Patent application title: PSOD EXPRESSION UNITS
Inventors:
Burkhard KrÖger (Limburgerhof, DE)
Oskar Zelder (Speyer, DE)
Corinna Klopprogge (Mannheim, DE)
Hartwig Schröder (Nussloch, DE)
Stefan Haefner (Ludwigshafen, DE)
Assignees:
PAIK KWANG INDUSTRIAL CO., LTD.
IPC8 Class: AC12N1574FI
USPC Class:
435471
Class name: Chemistry: molecular biology and microbiology process of mutation, cell fusion, or genetic modification introduction of a polynucleotide molecule into or rearrangement of nucleic acid within a microorganism (e.g., bacteria, protozoa, bacteriophage, etc.)
Publication date: 2010-03-11
Patent application number: 20100062535
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: PSOD EXPRESSION UNITS
Inventors:
Burkhard KROGER
Oskar ZELDER
Corinna KLOPPROGGE
Hartwig SCHRODER
Stefan HAEFNER
Agents:
LAHIVE & COCKFIELD, LLP;FLOOR 30, SUITE 3000
Assignees:
PAIK KWANG INDUSTRIAL CO., LTD.
Origin: BOSTON, MA US
IPC8 Class: AC12N1574FI
USPC Class:
435471
Patent application number: 20100062535
Abstract:
The present invention relates to the use of nucleic acid sequences for
regulating the transcription and expression of genes, the novel promoters
and expression units themselves, methods for altering or causing the
transcription rate and/or expression rate of genes, expression cassettes
comprising the expression units, genetically modified microorganisms with
altered or caused transcription rate and/or expression rate, and methods
for preparing biosynthetic products by cultivating the genetically
modified microorganisms.Claims:
1. An isolated nucleic acid molecule having promoter activity, selected
from the group consisting ofA) a nucleic acid molecule comprising the
nucleotide sequence of SEQ ID NO:1;B) a nucleic acid molecule comprising
a nucleotide sequence of at least 90% identity to the nucleotide sequence
of SEQ ID NO:1;C) a nucleic acid molecule which hybridizes with the
complement of the nucleotide sequence of SEQ ID NO:1; andD) a nucleic
acid molecule comprising a fragment of the nucleic acid molecule of (A),
(B) or (C),wherein the molecule has promoter activity; wherein the
nucleic acid molecule does not consist of SEQ ID NO:1.
2. A method of regulating the transcription of a gene comprising introducing into a host cell the nucleic acid molecule of claim 1 or a nucleic acid molecule consisting of SEQ ID NO:1, wherein the nucleic acid molecule has promoter activity.
3. A method for altering or causing the transcription rate of genes in microorganisms compared with the wild type bya) altering the specific promoter activity in the microorganism of endogenous nucleic acids having promoter activity, which regulate the transcription of endogenous genes, compared with the wild type orb) regulating the transcription of genes in the microorganism by nucleic acids having promoter activity or by nucleic acids having promoter activity with altered specific promoter activity according to embodiment a), where the genes are heterologous in relation to the nucleic acids having promoter activity.
4. The method according to claim 3, wherein the regulation of the transcription of genes in the microorganism by nucleic acids having promoter activity or by nucleic acids having promoter activity with altered specific promoter activity according to embodiment a) is achieved bya) introducing one or more nucleic acids having promoter activity, where appropriate with altered specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid having promoter activity, where appropriate with altered specific promoter activity, orb) introducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids having promoter activity, where appropriate with altered specific promoter activity, orc) introducing one or more nucleic acid constructs comprising a nucleic acid having promoter activity, where appropriate with altered specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
5. The method according to claim 3 or 4, wherein to increase or cause the transcription rate of genes in microorganisms compared with the wild typea) the specific promoter activity in the microorganism of endogenous nucleic acids having promoter activity, or which regulate the transcription of endogenous genes, is increased compared with the wild type, orb) the transcription of genes in the microorganism is regulated by nucleic acids having promoter activity or by nucleic acids having increased specific promoter activity according to embodiment a), where the genes are heterologous in relation to the nucleic acids having promoter activity.
6. The method according to claim 5, wherein the regulation of the transcription of genes in the microorganism by nucleic acids having promoter activity or by nucleic acids having promoter activity with increased specific promoter activity according to embodiment a) is achieved bya) introducing one or more nucleic acids having promoter activity, where appropriate with increased specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid having promoter activity, where appropriate with increased specific promoter activity, orb) introducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids having promoter activity, where appropriate with increased specific promoter activity, orc) introducing one or more nucleic acid constructs comprising a nucleic acid having promoter activity, where appropriate with increased specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
7. The method according to claim 3 or 4, wherein to reduce the transcription rate of genes in microorganisms compared with the wild typea) the specific promoter activity in the microorganism of endogenous nucleic acids having promoter activity, which regulate the transcription of endogenous genes, is reduced compared with the wild type, orb) nucleic acids having reduced specific promoter activity according to embodiment a) are introduced into the genome of the microorganism so that the transcription of endogenous genes takes place under the control of the introduced nucleic acid having reduced promoter activity.
8. The method according to claim 3, wherein the genes are selected from the group of nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compounds, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, where the genes may optionally comprise further regulatory elements.
9. The method according to claim 8, wherein the proteins from the biosynthetic pathway of amino acids are selected from the group of aspartate kinase, aspartate-semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator Lys R2, malate-quinone oxidoreductase, glucose-6-phosphate deydrogenase, 6-phosphogluconate dehydrogenase, transketolase, transaldolase, homoserine O-acetyltransferase, cystathionine gamma-synthase, cystathionine beta-lyase, serine hydroxymethyltransferase, O-acetyl homoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyltransferase, homoserine dehydrogenase, homoserine kinase, threonine synthase, threonine exporter carrier, threonine dehydratase, pyruvate oxidase, lysine exporter, biotin ligase, cysteine synthase I, cysteine synthase II, coenzyme B12-dependent methionine synthase, coenzyme B12-independent methionine synthase, sulfate adenylyltransferase subunit 1 and 2, phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA synthetase, phosphoenolpyruvate carboxylase, threonine efflux protein, serine hydroxymethyltransferase, fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077, protein of sulfate reduction RXA248, protein of sulfate reduction RXA247, protein OpcA, 1-phosphofructokinase and 6-phosphofructokinase.
Description:
RELATED APPLICATIONS
[0001]This application is a divisional of U.S. application Ser. No. 10/583,191, filed Jun. 14, 2006 which is a 371 national stage application of International Application No. PCT/EP2004/014337, filed Dec. 16, 2004, which claims the benefit of German Application No. 103 59 660.7, filed Dec. 18, 2003. The entire contents of each of these applications are hereby incorporated by reference herein.
DESCRIPTION
[0002]The present invention relates to the use of nucleic acid sequences for regulating the transcription and expression of genes, the novel promoters and expression units themselves, methods for altering or causing the transcription rate and/or expression rate of genes, expression cassettes comprising the expression units, genetically modified microorganisms with altered or caused transcription rate and/or expression rate, and methods for preparing biosynthetic products by cultivating the genetically modified microorganisms.
[0003]Various biosynthetic products such as, for example, fine chemicals, such as, inter alia, amino acids, vitamins, but also proteins, are produced in cells by natural metabolic processes and are used in many branches of industry, including the cosmetics, feed, food and pharmaceutical industries. These substances, which are referred to collectively as fine chemicals/proteins, comprise inter alia organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, and proteins and enzymes. Their production takes place most expediently on the industrial scale by culturing bacteria which have been developed in order to produce and secrete large quantities of the particular desired substance. Organisms particularly suitable for this purpose are coryneform bacteria, gram-positive non-pathogenic bacteria.
[0004]It is known that amino acids are prepared by fermentation of strains of coryneform bacteria, especially Corynebacterium glutamicum. Because of the great importance, continuous work is done on improving the production processes. Process improvements may relate to fermentation technique measures such as, for example, stirring and oxygen supply, or the composition of the nutrient media, such as, for example, the sugar concentration during the fermentation, or the working up to give the product, for example by ion exchange chromatography or else spray drying, or the intrinsic performance properties of the microorganism itself.
[0005]Methods of recombinant DNA technology have likewise been employed for some years for strain improvement of Corynebacterium strains producing fine chemical/proteins, by amplifying individual genes and investigating the effect on the production of fine chemicals/proteins.
[0006]Other ways for developing a process for producing fine chemicals, amino acids or proteins, or for increasing or improving the productivity of a pre-existing process for producing fine chemicals, amino acids or proteins, are to increase or to alter the expression of one or more genes, and/or to influence the translation of an mRNA by suitable polynucleotide sequences. In this connection, influencing may include increasing, reducing, or else other parameters of the expression of genes, such as chronological expression patterns.
[0007]Various constituents of bacterial regulatory sequences are known to the skilled worker. A distinction is made between the binding sites for regulators, also called operators, the binding sites for RNA polymerase holoenzymes, also called -35 and -10 regions, and the binding site for ribosomal 16S RNA, also called ribosome binding site or else Shine-Dalgarno sequence.
[0008]The sequence of a ribosome binding site, also called Shine-Dalgarno sequence, means for the purposes of this invention polynucleotide sequences which are located up to 20 bases upstream of the translation initiation codon.
[0009]In the literature (E. coli and S. typhimurium, Neidhardt F. C. 1995 ASM Press) it is reported that both the composition of the polynucleotide sequence of the Shine-Dalgarno sequence, the sequence string of the bases, but also the distance of a polynucleotide sequence present in the Shine-Dalgarno sequence from has a considerable influence on the translation initiation rate.
[0010]Nucleic acid sequences having promoter activity can influence the formation of mRNA in various ways. Promoters whose activities are independent of the physiological growth phase of the organism are called constitutive. Other promoters in turn respond to external chemical and physical stimuli such as oxygen, metabolites, heat, pH, etc. Others in turn show a strong dependence of their activity in different growth phases. For example, promoters showing a particularly pronounced activity during the exponential growth phase of microorganisms, or else precisely in the stationary phase of microbial growth, are described in the literature. Both characteristics of promoters may have a beneficial effect on productivity for a production of fine chemicals and proteins, depending on the metabolic pathway.
[0011]For example, promoters which switch off the expression of a gene during growth, but switch it on after an optimal growth, can be used to regulate a gene which controls the production of a metabolite. The modified strain then displays the same growth parameters as the starting strain but produces more product per cell. This type of modification may increase both the titer (g of product/liter) and the C yield (g of product/g of C source).
[0012]It has already been possible to isolate in Corynebacterium species those nucleotide sequences which can be used to increase or diminish gene expression. These regulated promoters may increase or reduce the rate at which a gene is transcribed, depending on the internal and/or external conditions of the cell. In some cases, the presence of a particular factor, known as inducer, can stimulate the rate of transcription from the promoter. Inducers may influence transcription from the promoter either directly or indirectly. Another class of factors, known as suppressors, is able to reduce or else inhibit the transcription from the promoter. Like the inducers, the suppressors can also act directly or indirectly. However, temperature-regulated promoters are also known. Thus, the level of transcription of such promoters can be increased or else diminished for example by increasing the growth temperature above the normal growth temperature of the cell.
[0013]A small number of promoters from C. glutamicum have been described to date. The promoter of the malate synthase gene from C. glutamicum was described in DE 4440118. This promoter was inserted upstream of a structural gene coding for a protein. After transformation of such a construct into a coryneform bacterium there is regulation of the expression of the structural gene downstream of the promoter. Expression of the structural gene is induced as soon as an appropriate inducer is added to the medium. Reinscheid et al., Microbiology 145:503 (1999) described a transcriptional fusion between the pta-ack promoter from C. glutamicum and a reporter gene (chloramphenicol acetyltransferase). Cells of C. glutamicum comprising such a transcriptional fusion exhibited increased expression of the reporter gene on growth on acetate-containing medium. By comparison with this, transformed cells which grew on glucose showed no increased expression of this reporter gene.
[0014]Pa'tek et al., Microbiology 142:1297 (1996) describe some DNA sequences from C. glutamicum which are able to enhance the expression of a reporter gene in C. glutamicum cells. These sequences were compared together in order to define consensus sequences for C. glutamicum promoters.
[0015]Further DNA sequences from C. glutamicum which can be used to regulate gene expression have been described in the patent WO 02/40679. These isolated polynucleotides represent expression units from Corynebacterium glutamicum which can be used either to increase or else to reduce gene expression. This patent additionally describes recombinant plasmids on which the expression units from Corynebacterium glutamicum are associated with heterologous genes. The method described herein, of fusing a promoter from Corynebacterium glutamicum with a heterologous gene, can be employed inter alia for regulating the genes of amino acid biosynthesis.
[0016]It is an object of the present invention to provide further promoters and/or expression units with advantageous properties.
[0017]We have found that this object is achieved by the use of a nucleic acid having promoter activity, comprising [0018]A) the nucleic acid sequence SEQ. ID. NO. 1 or [0019]B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1, or [0020]C) a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. NO. 1 under stringent conditions, or [0021]D) functionally equivalent fragments of the sequences of A), B) or C)for the transcription of genes.
[0022]"Transcription" means according to the invention the process by which a complementary RNA molecule is produced starting from a DNA template. Proteins such as RNA polymerase, so-called sigma factors and transcriptional regulator proteins are involved in this process. The synthesized RNA is then used as template in the translation process, which then leads to the biosynthetically active protein.
[0023]The formation rate with which a biosynthetically active protein is produced is a product of the rate of transcription and of translation. Both rates can be influenced according to the invention, and thus influence the rate of formation of products in a microorganism.
[0024]A "promoter" or a "nucleic acid having promoter activity" means according to the invention a nucleic acid which, in a functional linkage to a nucleic acid to be transcribed, regulates the transcription of this nucleic acid.
[0025]A "functional linkage" means in this connection for example the sequential arrangement of one of the nucleic acids of the invention having promoter activity and a nucleic acid sequence to be transcribed and, where appropriate, further regulatory elements such as, for example, nucleic acid sequences which ensure the transcription of nucleic acids, and for example a terminator, in such a way that each of the regulatory elements is able to fulfill its function in the transcription of the nucleic acid sequence. A direct linkage in the chemical sense is not absolutely necessary therefor. Genetic control sequences, such as, for example, enhancer sequences, are able to exercise their function on the target sequence even from more remote positions or even from other DNA molecules. Arrangements in which the nucleic acid sequence to be transcribed is positioned behind (i.e. at the 3' end) of the promoter sequence of the invention, so that the two sequences are covalently connected together, are preferred. In this connection, the distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is preferably fewer than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.
[0026]"Promoter activity" means according to the invention the quantity of RNA formed by the promoter in a particular time, that is to say the transcription rate.
[0027]"Specific promoter activity" means according to the invention the quantity of RNA formed by the promoter in a particular time for each promoter.
[0028]The term "wild type" means according to the invention the appropriate starting microorganism.
[0029]Depending on the context, the term "microorganism" means the starting microorganism (wild type) or a genetically modified microorganism of the invention, or both.
[0030]Preferably, and especially in cases where the microorganism or the wild type cannot be unambiguously assigned, "wild type" means for the alteration or causing of the promoter activity or transcription rate, for the alteration of causing of the expression activity or expression rate and for increasing the content of biosynthetic products in each case a reference organism.
[0031]In a preferred embodiment, this reference organism is Corynebacterium glutamicum ATCC 13032.
[0032]In a preferred embodiment, the starting microorganisms used are already able to produce the desired fine chemical. Particular preference is given in this connection among the particularly preferred microorganisms of bacteria of the genus Corynebacterium and the particularly preferred fine chemicals L-lysine, L-methionine and L-threonine to those starting microorganisms already able to produce L-lysine, L-methionine and/or L-threonine. These are particularly preferably corynebacteria in which, for example, the gene coding for an aspartokinase (ask gene) is deregulated or the feedback inhibition is abolished or reduced. Such bacteria have, for example, a mutation leading to a reduction or abolition of the feedback inhibition, such as, for example, the mutation T311I, in the ask gene.
[0033]In the case of a "caused promoter activity" or transcription rate in relation to a gene compared with the wild type, therefore, compared with the wild type the formation of an RNA which was not present in this way in the wild type is caused.
[0034]In the case of an altered promoter activity or transcription rate in relation to a gene compared with the wild type, therefore, compared with the wild type the quantity of RNA produced in a particular time is altered.
[0035]"Altered" means in this connection preferably increased or reduced.
[0036]This can take place for example by increasing or reducing the specific promoter activity of the endogenous promoter of the invention, for example by mutating the promoter or by stimulating or inhibiting the promoter.
[0037]A further possibility is to achieve the increased promoter activity or transcription rate for example by regulating the transcription of genes in the microorganism by nucleic acids of the invention having promoter activity or by nucleic acids with increased specific promoter activity, where the genes are heterologous in relation to the nucleic acids having promoter activity.
[0038]The regulation of the transcription of genes in the microorganism by nucleic acids of the invention having promoter activity or by nucleic acids with increased specific promoter activity is preferably achieved by
introducing one or more nucleic acids of the invention having promoter activity, appropriate with altered specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid of the invention having promoter activity, appropriate with altered specific promoter activity, orintroducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids of the invention having promoter activity, where appropriate with altered specific promoter activity, orintroducing one or more nucleic acid constructs comprising a nucleic acid of the invention having promoter activity, where appropriate with altered specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
[0039]The nucleic acids of the invention having promoter activity comprise [0040]A) the nucleic acid sequence SEQ. ID. NO. 1 or [0041]B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1, or [0042]C) a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. NO. 1 under stringent conditions, or [0043]D) functionally equivalent fragments of the sequences of A), B) or C).
[0044]The nucleic acid sequence SEQ. ID. NO. 1 represents the promoter sequence of superoxide dismutase (Psod) from Corynebacterium glutamicum. SEQ. ID. NO. 1 corresponds to the promoter sequence of the wild type.
[0045]The invention additionally relates to nucleic acids having promoter activity comprising a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1.
[0046]Further natural examples of the invention for promoters of the invention can easily be found for example from various organisms whose genomic sequence is known, by identity comparisons of the nucleic acid sequences from databases with the sequence SEQ ID NO: 1 described above.
[0047]Artificial promoter sequences of the invention can easily be found starting from the sequence SEQ ID NO: 1 by artificial variation and mutation, for example by substitution, insertion or deletion of nucleotides.
[0048]The term "substitution" means in the description the replacement of one or more nucleotides by one or more nucleotides. "Deletion" is the replacement of a nucleotide by a direct linkage. Insertions are insertions of nucleotides into the nucleic acid sequence, with formal replacement of a direct linkage by one or more nucleotides.
[0049]Identity between two nucleic acids means the identity of the nucleotides over the complete length of the nucleic acid in each case, in particular the identity calculated by comparison with the aid of the vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins D G, Sharp P M. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 April; 5(2):151-1), setting the following parameters:
[0050]Multiple alignment parameter:
TABLE-US-00001 Gap opening penalty 10 Gap extension penalty 10 Gap separation penalty range 8 Gap separation penalty off % identity for alignment delay 40 Residue specific gaps off Hydrophilic residue gap off Transition weighing 0
[0051]Pairwise alignment parameter:
TABLE-US-00002 FAST algorithm on K-tuplesize 1 Gap penalty 3 Window size 5 Number of best diagonals 5
[0052]A nucleic acid sequence having an identity of at least 90% with the sequence SEQ ID NO: 1 accordingly means a nucleic acid sequence which, on comparison of its sequence with the sequence SEQ ID NO: 1, in particular in accordance with the above programming algorithm with the above parameter set, shows an identity of at least 90%.
[0053]Particularly preferred promoters show an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, particularly preferably 99%, with the nucleic acid sequence SEQ. ID. NO. 1.
[0054]Further natural examples of promoters can moreover easily be found starting from the nucleic acid sequences described above, in particular starting from the sequence SEQ ID NO: 1 from various organisms whose genomic sequence is unknown, by hybridization techniques in a manner known per se.
[0055]A further aspect of the invention therefore relates to nucleic acids having promoter activity comprising a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. No. 1 under stringent conditions. This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50 or particularly preferably more than 150, nucleotides.
[0056]The hybridization takes place according to the invention under stringent conditions. Such hybridization conditions are described for example in Sambrook, J., Fritsch, E. F., Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6:
[0057]Stringent hybridization conditions mean in particular:
incubation at 42° C. overnight in a solution consisting of 50% formamide, 5×SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters with 0.1×SSC at 65° C.
[0058]A "functionally equivalent fragment" means for nucleic acid sequences having promoter activity fragments which have substantially the same or a higher specific promoter activity than the starting sequence.
[0059]"Essentially identical" means a specific promoter activity which displays at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, particularly preferably 95% of the specific promoter activity of the starting sequence.
[0060]"Fragments" mean partial sequences of the nucleic acids having promoter activity which are described by embodiment A), B) or C). These fragments preferably have more than 10, but more preferably more than 12, 15, 30, 50 or particularly preferably more than 150, connected nucleotides of the nucleic acid sequence SEQ. ID. NO. 1.
[0061]It is particularly preferred to use the nucleic acid sequence SEQ. ID. NO. 1 as promoter, i.e. for transcription of genes.
[0062]SEQ. ID. NO. 1 has been described without assignment of function in the Genbank entry AP005283. The invention therefore further relates to the novel nucleic acid sequences of the invention having promoter activity.
[0063]The invention relates in particular to a nucleic acid having promoter activity, comprising [0064]A) the nucleic acid sequence SEQ. ID. NO. 1 or [0065]B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1, or [0066]C) a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. NO. 1 under stringent conditions, or [0067]D) functionally equivalent fragments of the sequences of A), B) or C),with the proviso that the nucleic acid having the sequence SEQ. ID. NO. 1 is excluded.
[0068]All the nucleic acids having promoter activity which are mentioned above can additionally be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks such as, for example, by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can take place for example in known manner by the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). Addition of synthetic oligonucleotides and filling in of gaps using the Klenow fragment of DNA polymerase and ligation reactions, and general cloning methods, are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
[0069]The invention further relates to the use of an expression unit comprising one of the nucleic acids of the invention having promoter activity and additionally functionally linked a nucleic acid sequence which ensures the translation of ribonucleic acids for the expression of genes.
[0070]An expression unit means according to the invention a nucleic acid having expression activity, i.e a nucleic acid which, in functional linkage to a nucleic acid to be expressed, or gene, regulates the expression, i.e. the transcription and the translation of this nucleic acid or of this gene.
[0071]A "functional linkage" means in this connection for example the sequential arrangement of one of the expression units of the invention and of a nucleic acid sequence which is to be expressed transgenically and, where appropriate, further regulatory elements such as, for example, a terminator in such a way that each of the regulatory elements can fulfill its function in the transgenic expression of the nucleic acid sequence. A direct linkage in the chemical sense is not absolutely necessary for this. Genetic control sequences, such as, for example, enhancer sequences, can exercise their function on the target sequence also from more remote positions or even from different DNA molecules. Arrangements in which the nucleic acid sequence to be expressed transgenically is positioned behind (i.e. at the 3' end) the expression unit sequence of the invention, so that the two sequences are covalently connected together, are preferred. It is preferred in this case for the distance between the expression unit sequence and the nucleic acid sequence to be expressed transgenically to be less than 200 base pairs, particularly preferably fewer than 100 base pairs, very particularly preferably fewer than 50 base pairs.
[0072]"Expression activity" means according to the invention the quantity of protein produced in a particular time by the expression unit, i.e. the expression rate.
[0073]"Specific expression activity" means according to the invention the quantity of protein produced by the expression unit in a particular time for each expression unit.
[0074]In the case of a "caused expression activity" or expression rate in relation to a gene compared with the wild type, therefore, compared with the wild type the production of a protein which was not present in this way in the wild type is caused.
[0075]In the case of an "altered expression activity" or expression rate in relation to a gene compared with the wild type, therefore, compared with the wild type the quantity of protein produced in a particular time is altered.
[0076]"Altered" preferably means in this connection increased or decreased.
[0077]This can take place for example by increasing or reducing the specific activity of the endogenous expression unit, for example by mutating the expression unit or by stimulating or inhibiting the expression unit.
[0078]The increased expression activity or expression rate can moreover be achieved for example by regulating the expression of genes in the microorganism by expression units of the invention or by expression units with increased specific expression activity, where the genes are heterologous in relation to the expression units.
[0079]The regulation of the expression of genes in the microorganism by expression units of the invention or by expression units of the invention with increased specific expression activity is preferably achieved by
introducing one or more expression units of the invention, where appropriate with altered specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units of the invention, where appropriate with altered specific expression activity, orintroducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with altered specific expression activity, orintroducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with altered specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0080]The expression units of the invention comprise a nucleic acid of the invention, described above, having promoter activity and additionally functionally linked a nucleic acid sequence which ensures the translation of ribonucleic acids.
[0081]This nucleic acid sequence which ensures the translation of ribonucleic acids preferably comprises the nucleic acid sequence SEQ. ID. NO. 42 as ribosome binding site.
[0082]In a preferred embodiment, the expression unit of the invention comprises: [0083]E) the nucleic acid sequence SEQ. ID. NO. 2 or [0084]F) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2, or [0085]G) a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. NO. 2 under stringent conditions, or [0086]H) functionally equivalent fragments of the sequences of E), F) or G).
[0087]The nucleic acid sequence SEQ. ID. NO. 2 represents the nucleic acid sequence of the expression unit of superoxide dismutase (Psod) from Corynebacterium glutamicum. SEQ. ID. NO. 2 corresponds to the sequence of the expression unit of the wild type.
[0088]The invention further relates to expression units comprising a sequence which is derived from this sequence by substitution, insertion or deletion of nucleotides and which have an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2.
[0089]Further natural examples of the invention for expression units of the invention can easily be found for example from various organisms whose genomic sequence is known, by identity comparisons of the nucleic acid sequences from databases with the sequence SEQ ID NO: 2 described above.
[0090]Artificial sequences of the invention of the expression units can easily be found starting from the sequence SEQ ID NO: 2 by artificial variation and mutation, for example by substitution, insertion or deletion of nucleotides.
[0091]A nucleic acid sequence having an identity of at least 90% with the sequence SEQ ID NO: 2 accordingly means a nucleic acid sequence which, on comparison of its sequence with the sequence SEQ ID NO: 2, in particular in accordance with the above programming algorithm with the above parameter set, shows an identity of at least 90%.
[0092]Particularly preferred expression units show an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, particularly preferably 99%, with the nucleic acid sequence SEQ. ID. NO. 2.
[0093]Further natural examples of expression units can moreover easily be found starting from the nucleic acid sequences described above, in particular starting from the sequence SEQ ID NO: 2 from various organisms whose genomic sequence is unknown, by hybridization techniques in a manner known per se.
[0094]A further aspect of the invention therefore relates to expression units comprising a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. No. 2 under stringent conditions. This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50 or particularly preferably more than 150, nucleotides.
[0095]"Hybridization" means the ability of a poly- or oligonucleotide to bind under stringent conditions to a virtually complementary sequence, while nonspecific bindings between non-complementary partners do not occur under these conditions. For this, the sequences ought preferably to be 90-100% complementary. The property of complementary sequences being able to bind specifically to one another is made use of for example in the Northern or Southern blotting technique or in primer binding in PCR or RT-PCR.
[0096]The hybridization takes place according to the invention under stringent conditions. Such hybridization conditions are described for example in Sambrook, J., Fritsch, E. F., Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6:
[0097]Stringent hybridization conditions mean in particular:
incubation at 42° C. overnight in a solution consisting of 50% formamide, 5×SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters with 0.1×SSC at 65° C.
[0098]The nucleotide sequences of the invention further make it possible to produce probes and primers which can be used for identifying and/or cloning homologous sequences in other cell types and microorganisms. Such probes and primers normally comprise a nucleotide sequence region which hybridizes under stringent conditions onto a least approximately 12, preferably at least approximately 25, such as, for example, approximately 40, 50 or 75 consecutive nucleotides of a sense strand of a nucleic acid sequence of the invention or of a corresponding antisense strand.
[0099]Also comprised according to the invention are nucleic acid sequences which comprise so-called silent mutations or are modified in accordance with the codon usage of a specific original or host organism compared with a specifically mentioned sequence, as well as naturally occurring variants such as, for example, splice variants or allelic variants, thereof.
[0100]A "functionally equivalent fragment" means for expression units fragments which have substantially the same or a higher specific expression activity than the starting sequence.
[0101]"Essentially identical" means a specific expression activity which displays at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, particularly preferably 95% of the specific expression activity of the starting sequence.
[0102]"Fragments" mean partial sequences of the expression units which are described by embodiment E), F) or G). These fragments preferably have more than 10, but more preferably more than 12, 15, 30, 50 or particularly preferably more than 150, connected nucleotides of the nucleic acid sequence SEQ. ID. NO. 1.
[0103]It is particularly preferred to use the nucleic acid sequence SEQ. ID. NO. 2 as expression unit, i.e. for expression of genes.
[0104]SEQ. ID. NO. 2 has been described without assignment of function in the Genbank entry AP005283. The invention therefore further relates to the novel expression units of the invention.
[0105]The invention relates in particular to an expression unit comprising a nucleic acid of the invention having promoter activity and additionally functionally linked a nucleic acid sequence which ensures the translation of ribonucleic acids.
[0106]The invention particularly preferably relates to an expression unit comprising [0107]E) the nucleic acid sequence SEQ. ID. NO. 2 or [0108]F) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and having an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2, or [0109]G) a nucleic acid sequence which hybridizes with the nucleic acid sequence SEQ. ID. NO. 2 under stringent conditions, or [0110]H) functionally equivalent fragments of the sequences of E), F) or G),with the proviso that the nucleic acid having the sequence SEQ. ID. NO. 2 is excluded.
[0111]The expression units of the invention comprise one or more of the following genetic elements: a minus 10 ("-10") sequence; a minus 35 ("-35") sequence; a transcription sequence start, an enhancer region; and an operator region.
[0112]These genetic elements are preferably specific for species of corynebacteria, especially for Corynbacterium glutamicum.
[0113]All the expression units which are mentioned above can additionally be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks such as, for example, by fragment condensation of individual overlapping complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can take place for example in known manner by the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). Addition of synthetic oligonucleotides and filling in of gaps using the Klenow fragment of DNA polymerase and ligation reactions, and general cloning methods, are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
[0114]The methods and techniques used for the inventions in this patent are known to the skilled worker trained in microbiological and recombinant DNA techniques. Methods and techniques for growing bacterial cells, inserting isolated DNA molecules into the host cell, and isolating, cloning and sequencing isolated nucleic acid molecules etc. are examples of such techniques and methods. These methods are described in many standard literature sources: Davis et al., Basic Methods In Molecular Biology (1986); J. H. Miller, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1972); J. H. Miller, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1992); M. Singer and P. Berg, Genes & Genomes, University Science Books, Mill Valley, Calif. (1991); J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); P. B. Kaufmann et al., Handbook of Molecular and Cellular Methods in Biology and Medicine, CRC Press, Boca Raton, Fla. (1995); Methods in Plant Molecular Biology and Biotechnology, B. R. Glick and J. E. Thompson, eds., CRC Press, Boca Raton, Fla. (1993); and P. F. Smith-Keary, Molecular Genetics of Escherichia coli, The Guilford Press, New York, N.Y. (1989).
[0115]All nucleic acid molecules of the present invention are preferably in the form of an isolated nucleic acid molecule. An "isolated" nucleic acid molecule is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid, and may additionally be substantially free of other cellular material or culture medium if it is prepared by recombinant techniques, or free of chemical precursors or other chemicals if it is chemically synthesized.
[0116]The invention additionally includes the nucleic acid molecules complementary to the specifically described nucleotide sequences, or a section thereof.
[0117]The promoters and/or expression units of the invention can for example be used particularly advantageously in improved methods for the preparation of biosynthetic products by fermentation as described hereinafter.
[0118]The promoters and/or expression units of the invention have in particular the advantage that they are induced in microorganisms by stress. It is possible by suitable control of the fermentation process to control this stress induction specifically for an increase in the transcription/expression rate of desired genes. In the production of L-lysine in particular, this stress phase is reached very early, so that in this case an increased transcription/expression rate of desired genes can be achieved very early.
[0119]The nucleic acids of the invention having promoter activity can be used to alter, i.e. to increase or reduce, or to cause the transcription rate of genes in microorganisms compared with the wild type.
[0120]The expression units of the invention can be used to alter, i.e. to increase or reduce, or to cause the expression rate of genes in microorganisms compared with the wild type.
[0121]The nucleic acids of the invention having promoter activity and the expression units of the invention can also serve to regulate and enhance the production of various biosynthetic products such as, for example, fine chemicals, proteins, in particular amino acids, microorganisms, in particular in Corynebacterium species.
[0122]The invention therefore relates to a method for altering or causing the transcription rate of genes in microorganisms compared with the wild type by [0123]a) altering the specific promoter activity in the microorganism of endogenous nucleic acids of the invention having promoter activity, which regulate the transcription of endogenous genes, compared with the wild type or [0124]b) regulating transcription of genes in the microorganism by nucleic acids of the invention having promoter activity or by nucleic acids with altered specific promoter activity as set forth in embodiment a), where the genes are heterologous in relation to the nucleic acids having promoter activity.
[0125]According to embodiment a), the alteration or causing of the transcription rate of genes in the microorganism compared with the wild type can take place by altering, i.e. increasing or reducing, the specific promoter activity in the microorganism. This can take place for example by targeted mutation of the nucleic acid sequence of the invention having promoter activity, i.e. by targeted substitution, deletion or insertion of nucleotides. An increased or reduced promoter activity can be achieved by replacing nucleotides in the RNA polymerase holoenzyme binding sites (known to the skilled worker also as -10 region and -35 region). Additionally by reducing or enlarging the distance of the described RNA polymerase holoenzyme binding sites from one another by deleting nucleotides or inserting nucleotides. Additionally by putting binding sites (also known to the skilled worker as operators) for regulatory proteins (known to the skilled worker as repressors and activators) in the spatial vicinity of the binding sites of the RNA polymerase holoenzyme so that, after binding to a promoter sequence, these regulators diminish or enhance the binding and transcription activity of the RNA polymerase holoenzyme, or else place it under a new regulatory influence.
[0126]The nucleic acid sequence SEQ. ID. NO. 44 preferably represents the ribosome binding site of the expression units of the invention, and the sequences SEQ. ID. NOs. 42 or 43 represent the -10 region of the expression units of the invention. Alterations in the nucleic acid sequence in these regions lead to an alteration in the specific expression activity.
[0127]The invention therefore relates to the use of the nucleic acid sequence SEQ. ID. NO. 44 as ribosome binding site in expression units which enable genes to be expressed in bacteria of the genus Corynebacterium or Brevibacterium.
[0128]The invention further relates to the use of the nucleic acid sequences SEQ. ID. NOs. 42 or 43 as -10 region in expression units which enable genes to be expressed in bacteria of the genus Corynebacterium or Brevibacterium.
[0129]The invention relates in particular to an expression unit which enables genes to be expressed in bacteria of the genus Corynebacterium or Brevibacterium, comprising the nucleic acid sequence SEQ. ID. NO. 44. In this case, the nucleic acid sequence SEQ. ID. NO. 44 is preferably used as ribosome binding site.
[0130]The invention further relates to an expression unit which enables genes to be expressed in bacteria of the genus Corynebacterium or Brevibacterium, comprising at least one of the nucleic acid sequences SEQ. ID. NOs. 42 or 43. In this case, one of the nucleic acid sequences SEQ. ID. NOs. 42 or 43 is preferably used as -10 region.
[0131]In relation to the "specific promoter activity", an increase or reduction compared with the wild type means an increase or reduction in the specific activity compared with the nucleic acid of the invention having promoter activity of the wild type, i.e. for example compared with SEQ. ID. NO. 1.
[0132]According to embodiment b), the alteration or causing of the transcription rate of genes in microorganisms compared with the wild type can take place by regulating the transcription of genes in the microorganism by nucleic acids of the invention having promoter activity or by nucleic acids with altered specific promoter activity according to embodiment a), where the genes are heterologous in relation to the nucleic acids having promoter activity.
[0133]This is preferably achieved by [0134]b1) introducing one or more nucleic acids of the invention having promoter activity, where appropriate with altered specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid having promoter activity, where appropriate with altered specific promoter activity, or [0135]b2) introducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids of the invention having promoter activity, where appropriate with altered specific promoter activity, or [0136]b3) introducing one or more nucleic acid constructs comprising a nucleic acid of the invention having promoter activity, where appropriate with altered specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
[0137]It is thus possible to alter, i.e. to increase or to reduce, the transcription rate of an endogenous gene of the wild type by
according to embodiment b1), introducing one or more nucleic acids of the invention having promoter activity, where appropriate with altered specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid having promoter activity, where appropriate with altered specific promoter activity, oraccording to embodiment b2), introducing one or more endogenous genes into the genome of the microorganism so that transcription of one or more of the introduced endogenous genes takes place under the control of the endogenous nucleic acids of the invention having promoter activity, where appropriate with altered specific promoter activity, oraccording to embodiment b3), introducing one or more nucleic acid constructs comprising a nucleic acid of the invention having promoter activity, where appropriate with altered specific promoter activity, and functionally linked one or more endogenous nucleic acids to be transcribed, into the microorganism.
[0138]It is thus further possible to cause the transcription rate of an exogenous gene compared with the wild type by
according to embodiment b2), introducing one or more endogenous genes into the genome of the microorganism so that transcription of one or more of the introduced exogenous genes takes place under the control of the endogenous nucleic acids of the invention having promoter activity, where appropriate with altered specific promoter activity, oraccording to embodiment b3), introducing one or more nucleic acid constructs comprising a nucleic acid of the invention having promoter activity, where appropriate with altered specific promoter activity, and functionally linked one or more exogenous nucleic acids to be transcribed, into the microorganism.
[0139]The insertion of genes according to embodiment b2) can moreover take place by integrating a gene into coding regions or noncoding regions. Insertion preferably takes place into noncoding regions.
[0140]Insertion of nucleic acid constructs according to embodiment b3) may moreover take place chromosomally or extrachromosomally. There is preferably chromosomal insertion of the nucleic acid constructs. A "chromosomal" integration is the insertion of an exogenous DNA fragment into the chromosome of a host cell. This term is also used for homologous recombination between an exogenous DNA fragment and the appropriate region on the chromosome of the host cell.
[0141]In embodiment b) there is preferably also use of nucleic acids of the invention with altered specific promoter activity in accordance with embodiment a). In embodiment b), as described in embodiment a), these may be present or be prepared in the microorganism, or be introduced in isolated form into the microorganism.
[0142]"Endogenous" means genetic information, such as, for example, genes, which is already present in the wild-type genome.
[0143]"Exogenous" means genetic information, such as, for example, genes, which is not present in the wild-type genome.
[0144]The term "genes" in relation to regulation of transcription by the nucleic acids of the invention having promoter activity preferably means nucleic acids which comprise a region to be transcribed, i.e. for example a region which regulates the translation, and a coding region and, where appropriate, further regulatory elements such as, for example, a terminator.
[0145]The term "genes" in relation to the regulation, described hereinafter, of expression by the expression units of the invention preferably means nucleic acids which comprise a coding region and, where appropriate, further regulatory elements such as, for example, a terminator.
[0146]A "coding region" means a nucleic acid sequence which encodes a protein.
[0147]"Heterologous" in relation to nucleic acids having promoter activity and genes means that the genes used are not in the wild type transcribed under the regulation of the nucleic acids of the invention having promoter activity, but that a new functional linkage which does not occur in the wild type is produced, and the functional combination of nucleic acid of the invention having promoter activity and specific gene does not occur in the wild type.
[0148]"Heterologous" in relation to expression units and genes means that the genes used are not in the wild type expressed under the regulation of the expression units of the invention having promoter activity, but that a new functional linkage which does not occur in the wild type is produced, and the functional combination of expression unit of the invention and specific gene does not occur in the wild type.
[0149]The invention further relates in a preferred embodiment to a method for increasing or causing the transcription rate of genes in microorganisms compared with the wild type by [0150]ah) increasing the specific promoter activity in the microorganism of endogenous nucleic acids of the invention having promoter activity, which regulate the transcription of endogenous genes, compared with the wild type, or [0151]bh) regulating the transcription of genes in the microorganism by nucleic acids of the invention having promoter activity or by nucleic acids with increased specific promoter activity as set forth in embodiment a), where the genes are heterologous in relation to the nucleic acids having promoter activity.
[0152]The regulation of the transcription of genes in the microorganism by nucleic acids of the invention having promoter activity or by nucleic acids of the invention with increased specific promoter activity according to embodiment ah) is preferably achieved by [0153]bh1) introducing one or more nucleic acids of the invention having promoter activity, where appropriate with increased specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid of the invention having promoter activity, where appropriate with increased specific promoter activity, or [0154]bh2) introducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids of the invention having promoter activity, where appropriate with increased specific promoter activity, or [0155]bh3) introducing one or more nucleic acid constructs comprising a nucleic acid of the invention having promoter activity, where appropriate with increased specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
[0156]The invention further relates in a preferred embodiment to a method for reducing the transcription rate of genes in microorganisms compared with the wild type by [0157]ar) reducing the specific promoter activity in the microorganism of endogenous nucleic acids of the invention having promoter activity, which regulate the transcription of the endogenous genes, compared with the wild type, or [0158]br) introducing nucleic acids with reduced specific promoter activity as set forth in embodiment a) into the genome of the microorganism so that transcription of endogenous genes takes place under the control of the introduced nucleic acid with reduced promoter activity.
[0159]The invention further relates to a method for altering or causing the expression rate of a gene in microorganisms compared with the wild type by [0160]c) altering the specific expression activity in the microorganism of endogenous expression units of the invention, which regulate the expression of the endogenous genes, compared with the wild type, or [0161]d) regulating the expression of genes in the microorganism by expression units of the invention or by expression units of the invention with altered specific expression activity as set forth in embodiment c), where the genes are heterologous in relation to the expression units.
[0162]According to embodiment c), the alteration or causing of the expression rate of genes in microorganisms compared with the wild type can take place by altering, i.e. increasing or reducing, the specific expression activity in the microorganism. This can take place for example by targeted mutation of the nucleic acid sequence of the invention having promoter activity, i.e. by targeted substitution, deletion or insertion of nucleotides. For example, extending the distance between Shine-Dalgarno sequence and the translation start codon usually leads to a change, a diminution or else an enhancement of the specific expression activity. An alteration of the specific expression activity can also be achieved by either shortening or extending the distance of the sequence of the Shine-Dalgarno region (ribosome binding site) from the translation start codon through deletions or insertions of nucleotides. But also by altering the sequence of the Shine-Dalgarno region in such a way that the homology to complementary 3' side 16S rRNA is either enhanced or else diminished.
[0163]In relation to the "specific expression activity", an increase or reduction compared with the wild type means an increase or reduction of the specific activity compared with the expression unit of the invention of the wild type, i.e. for example compared with SEQ. ID. NO. 2.
[0164]According to embodiment d), the alteration or causing of the expression rate of genes in microorganisms compared with the wild type can take place by regulating the expression of genes in the microorganism by expression units of the invention or by expression units of the invention with altered specific expression activity as set forth in embodiment c), where the genes are heterologous in relation to the expression units.
[0165]This is preferably achieved by [0166]d1) introducing one or more expression units of the invention, where appropriate with altered specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units, or [0167]d2) introducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with altered specific expression activity, or [0168]d3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with altered specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0169]It is thus possible to alter, i.e. to increase or to reduce, the expression rate of an endogenous gene of the wild type by
according to embodiment d1) introducing one or more expression units of the invention, where appropriate with altered specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units, oraccording to embodiment d2) introducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with altered specific expression activity, oraccording to embodiment d3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with altered specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0170]It is thus further possible to cause the expression rate of an endogenous gene compared with the wild type by
according to embodiment d2) introducing one or more exogenous genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with altered specific expression activity, oraccording to embodiment d3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with altered specific expression activity, and functionally linked one or more exogenous nucleic acids to be expressed, into the microorganism.
[0171]The insertion of genes according to embodiment d2) can moreover take place by integrating a gene into coding regions or noncoding regions. Insertion preferably takes place into noncoding regions.
[0172]Insertion of nucleic acid constructs according to embodiment d3) may moreover take place chromosomally or extrachromosomally. There is preferably chromosomal insertion of the nucleic acid constructs.
[0173]The nucleic acid constructs are also referred to hereinafter as expression cassettes.
[0174]In embodiment d) there is preferably also use of expression units of the invention with altered specific expression activity in accordance with embodiment c). In embodiment d), as described in embodiment c), these may be present or be prepared in the microorganism, or be introduced in isolated form into the microorganism.
[0175]The invention further relates in a preferred embodiment to a method for increasing or causing the expression rate of a gene in microorganisms compared with the wild type by
ch) increasing the specific expression activity in the microorganism of endogenous expression units of the invention, which regulate the expression of the endogenous genes, compared with the wild type, ordh) regulating the expression of genes in the microorganism by expression units of the invention or by expression units with increased specific expression activity as set forth in embodiment a), where the genes are heterologous in relation to the expression units.
[0176]The regulation of the expression of genes in the microorganism by expression units of the invention or by expression units with increased specific expression activity as set forth in embodiment c) is preferably achieved by [0177]dh1) introducing one or more expression units of the invention, where appropriate with increased specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units, where appropriate with increased specific expression activity, or [0178]dh2) introducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with increased specific expression activity, or [0179]dh3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0180]The invention further relates to a method for reducing the expression rate of genes in microorganisms compared with the wild type by
Cr) reducing the specific expression activity in the microorganism of endogenous expression units of the invention, which regulate the expression of the endogenous genes, compared with the wild type, ordr) introducing expression units with reduced specific expression activity as set forth in embodiment cr) into the genome of the microorganism so that expression of endogenous genes takes place under the control of the introduced expression units with reduced expression activity.
[0181]In a preferred embodiment of the methods of the invention described above for altering or causing the transcription rate and/or expression rate of genes in microorganisms, the genes are selected from the group of nucleic acids encoding a protein from the biosynthetic pathway of fine chemicals, where the genes may optionally comprise further regulatory elements.
[0182]In a particularly preferred embodiment of the methods of the invention described above for altering or causing the transcription rate and/or expression rate of genes in microorganisms, the genes are selected from the group of nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compounds, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, where the genes may optionally comprise further regulatory elements.
[0183]In a particularly preferred embodiment, the proteins from the biosynthetic pathway of amino acids are selected from the group of aspartate kinase, aspartate-semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate deydrogenase, 6-phosphogluconate dehydrogenase, transketolase, transaldolase, homoserine O-acetyltransferase, cystathionine gamma-synthase, cystathionine beta-lyase, serine hydroxymethyltransferase, O-acetyl homoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyltransferase, homoserine dehydrogenase, homoserine kinase, threonine synthase, threonine exporter carrier, threonine dehydratase, pyruvate oxidase, lysine exporter, biotin ligase, cysteine synthase I, cysteine synthase II, coenzyme B12-dependent methionine synthase, coenzyme B12-independent methionine synthase activity, sulfate adenylyltransferase subunit 1 and 2, phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA synthetase, phosphoenolpyruvate carboxylase, threonine efflux protein, serine hydroxymethyltransferase, fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077, protein of sulfate reduction RXA248, protein of sulfate reduction RXA247, protein OpcA, 1-phosphofructokinase and 6-phosphofructokinase.
[0184]Preferred proteins and nucleic acids encoding these proteins of the proteins described above from the biosynthetic pathway of amino acids are respectively protein sequences and nucleic acid sequences of microbial origin, preferably from bacteria of the genus Corynebacterium or Brevibacterium, preferably from coryneform bacteria, particularly preferably from Corynebacterium glutamicum.
[0185]Examples of particularly preferred protein sequences and the corresponding nucleic acid sequences encoding these proteins from the biosynthetic pathway of amino acids, the document referring thereto, and the designation thereof in the referring document are listed in Table 1:
TABLE-US-00003 TABLE 1 SEQ. ID. NO. Nucleic acid Referring in referring Protein encoding protein document document Aspartate kinase ask or lysC EP1108790 DNA: 281 Protein: 3781 Aspartate-semialdehyde asd EP1108790 DNA: 331 dehydrogenase Protein: 3831 Dihydrodipicolinate dapA WO 0100843 DNA: 55 synthetase Protein: 56 Dihydrodipicolinate dapB WO 0100843 DNA: 35 reductase Protein: 36 meso-Diaminopimelate ddh EP1108790 DNA: 3494 D-dehydrogenase Protein: 6944 Diaminopicolinate lysA EP1108790 DNA: 3451 decarboxylase Prot.: 6951 Lysine exporter lysE EP1108790 DNA: 3455 Prot.: 6955 Arginyl-tRNA synthetase argS EP1108790 DNA: 3450 Prot.: 6950 Glucose-6-phosphate zwf WO 0100844 DNA: 243 dehydrognease Prot.: 244 Glyceraldehyde-3- gap WO 0100844 DNA: 187 phosphate dehydrogenase Prot.: 188 3-Phosphoglycerate pgk WO 0100844 DNA: 69 kinase Prot.: 70 Pyruvate carboxylase pycA EP1108790 DNA: 765 Prot.: 4265 Triosephosphate tpi WO 0100844 DNA: 61 isomerase Prot.: 62 Biotin ligase birA EP1108790 DNA: 786 Prot.: 4286 PEP carboxylase pck EP1108790 DNA: 3470 Prot.: 6970 Homoserine kinase thrB WO 0100843 DNA: 173 Prot.: 174 Threonine synthase thrC WO 0100843 DNA: 175 Prot.: 176 Threonine export carrier thrE WO 0251231 DNA: 41 Prot.: 42 Threonine efflux protein RXA2390 WO 0100843 DNA: 7 Prot.: 8 Threonine dehydratase ilvA EP 1108790 DNA: 2328 Prot.: 5828 Homoserine met A EP 1108790 DNA: 727 O-acetyltransferase Prot: 4227 Cystathionine gamma- metB EP 1108790 DNA: 3491 synthase Prot: 6991 Cystathionine beta-lyase metC EP 1108790 DNA: 2535 Prot: 6035 Coenzyme B12-dependent metH EP 1108790 DNA: 1663 methionine synthase, - Prot: 5163 O-Acetylhomoserine metY EP 1108790 DNA: 726 sulfhydrylase Prot: 4226 Methylenetetrahydrofolate metF EP 1108790 DNA: 2379 reductase Prot: 5879 D-3-Phosphoglycerate serA EP 1108790 DNA: 1415 dehydrogenase Prot: 4915 Phosphoserine serB WO 0100843 DNA: 153 phosphatase 1 Prot.: 154 Phosphoserine serB EP 1108790 DNA: 467 phosphatase 2 Prot: 3967 Phosphoserine serB EP 1108790 DNA: 334 phosphatase 3 Prot.: 3834 Phosphoserine serC WO 0100843 DNA: 151 aminotransferase Prot.: 152 Serine acetyltransferase cysE WO 0100843 DNA: 243 Prot.: 244 Cysteine synthase I cysK EP 1108790 DNA: 2817 Prot.: 6317 Cysteine synthase II CysM EP 1108790 DNA: 2338 Prot.: 5838 Homoserine hom EP 1108790 DNA: 3452 dehydrogenase Prot.: 6952 Coenzyme B12- metE WO 0100843 DNA: 755 independent methionine Prot.: 756 synthase Serine glyA WO 0100843 DNA: 143 hydroxymethyltransferase Prot.: 144 Protein in sulfate reduction RXA247 EP 1108790 DNA: 3089 Prot.: 6589 Protein in sulfate reduction RXA248 EP 1108790 DNA: 3090 Prot.: 6590 Sulfate CysN EP 1108790 DNA: 3092 adenylyltransferase Prot.: 6592 subunit 1 Sulfate CysD EP 1108790 DNA: 3093 adenylyltransferase Prot.: 6593 subunit 2 Phosphoadenosine- CysH WO 02729029 DNA: 7 phosphosulfate reductase Prot.: 8 Ferredoxin-sulfite RXA073 WO 0100842 DNA: 329 reductase Prot.: 330 Ferredoxin NADP- RXA076 WO 0100843 DNA: 79 reductase Prot.: 80 Transcriptional regulator luxR WO 0100842 DNA: 297 LuxR Protein: 298 Transcriptional regulator lysR1 EP 1108790 DNA: 676 LysR1 Protein: 4176 Transcriptional regulator lysR2 EP 1108790 DNA: 3228 LysR2 Protein: 6728 Transcriptional regulator lysR3 EP 1108790 DNA: 2200 LysR3 Protein: 5700 Malate-quinone mqo WO 0100844 DNA: 569 oxidoreductase Protein: 570 Transketolase RXA2739 EP 1108790 DNA: 1740 Prot: 5240 Transaldolase RXA2738 WO 0100844 DNA: 245 Prot: 246 OpcA opcA WO 0100804 DNA: 79 Prot: 80 1-Phosphofructokinase 1 pfk1 WO0100844 DNA: 55 Protein: 56 1-Phosphofructokinase 2 pfk2 WO0100844 DNA: 57 Protein: 58 6-Phosphofructokinase 1 6-pfk1 EP 1108790 DNA: 1383 Protein: 4883 6-Phosphofructokinase 2 6-pfk2 DE 10112992 DNA: 1 Protein: 2 Fructose-1,6- fbr1 EP1108790 DNA: 1136 bisphosphatase 1 Protein: 4636 Pyruvate oxidase poxB WO 0100844 DNA: 85 Protein: 86 RXA00655 regulator RXA655 US2003162267.2 DNA: 1 Prot.: 2 RXN02910 regulator RXN2910 US2003162267.2 DNA: 5 Prot.: 6 6- RXA2735 WO 0100844 DNA: 1 phosphogluconolactonase Prot.: 2
[0186]A further example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of fructose-1,6-bisphosphatase 2, also called fbr2, (SEQ. ID. NO. 41) and the corresponding nucleic acid sequence encoding a fructose-1,6-bisphosphatase 2 (SEQ. ID. NO. 40).
[0187]A further example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of the protein in sulfate reduction, also called RXA077, (SEQ. ID. NO. 4) and the corresponding nucleic acid sequence encoding a protein in sulfate reduction (SEQ. ID. NO. 3).
[0188]Further particularly preferred protein sequences from the biosynthetic pathway of amino acids have in each case the amino acid sequence indicated in Table 1 for this protein, where the respective protein has, in at least one of the amino acid positions indicated in Table 2/column 2 for this amino acid sequence, a different proteinogenic amino acid than the respective amino acid indicated in Table 2/column 3 in the same line. In a further preferred embodiment, the proteins have, in at least one of the amino acid positions indicated in Table 2/column 2 for the amino acid sequence, the amino acid indicated in Table 2/column 4 in the same line. The proteins indicated in Table 2 are mutated proteins of the biosynthetic pathway of amino acids, which have particularly advantageous properties and are therefore particularly suitable for expressing the corresponding nucleic acids through the promoter of the invention and for producing amino acids. For example, the mutation T311I leads to the feedback inhibition of ask being switched off.
[0189]The corresponding nucleic acids which encode a mutated protein described above from Table 2 can be prepared by conventional methods.
[0190]A suitable starting point for preparing the nucleic acid sequences encoding a mutated protein is, for example, the genome of a Corynebacterium glutamicum strain which is obtainable from the American Type Culture Collection under the designation ATCC 13032, or the nucleic acid sequences referred to in Table 1. For the back-translation of the amino acid sequence of the mutated proteins into the nucleic acid sequences encoding these proteins, it is advantageous to use the codon usage of the organism into which the nucleic acid sequence is to be introduced or in which the nucleic acid sequence is present. For example, it is advantageous to use the codon usage of Corynebacterium glutamicum for Corynebacterium glutamicum. The codon usage of the particular organism can be ascertained in a manner known per se from databases or patent applications which describe at least one protein and one gene which encodes this protein from the desired organism.
[0191]The information in Table 2 is to be understood in the following way:
[0192]In column 1 "identification", an unambiguous designation for each sequence in relation to Table 1 is indicated.
[0193]In column 2 "AA-POS", the respective number refers to the amino acid position of the corresponding polypeptide sequence from Table 1. A "26" in the column "AA-POS" accordingly means amino acid position 26 of the correspondingly indicated polypeptide sequence. The numbering of the position starts at +1 at the N terminus.
[0194]In column 3 "AA wild type", the respective letter designates the amino acid--represented in one-letter code--at the position indicated in column 2 in the corresponding wild-type strain of the sequence from Table 1.
[0195]In column 4 "AA mutant", the respective letter designates the amino acid--represented in one-letter code--at the position indicated in column 2 in the corresponding mutant strain.
[0196]In column 5 "function", the physiological function of the corresponding polypeptide sequence is indicated.
[0197]For mutated protein with a particular function (column 5) and a particular initial amino acid sequence (Table 1), columns 2, 3 and 4 describe at least one mutation, and a plurality of mutations for some sequences. This plurality of mutations always refers to the closest initial amino acid sequence above in each case (Table 1). The term "at least one of the amino acid positions" of a particular amino acid sequence preferably means at least one of the mutations described for this amino acid sequence in columns 2, 3 and 4.
[0198]One-letter code for proteinogenic amino acids:
A alanineC cysteineD aspartateE glutamateF phenylalanineG glycineH histidineI isoleucineK lysineL leucineM methionineN asparagineP prolineQ glutamineR arginineS serineT threonineV valineW tryptophanY tyrosine
TABLE-US-00004 TABLE 2 Column 1 Column 2 Column 3 Column 4 Column 5 Identification AA position AA wild type AA mutant Function ask 317 S A aspartate kinase 311 T I 279 A T asd 66 D G aspartate-semialdehyde dehydrogenase 234 R H 272 D E 285 K E 20 L F dapA 2 S A dihydrodipicolinate synthetase 84 K N 85 L V dapB 91 D A dihydrodipicolinate reductase 83 D N ddh 174 D E meso-diaminopimelate D-dehydrogenase 235 F L 237 S A lysA 265 A D diaminopicolinate decarboxylase 320 D N 332 I V argS 355 G D arginyl-tRNA synthetase 156 A S 513 V A 540 H R zwf 8 S T glucose-6-phosphate dehydrogenase 150 T A 321 G S gap 264 G S glyceraldehyde-3-phosphate dehydrogenase pycA 7 S L pyruvate carboxylase 153 E D 182 A S 206 A S 227 H R 455 A G 458 P S 639 S T 1008 R H 1059 S P 1120 D E pck 162 H Y PEP carboxylase 241 G D 829 T R thrB 103 S A homoserine kinase 190 T A 133 A V 138 P S thrC 69 G R threonine synthase 478 T I RXA330 85 I M threonine efflux protein 161 F I 195 G D hom 104 V I homoserine dehydrogenase 116 T I 148 G A 59 V A 270 T S 345 R P 268 K N 61 D H 72 E Q lysR1 80 R H transcriptional regulator LysR1 lysR3 142 R W transcriptional regulator LysR3 179 A T RXA2739 75 N D transketolase 329 A T 332 A T 556 V I RXA2738 242 K M transaldolase opcA 107 Y H OpcA 219 K N 233 P S 261 Y H 312 S F 65 G R aspartate-1-decarboxylase 33 G S 6-phosphogluconolactonase
[0199]In the methods of the invention described above for altering or causing the transcription rate and/or expression rate of genes in microorganisms, and the methods described hereinafter for producing genetically modified microorganisms, the genetically modified microorganisms described hereinafter and the methods described hereinafter for producing biosynthetic products, the introduction of the nucleic acids of the invention having promoter activity, of the expression units of the invention, of the genes described above and of the nucleic acid constructs or expression cassettes described above into the microorganism, in particular into coryneform bacteria, preferably takes place by the SacB method.
[0200]The SacB method is known to the skilled worker and described for example in Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A.; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum, Gene. 1994 Jul. 22; 145(1):69-73 and Blomfield I C, Vaughn V, Rest R F, Eisenstein B I.; Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon; Mol Microbiol. 1991 June; 5(6):1447-57.
[0201]In a preferred embodiment of the methods of the invention described above, the alteration or causing of the transcription rate and/or expression rate of genes in microorganisms takes place by introducing nucleic acids of the invention having promoter activity or expression units of the invention into the microorganism.
[0202]In a further preferred embodiment of the methods of the invention described above, the alteration or causing of the transcription rate and/or expression rate of genes in microorganisms takes place by introducing the nucleic acid constructs or expression cassettes described above into the microorganism.
[0203]The invention therefore also relates to an expression cassette comprising
at least one expression unit of the inventionat least one further nucleic acid sequence to be expressed, i.e. a gene to be expressed andwhere appropriate further genetic control elements such as, for example, a terminator,where at least one expression unit and a further nucleic acid sequence to be expressed are functionally linked together, and the further nucleic acid sequence to be expressed is heterologous in relation to the expression unit.
[0204]The nucleic acid sequence to be expressed is preferably at least one nucleic acid encoding a protein from the biosynthesis pathway of fine chemicals.
[0205]The nucleic acid sequence to be expressed is particularly preferably selected from the group of nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compounds, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes.
[0206]Preferred proteins from the biosynthetic pathway of amino acids are described above and examples thereof are described in Tables 1 and 2.
[0207]The physical location of the expression unit relative to the gene to be expressed in the expression cassettes of the invention is chosen so that the expression unit regulates the transcription and preferably also the translation of the gene to be expressed, and thus enables one or more proteins to be produced. "Enabling production" includes in this connection a constitutive increase in the production, diminution or blocking of production under specific conditions and/or increasing the production under specific conditions. The "conditions" comprise in this connection: (1) addition of a component to the culture medium, (2) removal of a component from the culture medium, (3) replacement of one component in the culture medium by a second component, (4) increasing the temperature of the culture medium, (5) reducing the temperature of the culture medium, and (6) regulating the atmospheric conditions such as, for example, the oxygen or nitrogen concentration in which the culture medium is kept.
[0208]The invention further relates to an expression vector comprising an expression cassette of the invention described above.
[0209]Vectors are well known to the skilled worker and can be found in "Cloning Vectors" (Pouwels P. H. et al., editors, Elsevier, Amsterdam-New York-Oxford, 1985). Apart from plasmids, vectors also mean all other vectors known to the skilled worker, such as, for example, phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors may undergo autonomous replication in the host organism or chromosomal replication.
[0210]Suitable and particularly preferred plasmids are those which are replicated in coryneform bacteria. Numerous known plasmid vectors such as, for example, pZ1 (Menke) et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKEx1 (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1. Other plasmid vectors such as, for example, pCLiK5MCS, or those based on pCG4 (U.S. Pat. No. 4,489,160) or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) or pAG1 (U.S. Pat. No. 5,158,891), can be used in the same way.
[0211]Also suitable are those plasmid vectors with the aid of which the method of gene amplification by integration into the chromosome can be used, as described for example by Reinscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for the duplication and amplification of the hom-thrB operon. In this method the complete gene is cloned into a plasmid vector which is able to replicate in a host (typically E. coli) but not in C. glutamicum. Examples of suitable vectors are pSUP301 (Sirnon et al., Biotechnology 1, 784-791 (1983)), pK18mob or pK19mob (Schafer et al., Gene 145, 69-73 (1994)), Bernard et al., Journal of Molecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene 41: 337-342). The plasmid vector which comprises the gene to be amplified is subsequently transferred by transformation into the desired strain of C. glutamicum. Methods for transformation are described for example in Thierbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican and Shivnan (Biotechnology 7, 1067-1070 (1989)) and Tauch et al. (FEMS Microbiological Letters 123, 343-347 (1994)).
[0212]The invention further relates to a genetically modified microorganism where the genetic modification leads to an alteration or causing of the transcription rate of at least one gene compared with the wild type, and is dependent on
a) altering the specific promoter activity in the microorganism of at least one endogenous nucleic acid having promoter activity as set forth in claim 1, which regulates the transcription of at least one endogenous gene, orb) regulating the transcription of genes in the microorganism by nucleic acids having promoter activity as set forth in claim 1 or by nucleic acids having promoter activity as set forth in claim 1 with altered specific promoter activity as set forth in embodiment a), where the genes are heterologous in relation to the nucleic acids having promoter activity.
[0213]As described above for the methods, the regulation of the transcription of genes in the microorganism by nucleic acids having promoter activity as set forth in claim 1 or by nucleic acids having promoter activity as set forth in claim 1 with altered specific promoter activity as set forth in embodiment a), is achieved by
b1) introducing one or more nucleic acids having promoter activity as set forth in claim 1, where appropriate with altered specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid having promoter activity as set forth in claim 1, where appropriate with altered specific promoter activity, orb2) introducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids having promoter activity as set forth in claim 1, where appropriate with altered specific promoter activity, orb3) introducing one or more nucleic acid constructs comprising a nucleic acid having promoter activity as set forth in claim 1, where appropriate with altered specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
[0214]The invention further relates to a genetically modified microorganism having elevated or caused transcription rate of at least one gene compared with the wild type, where
ah) the specific promoter activity in the microorganism of endogenous nucleic acids having promoter activity as set forth in claim 1, which regulate the transcription of endogenous genes, is increased compared with the wild type, orbh) the transcription of genes in the microorganism is regulated by nucleic acids having promoter activity as set forth in claim 1 or by nucleic acids having increased specific promoter activity as set forth in embodiment ah), where the genes are heterologous in relation to the nucleic acids having promoter activity.
[0215]As described above for the methods, the regulation of the transcription of genes in the microorganism by nucleic acids having promoter activity as set forth in claim 1 or by nucleic acids having promoter activity as set forth in claim 1 with increased specific promoter activity as set forth in embodiment a), is achieved by
bh1) introducing one or more nucleic acids having promoter activity as set forth in claim 1, where appropriate with increased specific promoter activity, into the genome of the microorganism so that transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid having promoter activity, where appropriate with increased specific promoter activity, orbh2) introducing one or more genes into the genome of the microorganism so that transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids having promoter activity as set forth in claim 1, where appropriate with increased specific promoter activity, orbh3) introducing one or more nucleic acid constructs comprising a nucleic acid having promoter activity as set forth in claim 1, where appropriate with increased specific promoter activity, and functionally linked one or more nucleic acids to be transcribed, into the microorganism.
[0216]The invention further relates to a genetically modified microorganism with reduced transcription rate of at least one gene compared with the wild type, where
ar) the specific promoter activity in the microorganism of at least one endogenous nucleic acid having promoter activity as set forth in claim 1, which regulates the transcription of at least one endogenous gene, is reduced compared with the wild type, orbr) one or more nucleic acids having reduced promoter activity as set forth in embodiment a) are introduced into the genome of the microorganism so that the transcription of at least one endogenous gene takes place under the control of the introduced nucleic acid having reduced promoter activity.
[0217]The invention further relates to a genetically modified microorganism, where the genetic modification leads to an alteration or causing of the expression rate of at least one gene compared with the wild type, and is dependent on
c) altering the specific expression activity in the microorganism of at least one endogenous expression unit as set forth in claim 2 or 3, which regulates the expression of at least one endogenous gene, compared with the wild type ord) regulating the expression of genes in the microorganism by expression units as set forth in claim 2 or 3 or by expression units as set forth in claim 2 or 3 with altered specific expression activity as set forth in embodiment a), where the genes are heterologous in relation to the expression units.
[0218]As described above for the methods, the regulation of the expression of genes in the microorganism by expression units as set forth in claim 2 or 3 or by expression units as set forth in claim 2 or 3 with altered specific expression activity as set forth in embodiment a) is achieved by
d1) introducing one or more expression units as set forth in claim 2 or 3, where appropriate with altered specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units according to claim 2 or 3, where appropriate with altered specific expression activity, ord2) introducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units as set forth in claim 2 or 3, where appropriate with altered specific expression activity, ord3) introducing one or more nucleic acid constructs comprising an expression unit as set forth in claim 2 or 3, where appropriate with altered specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0219]The invention further relates to a genetically modified microorganism with increased or caused expression rate of at least one gene compared with the wild type, where
ch) the specific expression activity in the microorganism of at least one endogenous expression unit as set forth in claim 2 or 3, which regulates the expression of the endogenous genes, is increased compared with the wild type, ordh) the expression of genes in the microorganism is regulated by expression units as set forth in claim 2 or 3 or by expression units as set forth in claim 2 or 3 with increased specific expression activity as set forth in embodiment a), where the genes are heterologous in relation to the expression units.
[0220]As described above for the methods, the regulation of the expression of genes in the microorganism by expression units as set forth in claim 2 or 3 or by expression units as set forth in claim 2 or 3 with increased specific expression activity as set forth in embodiment a) is achieved by
dh1) introducing one or more expression units as set forth in claim 2 or 3, where appropriate with increased specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units according to claim 2 or 3, where appropriate with increased specific expression activity, ordh2) introducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units as set forth in claim 2 or 3, where appropriate with increased specific expression activity, ordh3) introducing one or more nucleic acid constructs comprising an expression unit as set forth in claim 2 or 3, where appropriate with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0221]The invention further relates to a genetically modified microorganism with reduced expression rate of at least one gene compared with the wild type, where
cr) the specific expression activity in the microorganism of at least one endogenous expression unit as set forth in claim 2 or 3, which regulates the expression of at least one endogenous gene, is reduced compared with the wild type, ordr) one or more expression units according to claim 2 or 3 with reduced expression activity are introduced into the genome of the microorganism so that expression of at least one endogenous gene takes place under the control of the introduced expression unit according to claim 2 or 3 with reduced expression activity.
[0222]The invention further relates to a genetically modified microorganism comprising an expression unit as set forth in claim 2 or 3 and functionally linked a gene to be expressed, where the gene is heterologous in relation to the expression unit.
[0223]This genetically modified microorganism particularly preferably comprises an expression cassette of the invention.
[0224]The present invention particularly preferably relates to genetically modified microorganisms, in particular coryneform bacteria, which comprise a vector, in particular shuttle vector or plasmid vector, which harbors at least one recombinant nucleic acid construct as defined according to the invention.
[0225]In a preferred embodiment of the genetically modified microorganisms, the genes described above are at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.
[0226]In a particularly preferred embodiment of the genetically modified microorganisms, the genes described above are selected from the group of nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compounds, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway of enzymes, where the genes may optionally comprise further regulatory elements.
[0227]Preferred proteins from the biosynthetic pathway of amino acids are selected from the group of aspartate kinase, aspartate-semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate deydrogenase, 6-phosphogluconate dehydrogenase, transketolase, transaldolase, homoserine O-acetyltransferase, cystathionine gamma-synthase, cystathionine beta-lyase, serine hydroxymethyltransferase, O-acetylhomoserine sulfhydrylase, methylenetetrahydrofolate reductase, phosphoserine aminotransferase, phosphoserine phosphatase, serine acetyltransferase, homoserine dehydrogenase, homoserine kinase, threonine synthase, threonine exporter carrier, threonine dehydratase, pyruvate oxidase, lysine exporter, biotin ligase, cysteine synthase I, cysteine synthase II, coenzyme B12-dependent methionine synthase, coenzyme B12-independent methionine synthase activity, sulfate adenylyltransferase subunit 1 and 2, phosphoadenosine-phosphosulfate reductase, ferredoxin-sulfite reductase, ferredoxin NADP reductase, 3-phosphoglycerate dehydrogenase, RXA00655 regulator, RXN2910 regulator, arginyl-tRNA synthetase, phosphoenolpyruvate carboxylase, threonine efflux protein, serine hydroxymethyltransferase, fructose-1,6-bisphosphatase, protein of sulfate reduction RXA077, protein of sulfate reduction RXA248, protein of sulfate reduction RXA247, protein OpcA, 1-phosphofructokinase and 6-phosphofructokinase.
[0228]Particularly preferred examples of the proteins and genes from the biosynthetic pathway of amino acids are described above in Table 1 and Table 2.
[0229]Preferred microorganisms or genetically modified microorganisms are bacteria, algae, fungi or yeasts.
[0230]Particularly preferred microorganisms are, in particular, coryneform bacteria.
[0231]Preferred coryneform bacteria are bacteria of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium efficiens or of the genus Brevibacterium, in particular of the species Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum.
[0232]Particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are selected from the group of Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens DSM 44547, Corynebacterium efficiens DSM 44548, Corynebacterium efficiens DSM 44549, Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869, Brevibacterium divaricatum ATCC 14020, Corynebacterium glutamicum KFCC10065 and Corynebacterium glutamicum ATCC21608.
[0233]The abbreviation KFCC means the Korean Federation of Culture Collection, the abbreviation ATCC the American type strain culture collection and the abbreviation DSM the Deutsche Sammlung von Mikroorganismen.
[0234]Further particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are listed in Table 3:
TABLE-US-00005 Bacterium Deposition number Genus species ATCC FERM NRRL CECT NCIMB CBS NCTC DSMZ Brevibacterium ammoniagenes 21054 Brevibacterium ammoniagenes 19350 Brevibacterium ammoniagenes 19351 Brevibacterium ammoniagenes 19352 Brevibacterium ammoniagenes 19353 Brevibacterium ammoniagenes 19354 Brevibacterium ammoniagenes 19355 Brevibacterium ammoniagenes 19356 Brevibacterium ammoniagenes 21055 Brevibacterium ammoniagenes 21077 Brevibacterium ammoniagenes 21553 Brevibacterium ammoniagenes 21580 Brevibacterium ammoniagenes 39101 Brevibacterium butanicum 21196 Brevibacterium divaricatum 21792 P928 Brevibacterium flavum 21474 Brevibacterium flavum 21129 Brevibacterium flavum 21518 Brevibacterium flavum B11474 Brevibacterium flavum B11472 Brevibacterium flavum 21127 Brevibacterium flavum 21128 Brevibacterium flavum 21427 Brevibacterium flavum 21475 Brevibacterium flavum 21517 Brevibacterium flavum 21528 Brevibacterium flavum 21529 Brevibacterium flavum B11477 Brevibacterium flavum B11478 Brevibacterium flavum 21127 Brevibacterium flavum B11474 Brevibacterium healii 15527 Brevibacterium ketoglutamicum 21004 Brevibacterium ketoglutamicum 21089 Brevibacterium ketosoreductum 21914 Brevibacterium lactofermentum 70 Brevibacterium lactofermentum 74 Brevibacterium lactofermentum 77 Brevibacterium lactofermentum 21798 Brevibacterium lactofermentum 21799 Brevibacterium lactofermentum 21800 Brevibacterium lactofermentum 21801 Brevibacterium lactofermentum B11470 Brevibacterium lactofermentum B11471 Brevibacterium lactofermentum 21086 Brevibacterium lactofermentum 21420 Brevibacterium lactofermentum 21086 Brevibacterium lactofermentum 31269 Brevibacterium linens 9174 Brevibacterium linens 19391 Brevibacterium linens 8377 Brevibacterium paraffinolyticum 11160 Brevibacterium spec. 717.73 Brevibacterium spec. 717.73 Brevibacterium spec. 14604 Brevibacterium spec. 21860 Brevibacterium spec. 21864 Brevibacterium spec. 21865 Brevibacterium spec. 21866 Brevibacterium spec. 19240 Corynebacterium acetoacidophilum 21476 Corynebacterium acetoacidophilum 13870 Corynebacterium acetoglutamicum B11473 Corynebacterium acetoglutamicum B11475 Corynebacterium acetoglutamicum 15806 Corynebacterium acetoglutamicum 21491 Corynebacterium acetoglutamicum 31270 Corynebacterium acetophilum B3671 Corynebacterium ammoniagenes 6872 2399 Corynebacterium ammoniagenes 15511 Corynebacterium fujiokense 21496 Corynebacterium glutamicum 14067 Corynebacterium glutamicum 39137 Corynebacterium glutamicum 21254 Corynebacterium glutamicum 21255 Corynebacterium glutamicum 31830 Corynebacterium glutamicum 13032 Corynebacterium glutamicum 14305 Corynebacterium glutamicum 15455 Corynebacterium glutamicum 13058 Corynebacterium glutamicum 13059 Corynebacterium glutamicum 13060 Corynebacterium glutamicum 21492 Corynebacterium glutamicum 21513 Corynebacterium glutamicum 21526 Corynebacterium glutamicum 21543 Corynebacterium glutamicum 13287 Corynebacterium glutamicum 21851 Corynebacterium glutamicum 21253 Corynebacterium glutamicum 21514 Corynebacterium glutamicum 21516 Corynebacterium glutamicum 21299 Corynebacterium glutamicum 21300 Corynebacterium glutamicum 39684 Corynebacterium glutamicum 21488 Corynebacterium glutamicum 21649 Corynebacterium glutamicum 21650 Corynebacterium glutamicum 19223 Corynebacterium glutamicum 13869 Corynebacterium glutamicum 21157 Corynebacterium glutamicum 21158 Corynebacterium glutamicum 21159 Corynebacterium glutamicum 21355 Corynebacterium glutamicum 31808 Corynebacterium glutamicum 21674 Corynebacterium glutamicum 21562 Corynebacterium glutamicum 21563 Corynebacterium glutamicum 21564 Corynebacterium glutamicum 21565 Corynebacterium glutamicum 21566 Corynebacterium glutamicum 21567 Corynebacterium glutamicum 21568 Corynebacterium glutamicum 21569 Corynebacterium glutamicum 21570 Corynebacterium glutamicum 21571 Corynebacterium glutamicum 21572 Corynebacterium glutamicum 21573 Corynebacterium glutamicum 21579 Corynebacterium glutamicum 19049 Corynebacterium glutamicum 19050 Corynebacterium glutamicum 19051 Corynebacterium glutamicum 19052 Corynebacterium glutamicum 19053 Corynebacterium glutamicum 19054 Corynebacterium glutamicum 19055 Corynebacterium glutamicum 19056 Corynebacterium glutamicum 19057 Corynebacterium glutamicum 19058 Corynebacterium glutamicum 19059 Corynebacterium glutamicum 19060 Corynebacterium glutamicum 19185 Corynebacterium glutamicum 13286 Corynebacterium glutamicum 21515 Corynebacterium glutamicum 21527 Corynebacterium glutamicum 21544 Corynebacterium glutamicum 21492 Corynebacterium glutamicum B8183 Corynebacterium glutamicum B8182 Corynebacterium glutamicum B12416 Corynebacterium glutamicum B12417 Corynebacterium glutamicum B12418 Corynebacterium glutamicum B11476 Corynebacterium glutamicum 21608 Corynebacterium lilium P973 Corynebacterium nitrilophilus 21419 11594 Corynebacterium spec. P4445 Corynebacterium spec. P4446 Corynebacterium spec. 31088 Corynebacterium spec. 31089 Corynebacterium spec. 31090 Corynebacterium spec. 31090 Corynebacterium spec. 31090 Corynebacterium spec. 15954 20145 Corynebacterium spec. 21857 Corynebacterium spec. 21862 Corynebacterium spec. 21863
[0235]The abbreviations have the following meaning:
ATCC: American Type Culture Collection, Rockville, Md., USA
FERM: Fermentation Research Institute, Chiba, Japan
NRRL: ARS Culture Collection, Northern Regional Research Laboratory, Peoria, Ill., USA
CECT: Coleccion Espanola de Cultivos Tipo, Valencia, Spain
NCIMB: National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK
[0236]CBS: Centraalbureau voor Schimmelcultures, Baarn, NL
NCTC: National Collection of Type Cultures, London, UK
DSMZ: Deutsche Sammlung von Mikroorganismen and Zellkulturen, Braunschweig, Germany
[0237]Through the nucleic acids of the invention having promoter activity and the expression units of the invention it is possible with the aid of the methods of the invention described above to regulate the metabolic pathways in the genetically modified microorganisms of the invention described above to specific biosynthetic products.
[0238]For this purpose, for example, metabolic pathways which lead to a specific biosynthetic product are enhanced by causing or increasing the transcription rate or expression rate of genes of this biosynthetic pathway in which the increased quantity of protein leads to an increased total activity of these proteins of the desired biosynthetic pathway and thus to an enhanced metabolic flux toward the desired biosynthetic product.
[0239]In addition, metabolic pathways which diverge from a specific biosynthetic product can be diminished by reducing the transcription rate or expression rate of genes of this divergent biosynthetic pathway in which the reduced quantity of protein leads to a reduced total activity of these proteins of the unwanted biosynthetic pathway and thus additionally to an enhanced metabolic flux toward the desired biosynthetic product.
[0240]The genetically modified microorganisms of the invention are able for example to produce biosynthetic products from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol.
[0241]The invention therefore relates to a method for producing biosynthetic products by cultivating genetically modified microorganisms of the invention.
[0242]Depending on the desired biosynthetic product, the transcription rate or expression rate of various genes must be increased or reduced. Ordinarily, it is advantageous to alter the transcription rate or expression rate of a plurality of genes, i.e. to increase the transcription rate or expression rate of a combination of genes and/or to reduce the transcription rate or expression rate of a combination of genes.
[0243]In the genetically modified microorganisms of the invention, at least one altered, i.e. increased or reduced, transcription rate or expression rate of a gene is attributable to a nucleic acid of the invention having promoter activity or expression unit of the invention.
[0244]Further, additionally altered, i.e. additionally increased or additionally reduced, transcription rates or expression rates of further genes in the genetically modified microorganism may, but need not, derive from the nucleic acids of the invention having promoter activity or the expression units of the invention.
[0245]The invention therefore further relates to a method for producing biosynthetic products by cultivating genetically modified microorganisms of the invention.
[0246]Preferred biosynthetic products are fine chemicals.
[0247]The term "fine chemical" is known in the art and includes compounds which are produced by an organism and are used in various branches of industry such as, for example but not restricted to, the pharmaceutical industry, the agriculture, cosmetics, food and feed industries. These compounds include organic acids such as, for example, tartaric acid, itaconic acid and diaminopimelic acid, and proteinogenic and non-proteinogenic amino acids, purine bases and pyrimidine bases, nucleosides and nucleotides (as described for example in Kuninaka, A. (1996) Nucleotides and related compounds, pp. 561-612, in Biotechnology vol. 6, Rehm et al., editors, VCH: Weinheim and the references present therein), lipids, saturated and unsaturated fatty acids (e.g. arachidonic acid), diols (e.g. propanediol and butanediol), carbohydrates (e.g. hyaluronic acid and trehalose), aromatic compounds (e.g. aromatic amines, vanillin and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the references present therein; and Ong, A. S., Niki, E. and Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research--Asia, held on Sep. 1-3, 1994 in Penang, Malaysia, AOCS Press (1995)), enzymes and all other chemicals described by Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 and the references indicated therein. The metabolism and the uses of certain fine chemicals are explained further below.
I. Amino Acid Metabolism and Uses
[0248]The amino acids comprise the fundamental structural units of all proteins and are thus essential for normal cell functions. The term "amino acid" is known in the art. The proteinogenic amino acids, of which there are 20 types, serve as structural units for proteins, in which they are linked together by peptide bonds, whereas the non-proteinogenic amino acids (of which hundreds are known) usually do not occur in proteins (see Ullmann's Encyclopedia of Industrial Chemistry, vol. A2, pp. 57-97 VCH: Weinheim (1985)). The amino acids may be in the D or L configuration, although L-amino acids are usually the only type found in naturally occurring proteins. Biosynthetic and degradation pathways of each of the 20 proteinogenic amino acids are well characterized both in prokaryotic and in eukaryotic cells (see, for example, Stryer, L. Biochemistry, 3rd edition, pp. 578-590 (1988)). The "essential" amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine), so-called because they must, owing to the complexity of their biosynthesis, be taken in with the diet, are converted by simple biosynthetic pathways into the other 11 "nonessential" amino acids (alanine, arginine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine and tyrosine). Higher animals have the ability to synthesize some of these amino acids, but the essential amino acids must be taken in with the food in order for normal protein synthesis to take place.
[0249]Apart from their function in protein biosynthesis, these amino acids are chemicals of interest per se, and it has been found that many have uses in various applications in the food, feed, chemicals, cosmetics, agriculture and pharmaceutical industries. Lysine is an important amino acid not only for human nutrition but also for monogastric species such as poultry and pigs. Glutamate is used most frequently as flavor additive (monosodium glutamate, MSG) and widely in the food industry, as well as aspartate, phenylalanine, glycine and cysteine. Glycine, L-methionine and tryptophan are all used in the pharmaceutical industry. Glutamine, valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine are used in the pharmaceutical industry and the cosmetics industry. Threonine, tryptophan and D-/L-methionine are widely used feed additives (Leuchtenberger, W. (1996) Amino acids--technical production and use, pp. 466-502 in Rehm et al., (editors) Biotechnology vol. 6, chapter 14a, VCH: Weinheim). It has been found that these amino acids are additionally suitable as precursors for synthesizing synthetic amino acids and proteins such as N-acetylcysteine, S-carboxymethyl-L-cysteine, (S)-5-hydroxytryptophan and other substances described in Ullmann's Encyclopedia of Industrial Chemistry, vol. A2, pp. 57-97, VCH, Weinheim, 1985.
[0250]The biosynthesis of these natural amino acids in organisms able to produce them, for example bacteria, has been well characterized (for a review of bacterial amino acid biosynthesis and its regulation, see Umbarger, H. E. (1978) Ann. Rev. Biochem. 47: 533-606). Glutamate is synthesized by reductive amination of α-ketoglutarate, an intermediate in the citric acid cycle. Glutamine, proline and arginine are each generated successively from glutamate. Biosynthesis of serine takes place in a three-step method and starts with 3-phosphoglycerate (an intermediate of glycolysis) and yields this amino acid after oxidation, transamination and hydrolysis steps. Cysteine and glycine are each produced from serine, the former by condensation of homocysteine with serine, and the latter by transfer of the side-chain β-carbon atom to tetrahydrofolate in a reaction catalyzed by serine transhydroxymethylase. Phenylalanine and tyrosine are synthesized from the precursors of the glycolysis and pentose phosphate pathways, erythrose 4-phosphate and phosphenolpyruvate in a 9-step biosynthetic pathway which differs only in the last two steps after the synthesis of prephenate. Tryptophan is likewise produced from these two starting molecules, but its synthesis takes place in an 11-step pathway. Tyrosine can also be produced from phenylalanine in a reaction catalyzed by phenylalanine hydroxylase. Alanine, valine and leucine are each biosynthetic products of pyruvate, the final product of glycolysis. Aspartate is formed from oxalacetate, an intermediate of the citrate cycle. Asparagine, methionine, threonine and lysine are each produced by conversion of aspartate. Isoleucine is formed from threonine. Histidine is formed in a complex 9-step pathway from 5-phosphoribosyl 1-pyrophosphate, an activated sugar.
[0251]Amino acids whose quantity exceeds the protein biosynthesis requirement of the cell cannot be stored and are instead degraded, so that intermediates are provided for the main metabolic pathways of the cell (for a review, see Stryer, L., Biochemistry, 3rd edition, chapter 21 "Amino Acid Degradation and the Urea Cycle"; pp. 495-516 (1988)). Although the cell is able to convert unwanted amino acids into useful metabolic intermediates, amino acid production is costly in terms of the energy, the precursor molecules and the enzymes required for their synthesis. It is therefore not surprising that amino acid biosynthesis is regulated by feedback inhibition, where the presence of a particular amino acid slows down or entirely terminates its own production (for a review of the feedback mechanism in amino acid biosynthetic pathways, see Stryer, L., Biochemistry, 3rd edition, chapter 24, "Biosynthesis of Amino Acids and Heme", pp. 575-600 (1988)). The output of a particular amino acid is therefore restricted by the quantity of this amino acid in the cell.
II. Vitamins, Cofactors and Nutraceutical Metabolism, and Uses
[0252]Vitamins, cofactors and nutraceuticals comprise a further group of molecules. Higher animals have lost the ability to synthesize these and therefore need to take them in, although they are easily synthesized by other organisms such as bacteria. These molecules are either biologically active molecules per se or precursors of biologically active substances which serve as electron carriers or intermediates in a number of metabolic pathways. These compounds have, besides their nutritional value, also a significant industrial value as coloring agents, antioxidants and catalysts or other processing aids. (For a review of the structure, activity and industrial applications of these compounds, see, for example, Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", vol. A27, pp. 443-613, VCH: Weinheim, 1996). The term "vitamin" is known in the art and includes nutrients which are required by an organism for normal functioning, but cannot be synthesized by this organism itself. The group of vitamins may include cofactors and nutraceutical compounds. The term "cofactor" includes non-protein compounds which are necessary for the occurrence of normal enzymic activity. These compounds may be organic or inorganic; the cofactor molecules of the invention are preferably organic. The term "nutraceutical" includes food additives which promote health in plants and animals, especially in humans. Examples of such molecules are vitamins, antioxidants and likewise certain lipids (e.g. polyunsaturated fatty acids).
[0253]Biosynthesis of these molecules in organisms able to produce them, such as bacteria, has been characterized in detail (Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", vol. A27, pp. 443-613, VCH: Weinheim, 1996, Michal, G. (1999) Biochemical Pathways An Atlas of Biochemistry and Molecular Biology, John Wiley & Sons; Ong, A. S., Niki, E. and Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for free Radical Research--Asia, held on Sep. 1-3, 1994, in Penang, Malaysia, AOCS Press, Champaign, Ill. X, 374 S).
[0254]Thiamine (vitamin B1) is formed by chemical coupling of pyrimidine and thiazole units. Riboflavin (vitamin B2) is synthesized from guanosine 5'-triphosphate (GTP) and ribose 5-phosphate. Riboflavin in turn is employed for the synthesis of flavin mononucleotide (FMN) and flavin-adenine dinucleotide (FAD). The family of compounds referred to jointly as "vitamin B6" (e.g. pyridoxine, pyridoxamine, pyridoxal 5-phosphate and the commercially used pyridoxine hydrochloride) are all derivatives of the common structural unit 5-hydroxy-6-methylpyridine. Pantothenate (pantothenic acid, R-(+)-N-(2,4-dihydroxy-3,3-dimethyl-1-oxobutyl)-β-alanine) can be produced either by chemical synthesis or by fermentation. The last steps in pantothenate biosynthesis consist of ATP-driven condensation of β-alanine and pantoic acid. The enzymes responsible for the biosynthetic steps for conversion into pantoic acid, into β-alanine and for condensation to pantothenic acid are known. The metabolically active form of pantothenate is coenzyme A, whose biosynthesis proceeds through 5 enzymatic steps. Pantothenate, pyridoxal 5-phosphate, cysteine and ATP are the precursors of coenzyme A. These enzymes catalyze not only the formation of pantothenate but also the production of (R)-pantoic acid, (R)-pantolactone, (R)-panthenol (provitamin B5), pantethein (and its derivatives) and coenzyme A.
[0255]The biosynthesis of biotin from the precursor molecule pimeloyl-CoA in microorganisms has been investigated in detail, and several of the genes involved have been identified. It has emerged that many of the corresponding proteins are involved in Fe cluster synthesis and belong to the class of nifS proteins. Lipoic acid is derived from octanoic acid and serves as coenzyme in energy metabolism, where it becomes a constituent of the pyruvate dehydrogenase complex and of the α-ketoglutarate dehydrogenase complex. The folates are a group of substances which are all derived from folic acid, which in turn is derived from L-glutamic acid, p-aminobenzoic acid and 6-methylpterin. The biosynthesis of folic acid and its derivatives starting from the metabolic intermediates guanosine 5'-triphosphate (GTP), L-glutamic acid and p-aminobenzoic acid has been investigated in detail in certain microorganisms.
[0256]Corrinoids (such as the cobalamins and in particular vitamin B12) and the porphyrins belong to a group of chemicals which are distinguished by a tetrapyrrole ring system. The biosynthesis of vitamin B12 is so complex that it has not yet been completely characterized, but most of the enzymes and substrates involved are now known. Nicotinic acid (nicotinate) and nicotinamide are pyridine derivatives, which are also referred to as "niacin". Niacin is the precursor of the important coenzymes NAD (nicotinamide-adenine dinucleotide) and NADP (nicotinamide-adenine dinucleotide phosphate) and their reduced forms.
[0257]The production of these compounds on the industrial scale is based for the most part on cell-free chemical syntheses, although some of these chemicals have likewise been produced by large-scale culturing of microorganisms, such as riboflavin, vitamin B6, pantothenate and biotin. Only vitamin B12 is produced solely by fermentation, because of the complexity of its synthesis. In vitro methods require a considerable expenditure of materials and time and frequently of high costs.
III. Purine, Pyrimidine, Nucleoside and Nucleotide Metabolism and Uses
[0258]Genes for purine and pyrimidine metabolism and their corresponding proteins are important targets for the therapy of neoplastic diseases and viral infections. The term "purine" or "pyrimidine" comprises nitrogenous bases which are a constituent of nucleic acids, coenzymes and nucleotides. The term "nucleotide" comprises the fundamental structural units of nucleic acid molecules, which include a nitrogenous base, a pentose sugar (the sugar in RNA is ribose, and the sugar in DNA is D-deoxyribose) and phosphoric acid. The term "nucleoside" comprises molecules which serve as precursors of nucleotides but which, in contrast to nucleotides, have no phosphoric acid unit. It is possible by inhibiting the biosynthesis of these molecules or their mobilization for formation of nucleic acid molecules to inhibit RNA and DNA synthesis; targeted inhibition of this activity in carcinogenic cells allows the ability of tumor cells to divide and replicate to be inhibited.
[0259]There are also nucleotides which do not form nucleic acid molecules but serve as energy stores (i.e. AMP) or as coenzymes (i.e. FAD and NAD).
[0260]Several publications have described the use of these chemicals for these medical indications, where purine and/or pyrimidine metabolism is influenced (e.g. Christopherson, R. I. and Lyons, S. D. (1990) "Potent inhibitors of de novo pyrimidine and purine biosynthesis as chemotherapeutic agents", Med. Res. Reviews 10: 505-548). Investigations on enzymes involved in purine and pyrimidine metabolism have concentrated on the development of novel medicaments which can be used for example as immunosuppressants or antiproliferatives (Smith, J. L. "Enzymes in Nucleotide Synthesis" Curr. Opin. Struct. Biol. 5 (1995) 752-757; Biochem. Soc. Transact. 23 (1995) 877-902). Purine and pyrimidine bases, nucleosides and nucleotides have, however, also other possible uses: as intermediates in the biosynthesis of various fine chemicals (e.g. thiamine, S-adenosylmethionine, folates or riboflavin), as energy carriers for the cell (e.g. ATP or GTP) and for chemicals themselves, are commonly used as flavor enhancers (e.g. IMP or GMP) or for many medical applications (see, for example, Kuninaka, A., (1996) "Nucleotides and Related Compounds" in Biotechnology, vol. 6, Rehm et al., editors VCH: Weinheim, pp. 561-612). Enzymes involved in purine, pyridine, nucleoside or nucleotide metabolism are also increasingly serving as targets for the development of chemicals for crop protection, including fungicides, herbicides and insecticides.
[0261]The metabolism of these compounds in bacteria has been characterized (for reviews, see, for example, Zalkin, H. and Dixon, J. E. (1992) "De novo purine nucleotide biosynthesis" in Progress in Nucleic Acids Research and Molecular biology, vol. 42, Academic Press, pp. 259-287; and Michal, G. (1999) "Nucleotides and Nucleosides"; chapter 8 in: Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, Wiley, New York). Purine metabolism, which is the subject of intensive research, is essential for normal functioning of the cell. Impaired purine metabolism in higher animals may cause severe disorders, e.g. gout. The purine nucleotides are synthesized over a number of steps via the intermediate compound inosine 5'-phosphate (IMP) from ribose 5-phosphate, leading to production of guanosine 5'-monophosphate (GMP) or adenosine 5'-monophosphate (AMP), from which the triphosphate forms, which are used as nucleotides, can easily be prepared. These compounds are also used as energy stores, so that their degradation provides energy for many different biochemical processes in the cell. Pyrimidine biosynthesis takes place via the formation of uridine 5'-monophosphate (UMP) from ribose 5-phosphate. UMP in turn is converted into cytidine 5'-triphosphate (CTP). The deoxy forms of all nucleotides are prepared in a one-step reduction reaction from the diphosphate ribose form of the nucleotide to give the diphosphate deoxyribose form of the nucleotide. After phosphorylation, these molecules are able to take part in DNA synthesis.
IV. Trehalose Metabolism and Uses
[0262]Trehalose consists of two glucose molecules which are linked together via an α,α-1,1 linkage. It is commonly used in the food industry as sweetener, as additive to dried or frozen foods and in beverages. However, it is also used in the pharmaceutical industry, the cosmetics and biotechnology industry (see, for example, Nishimoto et al., (1998) U.S. Pat. No. 5,759,610; Singer, M. A. and Lindquist, S. Trends Biotech. 16 (1998) 460-467; Paiva, C. L. A. and Panek, A. D. Biotech Ann. Rev. 2 (1996) 293-314; and Shiosaka, M. FFIJ. Japan 172 (1997) 97-102). Trehalose is produced by enzymes of many microorganisms and is released in a natural way into the surrounding medium, from which it can be isolated by methods known in the art.
[0263]Particularly preferred biosynthetic products are selected from the group of organic acids, proteins, nucleotides and nucleosides, both proteinogenic and non-proteinogenic amino acids, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, enzymes and proteins.
[0264]Preferred organic acids are tartaric acid, itaconic acid and diaminopimelic acid.
[0265]Preferred nucleosides and nucleotides are described for example in Kuninaka, A. (1996) Nucleotides and related compounds, pp. 561-612, in Biotechnology, vol. 6, Rehm et al., editors VCH: Weinheim and references present therein.
[0266]Preferred biosynthetic products are additionally lipids, saturated and unsaturated fatty acids such as, for example, arachidonic acid, diols such as, for example, propanediol and butanediol, carbohydrates such as, for example, hyaluronic acid and trehalose, aromatic compounds such as, for example, aromatic amines, vanillin and indigo, vitamins and cofactors as described for example in Ullmann's Encyclopedia of Industrial Chemistry, vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the references present therein; and Ong, A. S., Niki, E. and Packer, L. (1995) "Nutrition, Lipids, Health and Disease" Proceedings of the UNESCO/Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research--Asia, held on Sep. 1-3, 1994 in Penang, Malaysia, AOCS Press (1995)), enzymes, polyketides (Cane et al. (1998) Science 282: 63-68) and all other chemicals described by Gutcho (1983) in Chemicals by Fermentation, Noyes Data Corporation, ISBN: 0818805086 and the references indicated therein.
[0267]Particularly preferred biosynthetic products are amino acids, particularly preferably essential amino acids, in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid, L-serine, L-proline, L-valine, L-isoleucine, L-cysteine, L-tyrosine, L-histidine, L-arginine, L-asparagine, L-aspartic acid and L-threonine, L-homoserine, especially L-lysine, L-methionine and L-threonine. An amino acid such as, for example, lysine, methionine and threonine means hereinafter both in each case the L and the D form of the amino acid, preferably the L form, i.e. for example L-lysine, L-methionine and L-threonine.
[0268]The invention relates in particular to a method for producing lysine by cultivating genetically modified microorganisms with increased or caused expression rate of at least one gene compared with the wild type, where
ch) the specific expression activity in the microorganism of at least one endogenous expression unit of the invention, which regulates the expression of the endogenous genes, is increased compared with the wild type, ordh) the expression of genes in the microorganism is regulated by expression units of the invention or by expression units with increased specific expression activity as set forth in embodiment a), where the genes are heterologous in relation to the expression units,and where the genes are selected from the group of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate-semialdehyde dehydrogenase, nucleic acids encoding a diaminopimelate dehydrogenase, nucleic acids encoding a diaminopimelate decarboxylase, nucleic acids encoding a dihydrodipicolinate synthetase, nucleic acids encoding a dihydrodipicolinate reductase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a transcriptional regulator LuxR, nucleic acids encoding a transcriptional regulator LysR1, nucleic acids encoding a transcriptional regulator LysR2, nucleic acids encoding a malate-quinone oxidoreductase, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a 6-phosphogluconate dehydrogenase, nucleic acids encoding a transketolase, nucleic acids encoding a transaldolase, nucleic acids encoding a lysine exporter, nucleic acids encoding a biotin ligase, nucleic acids encoding an arginyl-tRNA synthetase, nucleic acids encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding a fructose-1,6-bisphosphatase, nucleic acids encoding a protein OpcA, nucleic acids encoding a 1-phosphofructokinase and nucleic acids encoding a 6-phosphofructokinase.
[0269]As described above for the methods, the regulation of the expression of these genes in the microorganism by expression units of the invention or by expression units of the invention with increased specific expression activity in accordance with embodiment ch) is achieved by
dh1) introducing one or more expression units of the invention, where appropriate with increased specific expression activity, into the genome of the microorganism so that expression of one or more endogenous genes takes place under the control of the introduced expression units of the invention, where appropriate with increased specific expression activity, ordh2) introducing one or more of these genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with increased specific expression activity, ordh3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0270]A further preferred embodiment of the method described above for preparing lysine comprises the genetically modified microorganisms, compared with the wild type, having additionally an increased activity, of at least one of the activities selected from the group of aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, diaminopimelate dehydrogenase activity, diaminopimelate decarboxylase activity, dihydrodipicolinate synthetase activity, dihydrodipicolinate reductase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, activity of the transcriptional regulator LuxR, activity of the transcriptional regulator LysR1, activity of the transcriptional regulator LysR2, malate-quinone oxidoreductase activity, glucose-6-phosphate dehydrogenase activity, 6-phosphogluconate dehydrogenase activity, transketolase activity, transaldolase activity, lysine exporter activity, arginyl-tRNA synthetase activity, phosphoenolpyruvate carboxylase activity, fructose-1,6-bisphosphatase activity, protein OpcA activity, 1-phosphofructokinase activity, 6-phosphofructokinase activity and biotin ligase activity.
[0271]A further particularly preferred embodiment of the method described above for preparing lysine comprises the genetically modified microorganisms having, compared with the wild type, additionally a reduced activity, of at least one of the activities selected from the group of threonine dehydratase activity, homoserine O-acetyl-transferase activity, O-acetylhomoserine sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, homoserine kinase activity, homoserine dehydrogenase activity, threonine exporter activity, threonine efflux protein activity, asparaginase activity, aspartate decarboxylase activity and threonine synthase activity.
[0272]These additional increased or reduced activities of at least one of the activities described above may, but need not, be caused by a nucleic acid of the invention having promoter activity and/or an expression unit of the invention.
[0273]The invention further relates to a method for producing methionine by cultivating genetically modified microorganisms with increased or caused expression rate of at least one gene compared with the wild type, where
ch) the specific expression activity in the microorganism of at least one endogenous expression unit of the invention, which regulates the expression of the endogenous genes, is increased compared with the wild type, ordh) the expression of genes in the microorganism is regulated by expression units of the invention or by expression units of the invention with increased specific expression activity as set forth in embodiment a), where the genes are heterologous in relation to the expression units,and where the genes are selected from the group of nucleic acids encodng an aspartate kinase, nucleic acids encoding an aspartate-semialdehyde dehydrogenase, nucleic acids encoding a homoserine dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine O-acetyltransferase, nucleic acids encoding a cystathionine gamma-synthase, nucleic acids encoding a cystathionine beta-lyase, nucleic acids encoding a serine hydroxymethyltransferase, nucleic acids encoding an O-acetylhomoserine sulfhydrylase, nucleic acids encoding a methylenetetrahydrofolate reductase, nucleic acids encoding a phosphoserine aminotransferase, nucleic acids encoding a phosphoserine phosphatase, nucleic acids encoding a serine acetyltransferase, nucleic acids encoding a cysteine synthase I, nucleic acids encoding a cysteine synthase II activity, nucleic acids encoding a coenzyme B12-dependent methionine synthase activity, nucleic acids encoding a coenzyme B12-independent methionine synthase activity, nucleic acids encoding a sulfate adenylyltransferase activity, nucleic acids encoding a phosphoadenosine phosphosulfate reductase activity, nucleic acids encoding a ferredoxin-sulfite reductase activity, nucleic acids encoding a ferredoxin NADPH-reductase activity, nucleic acids encoding a ferredoxin activity, nucleic acids encoding a protein of sulfate reduction RXA077, nucleic acids encoding a protein of sulfate reduction RXA248, nucleic acids encoding a protein of sulfate reduction RXA247, nucleic acids encoding an RXA0655 regulator and nucleic acids encoding an RXN2910 regulator.
[0274]As described above for the methods, the regulation of the expression of these genes in the microorganism by expression units of the invention or by expression units of the invention with increased specific expression activity according to embodiment ch) is achieved by
dh1) introducing one or more expression units of the invention, where appropriate with increased specific expression activity, into the genome of the microorganism so that expression of one or more of these endogenous genes takes place under the control of the introduced expression units of the invention, where appropriate with increased specific expression activity, ordh2) introducing one or more genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with increased specific expression activity, ordh3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0275]A further preferred embodiment of the method described above for preparing methionine comprises the genetically modified microorganisms having, compared with the wild type, additionally an increased activity, of at least one of the activities selected from the group of aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, homoserine dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, homoserine O-acetyltransferase activity, cystathionine gamma-synthase activity, cystathionine beta-lyase activity, serine hydroxymethyltransferase activity, O-acetyl homoserine sulfhydrylase activity, methylenetetrahydrofolate reductase activity, phosphoserine aminotransferase activity, phosphoserine phosphatase activity, serine acetyltransferase activity, cysteine synthase I activity, cysteine synthase II activity, coenzyme B12-dependent methionine synthase activity, coenzyme B12-independent methionine synthase activity, sulfate adenylyltransferase activity, phosphoadenosine-phosphosulfate reductase activity, ferredoxin-sulfite reductase activity, ferredoxin NADPH-reductase activity, ferredoxin activity, activity of a protein of sulfate reduction RXA077, activity of a protein of sulfate reduction RXA248, activity of a protein of sulfate reduction RXA247, activity of an RXA655 regulator and activity of an RXN2910 regulator.
[0276]A further particularly preferred embodiment of the method described above for preparing methionine comprises the genetically modified microorganisms having, compared with the wild type, additionally a reduced activity, of at least one of the activities selected from the group of homoserine kinase activity, threonine dehydratase activity, threonine synthase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthase activity, dihydrodipicolinate reductase activity and diaminopicolinate decarboxylase activity.
[0277]These additional increased or reduced activities of at least one of the activities described above may, but need not, be caused by a nucleic acid of the invention having promoter activity and/or an expression unit of the invention.
[0278]The invention further relates to a method for preparing threonine by cultivating genetically modified microorganisms with increased or caused expression rate of at least one gene compared with the wild type, where
ch) the specific expression activity in the microorganism of at least one endogenous expression unit of the invention, which regulates the expression of the endogenous genes, is increased compared with the wild type, ordh) the expression of genes in the microorganism is regulated by expression units of the invention or by expression units of the invention with increased specific expression activity as set forth in embodiment a), where the genes are heterologous in relation to the expression units,and where the genes are selected from the group of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate-semialdehyde dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine kinase, nucleic acids encoding a threonine synthase, nucleic acids encoding a threonine exporter carrier, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a transaldolase, nucleic acids encoding a transketolase, nucleic acids encoding a malate-quinone oxidoreductase, nucleic acids encoding a 6-phosphogluconate dehydrogenase, nucleic acids encoding a lysine exporter, nucleic acids encoding a biotin ligase, nucleic acids encoding a phosphoenolpyruvate carboxylase, nucleic acids encoding a threonine efflux protein, nucleic acids encoding a fructose-1,6-bisphosphatase, nucleic acids encoding an OpcA protein, nucleic acids encoding a 1-phosphofructokinase, nucleic acids encoding a 6-phosphofructokinase, and nucleic acids encoding a homoserine dehydrogenase.
[0279]As described above for the methods, the regulation of the expression of these genes in the microorganism by expression units of the invention or by expression units of the invention with increased specific expression activity according to embodiment ch) is achieved by
dh1) introducing one or more expression units of the invention, where appropriate with increased specific expression activity, into the genome of the microorganism so that expression of one or more of these endogenous genes takes place under the control of the introduced expression units of the invention, where appropriate with increased specific expression activity, ordh2) introducing one or more of these genes into the genome of the microorganism so that expression of one or more of the introduced genes takes place under the control of the endogenous expression units of the invention, where appropriate with increased specific expression activity, ordh3) introducing one or more nucleic acid constructs comprising an expression unit of the invention, where appropriate with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into the microorganism.
[0280]A further preferred embodiment of the method described above for preparing threonine comprises the genetically modified microorganisms having, compared with the wild type, additionally an increased activity, of at least one of the activities selected from the group of aspartate kinase activity, aspartate-semialdehyde dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, threonine synthase activity, activity of a threonine export carrier, transaldolase activity, transketolase activity, glucose-6-phosphate dehydrogenase activity, malate-quinone oxidoreductase activity, homoserine kinase activity, biotin ligase activity, phosphoenolpyruvate carboxylase activity, threonine efflux protein activity, protein OpcA activity, 1-phosphofructokinase activity, 6-phosphofructokinase activity, fructose-1,6-bisphosphatase activity, 6-phosphogluconate dehydrogenase and homoserine dehydrogenase activity.
[0281]A further particularly preferred embodiment of the method described above for preparing threonine comprises the genetically modified microorganisms having, compared with the wild type, additionally a reduced activity, of at least one of the activities selected from the group of threonine dehydratase activity, homoserine O-acetyltransferase activity, serine hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthetase activity, dihydrodipicolinate reductase activity, asparaginase activity, aspartate decarboxylase activity, lysine exporter activity, acetolactate synthase activity, ketol-acid reductoisomerase activity, branched chain aminotransferase activity, coenzyme B12-dependent methionine synthase activity, coenzyme B12-independent methionine synthase activity, dihydroxy-acid dehydratase activity and diaminopicolinate decarboxylase activity.
[0282]These additional increased or reduced activities of at least one of the activities described above may, but need not, be caused by a nucleic acid of the invention having promoter activity and/or an expression unit of the invention.
[0283]The term "activity" of a protein means in the case of enzymes the enzymic activity of the corresponding protein, and in the case of other proteins, for example structural or transport proteins, the physiological activity of the proteins.
[0284]The enzymes are ordinarily able to convert a substrate into a product or catalyze this conversion step.
[0285]Accordingly, the "activity" of an enzyme means the quantity of substrate converted by the enzyme, or the quantity of product formed, in a particular time.
[0286]Thus, where an activity is increased compared with the wild type, the quantity of the substrate converted by the enzyme, or the quantity of product formed, in a particular time is increased compared with the wild type.
[0287]This increase in the "activity" preferably amounts, for all activities described hereinbefore and hereinafter, to at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, especially at least 600% of the "activity of the wild type".
[0288]Thus, where an activity is reduced compared with the wild type, the quantity of substrate converted by the enzyme, or the quantity of product formed, in a particular time is reduced compared with the wild type.
[0289]A reduced activity preferably means the partial or substantially complete suppression or blocking, based on various cell biological mechanisms, of the functionality of this enzyme in a microorganism.
[0290]A reduction in the activity comprises a quantitative decrease in an enzyme as far as substantially complete absence of the enzyme (i.e. lack of detectability of the corresponding activity or lack of immunological detectability of the enzyme). The activity in the microorganism is preferably reduced, compared with the wild type, by at least 5%, further preferably by at least 20%, further preferably by at least 50%, further preferably by 100%. "Reduction" also means in particular the complete absence of the corresponding activity.
[0291]The activity of particular enzymes in genetically modified microorganisms and in the wild type, and thus the increase or reduction in the enzymic activity, can be measured by known methods such as, for example, enzyme assays.
[0292]For example, a pyruvate carboxylase means a protein which exhibits the enzymatic activity of converting pyruvate into oxaloacetate.
[0293]Correspondingly, a pyruvate carboxylase activity means the quantity of pyruvate converted by the pyruvate carboxlyase protein, or quantity of oxaloacetate formed, in a particular time.
[0294]Thus, where a pyruvate carboxylase activity is increased compared with the wild type, the quantity of pyruvate converted by the pyruvate carboxylase protein, or the quantity of oxaloacetate formed, in a particular time is increased compared with the wild type.
[0295]This increase in the pyruvate carboxylase activity is preferably at least 5%, further preferably at least 20%, further preferably at least 50%, further preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600%, of the pyruvate carboxylase activity of the wild type.
[0296]In addition, for example a phosphoenolpyruvate carboxykinase activity means the enzymic activity of a phosphoenolpyruvate carboxykinase.
[0297]A phosphoenolpyruvate carboxykinase means a protein which exhibits the enzymatic activity of converting oxaloacetate into phosphoenolpyruvate.
[0298]Correspondingly, phosphoenolpyruvate carboxykinase activity means the quantity of oxaloacetate converted by the phosphoenolpyruvate carboxykinase protein, or quantity of phosphoenolpyruvate formed, in a particular time.
[0299]When the phosphoenolpyruvate carboxykinase activity is reduced compared with the wild type, therefore, the quantity of oxaloacetate converted by the phosphoenolpyruvate carboxykinase protein, or the quantity of phosphoenolpyruvate formed, in a particular time, is reduced compared with the wild type.
[0300]A reduction in phosphoenolpyruvate carboxykinase activity comprises a quantitative decrease in a phosphoenolpyruvate carboxykinase as far as a substantially complete absence of phosphoenolpyruvate carboxykinase (i.e. lack of detectability of phosphoenolpyruvate carboxykinase activity or lack of immunological detectability of phosphoenolpyruvate carboxykinase). The phosphoenolpyruvate carboxykinase activity is preferably reduced, compared with the wild type, by at least 5%, further preferably by at least 20%, further preferably by at least 50%, further preferably by 100%. In particular, "reduction" also means the complete absence of phosphoenolpyruvate carboxykinase activity.
[0301]The additional increasing of activities can take place in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing gene expression of nucleic acids encoding the proteins described above compared with the wild type.
[0302]Increasing the gene expression of the nucleic acids encoding the proteins described above compared with the wild type can likewise take place in various ways, for example by inducing the gene by activators or, as described above, by increasing the promoter activity or increasing the expression activity or by introducing one or more gene copies into the microorganism.
[0303]Increasing the gene expression of a nucleic acid encoding a protein also means according to the invention manipulation of the expression of endogenous proteins intrinsic to the microorganism.
[0304]This can be achieved for example, as described above, by altering the promoter and/or expression unit sequences of the genes. Such an alteration, which results in an increased expression rate of the gene, can take place for example by deletion or insertion of DNA sequences.
[0305]It is possible, as described above, to alter the expression of endogenous proteins by applying exogenous stimuli. This can take place through particular physiological conditions, i.e. through the application of foreign substances.
[0306]The skilled worker may have recourse to further different procedures, singly or in combination, to achieve an increase in gene expression. Thus, for example, the copy number of the appropriate genes can be increased, or the promoter and regulatory region or the ribosome binding site located upstream of the structural gene can be mutated. It is additionally possible to increase the expression during fermentative production through inducible promoters. Procedures to prolong the lifespan of the mRNA likewise improve expression. Enzymic activity is likewise enhanced also by preventing degradation of enzyme protein. The genes or gene constructs may be either present in plasmids with varying copy number or integrated and amplified in the chromosome. It is also possible as an alternative to achieve overexpression of the relevant genes by altering the composition of the media and management of the culture.
[0307]The skilled worker can find guidance on this inter alia in Martin et al. (Biotechnology 5, 137-146 (1987)), in Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio/Technology 6, 428-430 (1988)), in Eikmanns et al. (Gene 102, 93-98 (1991)), in European patent 0472869, in U.S. Pat. No. 4,601,893, in Schwarzer and Puhler (Biotechnology 9, 84-87 (1991), in Reinscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994), in LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in the patent application WO 96/15246, in Malumbres et al. (Gene 134, 15-24 (1993)), in the Japanese published specification JP-A-10-229891, in Jensen and Hammer (Biotechnology and Bioengineering 58, 191-195 (1998)), in Makrides (Microbiological Reviews 60:512-538 (1996) and in well-known textbooks of genetics and molecular biology.
[0308]It may additionally be advantageous for the production of biosynthetic products, especially L-lysine, L-methionine and L-threonine, besides the expression or enhancement of a gene, to eliminate unwanted side reactions (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).
[0309]In a preferred embodiment, gene expression of a nucleic acid encoding one of the proteins described above is increased by introducing at least one nucleic acid encoding a corresponding protein into the microorganism. The introduction of the nucleic acid can take place chromosomally or extrachromosomally, i.e. through increasing the copy number on the chromosome and/or a copy of the gene on a plasmid which replicates in the host microorganism.
[0310]The introduction of the nucleic acid, for example in the form of an expression cassette comprising the nucleic acid, preferably takes place chromosomally, in particular by the SacB method described above.
[0311]It is possible in principle to use for this purpose any gene which encodes one of the proteins described above.
[0312]In the case of genomic nucleic acid sequences from eukaryotic sources which comprise introns, if the host microorganism is unable or cannot be made able to express the corresponding proteins it is preferred to use nucleic acid sequences whch have already been processed, such as the corresponding cDNAs.
[0313]Examples of the corresponding genes are listed in Table 1 and 2.
[0314]The activities described above in microorganisms are preferably reduced by at least one of the following methods: [0315]introduction of at least one sense ribonucleic acid sequence for inducing cosuppression or of an expression cassette ensuring expression thereof [0316]introduction of at least one DNA- or protein-binding factor against the corresponding gene, RNA or protein or of an expression cassette ensuring expression thereof [0317]introduction of at least one viral nucleic acid sequence which causes RNA degradation, or of an expression cassette ensuring expression thereof [0318]introduction of at least one construct to produce a loss of function, such as, for example, generation of stop codons or a shift in the reading frame, of a gene, for example by producing an insertion, deletion, inversion or mutation in a gene. It is possible and preferred to generate knockout mutants by targeted insertion into the desired target gene through homologous recombination or introduction of sequence-specific nucleases against the target gene. [0319]introduction of a promoter with reduced promoter activity or of an expression unit with reduced expression activity.
[0320]The skilled worker is aware that further methods can also be employed within the scope of the present invention for reducing its activity or function. For example, the introduction of a dominant negative variant of a protein or of an expression cassette ensuring expression thereof may also be advantageous.
[0321]It is moreover possible for each single one of these methods to bring about a reduction in the quantity of protein, quantity of mRNA and/or activity of a protein. A combined use is also conceivable. Further methods are known to the skilled worker and may comprise impeding or suppressing the processing of the protein, of the transport of the protein or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an RNA-degrading enzyme and/or inhibition of translation elongation or termination.
[0322]In the method of the invention for producing biosynthetic products, the step of cultivation of the genetically modified microorganisms is preferably followed by an isolation of biosynthetic products from the microorganisms or/or from the fermentation broth. These steps may take place at the same time and/or preferably after the cultivation step.
[0323]The genetically modified microorganisms of the invention can be cultivated to produce biosynthetic products, in particular L-lysine, L-methionine and L-threonine, continuously or discontinuously in a batch method (batch cultivation) or in the fed batch or repeated fed batch method. A summary of known cultivation methods is to be found in the textbook by Chmiel (Bioprozeβtechnik 1. Einfuhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren and periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).
[0324]The culture medium to be used must satisfy in a suitable manner the demands of the respective strains. There are descriptions of culture media for various microorganisms in the handbook "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981).
[0325]These media which can be employed according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and/or trace elements.
[0326]Preferred carbon sources are sugars such as mono-, di- or polysaccharides. Examples of very good carbon sources are glucose, fructose, mannose, galactose, ribose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugars can be put in the media also via complex compounds such as molasses, or other by-products of sugar refining. It may also be advantageous to add mixtures of various carbon sources. Other possible carbon sources are oils and fats such as, for example, soybean oil, sunflower oil, peanut oil and coconut fat, fatty acids such as, for example, palmitic acid, stearic acid or linoleic acid, alcohols such as, for example, glycerol, methanol or ethanol and organic acids such as, for example, acetic acid or lactic acid.
[0327]Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds. Examples of nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soybean flour, soybean protein, yeast extract, meat extract and others. The nitrogen sources may be used singly or as mixtures.
[0328]Inorganic salt compounds which may be present in the media comprise the chloride, phosphoric or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron.
[0329]For producing fine chemicals, especially methionine, it is possible to use as sulfur source inorganic compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, but also organic sulfur compounds such as mercaptans and thiols.
[0330]It is possible to use as phosphorus source phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate or the corresponding sodium-containing salts.
[0331]Chelating agents can be added to the medium in order to keep the metal ions in solution. Particularly suitable chelating agents comprise dihydroxyphenols such as catechol or protocatechuate, or organic acids such as citric acid.
[0332]The fermentation media employed according to the invention normally also comprise other growth factors such as vitamins or growth promoters, which include for example biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate and pyridoxine. Growth factors and salts are frequently derived from complex components of the media, such as yeast extract, molasses, corn steep liquor and the like. Suitable precursors may also be added to the culture medium. The exact composition of the compounds in the media depends greatly on the particular experiment and will be decided individually for each specific case. Information on optimization of media is obtainable from the textbook "Applied Microbiol. Physiology, A Practical Approach" (editors P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). Growth media can also be purchased from commercial suppliers, such as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the like.
[0333]All the components of the media are sterilized either by heat (20 min at 1.5 bar and 121° C.) or by sterilizing filtration. The components can be sterilized either together or, if necessary, separately. All the components of the media may be present at the start of culturing or optionally be added continuously or batchwise.
[0334]The temperature of the culture is normally between 15° C. and 45° C., preferably at 25° C. to 40° C. and can be kept constant or changed during the experiment. The pH of the medium should be in the range from 5 to 8.5, preferably around 7.0. The pH for the culturing can be controlled during the culturing by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia or acidic compounds such as phosphoric acid or sulfuric acid. The development of foam can be controlled by employing antifoams such as, for example, fatty acid polyglycol esters. The stability of plasmids can be maintained by adding to the medium suitable substances with a selective action, such as, for example, antibiotics. Aerobic conditions are maintained by introducing oxygen or oxygen-containing gas mixtures such as, for example, ambient air into the culture. The temperature of the culture is normally 20° C. to 45° C. The culture is continued until formation of the desired product is at a maximum. This aim is normally reached within 10 hours to 160 hours.
[0335]The dry matter content of the fermentation broths obtained in this way is normally from 7.5 to 25% by weight.
[0336]It is additionally advantageous also to run the fermentation with sugar limitation at least at the end, but in particular over at least 30% of the fermentation time. This means that the concentration of utilizable sugar in the fermentation medium is kept at 0 to 3 g/l, or is reduced, during this time.
[0337]Biosynthetic products are isolated from the fermentation broth and/or the microorganisms in a manner known per se in accordance with the physical/chemical properties of the required biosynthetic product and the biosynthetic by-products.
[0338]The fermentation broth can then be processed further for example. Depending on the requirement, the biomass can be removed wholly or partly from the fermentation broth by separation methods such as, for example, centrifugation, filtration, decantation or a combination of these methods, or left completely in it.
[0339]The fermentation broth can then be concentrated by known methods such as, for example, with the aid of a rotary evaporator, thin-film evaporator, falling-film evaporator, by reverse osmosis or by nanofiltration. This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other methods.
[0340]However, it is also possible to purify the biosynthetic products, especially L-lysine, L-methionine and L-threonine, further. For this purpose, the product-containing broth is subjected, after removal of the biomass, to a chromatography using a suitable resin, with the desired product or the impurities being retained wholly or partly on the chromatography resin. These chromatographic steps can be repeated if required, using the same or different chromatography resins. The skilled worker is proficient in the selection of suitable chromatography resins and their most effective use. The purified product can be concentrated by filtration or ultrafiltration and be stored at a temperature at which the stability of the product is a maximum.
[0341]The biosynthetic products may result in various forms, for example in the form of their salts or esters.
[0342]The identity and purity of the isolated compound(s) can be determined by prior art techniques. These comprise high performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin-layer chromatography, NIRS, enzyme assay or microbiological assays. These analytical methods are summarized in: Patek et al. (1994) Appl. Environ. Microbiol. 60:133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19:67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp. 559-566, 575-581 and pp. 581-587; Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17.
[0343]The invention is now described in more detail by means of the following nonlimiting examples:
EXAMPLE 1
Construction of Plasmid pCIS lysC
[0344]In the first step of strain construction, an allelic exchange of the lysC wild-type gene in Corynebacterium glutamicum ATCC13032 was carried out. In this case, a nucleotide exchange was carried out in the lysC gene so that in the resulting protein the amino acid Thr at position 311 was replaced by an Ile. Starting from the chromosomal DNA from ATCC13032 as template for a PCR reaction, lysC was amplified with the oligonucleotide primers SEQ ID NO:5 and SEQ ID NO:6 with the aid of the Pfu-Turbo PCR system (Stratagene USA) in accordance with the manufacturer's instructions.
TABLE-US-00006 SEQ ID NO: 5 5'-GAGAGAGAGACGCGTCCCAGTGGCTGAGACGCATC-3' SEQ ID NO: 6 5'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-3'
[0345]Chromosomal DNA was prepared from C. glutamicum ATCC 13032 as described by Tauch et al. (1995) Plasmid 33:168-179 or Eikmanns et al. (1994) Microbiology 140:1817-1828. The amplified fragment is flanked at its 5' end by a SalI restriction site and at its 3' end by a MluI restriction site. Before the cloning, the amplified fragment was digested with these two restriction enzymes and purified using GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg).
[0346]The resulting polynucleotide was cloned via the SalI and MluI restriction sites into pCLIK5 MCS integrative SacB called pCIS hereinafter (SEQ ID NO: 7) and transformed into E. coli XL-1 blue. Selection for plasmid-harboring cells was achieved by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing kanamycin (20 μg/ml). The plasmid was isolated and the expected nucleotide sequence was confirmed by sequencing. Preparation of the plasmid DNA was carried out by methods and with materials from Qiagen. Sequencing reactions were carried out as described by Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467. The sequencing reactions were fractionated and evaluated using an ABI prism 377 (PE Applied Biosystems, Weiterstadt). The resulting plasmid pCIS lysC is listed as SEQ ID NO:8.
EXAMPLE 2
Mutagenesis of the lysC Gene from C. glutamicum
[0347]Directed mutagenesis of the lysC gene from C. glutamicum was carried out with the Quickchange kit (from Stratagene/USA) in accordance with the manufacturer's instructions. The mutagenesis was carried out in the plasmid pCIS lysC, SEQ ID NO:8. For the exchange from thr 311 to 311ile by means of the Quickchange method (Stratagene), the following oligonucleotide primers were synthesized:
TABLE-US-00007 SEQ ID NO: 9 5'-CGGCACCACCGACATCATCTTCACCTGCCCTCGTTCCG-3' SEQ ID NO: 10 5'-CGGAACGAGGGCAGGTGAAGATGATGTCGGTGGTGCCG-3'
[0348]Use of these oligonucleotide primers in the Quickchange reaction leads to an exchange of the nucleotide in position 932 (from C to T) in the lysC gene SEQ ID NO:11. The resulting amino acid exchange Thr311Ile in the lysC gene was confirmed after transformation into E. coli XL1-blue and plasmid preparation by a sequencing reaction. The plasmid received the designation pCIS lysC thr311ile and is listed as SEQ ID NO:12.
[0349]The plasmid pCIS lysC thr311ile was transformed into C. glutamicum ATCC13032 by electroporation as described by Liebl et al. (1989) FEMS Microbiology Letters 53:299-303. Modifications of the protocol are described in DE 10046870. The chromosomal arrangement of the lysC locus of individual transformants was checked by Southern blotting and hybridization using standard methods as described in Sambrook et al. (1989), Molecular Cloning. A Laboratory Manual, Cold Spring Harbor. This ensured that the transformants have integrated the transformed plasmid by homologous recombination at the lysC locus. After such colonies had grown overnight in media containing no antibody, the cells were plated out on a sucrose CM agar medium (10% sucrose, 10 g/l glucose; 2.5 g/l NaCl; 2 g/l urea, 10 g/l Bacto peptone (from Difco); 10 g/l yeast extract, 22.0 g/L agar (Difco)) and incubated at 30° C. for 24 hours.
[0350]Since the sacB gene present in the vector pCIS lysC thr311ile converts sucrose into a toxic product, the only colonies able to grow are those which have deleted the sacB gene by a second homologous recombination step between the wild-type lysC gene and the mutated lysC thr311ile gene. During the homologous recombination there may be deletion either of the wild-type gene or of the mutated gene together with the sacB gene. Deletion of the SacB gene together with the wild-type gene results in a mutated transformant.
[0351]Grown colonies were picked and investigated for a kanamycin-sensitive phenotype. Clones with deleted SacB gene must simultaneously show kanamycin-sensitive growth behavior. Such Kan-sensitive clones were investigated in a shaken flask for their lysine productivity (see example 6). The untreated C. glutamicum ATCC13032 was cultured for comparison. Clones with lysine production increased compared with the control were selected, chromosomal DNA isolated and the corresponding region of the lysC gene amplified by a PCR reaction and sequenced. Such a clone with the property of increased lysine synthesis and demonstrated mutation in lysC at position 932 was referred to as ATCC13032 lysCfbr.
EXAMPLE 3
Preparation of an Integrated Plasmid for Overexpression of the lysC Gene with the Aid of the Heterologous Expression unit Psod (SEQ. ID. NO. 2)
[0352]The following oligonucleotides were defined for amplification of the expression unit of the gene which codes for superoxide dismutase.
TABLE-US-00008 SEQ ID 13: sod8: 5'-accctggcggaaaccctgagtcg-3' SEQ ID 14: sod1: 5'-tacgaccagggccacgggtaaaaaatcctttcgtaggtttc cgcaccgagcatatacatcttttg-3'
[0353]The primers were employed in a PCR reaction with chromosomal DNA from C. glutamicum ATCC 13032. It was possible with this approach to amplify a DNA fragment which corresponded to the expected size of 657 bp.
[0354]The following oligonucleotides were defined for amplification of the gene which codes for aspartokinase.
TABLE-US-00009 SEQ ID 15 lysC2: 5'-cctacgaaaggattttttacccgtggccctggtcgtac ag-3' SEQ ID 16: lysC6: 5'-gattagtggaacctcgtcgtc-3'
[0355]The primers were employed in a PCR reaction with chromosomal DNA from C. glutamicum ATCC13032 lysCfbr. It was possible with this approach to amplify a DNA fragment which corresponded to the expected size of 1638 bp.
[0356]The primers sod1 and ask2 contain an overlapping sequence and are homologous to one another at their 5' ends.
[0357]The PCR products obtained above were employed as template for a further PCR in which the following primers were used.
TABLE-US-00010 SEQ ID 17: sod4: 5'-gcggcgcaggattttctaa-3' SEQ ID 18: lysC4: 5'-tcggttgcctgagtaatgtctt-3'
[0358]It was possible with this approach to amplify a DNA fragment which corresponded to the expected size of 1811 bp. This Psod/lysC fusion was then cloned into the vector pCR2.1 (from Invitrogen GmbH, Karlsruhe, Germany). In a further step, the Psod/lysC fusion was cloned from the plasmid pCR2.1 (from Invitrogen GmbH, Karlsruhe, Germany) as 1773 by EcoRI fragment into the integration vector pK19 mob sacB SEQ ID NO 19, which had previously been cut with the restriction endonuclease EcoRI. The resulting plasmid was referred to as pk19 mob sacB Psod lysC.
[0359]The following oligonucleotides were defined for amplification of a 5' region of the lysC gene:
TABLE-US-00011 SEQ ID 20: lysC23: 5'-caccgcggctttggacatcactgctac-3' SEQ ID 21: lysC24: 5'-cctggggctttagcggatgcgtctca-3'
[0360]The primers were employed in a PCR reaction with chromosomal DNA from C. glutamicum. It was possible with this approach to amplify a DNA fragment which corresponded to the expected size of 674 bp. This DNA fragment was cloned into the vector pCR2.1 (from Invitrogen GmbH, Karlsruhe, Germany). A 787 by SpeI/XbaI fragment was then subsequently cloned into the vector pK19 mob sacB Psod lysC, which had previously been digested with the restriction enzyme NheI. The resulting plasmid was referred to as pK19 mob sacB Psod lysC+US (SEQ ID 22). Up to this step, all clonings were carried out in Escherichia coli XL-1 Blue (from Stratagene, Amsterdam, Netherlands).
[0361]The transformation plasmid pK19 mob sacB Psod lysC+US was then used to transform E. coli Mn522 (from Stratagene, Amsterdam, Netherlands) together with the plasmid pTc15AcglM as described by Liebl et al. (1989) FEMS Microbiology Letters 53:299-303. The plasmid pTc15AcglM enables DNA to be methylated according to the methylation pattern of Corynebacterium glutamicum (DE 10046870). This step enables Corynebacterium glutamicum subsequently to undergo electroporation with the integration plasmid pK19 mob sacB Psod lysC+US. This electroporation and the subsequent selection on CM plates with kanamycin (25 μg/ml) resulted in a plurality of transconjugants. To select for the second recombination event, which should lead to excision of the vector together with the lysC promoter and the lysC gene, these transconjugants were cultured in CM medium without kanamycin overnight and then plated out on CM plates with 10% sucrose for selection. The sacB gene present on the vector pK19 mob sacB codes for the enzyme levansucrase and leads to the synthesis of levan on growth on sucrose. Since levan is toxic for C. glutamicum, the only C. glutamicum cells able to grow on sucrose-containing medium are those which have lost the integration plasmid through the second recombination step (Jager et al., Journal of Bacteriology 174 (1992) 5462-5466). 100 sucrose-resistant clones were examined for their kanamycin sensitivity. It was possible to demonstrate for 57 of the tested clones not only resistance to sucrose but also sensitivity to kanamycin. A polymerase chain reaction (PCR) was used to check whether the desired replacement of the natural expression unit by the Psod expression unit had also taken place. Chromosomal DNA was isolated from the initial strain and 20 clones for this analysis. For this purpose, the respective clones were removed from the agar plate with a toothpick and suspended in 100 μl of H2O and boiled at 95° C. for 10 min. 10 μl portions of the resulting solution were employed as template in the PCR. The primers used were oligonucleotides which are homologous to the Psod expression unit and the lysC gene. The PCR conditions were chosen as follows: predenaturation: 5 min at 95° C.; denaturation 30 sec at 95° C.; hybridization 30 sec at 55° C.; amplification 2 min at 72° C.; 30 cycles; final extension 5 min at 72° C. In the mixture with the DNA of the initial strain it was not possible for a PCR product to result owing to the choice of the oligonucleotides. Only with clones in which the second recombination effected replacement of the natural promoter (PlysC) by Psod was a band with a size of 340 by expected. In total, 2 of the tested 20 clones were positive.
EXAMPLE 4
Aspartokinase (lysC) Assay
[0362]C. glutamicum strains which contained either a chromosomal copy of the lysCfbr gene with the natural promoter or a chromosomal copy of the Psod lysCfbr construct were cultured in MMA medium (20 g/l glucose, 10 g/l (NH4)2SO4, 0.5 g KH2PO4, 0.5 g K2HPO4, 2.5 g urea, 5 g NaCl, 400 mg MgSO4*7H2O, 10 mg FeSO4*7H2O, MnSO4*6H2O, 100 mg L-leucine, 100 mg L-cysteine, 250 mg pantothenic acid, 5 mg nicotinamide, 100 μg biotin, 200 μg thiamine, 15 g MOPS, pH 6.8) at 30° C. until the OD600 was 8. The cells were spun down at 4° C. and then washed twice with cold tris-HCl buffer (0.1%, pH 8.0). After renewed centrifugation, the cells were taken up in cold tris-HCl buffer (0.1%, pH 8.0) and adjusted to an OD600 of 160. For cell disruption, 1 ml of this cell suspension was transferred into 2 ml Ribolyser tubes from Hybaid and lysed in a Ribolyser from Hybaid at a rotation setting of 6.0 three times for 30 sec each time. The lysate was clarified by centrifugation at 15 000 rpm and 4° C. in an Eppendorf centrifuge for 30 minutes, and the supernatant was transferred into a new Eppendorf cup. The protein content was determined as described by Bradford, M. M. (1976) Anal. Biochem. 72:248-254.
[0363]The aspartokinase enzymatic activity was determined as follows. 1 ml reaction mixtures with 100 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 600 mM hydroxylamine HCl (pH 7.0 with 10N KOH), 4 mM ATP, 200 mM aspartate (sodium salt) and H2O and 1 ml were incubated at 30° C. for 10 min. The assay was started by adding the respective protein lysate and incubating at 30° C. for 30 min. The reaction was stopped by adding 1 ml of the stop solution (10% iron chloride, 3.3% trichloroacetic acid, 0.7N NaCl) to the reaction mixture. After a centrifugation step, the OD540 of the supernatant was measured. 1 unit in this case is equivalent to 1 nmol of aspartate hydroxamate formed per mg of protein and per minute.
[0364]The results are shown in Table 1a.
TABLE-US-00012 TABLE 1a Specific activity Strain [nmol/mg/min] ATCC 13032 lysCfbr 19.35 ATCC 13032 Psod lysCfbr 41.22
[0365]It was possible to double the aspartokinase activity by integrating the Psod lysC contract into the chromosome.
EXAMPLE 5
Production of Lysine
[0366]To investigate the effect of the Psod lysC construct on lysine production, the strain ATCC13032, ATCC13032 lysCfbr or ATCC13032 Psod lysCfbr was cultured on CM plates (10.0 g/l D-glucose, 2.5 g/l NaCl, 2.0 g/l urea, 10.0 g/l Bacto peptone (Difco), 5.0 g/l yeast extract (Difco), 5.0 g/l beef extract (Difco), 22.0 g/l agar (Difco), autoclaved (20 min. 121° C.)) at 30° C. for 2 days. The cells were then scraped off the plate and resuspended in saline. For the main culture, 10 ml of medium 1 and 0.5 g of autoclaved CaCO3 (Riedel de Haen) in a 100 ml Erlenmeyer flask were inoculated with the cell suspension until the OD600 was 1.5 and incubated on a shaker of the type Infors AJ118 (from Infors, Bottmingen, Switzerland) at 220 rpm for 39 h. The concentration of the lysine secreted into the medium was then determined.
Medium I:
[0367]40 g/l sucrose60 g/1 molasses (calculated for 100% sugar content)
10 g/l (NH4)2SO4
0.4 g/l MgSO4*7H2O
0.6 g/l KH2PO4
[0368]0.3 mg/l thiamin*HCl1 mg/l biotin (from a 1 mg/ml stock solution which had been sterilized by filtration and adjusted to pH 8.0 with NH4OH)2 mg/l FeSO4 2 mg/l MnSO4 adjusted to pH 7.8 with NH4OH, autoclaved (121° C., 20 min).
[0369]In addition, vitamin B12 (hydroxycobalamin Sigma Chemicals) from a stock solution (200 μg/ml, sterilized by filtration) is added to a final concentration of 100 μg/I.
[0370]The amino acid concentration was determined by Agilent high pressure liquid chromatography on an Agilent 1100 series LC system HPLC. Precolumn derivatization with ortho-phthalaldehyde permits quantification of the amino acids formed, and the amino acid mixture is fractionated on a Hypersil AA column (Agilent). The result of the investigation is shown in Table 2a.
TABLE-US-00013 TABLE 2a Strain L-lysine (g/l) ATCC13032 0 ATCC13032 lysCfbr 10.15 ATCC13032 Psod lysCfbr 12.67
EXAMPLE 6
Preparation of the Vector pCLiK5MCS
[0371]Firstly, the ampicillin resistance and origin of replication of the vector pBR322 were amplified by the polymerase chain reaction (PCR) using the oligonucleotide primers SEQ ID NO: 23 and SEQ ID NO: 24.
TABLE-US-00014 SEQ ID NO: 23 5'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCG CACAG-3' SEQ ID NO: 24 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGG GCCTCG-3'
[0372]Besides the sequences complementary to pBR322, the oligonucleotide primer SEQ ID NO: 23 contains in the 5'-3' direction the cleavage sites for the restriction endonucleases SmaI, BamHI, NheI and AscI and the oligonucleotide primer SEQ ID NO: 24 contains in the 5'-3' direction the cleavage sites for the restriction endonucleases XbaI, XhoI, NotI and DraI. The PCR reaction was carried out with PfuTurbo polymerase (Stratagene, La Jolla, USA) by a standard method such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)). The resulting DNA fragment with a size of approximately 2.1 kb as purified using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. The blunt ends of the DNA fragment were ligated together using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing ampicillin (50 μg/ml).
[0373]The plasmid DNA of an individual clone was isolated using the Qiaprep spin miniprep kit (Qiagen, Hilden) in accordance with the manufacturer's instructions and checked by restriction digestions. The plasmid obtained in this way is called pCLiK1.
[0374]Starting from the plasmid pWLT1 (Liebl et al., 1992) as template for a PCR reaction, a kanamycin resistance cassette was amplified using the oligonucleotide primers SEQ ID NO: 25 and SEQ ID NO: 26.
TABLE-US-00015 SEQ ID NO: 25: 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCG GA-3' SEQ ID NO: 26 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-3'
[0375]Besides the sequences complementary to pWLT1, the oligonucleotide primer SEQ ID NO: 25 contains in the 5'-3' direction the cleavage sites for the restriction endonucleases XbaI, SmaI, BamHI, NheI and the oligonucleotide primer SEQ ID NO: 26 contains in the 5'-3' direction the cleavage sites for the restriction endonucleases AscI and NheI. The PCR reaction was carried out with PfuTurbo polymerase (Stratagene, La Jolla, USA) by standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)). The resulting DNA fragment with a size of approximately 1.3 kb was purified using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. The DNA fragment was cut with the restriction endonucleases XbaI and AscI (New England Biolabs, Beverly, USA) and subsequently again purified using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. The vector pCLiK1 was likewise cut with the restriction endonucleases XbaI and AscI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) in accordance with the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 2.1 kb) was isolated using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. This vector fragment was ligated with the cut PCR fragment using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing ampicillin (50 μg/ml) and kanamycin (20 μg/ml).
[0376]The plasmid DNA of an individual clone was isolated using the Qiaprep spin miniprep kit (Qiagen, Hilden) in accordance with the manufacturer's instructions and checked by restriction digestions. The plasmid obtained in this way is called pCLiK2.
[0377]The vector pCLiK2 was cut with the restriction endonuclease DraI (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, a vector fragment approx. 2.3 kb in size was isolated using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. This vector fragment was religated using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing kanamycin (20 μg/ml).
[0378]The plasmid DNA of an individual clone was isolated using the Qiaprep spin miniprep kit (Qiagen, Hilden) in accordance with the manufacturer's instructions and checked by restriction digestions. The plasmid obtained in this way is called pCLiK3.
[0379]Starting from the plasmid pWLQ2 (Liebl et al., 1992) as template for a PCR reaction, the origin of replication pHM1519 was amplified using the oligonucleotide primers SEQ ID NO: 27 and SEQ ID NO: 28.
TABLE-US-00016 SEQ ID NO: 27: 5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-3' SEQ ID NO: 28: 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3'
[0380]Besides the sequences complementary to pWLQ2, the oligonucleotide primers SEQ ID NO: 27 and SEQ ID NO: 28 contain cleavage sites for the restriction endonuclease NotI. The PCR reaction was carried out with PfuTurbo polymerase (Stratagene, La Jolla, USA) by a standard method such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)). The resulting DNA fragment with a size of approximately 2.7 kb was purified using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. The DNA fragment was cut with the restriction endonuclease NotI (New England Biolabs, Beverly, USA) and then again purified with the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. The vector pCLiK3 was likewise cut with the restriction endonuclease NotI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) in accordance with the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 2.3 kb) was isolated with the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. This vector fragment was ligated with the cut PCR fragment using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing kanamycin (20 μg/ml).
[0381]The plasmid DNA of an individual clone was isolated using the Qiaprep spin miniprep kit (Qiagen, Hilden) in accordance with the manufacturer's instructions and checked by restriction digestions. The plasmid obtained in this way is called pCLiK5.
[0382]To extend pCLiK5 by a multiple cloning site (MCS), the two synthetic, very substantially complementary oligonucleotides SEQ ID NO: 29 and SEQ ID NO: 30, which contain cleavage sites for the restriction endonucleases SwaI, XhoI, AatI, ApaI, Asp718, MluI, NdeI, SpeI, EcoRV, SalI, ClaI, BamHI, XbaI and SmaI, were combined by heating together at 95° C. and slow cooling to give a double-stranded DNA fragment.
TABLE-US-00017 SEQ ID NO: 29: 5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCG TCATATGACTAGTTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCT GCGTTAATTAACAATTGGGATCCTCTAGACCCGGGATTTAAAT-3' SEQ ID NO: 30: 5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGC AGAAGAGCATCGATGTCGACGATATCCCTAGGTCCGAACTAGTCATATGA CGCGTGGTACCGGGCCCGACGTCAGGCCTCTCGAGATTTAAAT-3'
[0383]The vector pCLiK5 was cut with the restriction endonucleases XhoI and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) in accordance with the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 5.0 kb) was isolated with the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. This vector fragment was ligated to the synthetic double-stranded DNA fragment using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing kanamycin (20 μg/ml).
[0384]The plasmid DNA of an individual clone was isolated using the Qiaprep spin miniprep kit (Qiagen, Hilden) in accordance with the manufacturer's instructions and checked by restriction digestions. The plasmid obtained in this way is called pCLiK5MCS.
[0385]Sequencing reactions were carried out as described by Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467. The sequencing reactions were fractionated and evaluated using an ABI prism 377 (PE Applied Biosystems, Weiterstadt).
[0386]The resulting plasmid pCLiK5MCS is listed as SEQ ID NO: 31.
EXAMPLE 7
Preparation of the Plasmid PmetA metA
[0387]Chromosomal DNA was prepared from C. glutamicum ATCC 13032 as described by Tauch et al. (1995) Plasmid 33:168-179 or Eikmanns et al. (1994) Microbiology 140:1817-1828. The metA gene including the noncoding 5' region was amplified by the polymerase chain reaction (PCR) by standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, using the oligonucleotide primers SEQ ID NO: 32 and SEQ ID NO: 33, the chromosomal DNA as template and Pfu Turbo polymerase (from Stratagene).
TABLE-US-00018 SEQ ID NO: 32 5'-GCGCGGTACCTAGACTCACCCCAGTGCT-3' and SEQ ID NO: 33 5'-CTCTACTAGTTTAGATGTAGAACTCGATGT-3'
[0388]The resulting DNA fragment with a size of approx. 1.3 kb was purified using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions. It was then cleaved with the restriction enzymes Asp718 and SpeI (Roche Diagnostics, Mannheim) and the DNA fragment was purified with the GFX®PCR, DNA and Gel Band purification kit.
[0389]The vector pClik5MCS SEQ ID NO: 31 was cut with the restriction enzymes Asp718 and SpeI and, after fractionation by electrophoresis, a fragment 5 kb in size was isolated using the GFX®PCR, DNA and Gel Band purification kit.
[0390]The vector fragment was ligated together with the PCR fragment using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing kanamycin (20 μg/ml).
[0391]The plasmid DNA was prepared by methods and using materials from Qiagen. Sequencing reactions were carried out as described by Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467. The sequencing reactions were fractionated and evaluated using an ABI prism 377 (PE Applied Biosystems, Weiterstadt).
[0392]The resulting plasmid pCLiK5MCS PmetA metA is listed as SEQ ID NO: 34.
EXAMPLE 8
Preparation of the Plasmid pCLiK5MCS Psod metA
[0393]Chromosomal DNA was prepared from C. glutamicum ATCC 13032 as described by
[0394]Tauch et al. (1995) Plasmid 33:168-179 or Eikmanns et al. (1994) Microbiology 140:1817-1828. A DNA fragment of approx. 200 base pairs from the noncoding 5' region (region of the expression unit) of superoxide dismutase (Psod) was amplified by the polymerase chain reaction (PCR) by standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, using the oligonucleotide primers SEQ ID NO: 35 and SEQ ID NO: 36, the chromosomal DNA as template and Pfu Turbo polymerase (from Stratagene).
TABLE-US-00019 SEQ ID NO: 35 5'-GAGACTCGAGAGCTGCCAATTATTCCGGG-3' and SEQ ID NO: 36 5'-CCTGAAGGCGCGAGGGTGGGCATGGGTAAAAAATCCTTTCG-3'
[0395]The resulting DNA fragment was purified with the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg) in accordance with the manufacturer's instructions.
[0396]Starting from plasmid PmetA metA SEQ ID 34 as template for a PCR reaction, a part of metA was amplified using the oligonucleotide primers SEQ ID NO: 37: and SEQ ID NO: 38.
TABLE-US-00020 SEQ ID NO: 37 5'-CCCACCCTCGCGCCTTCAG-3' and SEQ ID NO: 38 5'-CTGGGTACATTGCGGCCC-3'
[0397]The resulting DNA fragment of approximately 470 base pairs was purified with the GFX®PCR, DNA and Gel Band purification kit in accordance with the manufacturer's instructions.
[0398]In a further PCR reaction, the two fragments obtained above were employed together as template. Owing to the sequences which have been introduced with the oligonucleotide primer SEQ ID NO: 36 and are homologous to metA, during the PCR reaction the two fragments are attached to one another and extended to give a continuous DNA strand by the polymerase employed. The standard method was modified by adding the oligonucleotide primers used SEQ ID NO: 35 and SEQ ID NO: 38, to the reaction mixture only at the start of the second cycle.
[0399]The amplified DNA fragment of approximately 675 base pairs was purified using the GFX®PCR, DNA and Gel Band purification kit in accordance with the manufacturer's instructions. It was then cleaved with the restriction enzymes XhoI and NcoI (Roche Diagnostics, Mannheim) and fractionated by gel electrophoresis. Subsequently, the DNA fragment approximately 620 base pairs in size was purified from the agarose using the GFX®PCR, DNA and Gel Band purification kit (Amersham Pharmacia, Freiburg). The plasmid PmetA metA SEQ ID NO: 34 was cleaved with the restriction enzymes NcoI and SpeI (Roche Diagnostics, Mannheim). After fractionation by gel electrophoresis, a metA fragment approximately 0.7 kb in size was purified from the agarose using the GFX®PCR, DNA and Gel Band purification kit.
[0400]The vector pClik5MCS SEQ ID NO: 31 was cut with the restriction enzymes XhoI and SpeI (Roche Diagnostics, Mannheim) and, after fractionation by electrophoresis, a fragment 5 kb in size was isolated using the GFX®PCR, DNA and Gel Band purification kit.
[0401]The vector fragment was ligated together with the PCR fragment and the metA fragment using the rapid DNA ligation kit (Roche Diagnostics, Mannheim) in accordance with the manufacturer's instructions, and the ligation mixture was transformed into competent E. coli XL-1 Blue (Stratagene, La Jolla, USA) by standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, (1989)). Plasmid-harboring cells were selected by plating out on LB agar (Lennox, 1955, Virology, 1:190) containing kanamycin (20 μg/ml).
[0402]The plasmid DNA was prepared by methods and using materials from Qiagen. Sequencing reactions were carried out as described by Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467. The sequencing reactions were fractionated and evaluated using an ABI prism 377 (PE Applied Biosystems, Weiterstadt).
[0403]The resulting plasmid pCLiK5MCS PSODmetA is listed as SEQ ID NO: 39.
EXAMPLE 9
MetA Activities
[0404]The strain Corynebacterium glutamicum ATCC13032 was transformed with each of the plasmids pClik5 MCS, pClik MCS PmetA metA, pCLiK5MCS Psod metA by the method described (Liebl, et al. (1989) FEMS Microbiology Letters 53:299-303). The transformation mixture was plated on CM plates which additionally contained 20 mg/l kanamycin in order to select for plasmid-containing cells. Resulting Kan-resistant clones were picked and isolated.
[0405]C. glutamicum strains which contained one of these plasmid constructs were cultured in MMA medium (40 g/l sucrose, 20 g/l (NH4)2SO4, 1 g/l KH2PO4, 1 g/l K2HPO4, 0.25 g/l MgSO4×7H2O, 54 g Aces, 1 ml CaCl2 (10 g/l), 1 ml protocatechuate (300 mg/10 ml), 1 ml trace element solution (10 g/l FeSO4×7H2O, 10 g/l MnSO4×H2O, 2 g/l ZnSO4×7H2O, 0.2 g/l CuSO4, 0.02 g/l NiCl2×6H2O), 100 μg/I vitamin B12, 0.3 mg/l thiamine, 1 mM leucine, 1 mg/l pyridoxal HCl, 1 ml biotin (100 mg/l), pH 7.0) at 30° C. overnight. The cells were spun down at 4° C. and then washed twice with cold Tris-HCl buffer (0.1%, pH 8.0). After renewed centrifugation, the cells were taken up in cold Tris-HCl buffer (0.1%, pH 8.0) and adjusted to an OD600 of 160. For cell disruption, 1 ml of this cell suspension was transferred into 2 ml Ribolyser tubes from Hybaid and lysed in a Ribolyser from Hybaid with a rotation setting of 6.0 three times for 30 sec each time. The lysate was clarified by centrifugation at 15 000 rpm and 4° C. in an Eppendorf centrifuge for 30 minutes, and the supernatant was transferred into a new Eppendororf cup. The protein content was determined as described by Bradford, M. M. (1976) Anal. Biochem. 72:248-254.
[0406]The measurement of the enzymatic activity of metA was carried out as follows. The 1 ml reaction mixtures contained 100 mM potassium phosphate buffer (pH 7.5), 5 mM MgCl2, 100 μM acetyl-CoA, 5 mM L-homoserine, 500 μM DTNB (Ellman's reagent) and cell extract. The assay was started by adding the respective protein lysate and incubated at room temperature. Kinetics were then recorded at 412 nm for 10 min.
[0407]The results are shown in Table 3a.
TABLE-US-00021 TABLE 3a Specific activity Strain [nmol/mg/min] ATCC 13032 pClik5MCS 12.6 ATCC 13032 pClik5MCS PmetA metA 50.7 ATCC 13032 pClik5MCS Psod metA 100.7
[0408]It was possible to increase MetA activity considerably by using the heterologous expression unit Psod.
Sequence CWU
1
441173DNACorynebacterium
glutamicummisc_feature(1)..(173)SUPEROXID\DISMUTASE\RXA03119\ 1gctgccaatt
attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt 60cgttgcaata
tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga 120agcgccatct
gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
1732191DNACorynebacterium
glutamicummisc_feature(1)..(191)SUPEROXID\DISMUTASE\RXA03119\ 2agctgccaat
tattccgggc ttgtgacccg ctacccgata aataggtcgg ctgaaaaatt 60tcgttgcaat
atcaacaaaa aggcctatca ttgggaggtg tcgcaccaag tacttttgcg 120aagcgccatc
tgacggattt tcaaaagatg tatatgctcg gtgcggaaac ctacgaaagg 180attttttacc c
19131365DNACorynebacterium glutamicummisc_feature(1)..(1365)RXA00077
3atgaatgatg agaatattca aagctccaac tatcagccat tcccgagttt tgacgattgg
60aaacagatcg aggtgtcgct cttagatgtc atcgaatcct cacgccattt ttctgatttg
120aaagatagca ctgatcgttc tgcgttagat gctgcgctag agagagcaaa aagagctgcc
180gcagttgata ccaatgccat agaaggaatc ttccaaactg atcgcggttt tacccataca
240gttgcaacgc aggtaggggc ttgggagcaa caaatggcga tgaaaggcaa acatgttaag
300cctgcgtttg acgatactct agaaggcttt gagtatgttc tcgatgcagt aactggtaga
360actccaatct ctcagcaatg gattagaaat ttgcacgccg tcattctgcg gagccaagaa
420agccacgagg tttttacagc cgttggagtc caaaatcagg cgcttcagaa aggcgagtat
480aaaactcagc caaatagtcc acagcgctca gatggatctg tacatgcata cgccccagtt
540gaagatactc ctgctgaaat ggctagattt atttcagaac ttgaatctaa ggaattctta
600gcagccgaga aggttattca agctgcctat gcccactatg ctttcgtatg tattcatcct
660tttgcagatg ggaatggacg agttgcacga gccttggcta gtgtttttct atacaaagat
720cctggtgtcc ctctcgtaat ctaccaagat caacgcagag attacatcca tgctctagaa
780gcagcggaca agaataaccc gctcctgctg attagattct ttgctgaacg agtgaccgat
840actattaact ctattatcgt tgatctcact accccgatcg cgggtaaatc tggttcggct
900aagctttcgg atgcgctacg ccccactcgc gtattaccag aattacatga tgctgcacat
960aggctccaag aaagtttatt tacagaaatc cgatctcgat tggatgaaga aggaaaaagg
1020aatgggttgg agtttctact tcaacggatt tttatcggtt ccccattcaa tctgccagag
1080ggctataacg ctttccctga tagctattgt ctgaccttag ctttcaatag caactctcca
1140aaacaaatct tccacccgct atccatagta atagcagctc gagatgggaa aagagcgagc
1200agcgacctcg tggcagctac ttctattgga tacaactttc acgcttacgg acgtgaagtc
1260gagcctgttg ttactgaaag ctttcgagaa cgtgtgaaaa tttacgccga cgggattgta
1320gatcacttct taaccgaact ggctaaaaag tttcaacaga attaa
13654454PRTCorynebacterium glutamicum 4Met Asn Asp Glu Asn Ile Gln Ser
Ser Asn Tyr Gln Pro Phe Pro Ser1 5 10
15Phe Asp Asp Trp Lys Gln Ile Glu Val Ser Leu Leu Asp Val
Ile Glu 20 25 30Ser Ser Arg
His Phe Ser Asp Leu Lys Asp Ser Thr Asp Arg Ser Ala 35
40 45Leu Asp Ala Ala Leu Glu Arg Ala Lys Arg Ala
Ala Ala Val Asp Thr 50 55 60Asn Ala
Ile Glu Gly Ile Phe Gln Thr Asp Arg Gly Phe Thr His Thr65
70 75 80Val Ala Thr Gln Val Gly Ala
Trp Glu Gln Gln Met Ala Met Lys Gly 85 90
95Lys His Val Lys Pro Ala Phe Asp Asp Thr Leu Glu Gly
Phe Glu Tyr 100 105 110Val Leu
Asp Ala Val Thr Gly Arg Thr Pro Ile Ser Gln Gln Trp Ile 115
120 125Arg Asn Leu His Ala Val Ile Leu Arg Ser
Gln Glu Ser His Glu Val 130 135 140Phe
Thr Ala Val Gly Val Gln Asn Gln Ala Leu Gln Lys Gly Glu Tyr145
150 155 160Lys Thr Gln Pro Asn Ser
Pro Gln Arg Ser Asp Gly Ser Val His Ala 165
170 175Tyr Ala Pro Val Glu Asp Thr Pro Ala Glu Met Ala
Arg Phe Ile Ser 180 185 190Glu
Leu Glu Ser Lys Glu Phe Leu Ala Ala Glu Lys Val Ile Gln Ala 195
200 205Ala Tyr Ala His Tyr Ala Phe Val Cys
Ile His Pro Phe Ala Asp Gly 210 215
220Asn Gly Arg Val Ala Arg Ala Leu Ala Ser Val Phe Leu Tyr Lys Asp225
230 235 240Pro Gly Val Pro
Leu Val Ile Tyr Gln Asp Gln Arg Arg Asp Tyr Ile 245
250 255His Ala Leu Glu Ala Ala Asp Lys Asn Asn
Pro Leu Leu Leu Ile Arg 260 265
270Phe Phe Ala Glu Arg Val Thr Asp Thr Ile Asn Ser Ile Ile Val Asp
275 280 285Leu Thr Thr Pro Ile Ala Gly
Lys Ser Gly Ser Ala Lys Leu Ser Asp 290 295
300Ala Leu Arg Pro Thr Arg Val Leu Pro Glu Leu His Asp Ala Ala
His305 310 315 320Arg Leu
Gln Glu Ser Leu Phe Thr Glu Ile Arg Ser Arg Leu Asp Glu
325 330 335Glu Gly Lys Arg Asn Gly Leu
Glu Phe Leu Leu Gln Arg Ile Phe Ile 340 345
350Gly Ser Pro Phe Asn Leu Pro Glu Gly Tyr Asn Ala Phe Pro
Asp Ser 355 360 365Tyr Cys Leu Thr
Leu Ala Phe Asn Ser Asn Ser Pro Lys Gln Ile Phe 370
375 380His Pro Leu Ser Ile Val Ile Ala Ala Arg Asp Gly
Lys Arg Ala Ser385 390 395
400Ser Asp Leu Val Ala Ala Thr Ser Ile Gly Tyr Asn Phe His Ala Tyr
405 410 415Gly Arg Glu Val Glu
Pro Val Val Thr Glu Ser Phe Arg Glu Arg Val 420
425 430Lys Ile Tyr Ala Asp Gly Ile Val Asp His Phe Leu
Thr Glu Leu Ala 435 440 445Lys Lys
Phe Gln Gln Asn 450535DNACorynebacterium glutamicum 5gagagagaga
cgcgtcccag tggctgagac gcatc
35634DNACorynebacterium glutamicum 6ctctctctgt cgacgaattc aatcttacgg cctg
3474323DNACorynebacterium
glutamicummisc_feature(457)..(1248)KanR 7tcgagaggcc tgacgtcggg cccggtacca
cgcgtcatat gactagttcg gacctaggga 60tatcgtcgac atcgatgctc ttctgcgtta
attaacaatt gggatcctct agacccggga 120tttaaatcgc tagcgggctg ctaaaggaag
cggaacacgt agaaagccag tccgcagaaa 180cggtgctgac cccggatgaa tgtcagctac
tgggctatct ggacaaggga aaacgcaagc 240gcaaagagaa agcaggtagc ttgcagtggg
cttacatggc gatagctaga ctgggcggtt 300ttatggacag caagcgaacc ggaattgcca
gctggggcgc cctctggtaa ggttgggaag 360ccctgcaaag taaactggat ggctttcttg
ccgccaagga tctgatggcg caggggatca 420agatctgatc aagagacagg atgaggatcg
tttcgcatga ttgaacaaga tggattgcac 480gcaggttctc cggccgcttg ggtggagagg
ctattcggct atgactgggc acaacagaca 540atcggctgct ctgatgccgc cgtgttccgg
ctgtcagcgc aggggcgccc ggttcttttt 600gtcaagaccg acctgtccgg tgccctgaat
gaactgcagg acgaggcagc gcggctatcg 660tggctggcca cgacgggcgt tccttgcgca
gctgtgctcg acgttgtcac tgaagcggga 720agggactggc tgctattggg cgaagtgccg
gggcaggatc tcctgtcatc tcaccttgct 780cctgccgaga aagtatccat catggctgat
gcaatgcggc ggctgcatac gcttgatccg 840gctacctgcc cattcgacca ccaagcgaaa
catcgcatcg agcgagcacg tactcggatg 900gaagccggtc ttgtcgatca ggatgatctg
gacgaagagc atcaggggct cgcgccagcc 960gaactgttcg ccaggctcaa ggcgcgcatg
cccgacggcg aggatctcgt cgtgacccat 1020ggcgatgcct gcttgccgaa tatcatggtg
gaaaatggcc gcttttctgg attcatcgac 1080tgtggccggc tgggtgtggc ggaccgctat
caggacatag cgttggctac ccgtgatatt 1140gctgaagagc ttggcggcga atgggctgac
cgcttcctcg tgctttacgg tatcgccgct 1200cccgattcgc agcgcatcgc cttctatcgc
cttcttgacg agttcttctg agcgggactc 1260tggggttcga aatgaccgac caagcgacgc
ccaacctgcc atcacgagat ttcgattcca 1320ccgccgcctt ctatgaaagg ttgggcttcg
gaatcgtttt ccgggacgcc ggctggatga 1380tcctccagcg cggggatctc atgctggagt
tcttcgccca cgctagcggc gcgccggccg 1440gcccggtgtg aaataccgca cagatgcgta
aggagaaaat accgcatcag gcgctcttcc 1500gcttcctcgc tcactgactc gctgcgctcg
gtcgttcggc tgcggcgagc ggtatcagct 1560cactcaaagg cggtaatacg gttatccaca
gaatcagggg ataacgcagg aaagaacatg 1620tgagcaaaag gccagcaaaa ggccaggaac
cgtaaaaagg ccgcgttgct ggcgtttttc 1680cataggctcc gcccccctga cgagcatcac
aaaaatcgac gctcaagtca gaggtggcga 1740aacccgacag gactataaag ataccaggcg
tttccccctg gaagctccct cgtgcgctct 1800cctgttccga ccctgccgct taccggatac
ctgtccgcct ttctcccttc gggaagcgtg 1860gcgctttctc atagctcacg ctgtaggtat
ctcagttcgg tgtaggtcgt tcgctccaag 1920ctgggctgtg tgcacgaacc ccccgttcag
cccgaccgct gcgccttatc cggtaactat 1980cgtcttgagt ccaacccggt aagacacgac
ttatcgccac tggcagcagc cactggtaac 2040aggattagca gagcgaggta tgtaggcggt
gctacagagt tcttgaagtg gtggcctaac 2100tacggctaca ctagaaggac agtatttggt
atctgcgctc tgctgaagcc agttaccttc 2160ggaaaaagag ttggtagctc ttgatccggc
aaacaaacca ccgctggtag cggtggtttt 2220tttgtttgca agcagcagat tacgcgcaga
aaaaaaggat ctcaagaaga tcctttgatc 2280ttttctacgg ggtctgacgc tcagtggaac
gaaaactcac gttaagggat tttggtcatg 2340agattatcaa aaaggatctt cacctagatc
cttttaaagg ccggccgcgg ccgccatcgg 2400cattttcttt tgcgttttta tttgttaact
gttaattgtc cttgttcaag gatgctgtct 2460ttgacaacag atgttttctt gcctttgatg
ttcagcagga agctcggcgc aaacgttgat 2520tgtttgtctg cgtagaatcc tctgtttgtc
atatagcttg taatcacgac attgtttcct 2580ttcgcttgag gtacagcgaa gtgtgagtaa
gtaaaggtta catcgttagg atcaagatcc 2640atttttaaca caaggccagt tttgttcagc
ggcttgtatg ggccagttaa agaattagaa 2700acataaccaa gcatgtaaat atcgttagac
gtaatgccgt caatcgtcat ttttgatccg 2760cgggagtcag tgaacaggta ccatttgccg
ttcattttaa agacgttcgc gcgttcaatt 2820tcatctgtta ctgtgttaga tgcaatcagc
ggtttcatca cttttttcag tgtgtaatca 2880tcgtttagct caatcatacc gagagcgccg
tttgctaact cagccgtgcg ttttttatcg 2940ctttgcagaa gtttttgact ttcttgacgg
aagaatgatg tgcttttgcc atagtatgct 3000ttgttaaata aagattcttc gccttggtag
ccatcttcag ttccagtgtt tgcttcaaat 3060actaagtatt tgtggccttt atcttctacg
tagtgaggat ctctcagcgt atggttgtcg 3120cctgagctgt agttgccttc atcgatgaac
tgctgtacat tttgatacgt ttttccgtca 3180ccgtcaaaga ttgatttata atcctctaca
ccgttgatgt tcaaagagct gtctgatgct 3240gatacgttaa cttgtgcagt tgtcagtgtt
tgtttgccgt aatgtttacc ggagaaatca 3300gtgtagaata aacggatttt tccgtcagat
gtaaatgtgg ctgaacctga ccattcttgt 3360gtttggtctt ttaggataga atcatttgca
tcgaatttgt cgctgtcttt aaagacgcgg 3420ccagcgtttt tccagctgtc aatagaagtt
tcgccgactt tttgatagaa catgtaaatc 3480gatgtgtcat ccgcattttt aggatctccg
gctaatgcaa agacgatgtg gtagccgtga 3540tagtttgcga cagtgccgtc agcgttttgt
aatggccagc tgtcccaaac gtccaggcct 3600tttgcagaag agatattttt aattgtggac
gaatcaaatt cagaaacttg atatttttca 3660tttttttgct gttcagggat ttgcagcata
tcatggcgtg taatatggga aatgccgtat 3720gtttccttat atggcttttg gttcgtttct
ttcgcaaacg cttgagttgc gcctcctgcc 3780agcagtgcgg tagtaaaggt taatactgtt
gcttgttttg caaacttttt gatgttcatc 3840gttcatgtct ccttttttat gtactgtgtt
agcggtctgc ttcttccagc cctcctgttt 3900gaagatggca agttagttac gcacaataaa
aaaagaccta aaatatgtaa ggggtgacgc 3960caaagtatac actttgccct ttacacattt
taggtcttgc ctgctttatc agtaacaaac 4020ccgcgcgatt tacttttcga cctcattcta
ttagactctc gtttggattg caactggtct 4080attttcctct tttgtttgat agaaaatcat
aaaaggattt gcagactacg ggcctaaaga 4140actaaaaaat ctatctgttt cttttcattc
tctgtatttt ttatagtttc tgttgcatgg 4200gcataaagtt gcctttttaa tcacaattca
gaaaatatca taatatctca tttcactaaa 4260taatagtgaa cggcaggtat atgtgatggg
ttaaaaagga tcggcggccg ctcgatttaa 4320atc
432385860DNACorynebacterium
glutamicummisc_feature(1)..(5860)PCIS\LYSC 8cccggtacca cgcgtcccag
tggctgagac gcatccgcta aagccccagg aaccctgtgc 60agaaagaaaa cactcctctg
gctaggtaga cacagtttat aaaggtagag ttgagcgggt 120aactgtcagc acgtagatcg
aaaggtgcac aaaggtggcc ctggtcgtac agaaatatgg 180cggttcctcg cttgagagtg
cggaacgcat tagaaacgtc gctgaacgga tcgttgccac 240caagaaggct ggaaatgatg
tcgtggttgt ctgctccgca atgggagaca ccacggatga 300acttctagaa cttgcagcgg
cagtgaatcc cgttccgcca gctcgtgaaa tggatatgct 360cctgactgct ggtgagcgta
tttctaacgc tctcgtcgcc atggctattg agtcccttgg 420cgcagaagcc caatctttca
cgggctctca ggctggtgtg ctcaccaccg agcgccacgg 480aaacgcacgc attgttgatg
tcactccagg tcgtgtgcgt gaagcactcg atgagggcaa 540gatctgcatt gttgctggtt
tccagggtgt taataaagaa acccgcgatg tcaccacgtt 600gggtcgtggt ggttctgaca
ccactgcagt tgcgttggca gctgctttga acgctgatgt 660gtgtgagatt tactcggacg
ttgacggtgt gtataccgct gacccgcgca tcgttcctaa 720tgcacagaag ctggaaaagc
tcagcttcga agaaatgctg gaacttgctg ctgttggctc 780caagattttg gtgctgcgca
gtgttgaata cgctcgtgca ttcaatgtgc cacttcgcgt 840acgctcgtct tatagtaatg
atcccggcac tttgattgcc ggctctatgg aggatattcc 900tgtggaagaa gcagtcctta
ccggtgtcgc aaccgacaag tccgaagcca aagtaaccgt 960tctgggtatt tccgataagc
caggcgaggc tgcgaaggtt ttccgtgcgt tggctgatgc 1020agaaatcaac attgacatgg
ttctgcagaa cgtctcttct gtagaagacg gcaccaccga 1080catcaccttc acctgccctc
gttccgacgg ccgccgcgcg atggagatct tgaagaagct 1140tcaggttcag ggcaactgga
ccaatgtgct ttacgacgac caggtcggca aagtctccct 1200cgtgggtgct ggcatgaagt
ctcacccagg tgttaccgca gagttcatgg aagctctgcg 1260cgatgtcaac gtgaacatcg
aattgatttc cacctctgag attcgtattt ccgtgctgat 1320ccgtgaagat gatctggatg
ctgctgcacg tgcattgcat gagcagttcc agctgggcgg 1380cgaagacgaa gccgtcgttt
atgcaggcac cggacgctaa agttttaaag gagtagtttt 1440acaatgacca ccatcgcagt
tgttggtgca accggccagg tcggccaggt tatgcgcacc 1500cttttggaag agcgcaattt
cccagctgac actgttcgtt tctttgcttc cccacgttcc 1560gcaggccgta agattgaatt
cgtcgacatc gatgctcttc tgcgttaatt aacaattggg 1620atcctctaga cccgggattt
aaatcgctag cgggctgcta aaggaagcgg aacacgtaga 1680aagccagtcc gcagaaacgg
tgctgacccc ggatgaatgt cagctactgg gctatctgga 1740caagggaaaa cgcaagcgca
aagagaaagc aggtagcttg cagtgggctt acatggcgat 1800agctagactg ggcggtttta
tggacagcaa gcgaaccgga attgccagct ggggcgccct 1860ctggtaaggt tgggaagccc
tgcaaagtaa actggatggc tttcttgccg ccaaggatct 1920gatggcgcag gggatcaaga
tctgatcaag agacaggatg aggatcgttt cgcatgattg 1980aacaagatgg attgcacgca
ggttctccgg ccgcttgggt ggagaggcta ttcggctatg 2040actgggcaca acagacaatc
ggctgctctg atgccgccgt gttccggctg tcagcgcagg 2100ggcgcccggt tctttttgtc
aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg 2160aggcagcgcg gctatcgtgg
ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg 2220ttgtcactga agcgggaagg
gactggctgc tattgggcga agtgccgggg caggatctcc 2280tgtcatctca ccttgctcct
gccgagaaag tatccatcat ggctgatgca atgcggcggc 2340tgcatacgct tgatccggct
acctgcccat tcgaccacca agcgaaacat cgcatcgagc 2400gagcacgtac tcggatggaa
gccggtcttg tcgatcagga tgatctggac gaagagcatc 2460aggggctcgc gccagccgaa
ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg 2520atctcgtcgt gacccatggc
gatgcctgct tgccgaatat catggtggaa aatggccgct 2580tttctggatt catcgactgt
ggccggctgg gtgtggcgga ccgctatcag gacatagcgt 2640tggctacccg tgatattgct
gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc 2700tttacggtat cgccgctccc
gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt 2760tcttctgagc gggactctgg
ggttcgaaat gaccgaccaa gcgacgccca acctgccatc 2820acgagatttc gattccaccg
ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg 2880ggacgccggc tggatgatcc
tccagcgcgg ggatctcatg ctggagttct tcgcccacgc 2940tagcggcgcg ccggccggcc
cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc 3000gcatcaggcg ctcttccgct
tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 3060ggcgagcggt atcagctcac
tcaaaggcgg taatacggtt atccacagaa tcaggggata 3120acgcaggaaa gaacatgtga
gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 3180cgttgctggc gtttttccat
aggctccgcc cccctgacga gcatcacaaa aatcgacgct 3240caagtcagag gtggcgaaac
ccgacaggac tataaagata ccaggcgttt ccccctggaa 3300gctccctcgt gcgctctcct
gttccgaccc tgccgcttac cggatacctg tccgcctttc 3360tcccttcggg aagcgtggcg
ctttctcata gctcacgctg taggtatctc agttcggtgt 3420aggtcgttcg ctccaagctg
ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 3480ccttatccgg taactatcgt
cttgagtcca acccggtaag acacgactta tcgccactgg 3540cagcagccac tggtaacagg
attagcagag cgaggtatgt aggcggtgct acagagttct 3600tgaagtggtg gcctaactac
ggctacacta gaaggacagt atttggtatc tgcgctctgc 3660tgaagccagt taccttcgga
aaaagagttg gtagctcttg atccggcaaa caaaccaccg 3720ctggtagcgg tggttttttt
gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 3780aagaagatcc tttgatcttt
tctacggggt ctgacgctca gtggaacgaa aactcacgtt 3840aagggatttt ggtcatgaga
ttatcaaaaa ggatcttcac ctagatcctt ttaaaggccg 3900gccgcggccg ccatcggcat
tttcttttgc gtttttattt gttaactgtt aattgtcctt 3960gttcaaggat gctgtctttg
acaacagatg ttttcttgcc tttgatgttc agcaggaagc 4020tcggcgcaaa cgttgattgt
ttgtctgcgt agaatcctct gtttgtcata tagcttgtaa 4080tcacgacatt gtttcctttc
gcttgaggta cagcgaagtg tgagtaagta aaggttacat 4140cgttaggatc aagatccatt
tttaacacaa ggccagtttt gttcagcggc ttgtatgggc 4200cagttaaaga attagaaaca
taaccaagca tgtaaatatc gttagacgta atgccgtcaa 4260tcgtcatttt tgatccgcgg
gagtcagtga acaggtacca tttgccgttc attttaaaga 4320cgttcgcgcg ttcaatttca
tctgttactg tgttagatgc aatcagcggt ttcatcactt 4380ttttcagtgt gtaatcatcg
tttagctcaa tcataccgag agcgccgttt gctaactcag 4440ccgtgcgttt tttatcgctt
tgcagaagtt tttgactttc ttgacggaag aatgatgtgc 4500ttttgccata gtatgctttg
ttaaataaag attcttcgcc ttggtagcca tcttcagttc 4560cagtgtttgc ttcaaatact
aagtatttgt ggcctttatc ttctacgtag tgaggatctc 4620tcagcgtatg gttgtcgcct
gagctgtagt tgccttcatc gatgaactgc tgtacatttt 4680gatacgtttt tccgtcaccg
tcaaagattg atttataatc ctctacaccg ttgatgttca 4740aagagctgtc tgatgctgat
acgttaactt gtgcagttgt cagtgtttgt ttgccgtaat 4800gtttaccgga gaaatcagtg
tagaataaac ggatttttcc gtcagatgta aatgtggctg 4860aacctgacca ttcttgtgtt
tggtctttta ggatagaatc atttgcatcg aatttgtcgc 4920tgtctttaaa gacgcggcca
gcgtttttcc agctgtcaat agaagtttcg ccgacttttt 4980gatagaacat gtaaatcgat
gtgtcatccg catttttagg atctccggct aatgcaaaga 5040cgatgtggta gccgtgatag
tttgcgacag tgccgtcagc gttttgtaat ggccagctgt 5100cccaaacgtc caggcctttt
gcagaagaga tatttttaat tgtggacgaa tcaaattcag 5160aaacttgata tttttcattt
ttttgctgtt cagggatttg cagcatatca tggcgtgtaa 5220tatgggaaat gccgtatgtt
tccttatatg gcttttggtt cgtttctttc gcaaacgctt 5280gagttgcgcc tcctgccagc
agtgcggtag taaaggttaa tactgttgct tgttttgcaa 5340actttttgat gttcatcgtt
catgtctcct tttttatgta ctgtgttagc ggtctgcttc 5400ttccagccct cctgtttgaa
gatggcaagt tagttacgca caataaaaaa agacctaaaa 5460tatgtaaggg gtgacgccaa
agtatacact ttgcccttta cacattttag gtcttgcctg 5520ctttatcagt aacaaacccg
cgcgatttac ttttcgacct cattctatta gactctcgtt 5580tggattgcaa ctggtctatt
ttcctctttt gtttgataga aaatcataaa aggatttgca 5640gactacgggc ctaaagaact
aaaaaatcta tctgtttctt ttcattctct gtatttttta 5700tagtttctgt tgcatgggca
taaagttgcc tttttaatca caattcagaa aatatcataa 5760tatctcattt cactaaataa
tagtgaacgg caggtatatg tgatgggtta aaaaggatcg 5820gcggccgctc gatttaaatc
tcgagaggcc tgacgtcggg 5860938DNACorynebacterium
glutamicum 9cggcaccacc gacatcatct tcacctgccc tcgttccg
381038DNACorynebacterium glutamicum 10cggaacgagg gcaggtgaag
atgatgtcgg tggtgccg
38111263DNACorynebacterium glutamicummisc_feature(1)..(1263)LYSC-GEN
11gtggccctgg tcgtacagaa atatggcggt tcctcgcttg agagtgcgga acgcattaga
60aacgtcgctg aacggatcgt tgccaccaag aaggctggaa atgatgtcgt ggttgtctgc
120tccgcaatgg gagacaccac ggatgaactt ctagaacttg cagcggcagt gaatcccgtt
180ccgccagctc gtgaaatgga tatgctcctg actgctggtg agcgtatttc taacgctctc
240gtcgccatgg ctattgagtc ccttggcgca gaagcccaat ctttcacggg ctctcaggct
300ggtgtgctca ccaccgagcg ccacggaaac gcacgcattg ttgatgtcac tccaggtcgt
360gtgcgtgaag cactcgatga gggcaagatc tgcattgttg ctggtttcca gggtgttaat
420aaagaaaccc gcgatgtcac cacgttgggt cgtggtggtt ctgacaccac tgcagttgcg
480ttggcagctg ctttgaacgc tgatgtgtgt gagatttact cggacgttga cggtgtgtat
540accgctgacc cgcgcatcgt tcctaatgca cagaagctgg aaaagctcag cttcgaagaa
600atgctggaac ttgctgctgt tggctccaag attttggtgc tgcgcagtgt tgaatacgct
660cgtgcattca atgtgccact tcgcgtacgc tcgtcttata gtaatgatcc cggcactttg
720attgccggct ctatggagga tattcctgtg gaagaagcag tccttaccgg tgtcgcaacc
780gacaagtccg aagccaaagt aaccgttctg ggtatttccg ataagccagg cgaggctgcg
840aaggttttcc gtgcgttggc tgatgcagaa atcaacattg acatggttct gcagaacgtc
900tcttctgtag aagacggcac caccgacatc accttcacct gccctcgttc cgacggccgc
960cgcgcgatgg agatcttgaa gaagcttcag gttcagggca actggaccaa tgtgctttac
1020gacgaccagg tcggcaaagt ctccctcgtg ggtgctggca tgaagtctca cccaggtgtt
1080accgcagagt tcatggaagc tctgcgcgat gtcaacgtga acatcgaatt gatttccacc
1140tctgagattc gtatttccgt gctgatccgt gaagatgatc tggatgctgc tgcacgtgca
1200ttgcatgagc agttccagct gggcggcgaa gacgaagccg tcgtttatgc aggcaccgga
1260cgc
1263125860DNACorynebacterium
glutamicummisc_feature(1)..(5860)PCIS\LYSC\THR311ILE 12cccggtacca
cgcgtcccag tggctgagac gcatccgcta aagccccagg aaccctgtgc 60agaaagaaaa
cactcctctg gctaggtaga cacagtttat aaaggtagag ttgagcgggt 120aactgtcagc
acgtagatcg aaaggtgcac aaaggtggcc ctggtcgtac agaaatatgg 180cggttcctcg
cttgagagtg cggaacgcat tagaaacgtc gctgaacgga tcgttgccac 240caagaaggct
ggaaatgatg tcgtggttgt ctgctccgca atgggagaca ccacggatga 300acttctagaa
cttgcagcgg cagtgaatcc cgttccgcca gctcgtgaaa tggatatgct 360cctgactgct
ggtgagcgta tttctaacgc tctcgtcgcc atggctattg agtcccttgg 420cgcagaagcc
caatctttca cgggctctca ggctggtgtg ctcaccaccg agcgccacgg 480aaacgcacgc
attgttgatg tcactccagg tcgtgtgcgt gaagcactcg atgagggcaa 540gatctgcatt
gttgctggtt tccagggtgt taataaagaa acccgcgatg tcaccacgtt 600gggtcgtggt
ggttctgaca ccactgcagt tgcgttggca gctgctttga acgctgatgt 660gtgtgagatt
tactcggacg ttgacggtgt gtataccgct gacccgcgca tcgttcctaa 720tgcacagaag
ctggaaaagc tcagcttcga agaaatgctg gaacttgctg ctgttggctc 780caagattttg
gtgctgcgca gtgttgaata cgctcgtgca ttcaatgtgc cacttcgcgt 840acgctcgtct
tatagtaatg atcccggcac tttgattgcc ggctctatgg aggatattcc 900tgtggaagaa
gcagtcctta ccggtgtcgc aaccgacaag tccgaagcca aagtaaccgt 960tctgggtatt
tccgataagc caggcgaggc tgcgaaggtt ttccgtgcgt tggctgatgc 1020agaaatcaac
attgacatgg ttctgcagaa cgtctcttct gtagaagacg gcaccaccga 1080catcatcttc
acctgccctc gttccgacgg ccgccgcgcg atggagatct tgaagaagct 1140tcaggttcag
ggcaactgga ccaatgtgct ttacgacgac caggtcggca aagtctccct 1200cgtgggtgct
ggcatgaagt ctcacccagg tgttaccgca gagttcatgg aagctctgcg 1260cgatgtcaac
gtgaacatcg aattgatttc cacctctgag attcgtattt ccgtgctgat 1320ccgtgaagat
gatctggatg ctgctgcacg tgcattgcat gagcagttcc agctgggcgg 1380cgaagacgaa
gccgtcgttt atgcaggcac cggacgctaa agttttaaag gagtagtttt 1440acaatgacca
ccatcgcagt tgttggtgca accggccagg tcggccaggt tatgcgcacc 1500cttttggaag
agcgcaattt cccagctgac actgttcgtt tctttgcttc cccacgttcc 1560gcaggccgta
agattgaatt cgtcgacatc gatgctcttc tgcgttaatt aacaattggg 1620atcctctaga
cccgggattt aaatcgctag cgggctgcta aaggaagcgg aacacgtaga 1680aagccagtcc
gcagaaacgg tgctgacccc ggatgaatgt cagctactgg gctatctgga 1740caagggaaaa
cgcaagcgca aagagaaagc aggtagcttg cagtgggctt acatggcgat 1800agctagactg
ggcggtttta tggacagcaa gcgaaccgga attgccagct ggggcgccct 1860ctggtaaggt
tgggaagccc tgcaaagtaa actggatggc tttcttgccg ccaaggatct 1920gatggcgcag
gggatcaaga tctgatcaag agacaggatg aggatcgttt cgcatgattg 1980aacaagatgg
attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg 2040actgggcaca
acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg 2100ggcgcccggt
tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg 2160aggcagcgcg
gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg 2220ttgtcactga
agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc 2280tgtcatctca
ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc 2340tgcatacgct
tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc 2400gagcacgtac
tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc 2460aggggctcgc
gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg 2520atctcgtcgt
gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct 2580tttctggatt
catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt 2640tggctacccg
tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc 2700tttacggtat
cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt 2760tcttctgagc
gggactctgg ggttcgaaat gaccgaccaa gcgacgccca acctgccatc 2820acgagatttc
gattccaccg ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg 2880ggacgccggc
tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccacgc 2940tagcggcgcg
ccggccggcc cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc 3000gcatcaggcg
ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 3060ggcgagcggt
atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 3120acgcaggaaa
gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 3180cgttgctggc
gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 3240caagtcagag
gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 3300gctccctcgt
gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 3360tcccttcggg
aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt 3420aggtcgttcg
ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 3480ccttatccgg
taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 3540cagcagccac
tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 3600tgaagtggtg
gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 3660tgaagccagt
taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 3720ctggtagcgg
tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 3780aagaagatcc
tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 3840aagggatttt
ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaaggccg 3900gccgcggccg
ccatcggcat tttcttttgc gtttttattt gttaactgtt aattgtcctt 3960gttcaaggat
gctgtctttg acaacagatg ttttcttgcc tttgatgttc agcaggaagc 4020tcggcgcaaa
cgttgattgt ttgtctgcgt agaatcctct gtttgtcata tagcttgtaa 4080tcacgacatt
gtttcctttc gcttgaggta cagcgaagtg tgagtaagta aaggttacat 4140cgttaggatc
aagatccatt tttaacacaa ggccagtttt gttcagcggc ttgtatgggc 4200cagttaaaga
attagaaaca taaccaagca tgtaaatatc gttagacgta atgccgtcaa 4260tcgtcatttt
tgatccgcgg gagtcagtga acaggtacca tttgccgttc attttaaaga 4320cgttcgcgcg
ttcaatttca tctgttactg tgttagatgc aatcagcggt ttcatcactt 4380ttttcagtgt
gtaatcatcg tttagctcaa tcataccgag agcgccgttt gctaactcag 4440ccgtgcgttt
tttatcgctt tgcagaagtt tttgactttc ttgacggaag aatgatgtgc 4500ttttgccata
gtatgctttg ttaaataaag attcttcgcc ttggtagcca tcttcagttc 4560cagtgtttgc
ttcaaatact aagtatttgt ggcctttatc ttctacgtag tgaggatctc 4620tcagcgtatg
gttgtcgcct gagctgtagt tgccttcatc gatgaactgc tgtacatttt 4680gatacgtttt
tccgtcaccg tcaaagattg atttataatc ctctacaccg ttgatgttca 4740aagagctgtc
tgatgctgat acgttaactt gtgcagttgt cagtgtttgt ttgccgtaat 4800gtttaccgga
gaaatcagtg tagaataaac ggatttttcc gtcagatgta aatgtggctg 4860aacctgacca
ttcttgtgtt tggtctttta ggatagaatc atttgcatcg aatttgtcgc 4920tgtctttaaa
gacgcggcca gcgtttttcc agctgtcaat agaagtttcg ccgacttttt 4980gatagaacat
gtaaatcgat gtgtcatccg catttttagg atctccggct aatgcaaaga 5040cgatgtggta
gccgtgatag tttgcgacag tgccgtcagc gttttgtaat ggccagctgt 5100cccaaacgtc
caggcctttt gcagaagaga tatttttaat tgtggacgaa tcaaattcag 5160aaacttgata
tttttcattt ttttgctgtt cagggatttg cagcatatca tggcgtgtaa 5220tatgggaaat
gccgtatgtt tccttatatg gcttttggtt cgtttctttc gcaaacgctt 5280gagttgcgcc
tcctgccagc agtgcggtag taaaggttaa tactgttgct tgttttgcaa 5340actttttgat
gttcatcgtt catgtctcct tttttatgta ctgtgttagc ggtctgcttc 5400ttccagccct
cctgtttgaa gatggcaagt tagttacgca caataaaaaa agacctaaaa 5460tatgtaaggg
gtgacgccaa agtatacact ttgcccttta cacattttag gtcttgcctg 5520ctttatcagt
aacaaacccg cgcgatttac ttttcgacct cattctatta gactctcgtt 5580tggattgcaa
ctggtctatt ttcctctttt gtttgataga aaatcataaa aggatttgca 5640gactacgggc
ctaaagaact aaaaaatcta tctgtttctt ttcattctct gtatttttta 5700tagtttctgt
tgcatgggca taaagttgcc tttttaatca caattcagaa aatatcataa 5760tatctcattt
cactaaataa tagtgaacgg caggtatatg tgatgggtta aaaaggatcg 5820gcggccgctc
gatttaaatc tcgagaggcc tgacgtcggg
58601323DNACorynebacterium glutamicummisc_feature(1)..(23)SOD8
13accctggcgg aaaccctgag tcg
231465DNACorynebacterium glutamicummisc_feature(1)..(65)SOD1 14tacgaccagg
gccacgggta aaaaatcctt tcgtaggttt ccgcaccgag catatacatc 60ttttg
651540DNACorynebacterium glutamicummisc_feature(1)..(40)LYSC2
15cctacgaaag gattttttac ccgtggccct ggtcgtacag
401621DNACorynebacterium glutamicummisc_feature(1)..(21)LYSC6
16gattagtgga acctcgtcgt c
211719DNACorynebacterium glutamicummisc_feature(1)..(19)SOD4 17gcggcgcagg
attttctaa
191822DNACorynebacterium glutamicummisc_feature(1)..(22)LYSC4
18tcggttgcct gagtaatgtc tt
22195720DNACorynebacterium glutamicummisc_feature(1)..(5720)PK19
19ggtcgactct agaggatccc cgggtaccga gctcgaattc actggccgtc gttttacaac
60gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccctt
120tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca
180gcctgaatgg cgaatggcga taagctagct tcacgctgcc gcaagcactc agggcgcaag
240ggctgctaaa ggaagcggaa cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg
300atgaatgtca gctactgggc tatctggaca agggaaaacg caagcgcaaa gagaaagcag
360gtagcttgca gtgggcttac atggcgatag ctagactggg cggttttatg gacagcaagc
420gaaccggaat tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac
480tggatggctt tcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag
540acaggatgag gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc
600gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat
660gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg
720tccggtgccc tgaatgaact ccaagacgag gcagcgcggc tatcgtggct ggccacgacg
780ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta
840ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta
900tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc
960gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc
1020gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg
1080ctcaaggcgc ggatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg
1140ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt
1200gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc
1260ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc
1320atcgccttct atcgccttct tgacgagttc ttctgagcgg gactctgggg ttcgctagag
1380gatcgatcct ttttaaccca tcacatatac ctgccgttca ctattattta gtgaaatgag
1440atattatgat attttctgaa ttgtgattaa aaaggcaact ttatgcccat gcaacagaaa
1500ctataaaaaa tacagagaat gaaaagaaac agatagattt tttagttctt taggcccgta
1560gtctgcaaat ccttttatga ttttctatca aacaaaagag gaaaatagac cagttgcaat
1620ccaaacgaga gtctaataga atgaggtcga aaagtaaatc gcgcgggttt gttactgata
1680aagcaggcaa gacctaaaat gtgtaaaggg caaagtgtat actttggcgt caccccttac
1740atattttagg tcttttttta ttgtgcgtaa ctaacttgcc atcttcaaac aggagggctg
1800gaagaagcag accgctaaca cagtacataa aaaaggagac atgaacgatg aacatcaaaa
1860agtttgcaaa acaagcaaca gtattaacct ttactaccgc actgctggca ggaggcgcaa
1920ctcaagcgtt tgcgaaagaa acgaaccaaa agccatataa ggaaacatac ggcatttccc
1980atattacacg ccatgatatg ctgcaaatcc ctgaacagca aaaaaatgaa aaatatcaag
2040tttctgaatt tgattcgtcc acaattaaaa atatctcttc tgcaaaaggc ctggacgttt
2100gggacagctg gccattacaa aacgctgacg gcactgtcgc aaactatcac ggctaccaca
2160tcgtctttgc attagccgga gatcctaaaa atgcggatga cacatcgatt tacatgttct
2220atcaaaaagt cggcgaaact tctattgaca gctggaaaaa cgctggccgc gtctttaaag
2280acagcgacaa attcgatgca aatgattcta tcctaaaaga ccaaacacaa gaatggtcag
2340gttcagccac atttacatct gacggaaaaa tccgtttatt ctacactgat ttctccggta
2400aacattacgg caaacaaaca ctgacaactg cacaagttaa cgtatcagca tcagacagct
2460ctttgaacat caacggtgta gaggattata aatcaatctt tgacggtgac ggaaaaacgt
2520atcaaaatgt acagcagttc atcgatgaag gcaactacag ctcaggcgac aaccatacgc
2580tgagagatcc tcactacgta gaagataaag gccacaaata cttagtattt gaagcaaaca
2640ctggaactga agatggctac caaggcgaag aatctttatt taacaaagca tactatggca
2700aaagcacatc attcttccgt caagaaagtc aaaaacttct gcaaagcgat aaaaaacgca
2760cggctgagtt agcaaacggc gctctcggta tgattgagct aaacgatgat tacacactga
2820aaaaagtgat gaaaccgctg attgcatcta acacagtaac agatgaaatt gaacgcgcga
2880acgtctttaa aatgaacggc aaatggtacc tgttcactga ctcccgcgga tcaaaaatga
2940cgattgacgg cattacgtct aacgatattt acatgcttgg ttatgtttct aattctttaa
3000ctggcccata caagccgctg aacaaaactg gccttgtgtt aaaaatggat cttgatccta
3060acgatgtaac ctttacttac tcacacttcg ctgtacctca agcgaaagga aacaatgtcg
3120tgattacaag ctatatgaca aacagaggat tctacgcaga caaacaatca acgtttgcgc
3180cgagcttcct gctgaacatc aaaggcaaga aaacatctgt tgtcaaagac agcatccttg
3240aacaaggaca attaacagtt aacaaataaa aacgcaaaag aaaatgccga tgggtaccga
3300gcgaaatgac cgaccaagcg acgcccaacc tgccatcacg agatttcgat tccaccgccg
3360ccttctatga aaggttgggc ttcggaatcg ttttccggga cgccctcgcg gacgtgctca
3420tagtccacga cgcccgtgat tttgtagccc tggccgacgg ccagcaggta ggccgacagg
3480ctcatgccgg ccgccgccgc cttttcctca atcgctcttc gttcgtctgg aaggcagtac
3540accttgatag gtgggctgcc cttcctggtt ggcttggttt catcagccat ccgcttgccc
3600tcatctgtta cgccggcggt agccggccag cctcgcagag caggattccc gttgagcacc
3660gccaggtgcg aataagggac agtgaagaag gaacacccgc tcgcgggtgg gcctacttca
3720cctatcctgc ccggctgacg ccgttggata caccaaggaa agtctacacg aaccctttgg
3780caaaatcctg tatatcgtgc gaaaaaggat ggatataccg aaaaaatcgc tataatgacc
3840ccgaagcagg gttatgcagc ggaaaagcgc tgcttccctg ctgttttgtg gaatatctac
3900cgactggaaa caggcaaatg caggaaatta ctgaactgag gggacaggcg agagacgatg
3960ccaaagagct cctgaaaatc tcgataactc aaaaaatacg cccggtagtg atcttatttc
4020attatggtga aagttggaac ctcttacgtg ccgatcaacg tctcattttc gccaaaagtt
4080ggcccagggc ttcccggtat caacagggac accaggattt atttattctg cgaagtgatc
4140ttccgtcaca ggtatttatt cggcgcaaag tgcgtcgggt gatgctgcca acttactgat
4200ttagtgtatg atggtgtttt tgaggtgctc cagtggcttc tgtttctatc agctcctgaa
4260aatctcgata actcaaaaaa tacgcccggt agtgatctta tttcattatg gtgaaagttg
4320gaacctctta cgtgccgatc aacgtctcat tttcgccaaa agttggccca gggcttcccg
4380gtatcaacag ggacaccagg atttatttat tctgcgaagt gatcttccgt cacaggtatt
4440tattcggcgc aaagtgcgtc gggtgatgct gccaacttac tgatttagtg tatgatggtg
4500tttttgaggt gctccagtgg cttctgtttc tatcagggct ggatgatcct ccagcgcggg
4560gatctcatgc tggagttctt cgcccacccc aaaaggatct aggtgaagat cctttttgat
4620aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta
4680gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa
4740acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt
4800tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag
4860ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta
4920atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca
4980agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag
5040cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa
5100agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga
5160acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc
5220gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc
5280ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt
5340gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt
5400gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag
5460gaagcggaag agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa
5520tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat
5580gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg
5640ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac
5700gccaagcttg catgcctgca
57202027DNACorynebacterium glutamicummisc_feature(1)..(27)LYSC23
20caccgcggct ttggacatca ctgctac
272126DNACorynebacterium glutamicummisc_feature(1)..(26)LYSC24
21cctggggctt tagcggatgc gtctca
26228324DNACorynebacterium glutamicummisc_feature(1)..(8324)PK19
22aaacgcaaaa gaaaatgccg atgggtaccg agcgaaatga ccgaccaagc gacgcccaac
60ctgccatcac gagatttcga ttccaccgcc gccttctatg aaaggttggg cttcggaatc
120gttttccggg acgccctcgc ggacgtgctc atagtccacg acgcccgtga ttttgtagcc
180ctggccgacg gccagcaggt aggccgacag gctcatgccg gccgccgccg ccttttcctc
240aatcgctctt cgttcgtctg gaaggcagta caccttgata ggtgggctgc ccttcctggt
300tggcttggtt tcatcagcca tccgcttgcc ctcatctgtt acgccggcgg tagccggcca
360gcctcgcaga gcaggattcc cgttgagcac cgccaggtgc gaataaggga cagtgaagaa
420ggaacacccg ctcgcgggtg ggcctacttc acctatcctg cccggctgac gccgttggat
480acaccaagga aagtctacac gaaccctttg gcaaaatcct gtatatcgtg cgaaaaagga
540tggatatacc gaaaaaatcg ctataatgac cccgaagcag ggttatgcag cggaaaagcg
600ctgcttccct gctgttttgt ggaatatcta ccgactggaa acaggcaaat gcaggaaatt
660actgaactga ggggacaggc gagagacgat gccaaagagc tcctgaaaat ctcgataact
720caaaaaatac gcccggtagt gatcttattt cattatggtg aaagttggaa cctcttacgt
780gccgatcaac gtctcatttt cgccaaaagt tggcccaggg cttcccggta tcaacaggga
840caccaggatt tatttattct gcgaagtgat cttccgtcac aggtatttat tcggcgcaaa
900gtgcgtcggg tgatgctgcc aacttactga tttagtgtat gatggtgttt ttgaggtgct
960ccagtggctt ctgtttctat cagctcctga aaatctcgat aactcaaaaa atacgcccgg
1020tagtgatctt atttcattat ggtgaaagtt ggaacctctt acgtgccgat caacgtctca
1080ttttcgccaa aagttggccc agggcttccc ggtatcaaca gggacaccag gatttattta
1140ttctgcgaag tgatcttccg tcacaggtat ttattcggcg caaagtgcgt cgggtgatgc
1200tgccaactta ctgatttagt gtatgatggt gtttttgagg tgctccagtg gcttctgttt
1260ctatcagggc tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccaccc
1320caaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga
1380gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc
1440tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt
1500ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc
1560gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact tcaagaactc
1620tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg
1680cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg
1740gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga
1800actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc
1860ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg
1920gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg
1980atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt
2040tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc
2100tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc gccgcagccg
2160aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc
2220gcctctcccc gcgcgttggc cgattcatta atgcagctgg cacgacaggt ttcccgactg
2280gaaagcgggc agtgagcgca acgcaattaa tgtgagttag ctcactcatt aggcacccca
2340ggctttacac tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt
2400tcacacagga aacagctatg accatgatta cgccaagctt gcatgcctgc aggtcgactc
2460tagaggatcc ccgggtaccg agctcgaatt cgccctttcg gttgcctgag taatgtcttc
2520tacctcgatt tccgtgccac ggaattcaat cttacggcct gcggaacgtg gggaagcaaa
2580gaaacgaaca gtgtcagctg ggaaattgcg ctcttccaaa agggtgcgca taacctggcc
2640gacctggccg gttgcaccaa caactgcgat ggtggtcatt gtaaaactac tcctttaaaa
2700ctttagcgtc cggtgcctgc ataaacgacg gcttcgtctt cgccgcccag ctggaactgc
2760tcatgcaatg cacgtgcagc agcatccaga tcatcttcac ggatcagcac ggaaatacga
2820atctcagagg tggaaatcaa ttcgatgttc acgttgacat cgcgcagagc ttccatgaac
2880tctgcggtaa cacctgggtg agacttcatg ccagcaccca cgagggagac tttgccgacc
2940tggtcgtcgt aaagcacatt ggtccagttg ccctgaacct gaagcttctt caagatctcc
3000atcgcgcggc ggccgtcgga acgagggcag gtgaagatga tgtcggtggt gccgtcttct
3060acagaagaga cgttctgcag aaccatgtca atgttgattt ctgcatcagc caacgcacgg
3120aaaaccttcg cagcctcgcc tggcttatcg gaaataccca gaacggttac tttggcttcg
3180gacttgtcgg ttgcgacacc ggtaaggact gcttcttcca caggaatatc ctccatagag
3240ccggcaatca aagtgccggg atcattacta taagacgagc gtacgcgaag tggcacattg
3300aatgcacgag cgtattcaac actgcgcagc accaaaatct tggagccaac agcagcaagt
3360tccagcattt cttcgaagct gagcttttcc agcttctgtg cattaggaac gatgcgcggg
3420tcagcggtat acacaccgtc aacgtccgag taaatctcac acacatcagc gttcaaagca
3480gctgccaacg caactgcagt ggtgtcagaa ccaccacgac ccaacgtggt gacatcgcgg
3540gtttctttat taacaccctg gaaaccagca acaatgcaga tcttgccctc atcgagtgct
3600tcacgcacac gacctggagt gacatcaaca atgcgtgcgt ttccgtggcg ctcggtggtg
3660agcacaccag cctgagagcc cgtgaaagat tgggcttctg cgccaaggga ctcaatagcc
3720atggcgacga gagcgttaga aatacgctca ccagcagtca ggagcatatc catttcacga
3780gctggcggaa cgggattcac tgccgctgca agttctagaa gttcatccgt ggtgtctccc
3840attgcggagc agacaaccac gacatcattt ccagccttct tggtggcaac gatccgttca
3900gcgacgtttc taatgcgttc cgcactctca agcgaggaac cgccatattt ctgtacgacc
3960agggccacgg gtaaaaaatc ctttcgtagg tttccgcacc gagcatatac atcttttgaa
4020aatccgtcag atggcgcttc gcaaaagtac ttggtgcgac acctcccaat gataggcctt
4080tttgttgata ttgcaacgaa atttttcagc cgacctattt atcgggtagc gggtcacaag
4140cccggaataa ttggcagcta agtagggttg aagggcataa ggcttcctca attttcgaaa
4200ggaacattcc tgttatggca tggtttttcg cacccgaacc cgtgatggtt accgctgatg
4260aggcgcttaa aggtggcagg catcctgttt tagaaaatcc tgcgccgcaa gggcgaattc
4320actggccgtc gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg
4380ccttgcagca catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg
4440cccttcccaa cagttgcgca gcctgaatgg cgaatggcga taagctagat gcatgctcga
4500gcggccgcca gtgtgatgga tatctgcaga attcgccctt ggggctttag cggatgcgtc
4560tcagccactg ggacgcgttc caataaacag accatatatt gatattcgat ttaatatttg
4620agacaaaagt gacaggtgct acttcgcgag caactcttta gtcaactacc ctgaatcaag
4680tgcaaagcaa tctgctcgcc gtgcttttcg ccctagcatc ggcattaaca atcgcatggg
4740gcaccgtggt cagacaccgg atcgcgctcc gcaccccaaa agatggctcc ctaaggagct
4800cacctttact caatgctctg atgacaccga tgtggtgggc aggcatgagt accgcgatgc
4860tggcatattt cttacaaaca gtagcacttg gtttcggcac cctcttggta gtgcaaccag
4920tgcttgtcct gtcgctgatg ttcacgctgc cgctctcagc acgattcaat ggctaccgac
4980tacgccgaac tgaaatcttc tgggctaccc tcctcaccgt agccgtgggc atcatgatcg
5040ttttgggacg cccccttccc ggaaaccccc acccccactc gatcgatgga ttccagtact
5100tttagtcggc gttgcagtaa tgggtggaat gtggctgctt gcggaatacg tattaaagaa
5160ggacaaagcc ctcatccttg gtcttgtgac gggtgcattg tttggctacg tagcagtgat
5220gtccaaagcc gcggtgaagg gcgaattcca gcacactggc ggccgttact agcttcacgc
5280tgccgcaagc actcagggcg caagggctgc taaaggaagc ggaacacgta gaaagccagt
5340ccgcagaaac ggtgctgacc ccggatgaat gtcagctact gggctatctg gacaagggaa
5400aacgcaagcg caaagagaaa gcaggtagct tgcagtgggc ttacatggcg atagctagac
5460tgggcggttt tatggacagc aagcgaaccg gaattgccag ctggggcgcc ctctggtaag
5520gttgggaagc cctgcaaagt aaactggatg gctttcttgc cgccaaggat ctgatggcgc
5580aggggatcaa gatctgatca agagacagga tgaggatcgt ttcgcatgat tgaacaagat
5640ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca
5700caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg
5760gttctttttg tcaagaccga cctgtccggt gccctgaatg aactccaaga cgaggcagcg
5820cggctatcgt ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact
5880gaagcgggaa gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct
5940caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg
6000cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt
6060actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc
6120gcgccagccg aactgttcgc caggctcaag gcgcggatgc ccgacggcga ggatctcgtc
6180gtgacccatg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga
6240ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc
6300cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt
6360atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga
6420gcgggactct ggggttcgct agaggatcga tcctttttaa cccatcacat atacctgccg
6480ttcactatta tttagtgaaa tgagatatta tgatattttc tgaattgtga ttaaaaaggc
6540aactttatgc ccatgcaaca gaaactataa aaaatacaga gaatgaaaag aaacagatag
6600attttttagt tctttaggcc cgtagtctgc aaatcctttt atgattttct atcaaacaaa
6660agaggaaaat agaccagttg caatccaaac gagagtctaa tagaatgagg tcgaaaagta
6720aatcgcgcgg gtttgttact gataaagcag gcaagaccta aaatgtgtaa agggcaaagt
6780gtatactttg gcgtcacccc ttacatattt taggtctttt tttattgtgc gtaactaact
6840tgccatcttc aaacaggagg gctggaagaa gcagaccgct aacacagtac ataaaaaagg
6900agacatgaac gatgaacatc aaaaagtttg caaaacaagc aacagtatta acctttacta
6960ccgcactgct ggcaggaggc gcaactcaag cgtttgcgaa agaaacgaac caaaagccat
7020ataaggaaac atacggcatt tcccatatta cacgccatga tatgctgcaa atccctgaac
7080agcaaaaaaa tgaaaaatat caagttcctg aatttgattc gtccacaatt aaaaatatct
7140cttctgcaaa aggcctggac gtttgggaca gctggccatt acaaaacgct gacggcactg
7200tcgcaaacta tcacggctac cacatcgtct ttgcattagc cggagatcct aaaaatgcgg
7260atgacacatc gatttacatg ttctatcaaa aagtcggcga aacttctatt gacagctgga
7320aaaacgctgg ccgcgtcttt aaagacagcg acaaattcga tgcaaatgat tctatcctaa
7380aagaccaaac acaagaatgg tcaggttcag ccacatttac atctgacgga aaaatccgtt
7440tattctacac tgatttctcc ggtaaacatt acggcaaaca aacactgaca actgcacaag
7500ttaacgtatc agcatcagac agctctttga acatcaacgg tgtagaggat tataaatcaa
7560tctttgacgg tgacggaaaa acgtatcaaa atgtacagca gttcatcgat gaaggcaact
7620acagctcagg cgacaaccat acgctgagag atcctcacta cgtagaagat aaaggccaca
7680aatacttagt atttgaagca aacactggaa ctgaagatgg ctaccaaggc gaagaatctt
7740tatttaacaa agcatactat ggcaaaagca catcattctt ccgtcaagaa agtcaaaaac
7800ttctgcaaag cgataaaaaa cgcacggctg agttagcaaa cggcgctctc ggtatgattg
7860agctaaacga tgattacaca ctgaaaaaag tgatgaaacc gctgattgca tctaacacag
7920taacagatga aattgaacgc gcgaacgtct ttaaaatgaa cggcaaatgg tacctgttca
7980ctgactcccg cggatcaaaa atgacgattg acggcattac gtctaacgat atttacatgc
8040ttggttatgt ttctaattct ttaactggcc catacaagcc gctgaacaaa actggccttg
8100tgttaaaaat ggatcttgat cctaacgatg taacctttac ttactcacac ttcgctgtac
8160ctcaagcgaa aggaaacaat gtcgtgatta caagctatat gacaaacaga ggattctacg
8220cagacaaaca atcaacgttt gcgccgagct tcctgctgaa catcaaaggc aagaaaacat
8280ctgttgtcaa agacagcatc cttgaacaag gacaattaac agtt
83242352DNACorynebacterium glutamicum 23cccgggatcc gctagcggcg cgccggccgg
cccggtgtga aataccgcac ag 522453DNACorynebacterium glutamicum
24tctagactcg agcggccgcg gccggccttt aaattgaaga cgaaagggcc tcg
532547DNACorynebacterium glutamicum 25gagatctaga cccggggatc cgctagcggg
ctgctaaagg aagcgga 472638DNACorynebacterium glutamicum
26gagaggcgcg ccgctagcgt gggcgaagaa ctccagca
382734DNACorynebacterium glutamicum 27gagagggcgg ccgcgcaaag tcccgcttcg
tgaa 342834DNACorynebacterium glutamicum
28gagagggcgg ccgctcaagt cggtcaagcc acgc
3429140DNACorynebacterium glutamicum 29tcgaatttaa atctcgagag gcctgacgtc
gggcccggta ccacgcgtca tatgactagt 60tcggacctag ggatatcgtc gacatcgatg
ctcttctgcg ttaattaaca attgggatcc 120tctagacccg ggatttaaat
14030140DNACorynebacterium glutamicum
30gatcatttaa atcccgggtc tagaggatcc caattgttaa ttaacgcaga agagcatcga
60tgtcgacgat atccctaggt ccgaactagt catatgacgc gtggtaccgg gcccgacgtc
120aggcctctcg agatttaaat
140315091DNACorynebacterium glutamicummisc_feature(1)..(5091)PCLIK5MCS
31tcgatttaaa tctcgagagg cctgacgtcg ggcccggtac cacgcgtcat atgactagtt
60cggacctagg gatatcgtcg acatcgatgc tcttctgcgt taattaacaa ttgggatcct
120ctagacccgg gatttaaatc gctagcgggc tgctaaagga agcggaacac gtagaaagcc
180agtccgcaga aacggtgctg accccggatg aatgtcagct actgggctat ctggacaagg
240gaaaacgcaa gcgcaaagag aaagcaggta gcttgcagtg ggcttacatg gcgatagcta
300gactgggcgg ttttatggac agcaagcgaa ccggaattgc cagctggggc gccctctggt
360aaggttggga agccctgcaa agtaaactgg atggctttct tgccgccaag gatctgatgg
420cgcaggggat caagatctga tcaagagaca ggatgaggat cgtttcgcat gattgaacaa
480gatggattgc acgcaggttc tccggccgct tgggtggaga ggctattcgg ctatgactgg
540gcacaacaga caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc
600ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga atgaactgca ggacgaggca
660gcgcggctat cgtggctggc cacgacgggc gttccttgcg cagctgtgct cgacgttgtc
720actgaagcgg gaagggactg gctgctattg ggcgaagtgc cggggcagga tctcctgtca
780tctcaccttg ctcctgccga gaaagtatcc atcatggctg atgcaatgcg gcggctgcat
840acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat cgagcgagca
900cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga gcatcagggg
960ctcgcgccag ccgaactgtt cgccaggctc aaggcgcgca tgcccgacgg cgaggatctc
1020gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct
1080ggattcatcg actgtggccg gctgggtgtg gcggaccgct atcaggacat agcgttggct
1140acccgtgata ttgctgaaga gcttggcggc gaatgggctg accgcttcct cgtgctttac
1200ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga cgagttcttc
1260tgagcgggac tctggggttc gaaatgaccg accaagcgac gcccaacctg ccatcacgag
1320atttcgattc caccgccgcc ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg
1380ccggctggat gatcctccag cgcggggatc tcatgctgga gttcttcgcc cacgctagcg
1440gcgcgccggc cggcccggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc
1500aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga
1560gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca
1620ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg
1680ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
1740cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc
1800ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct
1860tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc
1920gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
1980tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca
2040gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
2100tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag
2160ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt
2220agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa
2280gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg
2340attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ggccggccgc
2400ggccgcgcaa agtcccgctt cgtgaaaatt ttcgtgccgc gtgattttcc gccaaaaact
2460ttaacgaacg ttcgttataa tggtgtcatg accttcacga cgaagtacta aaattggccc
2520gaatcatcag ctatggatct ctctgatgtc gcgctggagt ccgacgcgct cgatgctgcc
2580gtcgatttaa aaacggtgat cggatttttc cgagctctcg atacgacgga cgcgccagca
2640tcacgagact gggccagtgc cgcgagcgac ctagaaactc tcgtggcgga tcttgaggag
2700ctggctgacg agctgcgtgc tcggccagcg ccaggaggac gcacagtagt ggaggatgca
2760atcagttgcg cctactgcgg tggcctgatt cctccccggc ctgacccgcg aggacggcgc
2820gcaaaatatt gctcagatgc gtgtcgtgcc gcagccagcc gcgagcgcgc caacaaacgc
2880cacgccgagg agctggaggc ggctaggtcg caaatggcgc tggaagtgcg tcccccgagc
2940gaaattttgg ccatggtcgt cacagagctg gaagcggcag cgagaattat cgcgatcgtg
3000gcggtgcccg caggcatgac aaacatcgta aatgccgcgt ttcgtgtgcc gtggccgccc
3060aggacgtgtc agcgccgcca ccacctgcac cgaatcggca gcagcgtcgc gcgtcgaaaa
3120agcgcacagg cggcaagaag cgataagctg cacgaatacc tgaaaaatgt tgaacgcccc
3180gtgagcggta actcacaggg cgtcggctaa cccccagtcc aaacctggga gaaagcgctc
3240aaaaatgact ctagcggatt cacgagacat tgacacaccg gcctggaaat tttccgctga
3300tctgttcgac acccatcccg agctcgcgct gcgatcacgt ggctggacga gcgaagaccg
3360ccgcgaattc ctcgctcacc tgggcagaga aaatttccag ggcagcaaga cccgcgactt
3420cgccagcgct tggatcaaag acccggacac ggagaaacac agccgaagtt ataccgagtt
3480ggttcaaaat cgcttgcccg gtgccagtat gttgctctga cgcacgcgca gcacgcagcc
3540gtgcttgtcc tggacattga tgtgccgagc caccaggccg gcgggaaaat cgagcacgta
3600aaccccgagg tctacgcgat tttggagcgc tgggcacgcc tggaaaaagc gccagcttgg
3660atcggcgtga atccactgag cgggaaatgc cagctcatct ggctcattga tccggtgtat
3720gccgcagcag gcatgagcag cccgaatatg cgcctgctgg ctgcaacgac cgaggaaatg
3780acccgcgttt tcggcgctga ccaggctttt tcacataggc tgagccgtgg ccactgcact
3840ctccgacgat cccagccgta ccgctggcat gcccagcaca atcgcgtgga tcgcctagct
3900gatcttatgg aggttgctcg catgatctca ggcacagaaa aacctaaaaa acgctatgag
3960caggagtttt ctagcggacg ggcacgtatc gaagcggcaa gaaaagccac tgcggaagca
4020aaagcacttg ccacgcttga agcaagcctg ccgagcgccg ctgaagcgtc tggagagctg
4080atcgacggcg tccgtgtcct ctggactgct ccagggcgtg ccgcccgtga tgagacggct
4140tttcgccacg ctttgactgt gggataccag ttaaaagcgg ctggtgagcg cctaaaagac
4200accaagggtc atcgagccta cgagcgtgcc tacaccgtcg ctcaggcggt cggaggaggc
4260cgtgagcctg atctgccgcc ggactgtgac cgccagacgg attggccgcg acgtgtgcgc
4320ggctacgtcg ctaaaggcca gccagtcgtc cctgctcgtc agacagagac gcagagccag
4380ccgaggcgaa aagctctggc cactatggga agacgtggcg gtaaaaaggc cgcagaacgc
4440tggaaagacc caaacagtga gtacgcccga gcacagcgag aaaaactagc taagtccagt
4500caacgacaag ctaggaaagc taaaggaaat cgcttgacca ttgcaggttg gtttatgact
4560gttgagggag agactggctc gtggccgaca atcaatgaag ctatgtctga atttagcgtg
4620tcacgtcaga ccgtgaatag agcacttaag gtctgcgggc attgaacttc cacgaggacg
4680ccgaaagctt cccagtaaat gtgccatctc gtaggcagaa aacggttccc ccgtagggtc
4740tctctcttgg cctcctttct aggtcgggct gattgctctt gaagctctct aggggggctc
4800acaccatagg cagataacgt tccccaccgg ctcgcctcgt aagcgcacaa ggactgctcc
4860caaagatctt caaagccact gccgcgactg ccttcgcgaa gccttgcccc gcggaaattt
4920cctccaccga gttcgtgcac acccctatgc caagcttctt tcaccctaaa ttcgagagat
4980tggattctta ccgtggaaat tcttcgcaaa aatcgtcccc tgatcgccct tgcgacgttg
5040gcgtcggtgc cgctggttgc gcttggcttg accgacttga tcagcggccg c
50913228DNACorynebacterium glutamicum 32gcgcggtacc tagactcacc ccagtgct
283330DNACorynebacterium glutamicum
33ctctactagt ttagatgtag aactcgatgt
30346349DNACorynebacterium glutamicummisc_feature(1)..(6349)PCLIK5MCS
34tcgatttaaa tctcgagagg cctgacgtcg ggcccggtac ctagactcac cccagtgctt
60aaagcgctgg gtttttcttt ttcagactcg tgagaatgca aactagacta gacagagctg
120tccatataca ctggacgaag ttttagtctt gtccacccag aacaggcggt tattttcatg
180cccaccctcg cgccttcagg tcaacttgaa atccaagcga tcggtgatgt ctccaccgaa
240gccggagcaa tcattacaaa cgctgaaatc gcctatcacc gctggggtga ataccgcgta
300gataaagaag gacgcagcaa tgtcgttctc atcgaacacg ccctcactgg agattccaac
360gcagccgatt ggtgggctga cttgctcggt cccggcaaag ccatcaacac tgatatttac
420tgcgtgatct gtaccaacgt catcggtggt tgcaacggtt ccaccggacc tggctccatg
480catccagatg gaaatttctg gggtaatcgc ttccccgcca cgtccattcg tgatcaggta
540aacgccgaaa aacaattcct cgacgcactc ggcatcacca cggtcgccgc agtacttggt
600ggttccatgg gtggtgcccg caccctagag tgggccgcaa tgtacccaga aactgttggc
660gcagctgctg ttcttgcagt ttctgcacgc gccagcgcct ggcaaatcgg cattcaatcc
720gcccaaatta aggcgattga aaacgaccac cactggcacg aaggcaacta ctacgaatcc
780ggctgcaacc cagccaccgg actcggcgcc gcccgacgca tcgcccacct cacctaccgt
840ggcgaactag aaatcgacga acgcttcggc accaaagccc aaaagaacga aaacccactc
900ggtccctacc gcaagcccga ccagcgcttc gccgtggaat cctacttgga ctaccaagca
960gacaagctag tacagcgttt cgacgccggc tcctacgtct tgctcaccga cgccctcaac
1020cgccacgaca ttggtcgcga ccgcggaggc ctcaacaagg cactcgaatc catcaaagtt
1080ccagtccttg tcgcaggcgt agataccgat attttgtacc cctaccacca gcaagaacac
1140ctctccagaa acctgggaaa tctactggca atggcaaaaa tcgtatcccc tgtcggccac
1200gatgctttcc tcaccgaaag ccgccaaatg gatcgcatcg tgaggaactt cttcagcctc
1260atctccccag acgaagacaa cccttcgacc tacatcgagt tctacatcta aactagttcg
1320gacctaggga tatcgtcgac atcgatgctc ttctgcgtta attaacaatt gggatcctct
1380agacccggga tttaaatcgc tagcgggctg ctaaaggaag cggaacacgt agaaagccag
1440tccgcagaaa cggtgctgac cccggatgaa tgtcagctac tgggctatct ggacaaggga
1500aaacgcaagc gcaaagagaa agcaggtagc ttgcagtggg cttacatggc gatagctaga
1560ctgggcggtt ttatggacag caagcgaacc ggaattgcca gctggggcgc cctctggtaa
1620ggttgggaag ccctgcaaag taaactggat ggctttcttg ccgccaagga tctgatggcg
1680caggggatca agatctgatc aagagacagg atgaggatcg tttcgcatga ttgaacaaga
1740tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct atgactgggc
1800acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc aggggcgccc
1860ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg acgaggcagc
1920gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg acgttgtcac
1980tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc tcctgtcatc
2040tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc ggctgcatac
2100gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg agcgagcacg
2160tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc atcaggggct
2220cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg aggatctcgt
2280cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc gcttttctgg
2340attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag cgttggctac
2400ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg tgctttacgg
2460tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg agttcttctg
2520agcgggactc tggggttcga aatgaccgac caagcgacgc ccaacctgcc atcacgagat
2580ttcgattcca ccgccgcctt ctatgaaagg ttgggcttcg gaatcgtttt ccgggacgcc
2640ggctggatga tcctccagcg cggggatctc atgctggagt tcttcgccca cgctagcggc
2700gcgccggccg gcccggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag
2760gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc
2820ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg
2880aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct
2940ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca
3000gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct
3060cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc
3120gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt
3180tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc
3240cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc
3300cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg
3360gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc
3420agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag
3480cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga
3540tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat
3600tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaagg ccggccgcgg
3660ccgcgcaaag tcccgcttcg tgaaaatttt cgtgccgcgt gattttccgc caaaaacttt
3720aacgaacgtt cgttataatg gtgtcatgac cttcacgacg aagtactaaa attggcccga
3780atcatcagct atggatctct ctgatgtcgc gctggagtcc gacgcgctcg atgctgccgt
3840cgatttaaaa acggtgatcg gatttttccg agctctcgat acgacggacg cgccagcatc
3900acgagactgg gccagtgccg cgagcgacct agaaactctc gtggcggatc ttgaggagct
3960ggctgacgag ctgcgtgctc ggccagcgcc aggaggacgc acagtagtgg aggatgcaat
4020cagttgcgcc tactgcggtg gcctgattcc tccccggcct gacccgcgag gacggcgcgc
4080aaaatattgc tcagatgcgt gtcgtgccgc agccagccgc gagcgcgcca acaaacgcca
4140cgccgaggag ctggaggcgg ctaggtcgca aatggcgctg gaagtgcgtc ccccgagcga
4200aattttggcc atggtcgtca cagagctgga agcggcagcg agaattatcg cgatcgtggc
4260ggtgcccgca ggcatgacaa acatcgtaaa tgccgcgttt cgtgtgccgt ggccgcccag
4320gacgtgtcag cgccgccacc acctgcaccg aatcggcagc agcgtcgcgc gtcgaaaaag
4380cgcacaggcg gcaagaagcg ataagctgca cgaatacctg aaaaatgttg aacgccccgt
4440gagcggtaac tcacagggcg tcggctaacc cccagtccaa acctgggaga aagcgctcaa
4500aaatgactct agcggattca cgagacattg acacaccggc ctggaaattt tccgctgatc
4560tgttcgacac ccatcccgag ctcgcgctgc gatcacgtgg ctggacgagc gaagaccgcc
4620gcgaattcct cgctcacctg ggcagagaaa atttccaggg cagcaagacc cgcgacttcg
4680ccagcgcttg gatcaaagac ccggacacgg agaaacacag ccgaagttat accgagttgg
4740ttcaaaatcg cttgcccggt gccagtatgt tgctctgacg cacgcgcagc acgcagccgt
4800gcttgtcctg gacattgatg tgccgagcca ccaggccggc gggaaaatcg agcacgtaaa
4860ccccgaggtc tacgcgattt tggagcgctg ggcacgcctg gaaaaagcgc cagcttggat
4920cggcgtgaat ccactgagcg ggaaatgcca gctcatctgg ctcattgatc cggtgtatgc
4980cgcagcaggc atgagcagcc cgaatatgcg cctgctggct gcaacgaccg aggaaatgac
5040ccgcgttttc ggcgctgacc aggctttttc acataggctg agccgtggcc actgcactct
5100ccgacgatcc cagccgtacc gctggcatgc ccagcacaat cgcgtggatc gcctagctga
5160tcttatggag gttgctcgca tgatctcagg cacagaaaaa cctaaaaaac gctatgagca
5220ggagttttct agcggacggg cacgtatcga agcggcaaga aaagccactg cggaagcaaa
5280agcacttgcc acgcttgaag caagcctgcc gagcgccgct gaagcgtctg gagagctgat
5340cgacggcgtc cgtgtcctct ggactgctcc agggcgtgcc gcccgtgatg agacggcttt
5400tcgccacgct ttgactgtgg gataccagtt aaaagcggct ggtgagcgcc taaaagacac
5460caagggtcat cgagcctacg agcgtgccta caccgtcgct caggcggtcg gaggaggccg
5520tgagcctgat ctgccgccgg actgtgaccg ccagacggat tggccgcgac gtgtgcgcgg
5580ctacgtcgct aaaggccagc cagtcgtccc tgctcgtcag acagagacgc agagccagcc
5640gaggcgaaaa gctctggcca ctatgggaag acgtggcggt aaaaaggccg cagaacgctg
5700gaaagaccca aacagtgagt acgcccgagc acagcgagaa aaactagcta agtccagtca
5760acgacaagct aggaaagcta aaggaaatcg cttgaccatt gcaggttggt ttatgactgt
5820tgagggagag actggctcgt ggccgacaat caatgaagct atgtctgaat ttagcgtgtc
5880acgtcagacc gtgaatagag cacttaaggt ctgcgggcat tgaacttcca cgaggacgcc
5940gaaagcttcc cagtaaatgt gccatctcgt aggcagaaaa cggttccccc gtagggtctc
6000tctcttggcc tcctttctag gtcgggctga ttgctcttga agctctctag gggggctcac
6060accataggca gataacgttc cccaccggct cgcctcgtaa gcgcacaagg actgctccca
6120aagatcttca aagccactgc cgcgactgcc ttcgcgaagc cttgccccgc ggaaatttcc
6180tccaccgagt tcgtgcacac ccctatgcca agcttctttc accctaaatt cgagagattg
6240gattcttacc gtggaaattc ttcgcaaaaa tcgtcccctg atcgcccttg cgacgttggc
6300gtcggtgccg ctggttgcgc ttggcttgac cgacttgatc agcggccgc
63493529DNACorynebacterium glutamicum 35gagactcgag agctgccaat tattccggg
293641DNACorynebacterium glutamicum
36cctgaaggcg cgagggtggg catgggtaaa aaatcctttc g
413719DNACorynebacterium glutamicum 37cccaccctcg cgccttcag
193818DNACorynebacterium glutamicum
38ctgggtacat tgcggccc
18396386DNACorynebacterium glutamicummisc_feature(1)..(6386)PCLIK5MCS
39tcgagagctg ccaattattc cgggcttgtg acccgctacc cgataaatag gtcggctgaa
60aaatttcgtt gcaatatcaa caaaaaggcc tatcattggg aggtgtcgca ccaagtactt
120ttgcgaagcg ccatctgacg gattttcaaa agatgtatat gctcggtgcg gaaacctacg
180aaaggatttt ttacccatgc ccaccctcgc gccttcaggt caacttgaaa tccaagcgat
240cggtgatgtc tccaccgaag ccggagcaat cattacaaac gctgaaatcg cctatcaccg
300ctggggtgaa taccgcgtag ataaagaagg acgcagcaat gtcgttctca tcgaacacgc
360cctcactgga gattccaacg cagccgattg gtgggctgac ttgctcggtc ccggcaaagc
420catcaacact gatatttact gcgtgatctg taccaacgtc atcggtggtt gcaacggttc
480caccggacct ggctccatgc atccagatgg aaatttctgg ggtaatcgct tccccgccac
540gtccattcgt gatcaggtaa acgccgaaaa acaattcctc gacgcactcg gcatcaccac
600ggtcgccgca gtacttggtg gttccatggg tggtgcccgc accctagagt gggccgcaat
660gtacccagaa actgttggcg cagctgctgt tcttgcagtt tctgcacgcg ccagcgcctg
720gcaaatcggc attcaatccg cccaaattaa ggcgattgaa aacgaccacc actggcacga
780aggcaactac tacgaatccg gctgcaaccc agccaccgga ctcggcgccg cccgacgcat
840cgcccacctc acctaccgtg gcgaactaga aatcgacgaa cgcttcggca ccaaagccca
900aaagaacgaa aacccactcg gtccctaccg caagcccgac cagcgcttcg ccgtggaatc
960ctacttggac taccaagcag acaagctagt acagcgtttc gacgccggct cctacgtctt
1020gctcaccgac gccctcaacc gccacgacat tggtcgcgac cgcggaggcc tcaacaaggc
1080actcgaatcc atcaaagttc cagtccttgt cgcaggcgta gataccgata ttttgtaccc
1140ctaccaccag caagaacacc tctccagaaa cctgggaaat ctactggcaa tggcaaaaat
1200cgtatcccct gtcggccacg atgctttcct caccgaaagc cgccaaatgg atcgcatcgt
1260gaggaacttc ttcagcctca tctccccaga cgaagacaac ccttcgacct acatcgagtt
1320ctacatctaa catatgacta gttcggacct agggatatcg tcgacatcga tgctcttctg
1380cgttaattaa caattgggat cctctagacc cgggatttaa atcgctagcg ggctgctaaa
1440ggaagcggaa cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg atgaatgtca
1500gctactgggc tatctggaca agggaaaacg caagcgcaaa gagaaagcag gtagcttgca
1560gtgggcttac atggcgatag ctagactggg cggttttatg gacagcaagc gaaccggaat
1620tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac tggatggctt
1680tcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag acaggatgag
1740gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg
1800agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat gccgccgtgt
1860tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg tccggtgccc
1920tgaatgaact gcaggacgag gcagcgcggc tatcgtggct ggccacgacg ggcgttcctt
1980gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta ttgggcgaag
2040tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta tccatcatgg
2100ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc gaccaccaag
2160cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatg
2220atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg ctcaaggcgc
2280gcatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg ccgaatatca
2340tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt gtggcggacc
2400gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc ggcgaatggg
2460ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc atcgccttct
2520atcgccttct tgacgagttc ttctgagcgg gactctgggg ttcgaaatga ccgaccaagc
2580gacgcccaac ctgccatcac gagatttcga ttccaccgcc gccttctatg aaaggttggg
2640cttcggaatc gttttccggg acgccggctg gatgatcctc cagcgcgggg atctcatgct
2700ggagttcttc gcccacgcta gcggcgcgcc ggccggcccg gtgtgaaata ccgcacagat
2760gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc
2820gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat
2880ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca
2940ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc
3000atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc
3060aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg
3120gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta
3180ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg
3240ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac
3300acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag
3360gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat
3420ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat
3480ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc
3540gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt
3600ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct
3660agatcctttt aaaggccggc cgcggccgcg caaagtcccg cttcgtgaaa attttcgtgc
3720cgcgtgattt tccgccaaaa actttaacga acgttcgtta taatggtgtc atgaccttca
3780cgacgaagta ctaaaattgg cccgaatcat cagctatgga tctctctgat gtcgcgctgg
3840agtccgacgc gctcgatgct gccgtcgatt taaaaacggt gatcggattt ttccgagctc
3900tcgatacgac ggacgcgcca gcatcacgag actgggccag tgccgcgagc gacctagaaa
3960ctctcgtggc ggatcttgag gagctggctg acgagctgcg tgctcggcca gcgccaggag
4020gacgcacagt agtggaggat gcaatcagtt gcgcctactg cggtggcctg attcctcccc
4080ggcctgaccc gcgaggacgg cgcgcaaaat attgctcaga tgcgtgtcgt gccgcagcca
4140gccgcgagcg cgccaacaaa cgccacgccg aggagctgga ggcggctagg tcgcaaatgg
4200cgctggaagt gcgtcccccg agcgaaattt tggccatggt cgtcacagag ctggaagcgg
4260cagcgagaat tatcgcgatc gtggcggtgc ccgcaggcat gacaaacatc gtaaatgccg
4320cgtttcgtgt gccgtggccg cccaggacgt gtcagcgccg ccaccacctg caccgaatcg
4380gcagcagcgt cgcgcgtcga aaaagcgcac aggcggcaag aagcgataag ctgcacgaat
4440acctgaaaaa tgttgaacgc cccgtgagcg gtaactcaca gggcgtcggc taacccccag
4500tccaaacctg ggagaaagcg ctcaaaaatg actctagcgg attcacgaga cattgacaca
4560ccggcctgga aattttccgc tgatctgttc gacacccatc ccgagctcgc gctgcgatca
4620cgtggctgga cgagcgaaga ccgccgcgaa ttcctcgctc acctgggcag agaaaatttc
4680cagggcagca agacccgcga cttcgccagc gcttggatca aagacccgga cacggagaaa
4740cacagccgaa gttataccga gttggttcaa aatcgcttgc ccggtgccag tatgttgctc
4800tgacgcacgc gcagcacgca gccgtgcttg tcctggacat tgatgtgccg agccaccagg
4860ccggcgggaa aatcgagcac gtaaaccccg aggtctacgc gattttggag cgctgggcac
4920gcctggaaaa agcgccagct tggatcggcg tgaatccact gagcgggaaa tgccagctca
4980tctggctcat tgatccggtg tatgccgcag caggcatgag cagcccgaat atgcgcctgc
5040tggctgcaac gaccgaggaa atgacccgcg ttttcggcgc tgaccaggct ttttcacata
5100ggctgagccg tggccactgc actctccgac gatcccagcc gtaccgctgg catgcccagc
5160acaatcgcgt ggatcgccta gctgatctta tggaggttgc tcgcatgatc tcaggcacag
5220aaaaacctaa aaaacgctat gagcaggagt tttctagcgg acgggcacgt atcgaagcgg
5280caagaaaagc cactgcggaa gcaaaagcac ttgccacgct tgaagcaagc ctgccgagcg
5340ccgctgaagc gtctggagag ctgatcgacg gcgtccgtgt cctctggact gctccagggc
5400gtgccgcccg tgatgagacg gcttttcgcc acgctttgac tgtgggatac cagttaaaag
5460cggctggtga gcgcctaaaa gacaccaagg gtcatcgagc ctacgagcgt gcctacaccg
5520tcgctcaggc ggtcggagga ggccgtgagc ctgatctgcc gccggactgt gaccgccaga
5580cggattggcc gcgacgtgtg cgcggctacg tcgctaaagg ccagccagtc gtccctgctc
5640gtcagacaga gacgcagagc cagccgaggc gaaaagctct ggccactatg ggaagacgtg
5700gcggtaaaaa ggccgcagaa cgctggaaag acccaaacag tgagtacgcc cgagcacagc
5760gagaaaaact agctaagtcc agtcaacgac aagctaggaa agctaaagga aatcgcttga
5820ccattgcagg ttggtttatg actgttgagg gagagactgg ctcgtggccg acaatcaatg
5880aagctatgtc tgaatttagc gtgtcacgtc agaccgtgaa tagagcactt aaggtctgcg
5940ggcattgaac ttccacgagg acgccgaaag cttcccagta aatgtgccat ctcgtaggca
6000gaaaacggtt cccccgtagg gtctctctct tggcctcctt tctaggtcgg gctgattgct
6060cttgaagctc tctagggggg ctcacaccat aggcagataa cgttccccac cggctcgcct
6120cgtaagcgca caaggactgc tcccaaagat cttcaaagcc actgccgcga ctgccttcgc
6180gaagccttgc cccgcggaaa tttcctccac cgagttcgtg cacaccccta tgccaagctt
6240ctttcaccct aaattcgaga gattggattc ttaccgtgga aattcttcgc aaaaatcgtc
6300ccctgatcgc ccttgcgacg ttggcgtcgg tgccgctggt tgcgcttggc ttgaccgact
6360tgatcagcgg ccgctcgatt taaatc
6386401005DNACorynebacterium
glutamicummisc_feature(1)..(1005)FRUCTOSE-1,6-BISPHOSPHATASE 40atgaacctaa
agaaccccga aacgccagac cgtaaccttg ctatggagct ggtgcgagtt 60acggaagcag
ctgcactggc ttctggacgt tgggttggac gtggcatgaa gaatgaaggc 120gacggtgccg
ctgttgacgc catgcgccag ctcatcaact cagtgaccat gaagggcgtc 180gttgttatcg
gcgagggcga aaaagacgaa gctccaatgc tgtacaacgg cgaagaggtc 240ggaaccggct
ttggacctga ggttgatatc gcagttgacc cagttgacgg caccaccctg 300atggctgagg
gtcgccccaa cgcaatttcc attctcgcag ctgcagagcg tggcaccatg 360tacgatccat
cctccgtctt ctacatgaag aagatcgccg tgggacctga ggccgcaggc 420aagatcgaca
tcgaagctcc agttgcccac aacatcaacg cggtggcaaa gtccaaggga 480atcaaccctt
ccgacgtcac cgttgtcgtg cttgaccgtc ctcgccacat cgaactgatc 540gcagacattc
gtcgtgcagg cgcaaaggtt cgtctcatct ccgacggcga cgttgcaggt 600gcagttgcag
cagctcagga ttccaactcc gtggacatca tgatgggcac cggcggaacc 660ccagaaggca
tcatcactgc gtgcgccatg aagtgcatgg gtggcgaaat ccagggcatc 720ctggccccaa
tgaacgattt cgagcgccag aaggcacacg acgctggtct ggttcttgat 780caggttctgc
acaccaacga tctggtgagc tccgacaact gctacttcgt ggcaaccggt 840gtgaccaacg
gtgacatgct ccgtggcgtt tcctaccgcg caaacggcgc aaccacccgt 900tccctggtta
tgcgcgcaaa gtcaggcacc atccgccaca tcgagtctgt ccaccagctg 960tccaagctgc
aggaatactc cgtggttgac tacaccaccg cgacc
100541335PRTCorynebacterium glutamicum 41Met Asn Leu Lys Asn Pro Glu Thr
Pro Asp Arg Asn Leu Ala Met Glu1 5 10
15Leu Val Arg Val Thr Glu Ala Ala Ala Leu Ala Ser Gly Arg
Trp Val 20 25 30Gly Arg Gly
Met Lys Asn Glu Gly Asp Gly Ala Ala Val Asp Ala Met 35
40 45Arg Gln Leu Ile Asn Ser Val Thr Met Lys Gly
Val Val Val Ile Gly 50 55 60Glu Gly
Glu Lys Asp Glu Ala Pro Met Leu Tyr Asn Gly Glu Glu Val65
70 75 80Gly Thr Gly Phe Gly Pro Glu
Val Asp Ile Ala Val Asp Pro Val Asp 85 90
95Gly Thr Thr Leu Met Ala Glu Gly Arg Pro Asn Ala Ile
Ser Ile Leu 100 105 110Ala Ala
Ala Glu Arg Gly Thr Met Tyr Asp Pro Ser Ser Val Phe Tyr 115
120 125Met Lys Lys Ile Ala Val Gly Pro Glu Ala
Ala Gly Lys Ile Asp Ile 130 135 140Glu
Ala Pro Val Ala His Asn Ile Asn Ala Val Ala Lys Ser Lys Gly145
150 155 160Ile Asn Pro Ser Asp Val
Thr Val Val Val Leu Asp Arg Pro Arg His 165
170 175Ile Glu Leu Ile Ala Asp Ile Arg Arg Ala Gly Ala
Lys Val Arg Leu 180 185 190Ile
Ser Asp Gly Asp Val Ala Gly Ala Val Ala Ala Ala Gln Asp Ser 195
200 205Asn Ser Val Asp Ile Met Met Gly Thr
Gly Gly Thr Pro Glu Gly Ile 210 215
220Ile Thr Ala Cys Ala Met Lys Cys Met Gly Gly Glu Ile Gln Gly Ile225
230 235 240Leu Ala Pro Met
Asn Asp Phe Glu Arg Gln Lys Ala His Asp Ala Gly 245
250 255Leu Val Leu Asp Gln Val Leu His Thr Asn
Asp Leu Val Ser Ser Asp 260 265
270Asn Cys Tyr Phe Val Ala Thr Gly Val Thr Asn Gly Asp Met Leu Arg
275 280 285Gly Val Ser Tyr Arg Ala Asn
Gly Ala Thr Thr Arg Ser Leu Val Met 290 295
300Arg Ala Lys Ser Gly Thr Ile Arg His Ile Glu Ser Val His Gln
Leu305 310 315 320Ser Lys
Leu Gln Glu Tyr Ser Val Val Asp Tyr Thr Thr Ala Thr 325
330 335426DNACorynebacterium
glutamicummisc_feature(1)..(6)POTENTIELLE_-10-REGION_1 42tgcaat
6437DNACorynebacterium
glutamicummisc_feature(1)..(7)POTENTIELLE_-10-REGION_2 43tatcatt
7447DNACorynebacterium
glutamicummisc_feature(1)..(7)RIBOSOMALE_BINDUNGSSTELLE\SHINE-DALGARNO
44gaaagga
7
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: