A method of treating growth hormone excess in a human subject, said method comprising administering to said human subject an effective amount of a polypeptide according to claim 1.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001]This application is a division of co-pending application Ser. No. 10/498,497, now U.S. Pat. No. ______, which was the US national stage of international application no. PCT/GB02/05523, filed Dec. 6, 2002. Priority is also claimed based on United Kingdom patent application no. GB 01 30052.4, filed Dec. 14, 2001.
BACKGROUND OF THE INVENTION
[0002]The invention relates to chimeric polypeptides wherein said polypeptides comprise a modified binding domain of growth hormone linked to a receptor binding domain of growth hormone receptor; and tandems/oligomers of said modified growth hormone binding domains.
[0003]Growth hormone (GH) is a member of a large family of hormones involved in the regulation of mammalian growth and development. Human GH is a 22 kDa polypeptide which is involved in a number of biological processes. For example, cell growth, lactation, the activation of macrophages and the regulation of energy metabolism. GH interacts sequentially with two membrane bound growth hormone receptors (GHR's) via two separate sites on GH referred as site 1 and site 2. Site 1 is a high affinity binding site and site 2 a low affinity site. A single GH molecule binds 1 GHR via site 1. A second GHR is then recruited via site 2 to form a GHR:GH:GHR complex. The complex is then internalized and activates a signal transduction cascade leading to changes in gene expression.
[0004]The extracellular domain of the GHR exists as two linked domains each of approximately 100 amino acids (SD-100), the C-terminal SD-100 domain (b) being closest to the cell surface and the N-terminal SD-100 domain (a) being furthest away. It is a conformational change in these two domains that occurs on hormone binding with the formation of the trimeric complex GHR-GH-GHR.
[0005]Modified GH's are disclosed in U.S. Pat. No. 5,849, 535 which is incorporated by reference. The modification to GH is at both site 1 and site 2 binding sites. The modifications to site 1 produce a GH molecule which has a higher affinity for GHR compared to wild-type GH. These modified GH molecules act agonists. There is also disclosure of site 2 modifications which result in the creation of GH antagonists. Further examples of modifications to GH which alter the binding affinity of GH for site 1 are disclosed in U.S. Pat. No. 5,854,026; U.S. Pat. No. 6,004,931; U.S. Pat. No. 6,022,711; U.S. Pat. No. 6,057,292; and U.S. Pat. No. 6,136,563 each of which are incorporated by reference. A summary of the modifications made to site 1 is provided in Table 1. Modifications to site 2 are also disclosed, in particular amino acid residue G120 which when modified to either arginine, lysine, tryptophan, tyrosine, phenylalanine, or glutamic acid creates a GH molecule with antagonistic properties.
[0006]In addition, the modified GH is coated in polyethylene glycol (PEG) by a process known as "pegylation" this has several beneficial effects. Firstly, the PEG coat increases the effective molecular weight of GH from 22 kD to approximately 40 kD. The effect this has is to decrease glomerular filtration of GH thereby increasing the half-life of GH in vivo which reduces the dose administered to produce the desired effect. In addition pegylation is thought to reduce both the immunogenicity and toxicity of proteins which are treated in this way, see Abuchowski et al J Biol Chem., 252, 3578-3581, (1977).
[0007]However, a consequence of pegylation is to reduce the affinity of the modified GH molecule for GHR. This means that an increased dose is required to counter the reduced affinity. This is undesirable since it counteracts the advantageous effect of pegylation with respect to increasing the half life of modified GH. It would be desirable to provide a modified GH molecule which does not require pegylation but has an increased half-life and also has the added benefits of reduced immunogenicity and lacks toxicity.
[0008]According to a first aspect of the invention there is provided a chimeric polypeptide comprising: [0009]i) at least one modified binding domain of growth hormone wherein said modification is the addition, deletion or substitution of at least one amino acid residue; and [0010]ii) a growth hormone binding domain of a growth hormone receptor.
[0011]In a preferred embodiment of the invention said polypeptide is modified in the site 1 binding domain of growth hormone.
[0012]In a further preferred embodiment of the invention said polypeptide is modified in the site 2 binding domain of growth hormone.
[0013]In a yet further preferred embodiment of the invention said polypeptide is modified at both site 1 and site 2 of growth hormone.
[0014]As previously described, site 1 mutations are known in the art which increase the affinity of growth hormone for its binding domain on growth hormone receptor. Such modified growth hormone acts as an agonist. If a site 1 modification is combined with a site 2 modification wherein the latter modification results in an inactive or partially active site 2 binding site then such a molecule is an antagonist. A modification just to site 2 which exploits a wild-type site 1 binding site also creates an antagonist.
[0015]In a further preferred embodiment of the invention there is provided a polypeptide comprising a site 1 binding domain which has been modified by amino acid substitution wherein said modification is selected from the group consisting of: histidine 18 with alanine or aspartic acid; and/or histidine 21 with asparagine; and/or glutamine 22 with alanine; and/or phenylalanine 25 with alanine; and/or aspartic acid 26 with alanine; and/or glutamine 29 with alanine; and/or glutamic acid 167 with alanine; and/or aspartic acid 171 with serine; and/or lysine 172 with serine or alanine; and/or isoleucine 179 with tyrosine, of the sequence represented in FIG. 13.
[0016]Preferably said modification to increase the affinity of site 1 for its binding domain in GHR consists of the amino acid substitutions: histidine 18 aspartic acid; histidine 21 asparagine; arginine 167 asparagine; aspartic acid 171 arginine; glutamic acid 174 serine; and isoleucine 179 threonine; as represented by the GH amino acid sequence in FIG. 13.
[0017]In a further preferred embodiment of the invention said modification to increase the affinity of site 1 for its binding domain in GHR consists of the amino acid substitutions: histidine 18 alanine; glutamine 22 alanine; phenylalanine 25 alanine; aspartic acid 26 alanine; glutamine 29 alanine; glutamic acid 65 alanine; lysine 168 alanine; and glutamic acid 174 alanine; as represented by the GH amino acid sequence in FIG. 13.
[0018]In a further preferred embodiment of the invention said site 2 modification is to amino acid residue 120 of the sequence presented in FIG. 13. Preferably said site 2 modification is combined with site 1 modifications as herein disclosed. Alternatively, GH is modified only at amino acid residue glycine 120.
[0019]In a preferred embodiment of the invention said site 2 modification is a substitution of glycine for an amino acid selected from the group consisting of: arginine; alanine; lysine; tryptophan; tyrosine; phenylalanine; and glutamic acid. Preferably said substitution is glycine 120 for arginine or lysine or alanine.
[0020]In a further preferred embodiment of the invention the growth hormone binding domain of GHR is the extracellular domain of GHR. More preferably the binding domain is the C-terminal SD-100 domain of GH. Alternatively said binding domain is the full length GHR.
[0021]In a preferred embodiment of the invention said chimeric polypeptide is a fusion protein wherein the modified GH is an inframe translational fusion with GHR, or part thereof. Preferably, said fusion polypeptide comprises modified GH and the C-terminal SD-100 domain of GHR.
[0022]In an alternative further preferred embodiment of the invention, the modified binding domain of GH is linked by a linker to the GH binding domain of GHR. The linker may be flexible.
[0023]The linker could be at any residue within the extracellular domain of the receptor which would allow the modified GH to flexibly bind with the free receptor at the cell surface. Preferably the linkage is made between a residue close to the C-terminus of the modified GH molecule and a residue close to the N-terminus of GHR. More preferably the linkage is made between a residue close to the C-terminus of modified GH molecule and a residue close to the N-terminal of the N-terminal of the C-terminal SD-100. More preferably the linkage is made at any of residues 126-128 of the N-terminus of the C-terminal SD-100 of the GHR. In one embodiment of the invention, the linkage is made at residue 127 of the N-terminus of the C-terminal SD-100. Preferably the linker is a peptide.
[0024]The crystal structure of the GHR:GH:GHR complex reveals that the distance between the C-terminus of GH (residue 191) and N-terminus of the C-terminus SD-100 (residue 126-128) is 10A. This provides invaluable information with respect to linker design.
[0025]Preferably the linker is a polypeptide which comprises 5 to 30 amino acid residues. More preferably the linker comprises 10 to 20 amino acid residues. More preferably still the linker comprises at least one copy of the peptide:
TABLE-US-00001 Gly Gly Gly Gly Ser (SEQ ID NO:7) (hereinafter referred to as "Gly4Ser").
[0026]In one embodiment of the invention the linker is 10 amino acids in length and comprises two copies of the Gly4Ser linker. In an alternative embodiment of the invention, the linker is 15 amino acids in length and comprises three copies of the Gly4Ser linker. In yet an alternative embodiment, the linker is 20 amino acids in length and comprises four copies of the Gly4Ser linker.
[0027]In a preferred embodiment of the invention said polypeptide is derived from human GH and human GHR.
[0028]According to a further aspect of the invention there is provided a nucleic acid molecule which encodes a polypeptide according to the invention selected from the group consisting of: [0029]i) a nucleic acid molecule as represented by the nucleic acid sequence in FIG. 13; and [0030]ii) a nucleic acid molecule which hybridizes to the nucleic acid sequence in (i).
[0031]Nucleic acid molecules which encode a modified growth hormone according to the invention can typically be synthesized by molecular techniques known in the art and include recombinant methods as well as the synthesis of nucleic acid molecules using oligonucleotide synthesizers.
[0032]In a preferred embodiment of the invention said nucleic acid molecule hybridizes under stringent hybridization.
[0033]The term "stringent hybridization conditions" as used herein refers to parameters with which the art is familiar. Nucleic acid hybridization parameters may be found in references which compile such methods, e.g. Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. More specifically, stringent conditions, as used herein, refers, for example, to hybridization at 65° C. in hybridization buffer (3.5×SSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.5 mM NaH2PO4(pH7), 0.5% SDS, 2 mM EDTA). SSC is 0.15M sodium chloride/0.015M sodium citrate, pH7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetracetic acid. After hybridization, the membrane upon which the DNA is transferred is washed at 2×SSC at room temperature and then at 0.1-0.5×SSC/0.1×SDS at temperatures up to 68° C.
[0034]According to a further aspect of the invention there is provided a vector comprising the nucleic acid molecule according to the invention.
[0035]In a preferred embodiment of the invention said vector is an expression vector adapted for recombinant gene expression.
[0036]Typically said adaptation includes, by example and not by way of limitation, the provision of transcription control sequences (promoter sequences) which mediate cell/tissue specific expression. These promoter sequences may be cell/tissue specific, inducible or constitutive.
[0037]Promoter is an art-recognized term and, for the sake of clarity, includes the following features which are provided by example only, and not by way of limitation. Enhancer elements are cis acting nucleic acid sequences often found 5' to the transcription initiation site of a gene (enhancers can also be found 3' to a gene sequence or even located in intronic sequences and is therefore position independent). Enhancers function to increase the rate of transcription of the gene to which the enhancer is linked. Enhancer activity is responsive to trans acting transcription factor which have been shown to bind specifically to enhancer elements. The binding/activity of transcription factors (please see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a number of environmental cues which include, by example and not by way of limitation, intermediary metabolites and/or environmental effectors.
[0038]Promoter elements also include so called TATA box and RNA polymerase initiation selection (RIS) sequences which function to select a site of transcription initiation. These sequences also bind polypeptides which function, inter alia, to facilitate transcription initiation selection by RNA polymerase.
[0039]Adaptations also include the provision of selectable markers and autonomous replication sequences which both facilitate the maintenance of said vector in either the eukaryotic cell or prokaryotic host. Vectors which are maintained autonomously are referred to as episomal vectors. Episomal vectors are desirable since these molecules can incorporate large DNA fragments (30-50 kb DNA). Episomal vectors of this type are described in WO98/07876 which is incorporated by reference.
[0040]Adaptations which facilitate the expression of vector encoded genes include the provision of transcription termination/polyadenylation sequences. This also includes the provision of internal ribosome entry sites (IRES) which function to maximize expression of vector encoded genes arranged in bicistronic or multi-cistronic expression cassettes.
[0041]These adaptations are well known in the art. There is a significant amount of published literature with respect to expression vector construction and recombinant DNA techniques in general. Please see, Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory, Cold Spring Harbour, N.Y. and references therein; Marston, F (1987) DNA Cloning Techniques: A Practical Approach Vol III IRL Press, Oxford UK; DNA Cloning: F M Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
[0042]According to a further aspect of the invention there is provided the use of the polypeptide according to the invention as a pharmaceutical. In a preferred embodiment of the invention said polypeptide is for use in the manufacture of a medicament for the treatment of a condition selected from the group consisting of: gigantism, acromegaly; cancer (e.g. Wilm's tumour, osteogenic sarcoma, breast, colon, prostate, thyroid); diabetic retinopathy; diabetic nephropathy and other complications of diabetes and GH excess.
[0043]The polypeptides and compositions of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, intraocular, subcutaneous, or transdermal. The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy.
[0044]When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents.
[0045]The compositions may be combined, if desired, with a pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
[0046]According to a yet further aspect of the invention there is provided a cell transformed or transfected with the nucleic acid or vector according to the invention.
[0047]In a preferred embodiment of the invention said cell is a eukaryotic cell. Preferably said cell is selected from the group consisting of: a slime mould (e.g. Dictyostelium spp) a yeast cell (e.g. Saccharomyces cerevisae; Pichia spp); a mammalian cell (e.g. Chinese Hamster Ovary); a plant cell; an insect cell (e.g. Spodoptera spp).
[0048]In an alternative preferred embodiment said cell is a prokaryotic cell, preferably Escherchia coli or Bacillus spp.
[0049]According to a further aspect of the invention there is provided a method to manufacture the polypeptide according to the invention comprising: [0050]i) providing a cell according to the invention; [0051]ii) incubating said cell under conditions conducive to the production of the polypeptide according to the invention; and optionally [0052]iii) isolating the polypeptide from the cell or the cell culture medium.
[0053]In a preferred method of the invention said polypeptide is provided with a secretion signal to facilitate the purification of the polypeptide from said cell. More preferably still said polypeptide is provided with an affinity tag to facilitate the purification of the polypeptide from said cell or the cell culture medium.
[0054]According to a yet further aspect of the invention there is provided a method of treatment of a mammal, preferably a human, comprising administering to said mammal the polypeptide according to the invention.
[0055]According to a further aspect of the invention there is provided a chimeric polypeptide comprising more than two modified growth hormone binding domains wherein said modification is the addition, deletion or substitution of at least one amino acid residue.
[0056]In a preferred embodiment of the invention there is provided a chimeric polypeptide comprising a plurality of modified growth hormone binding domains.
[0057]In a further preferred embodiment of the invention there is provided a chimeric polypeptide comprising at least two modified site 2 growth hormone binding domains.
[0058]In a further preferred embodiment of the invention there is provided a chimeric polypeptide comprising 3, 4, 5, 6, 7, 8, 9, 10 modified site 2 growth hormone binding domains.
[0059]In a yet further preferred embodiment of the invention said chimeric polypeptide comprises more than two modified growth hormone binding domains linked together by a linker molecule. Preferably said linker molecule is as hereinbefore disclosed.
[0060]According to a yet further aspect of the invention said chimeric polypeptide comprising more than two modified growth hormone binding domains further comprises at least one growth hormone binding domain of a growth hormone receptor.
[0061]Preferably said chimeric polypeptide consists of two modified growth hormone binding domains and one growth hormone binding domain of a growth hormone receptor.
[0062]Preferably said chimeric polypeptide consists of at least two modified site 2 growth hormone binding domains.
[0063]Aspects and embodiments which relate to a chimeric polypeptide comprising growth a hormone binding domain linked to a receptor binding domain are applicable to chimeric polypeptides comprising more than or a plurality of growth hormone binding domains. For example, vectors comprising nucleic acids encoding said chimeric polypeptides, pharmaceutical compositions comprising said polypeptides, cell-lines expressing said chimeric polypeptides, methods to manufacture said polypeptides and methods of treatment utilising said polypeptides are all within the scope of the invention with respect to this species of chimeric polypeptide.
BRIEF DESCRIPTION OF THE DRAWINGS
[0064]An embodiment of the invention will now be described by example only and with reference to the following figures:
[0065]FIG. 1 is a plasmid map of pHEAT.GH.G120R, which was generated by ligating the GH.G120R gene, synthesized by PCR, between the BamHI and NotI restriction sites. The selective marker on the plasmid is AmPR;
[0066]FIG. 2 is a plasmid map of pTrcHis-TOPO.quadrature1A7, which was generated by ligating the GH.G120R gene between the BamHI and NotI sites in pTrcHisquadrature1A1. The linker is (G4S)4, and the selective marker on the plasmid is AmPR;
[0067]FIG. 3 is a plasmid map of pTrcHis-TOPO.quadrature1B2, which was generated by ligating the GH.G120R gene between the BamHI and NotI sites in pTrcHisquadrature1B1. The linker is (G4S)4, and the selective marker on the plasmid is AmPR;
[0068]FIG. 4 is a plasmid map of pTrcHis-TOPO.quadrature1C3, which was generated by ligating the GH.G120R gene between the EcoRI and HinDIII sites in pTrcHisquadrature1A7. The linker is (G4S)4, and the selective marker on the plasmid is AmpR;
[0069]FIG. 5 shows the sequence of the GH.G120R gene (SEQ ID NO: 1), showing the start codon, 6×His tag, relevant restriction sites, stop codons and the G120R mutation (CGC). The actual GH.G120R component is shown in CAPITALS, and the sequenced regions are shown in bold
[0070]FIG. 6 shows the sequence of the quadrature1A7 gene (SEQ ID NO:2), showing the start codon, 6×His tag, relevant restriction sites, stop codons and the G120R mutation (CGC). The actual GH.G120R-(G4S)4-GHR(b) component is shown in CAPITALS, and the sequenced regions are shown in bold;
[0071]FIG. 7 shows the sequence of the quadrature1B2 gene (SEQ ID NO:3), showing the start codon, 6×His tag, relevant restriction sites, stop codons and the G120R mutation (CGC). The actual GH.G120R-(G4S)4-GHR(flec) component is shown in CAPITALS, and the sequenced regions are shown in bold;
[0072]FIG. 8 shows the sequence of the quadrature1C3 gene (SEQ ID NO:4), showing the start codon, 6×His tag, relevant restriction sites, stop codons and the G120R mutation (CGC). The actual GH.G120R-(G4S)4-GH.G120R component is shown in CAPITALS, and the sequenced regions are shown in bold;
[0073]FIG. 9 shows Western blots using anti-human GH as the primary antibody of 15% SDS PAGE gels for the expression studies of GH.G120R, quadrature1A7, quadrature1B2 and quadrature1C3. Expression was from the pTrcHis vector in E. coli XL1 Blue or E. coli SURE cells, these samples were taken 4 hours after induction with 1 mM (final concentration) IPTG. The blots show that GH.G120R and quadrature1C3 produce single bands, while the samples of quadrature1A7 and quadrature1B2 contain cleavage products;
[0074]FIG. 10 shows Coomassie stained [C] 15% SDS PAGE gels of purified GH.G120R, quadrature1A7 and quadrature1C3. Western blots [W] of these samples using anti-human GH as the primary antibody are also shown. The coomassie stained gels show that the purified protein samples are >95% pure, however the western blots show that only GH.G120R and quadrature1C3 produce single bands, while the sample of quadrature1A7 contain cleavage products;
[0075]FIG. 11 A-C present graphs depicting the results of the GH bioassay for GH.G120R (FIG. 11A), quadrature1A7 (FIG. 11B) and quadrature1C3 (FIG. 11C). Each graph shows a standard curve, the assay with the construct alone at different concentrations and the assay with the construct at different concentrations with 25 ng/ml hGH. These show that none of the proteins have inherent agonistic activity, but all have antagonistic activity with the GH.G120R being the most active, and quadrature1A7 the least;
[0076]FIG. 12 is the amino acid sequence (SEQ ID NO:5) of unmodified GH; and
[0077]FIG. 13 is the nucleic acid sequence (SEQ ID NO:6) of unmodified GH.
MATERIALS AND METHODS
[0078]The methods to generate modified GH at site 1 and/or site 2 are disclosed in U.S. 5,849,535; U.S. Pat. No. 5,854,026; U.S. Pat. No. 6,004,931; U.S. Pat. No. 6,022,711; U.S. Pat. No. 6,057,292 and U.S. Pat. No. 6,136,563, each of which is incorporated by reference.
DNA Constructs
Generation of Site 2 Mutated GH Antagonist (GHa)
[0079]The cDNA for human GH (FIG. 1) has been PCR amplified from human pituitary tissue and cloned into the vector pTrcHis-Topo (pTrcHis-TOPO-GHstop). The GHR extracellular domain was amplified from human liver cDNA using PCR.
Growth Hormone Antagonist (G120R) Constructs
G120R Mutation of Growth Hormone
[0080]The growth hormone (GH) gene was mutated using the phagemid ssDNA mutation method. The GH gene was first sub-cloned from pTrcHisGH into pT7T318 between BamHI and HindIII sites, to produce pT7T318-GH. This plasmid was then transformed into E. coli CJ236 and single stranded ssDNA produced.
[0081]The ssDNA pT7T318-GH was then mutated by changing the codon for Gly120 from GGC to CGC, the primer GH.(G120R) For was used (Table 1). The dsDNA pT7T318-GH.G120R produced after the mutation process was then used to sub-clone the GH.G120R into a pHEAT vector, this gave pHEAT.GH.G120R (FIG. 1).
Generation of GH.G120R Constructs
[0082]χ1A7 [GH.G120R-(G4S)4-GHR(b)]=GHa linked to b domain of GHR.
[0083]The GH.G120R gene was excised from pHEAT.GH.G120R (FIG. 1) using the restriction sites BamHI and NotI. The gene was then ligated in place of the GH gene in pTrcHisχ1A1 [GH-(G4S)4-GHR(b)] (FIG. 2). The resulting plasmid was transformed into Escherichia coli XL1 Blue and plated on LB (0.3% glucose, 50 μg/ml ampicillin, 12.5 μg/ml tetracycline) agar plates.
χ1B2 [GH.G120R-(G4S)4-GHRflec]=GHa linked to full length extracellular domain of the GHR.
[0084]The strategy used to generate the χ1A7 gene was repeated, however the recipient vector was pTrcHisχ1B1 [GH-(G4S)4-GHRflec] (FIG. 3). The resulting plasmid was transformed into E. coli XL1 Blue and plated on LB (0.3% glucose, 50 μg/ml ampicillin, 12.5 μg/ml tetracycline) agar plates.
χ1C3 [GH.G120R-(G4S)4-GH.G120R]=GHa tandem.
[0085]A PCR reaction was performed on pTrcHisGH using the primers DiGHEcoF1 and DiGHHinR1 (Table 1). The PCR product was then digested with EcoRI and HindIII, this was then ligated in place of the GHR(b) domain in pTrcHisχ1A1 [GH-(G4S)4-GHR(b)] (FIG. 4). The resulting plasmid was transformed into the recombinant deficient E. coli SURE and plated on LB (0.3% glucose, 50 μg/ml ampicillin, 12.5 μg/ml tetracycline, 50 μg/ml kanamycin) agar plates.
Sequencing Results
[0086]Plasmids containing the construct genes were sequenced. The sequences of the genes and the regions sequenced for GH.G120R, χ1A7, χ1B2 and χ1C3 are shown in FIGS. 5-8, respectively.
Expression Studies
[0087]Single colonies were used to inoculate 3 ml LB (0.3% glucose, 50 μg/ml ampicillin, 12.5 μg/ml tetracycline) broth for E. coli XL1 Blue cells and LB (0.3% glucose, 50μg/ml ampicillin, 12.5 μg/ml tetracycline, 50 μg/ml kanamycin) broth for E. coli SURE cells. These were grown, shaking, overnight at 37° C.
[0088]4 mls of 4YT media, containing the appropriate antibiotics, were then inoculated with 200 μl of the overnight LB culture. These were grown for 3 hours, 1 ml samples were then taken (T0 samples).
[0089]The 4YT cultures were then induced with IPTG to a final concentration of 1 mM and then further incubated for another 4 hours (T4 samples).
[0090]The T0 and T4 samples were processed immediately after they had been taken. They were first centrifuged to pellet the cells, the supernatant was then discarded and the pellet processed for running on a SDS PAGE gel. Protein was visualized on these PAGE gels by either Coomassie staining or by western blot using an anti-GH primary antibody to probe for the construct.
[0091]In all cases the Coomassie stained PAGE gels do not show over-expression of the construct. However, the constructs are observed on the western blots (FIG. 9). These show that in all cases protein of the correct size is expressed.
Purification
[0092]In general protein was purified from 4×250 ml cultures grown in 4YT, containing the appropriate antibiotics, and induced for 4-5 hours with IPTG to a final concentration of 1 mM. The cells were harvested by centrifugation and lysed by treatment with lysozyme and sodium deoxycholate followed by sonication.
[0093]The lysed cells were centrifuged to remove cell debris and the supernatant initially purified using Invitrogen ProBond Resin (Ni-column). Protein was eluted using 5 ml 0.5 M imidazole.
[0094]The protein sample was further purified by diluting the eluant from the Ni-column 10 times in a suitable buffer and then passing it through a MonoQ ion-exchange column. Protein was eluted using a salt gradient of 0-1 M NaCl over 20 ml at a rate of 0.5 ml/min; 0.5 ml fractions were collected. The fractions were then analyzed for the presence of the construct, and the fractions containing the construct pooled.
[0095]The purified protein was analyzed by SDS PAGE (Coomassie staining and western blot) (FIG. 10) and assayed to measure its concentration. The protein was then submitted for the bioassay.
[0096]In the cases of χ1A7 and χ1B2, which showed cleaved products by western blot, the constructs were submitted to the Rapid Translation System (RTS) for in vitro transcription. Previous, studies on χ1A1 and χ1B1 have shown that cleavage was greatly reduced using the RTS system in conjunction with protease inhibitors and chaperones for expression.
Bioassay
[0097]The purified constructs were submitted to the Asterion standard GH bioassay. Prepared 293 Hi, which stably express growth hormone receptor, were stimulated with the construct using a range of doses. A second duplicate plate was also prepared, but 25 ng/ml GH was added 30 min. after adding the construct to observe the antagonistic capability of the construct. All the GH.G120R constructs had antagonistic activities (FIG. 11).
Screening of Antagonist Activity
[0098]An established bioassay is used to screen for antagonist activity (9). A permanent cell line expressing the full length GHR is transiently transfected with a luciferase reporter that binds activated Stat5 (9). Twenty-four hours later the cells are stimulated with GH for 6 hours with or without antagonist. The cells are then lysed and luciferase activity measured (9).
Testing Metabolic Clearance Rate in Vivo
[0099]Sprague-Dawley rats are anaesthetized, and cannulae implanted in femoral and jugular veins. Two days later GH chimera or tandem is administered by intravenous or subcutaneous injection. Blood samples are collected via the femoral cannula and chimera, and tandem or oligomer protein levels measured by radio-immunoassay. Pharmacokinetic parameters are estimated using available computer programs fitting hormone concentration against time.
[0100]Table 1 represents a summary of amino acid substitutions made to site 1 of growth hormone. Modifications to site 2 include the substitution of G120 for any of arginine; alanine; lysine; tryptophan; tyrosine; phenylalanine; or glutamic acid.
TABLE-US-00002 TABLE 1 H18 H21 Q22 F25 D26 Q29 E65 R167 K168 D171 K172 E174 I179 D N N A S R S T A A A A A A A A A A A A A A A D A A A A A A S A A A A A A A S D A A A A A A A A A A A A A A A D N N A S R S T A A A A A A A A
TABLE-US-00003 TABLE 2 List of oligonucleotides used for mutagenesis and PCR procedures during this work. Oligo- nucleotide Oligonucleotide Sequence Sense/ Name (Size/bp) (5' 3') Antisense GH.(G120R)For GGACCTAGAGGAACGCATCCAAACGCT Sense GATGGG (33) (SEQ ID NO:8) DiGHEcoF1 AGGCGAATTCTTCCCAACCATTCCCTT Sense AT (29) (SEQ ID NO:9) DiGHHinR1 TTCCAAGCTTCATCAGAAGCCACAGCT Antisense GCCCTCCA (SEQ ID NO:10)
Sequence CWU
1
101693DNAHomo sapiens 1atggggggtt ctcatcatca tcatcatcat ggtatggcta
gcatgactgg tggacagcaa 60atgggtcggg atctgtacga cgatgacgat aaggatccaa
cccttttccc aaccattccc 120ttatccaggc tttttgacaa cgctagtctc cgcgcccatc
gtctgcacca gctggccttt 180gacacctacc aggagtttga agaagcctat atcccaaagg
aacagaagta ttcattcctg 240cagaaccccc agacctccct ctgtttctca gagtctattc
cgacaccctc caacagggag 300gaaacacaac agaaatccaa cctagagctg ctccgcatct
ccctgctgct catccagtcg 360tggctggagc ccgtgcagtt cctcaggagt gtcttcgcca
acagcctggt gtacggcgcc 420tctgacagca acgtctatga cctcctaaag gacctagagg
aacgcatcca aacgctgatg 480gggaggctgg aagatggcag cccccggact gggcagatct
tcaagcagac ctacagcaag 540ttcgacacaa actcacacaa cgatgacgca ctactcaaga
actacgggct gctctactgc 600ttcaggaagg acatggacaa ggtcgagaca ttcctgcgca
tcgtgcagtg ccgctctgtg 660gagggcagct gtggcttcgg cggccgctga taa
69321125DNAHomo sapiens 2atggggggtt ctcatcatca
tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60atgggtcggg atctgtacga
cgatgacgat aaggatccaa cccttttccc aaccattccc 120ttatccaggc tttttgacaa
cgctagtctc cgcgcccatc gtctgcacca gctggccttt 180gacacctacc aggagtttga
agaagcctat atcccaaagg aacagaagta ttcattcctg 240cagaaccccc agacctccct
ctgtttctca gagtctattc cgacaccctc caacagggag 300gaaacacaac agaaatccaa
cctagagctg ctccgcatct ccctgctgct catccagtcg 360tggctggagc ccgtgcagtt
cctcaggagt gtcttcgcca acagcctggt gtacggcgcc 420tctgacagca acgtctatga
cctcctaaag gacctagagg aacgcatcca aacgctgatg 480gggaggctgg aagatggcag
cccccggact gggcagatct tcaagcagac ctacagcaag 540ttcgacacaa actcacacaa
cgatgacgca ctactcaaga actacgggct gctctactgc 600ttcaggaagg acatggacaa
ggtcgagaca ttcctgcgca tcgtgcagtg ccgctctgtg 660gagggcagct gtggcttcgg
cggccgcggt ggcggaggta gtggtggcgg aggtagcggt 720ggcggaggtt ctggtggcgg
aggttccgaa ttcgaaatag tgcaaccaga tccacccatt 780gccctcaact ggactttact
gaacgtcagt ttaactggga ttcatgcaga tatccaagtg 840agatgggaag caccacgcaa
tgcagatatt cagaaaggat ggatggttct ggagtatgaa 900cttcaataca aagaagtaaa
tgaaactaaa tggaaaatga tggaccctat attgacaaca 960tcagttccag tgtactcatt
gaaagtggat aaggaatatg aagtgcgtgt gagatccaaa 1020caacgaaact ctggaaatta
tggcgagttc agtgaggtgc tctatgtaac acttcctcag 1080atgagccaat ttacatgtga
agaagatttc tactgataaa agctt 112531503DNAHomo sapiens
3atggggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa
60atgggtcggg atctgtacga cgatgacgat aaggatccaa cccttttccc aaccattccc
120ttatccaggc tttttgacaa cgctagtctc cgcgcccatc gtctgcacca gctggccttt
180gacacctacc aggagtttga agaagcctat atcccaaagg aacagaagta ttcattcctg
240cagaaccccc agacctccct ctgtttctca gagtctattc cgacaccctc caacagggag
300gaaacacaac agaaatccaa cctagagctg ctccgcatct ccctgctgct catccagtcg
360tggctggagc ccgtgcagtt cctcaggagt gtcttcgcca acagcctggt gtacggcgcc
420tctgacagca acgtctatga cctcctaaag gacctagagg aacgcatcca aacgctgatg
480gggaggctgg aagatggcag cccccggact gggcagatct tcaagcagac ctacagcaag
540ttcgacacaa actcacacaa cgatgacgca ctactcaaga actacgggct gctctactgc
600ttcaggaagg acatggacaa ggtcgagaca ttcctgcgca tcgtgcagtg ccgctctgtg
660gagggcagct gtggcttcgg cggccgcggt ggcggaggta gtggtggcgg aggtagcggt
720ggcggaggtt ctggtggcgg aggttccgaa ttcttttctg gaagtgaggc cacagcagct
780atccttagca gagcaccctg gagtctgcaa agtgttaatc caggcctaaa gacaaattct
840tctaaggagc ctaaattcac caagtgccgt tcacctgagc gagagacttt ttcatgccac
900tggacagatg aggttcatca tggtacaaag aacctaggac ccatacagct gttctatacc
960agaaggaaca ctcaagaatg gactcaagaa tggaaagaat gccctgatta tgtttctgct
1020ggggaaaaca gctgttactt taattcatcg tttacctcca tctggatacc ttattgtatc
1080aagctaacta gcaatggtgg tacagtggat gaaaagtgtt tctctgttga tgaaatagtg
1140caaccagatc cacccattgc cctcaactgg actttactga acgtcagttt aactgggatt
1200catgcagata tccaagtgag atgggaagca ccacgcaatg cagatattca gaaaggatgg
1260atggttctgg agtatgaact tcaatacaaa gaagtaaatg aaactaaatg gaaaatgatg
1320gaccctatat tgacaacatc agttccagtg tactcattga aagtggataa ggaatatgaa
1380gtgcgtgtga gatccaaaca acgaaactct ggaaattatg gcgagttcag tgaggtgctc
1440tatgtaacac ttcctcagat gagccaattt acatgtgaag aagatttcta ctgataaaag
1500ctt
150341379DNAHomo sapiens 4atggggggtt ctcatcatca tcatcatcat ggtatggcta
gcatgactgg tggacagcaa 60atgggtcggg atctgtacga cgatgacgat aaggatccaa
cccttttccc aaccattccc 120ttatccaggc tttttgacaa cgctagtctc cgcgcccatc
gtctgcacca gctggccttt 180gacacctacc aggagtttga agaagcctat atcccaaagg
aacagaagta ttcattcctg 240cagaaccccc agacctccct ctgtttctca gagtctattc
cgacaccctc caacagggag 300gaaacacaac agaaatccaa cctagagctg ctccgcatct
ccctgctgct catccagtcg 360tggctggagc ccgtgcagtt cctcaggagt gtcttcgcca
acagcctggt gtacggcgcc 420tctgacagca acgtctatga cctcctaaag gacctagagg
aacgcatcca aacgctgatg 480gggaggctgg aagatggcag cccccggact gggcagatct
tcaagcagac ctacagcaag 540ttcgacacaa actcacacaa cgatgacgca ctactcaaga
actacgggct gctctactgc 600ttcaggaagg acatggacaa ggtcgagaca ttcctgcgca
tcgtgcagtg ccgctctgtg 660gagggcagct gtggcttcgg cggccgcggt ggcggaggta
gtggtggcgg aggtagcggt 720ggcggaggtt ctggtggcgg aggttccgaa ttctttcccg
aagtgaggcc acagcagcta 780tccttagcag agcaccctga accattccct tatccaggct
ttttgacaac gctagtctcc 840gcgcccatcg tctgcaccag ctggcctttg acacctacca
ggagtttgaa gaagcctata 900tcccaaagga acagaagtat tcattcctgc agaaccccca
gacctccctc tgtttctcag 960agtctattcc gacaccctcc aacagggagg aaacacaaca
gaaatccaac ctagagctgc 1020tccgcatctc cctgctgctc atccagtcgt ggctggagcc
cgtgcagttc ctcaggagtg 1080tcttcgccaa cagcctggtg tacggcgcct ctgacagcaa
cgtctatgac ctcctaaagg 1140acctagagga acgcatccaa acgctgatgg ggaggctgga
agatggcagc ccccggactg 1200ggcagatctt caagcagacc tacagcaagt tcgacacaaa
ctcacacaac gatgacgcac 1260tactcaagaa ctacgggctg ctctactgct tcaggaagga
catggacaag gtcgagacat 1320tcctgcgcat cgtgcagtgc cgctctgtgg agggcagctg
tggcttctga taaaagctt 13795191PRTHomo sapiens 5Phe Pro Thr Ile Pro Leu
Ser Arg Leu Phe Asp Asn Ala Ser Leu Arg1 5
10 15Ala His Arg Leu His Gln Leu Ala Phe Asp Thr Tyr
Gln Glu Phe Glu 20 25 30Glu
Ala Tyr Ile Pro Lys Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro 35
40 45Gln Thr Ser Leu Cys Phe Ser Glu Ser
Ile Pro Thr Pro Ser Asn Arg 50 55
60Glu Glu Thr Gln Gln Lys Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu65
70 75 80Leu Leu Ile Gln Ser
Trp Leu Glu Pro Val Gln Phe Leu Arg Ser Val 85
90 95Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser Asp
Ser Asn Val Tyr Asp 100 105
110Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln Thr Leu Met Gly Arg Leu
115 120 125Glu Asp Gly Ser Pro Arg Thr
Gly Gln Ile Phe Lys Gln Thr Tyr Ser 130 135
140Lys Phe Asp Thr Asn Ser His Asn Asp Asp Ala Leu Leu Lys Asn
Tyr145 150 155 160Gly Leu
Leu Tyr Cys Phe Arg Lys Asp Met Asp Lys Val Glu Thr Phe
165 170 175Leu Arg Ile Val Gln Cys Arg
Ser Val Glu Gly Ser Cys Gly Phe 180 185
1906573DNAHomo sapiens 6ttcccaacca ttcccttatc caggcttttt
gacaacgcta gtctccgcgc ccatcgtctg 60caccagctgg cctttgacac ctaccaggag
tttgaagaag cctatatccc aaaggaacag 120aagtattcat tcctgcagaa cccccagacc
tccctctgtt tctcagagtc tattccgaca 180ccctccaaca gggaggaaac acaacagaaa
tccaacctag agctgctccg catctccctg 240ctgctcatcc agtcgtggct ggagcccgtg
cagttcctca ggagtgtctt cgccaacagc 300ctggtgtacg gcgcctctga cagcaacgtc
tatgacctcc taaaggacct agaggaaggc 360atccaaacgc tgatggggag gctggaagat
ggcagccccc ggactgggca gatcttcaag 420cagacctaca gcaagttcga cacaaactca
cacaacgatg acgcactact caagaactac 480gggctgctct actgcttcag gaaggacatg
gacaaggtcg agacattcct gcgcatcgtg 540cagtgccgct ctgtggaggg cagctgtggc
ttc 57375PRTArtificial
Sequencesynthesized 7Gly Gly Gly Gly Ser1 5833DNAArtificial
Sequencesynthesized 8ggacctagag gaacgcatcc aaacgctgat ggg
33929DNAArtificial Sequencesynthesized 9aggcgaattc
ttcccaacca ttcccttat
291035DNAArtificial Sequencesynthesized 10ttccaagctt catcagaagc
cacagctgcc ctcca 35
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: