Patent application title: POLYNUCLEOTIDES AND POLYPEPTIDES ASSOCIATED WITH THE DEVELOPMENT OF RHEUMATOID ARTHRITIS
Inventors:
Julie Carman (Lawrenceville, NJ, US)
Steven G. Nadler (Princeton, NJ, US)
Steven G. Nadler (Princeton, NJ, US)
Michael Bowen (Rockville, MD, US)
Michael G. Neubauer (Skillman, NJ, US)
Pin Lu (Princeton Jct., NJ, US)
IPC8 Class: AA61K39395FI
USPC Class:
4241331
Class name: Drug, bio-affecting and body treating compositions immunoglobulin, antiserum, antibody, or antibody fragment, except conjugate or complex of the same with nonimmunoglobulin material structurally-modified antibody, immunoglobulin, or fragment thereof (e.g., chimeric, humanized, cdr-grafted, mutated, etc.)
Publication date: 2010-05-13
Patent application number: 20100119509
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: POLYNUCLEOTIDES AND POLYPEPTIDES ASSOCIATED WITH THE DEVELOPMENT OF RHEUMATOID ARTHRITIS
Inventors:
Michael Bowen
Julie Carman
Steven G. Nadler
Michael G. Neubauer
Pin Lu
Agents:
LOUIS J. WILLE;BRISTOL-MYERS SQUIBB COMPANY
Assignees:
Bristol-Myers Squibb Company
Origin: PRINCETON, NJ US
IPC8 Class: AA61K39395FI
USPC Class:
4241331
Publication date: 05/13/2010
Patent application number: 20100119509
Abstract:
The present invention is directed to polynucleotides encoding polypeptides
associated with the development of rheumatoid arthritis and homologs
thereof. The invention further relates to diagnostic and therapeutic
methods for utilizing these polynucleotides and polypeptides in the
diagnosis, treatment, and/or prevention of rheumatoid arthritis and
related disease states. The invention further relates to screening
methods for identifying agonists and antagonists of the polynucleotides
and polypeptides of the present invention, and compounds identified
thereby.Claims:
1. An assay for identifying a compound that modulates the activity of a
gene associated with rheumatoid arthritis, comprising:(a) providing a
cell expressing a gene associated with rheumatoid arthritis, wherein the
nucleic acid sequence of said gene associated with rheumatoid arthritis
is at least 95% identical to a nucleic acid sequence selected from the
group consisting of SEQ ID NO:41 and SEQ ID NO:61,(b) contacting said
cell expressing said gene associated with rheumatoid arthritis with a
test compound; and(c) determining whether said test compound modulates
the activity of said gene associated with rheumatoid arthritis.
2. The assay of claim 1, wherein said assay is a cell-based assay.
3. The assay of claim 1, wherein said assay is a cell-free assay.
4. The assay of claim 3, wherein said cell-free assay is a ligand-binding assay.
5. The assay of claim 1, wherein said test compound modulates the activity of said gene associated with rheumatoid arthritis.
6. The assay of claim 1, wherein said test compound is an antagonist of a gene associated with rheumatoid arthritis.
7. The assay of claim 1, wherein said test compound is an agonist of a gene associated with rheumatoid arthritis.
8. The assay of claim 1, wherein said test compound binds to said gene associated with rheumatoid arthritis.
9. The assay of claim 1, wherein said assay is useful for identifying compounds which are useful for the treatment of rheumatoid arthritis.
10. A method for the treatment of rheumatoid arthritis, comprising:(a) identifying a patient suffering from rheumatoid arthritis; and(b) administering to said patient a therapeutically effective amount of a modulator of a gene associated with rheumatoid arthritis,wherein said gene associated with rheumatoid arthritis has a nucleic acid sequence which is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:61.
11. The method of claim 10, wherein said patient is identified as suffering from rheumatoid arthritis by measuring the expression level of said gene associated with rheumatoid arthritis in said patient.
12. The method of claim 10, wherein said modulator is an antagonist of a gene associated with rheumatoid arthritis.
13. A method for the treatment of rheumatoid arthritis, comprising:(a) identifying a patient suffering from rheumatoid arthritis; and(b) administering to said patient suffering from rheumatoid arthritis a therapeutically effective amount of a modulator of a polypeptide associated with rheumatoid arthritis,wherein said polypeptide associated with rheumatoid arthritis has an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:62.
14. The method of claim 13, wherein said patient is identified as suffering from rheumatoid arthritis by measuring the expression level of said polypeptide associated with rheumatoid arthritis.
15. The method of claim 13, wherein said modulator is an antagonist of a polypeptide associated with rheumatoid arthritis.
16. A method for the prevention of rheumatoid arthritis, comprising:(a) identifying a patient at risk for rheumatoid arthritis; and(b) administering to said patient at risk for rheumatoid arthritis a therapeutically effective amount of a modulator of a gene associated with rheumatoid arthritis,wherein said gene associated with rheumatoid arthritis has a nucleic acid sequence which is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:61.
17. The method of claim 16, wherein said patient is identified as being at risk for rheumatoid arthritis by measuring the expression level of said gene associated with rheumatoid arthritis in said patient.
18. The method of claim 16, wherein said modulator is an antagonist of said gene associated with rheumatoid arthritis.
19. A method for the prevention of rheumatoid arthritis, comprising:(a) identifying a patient at risk for rheumatoid arthritis; and(b) administering to said patient at risk for rheumatoid arthritis a therapeutically effective amount of a modulator of a polypeptide associated with rheumatoid arthritis,wherein said polypeptide associated with rheumatoid arthritis has an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:62.
20. The method of claim 19, wherein said patient is identified as being at risk for rheumatoid arthritis by measuring the expression level of said polypeptide associated with rheumatoid arthritis in said patient.
21. The method of claim 19, wherein said modulator is an antagonist of said polypeptide associated with rheumatoid arthritis.
22. A compound useful for the treatment of rheumatoid arthritis, wherein said compound is identified by:(a) providing a cell expressing a gene associated with rheumatoid arthritis, wherein said gene associated with rheumatoid arthritis has a nucleic acid sequence which is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:61;(b) contacting said cell expressing said gene associated with rheumatoid arthritis with said compound; and(c) determining whether said compound modulates the activity of said gene associated with rheumatoid arthritis.
23. The compound of claim 22, wherein said compound is an antagonist of said gene associated with rheumatoid arthritis.
24. The compound of claim 22, wherein said compound is an agonist of said gene associated with rheumatoid arthritis.
25. A compound useful for the treatment of rheumatoid arthritis, wherein said compound is identified by:(a) providing a cell expressing a polypeptide associated with rheumatoid arthritis,wherein said polypeptide associated with rheumatoid arthritis has an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:62;(b) contacting said cell expressing said polypeptide associated with rheumatoid arthritis with said compound; and(c) determining whether said compound modulates the activity of said polypeptide associated with rheumatoid arthritis.
26. The compound of claim 25, wherein said compound is an antagonist of said polypeptide associated with rheumatoid arthritis.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001]This application is a divisional of U.S. application Ser. No. 11/811,442, filed Jun. 7, 2007, now allowed, which is a divisional of U.S. application Ser. No. 10/308,279 filed Dec. 3, 2002, issued as U.S. Pat. No. 7,244,573, which claims priority to U.S. Provisional Patent Application No. 60/337,429, filed Dec. 3, 2001, and hereby expressly incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002]The present invention provides polynucleotides encoding polypeptides associated with the development and progression of rheumatoid arthritis and homologs thereof. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing said polypeptides. The invention further relates to diagnostic and therapeutic methods for utilizing these polypeptides in the diagnosis, treatment, and/or prevention of rheumatoid arthritis and related disease states. The invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the present invention.
BACKGROUND OF RELATED TECHNOLOGY
[0003]Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by progressive joint destruction. Initial destruction of cartilage and bone is associated with the formation of a pannus, consisting of a hypertrophic synovial membrane containing hyperplastic synoviocytes and an infiltrate of inflammatory cells including T cells, B cells, CD68+ macrophages, mast cells, and endothelial cells. The causes of RA are not well understood. Genetic studies have linked expression of specific major histocompatibility complex class II antigens to the development of RA, suggesting the involvement of antigen-specific mechanisms in disease progression (Zanelli et al., Hum. Immunol. 61:1254-1261 (2000)).
[0004]CD4+ T cells are thought to play a key role in initiation and progression of disease. Although many putative self antigens have been proposed, none have been definitively associated with the initiation of disease. Antigen-activated T cells stimulate monocytes, macrophages, and synovial fibroblasts to secrete pro-inflammatory cytokines including interleukin-1 (IL-1), interleukin-6 (IL-6), and TNF-α. These cytokines stimulate synovial fibroblasts, osteoclasts, and chondrocytes to release matrix metalloproteinases (MMPs) that destroy surrounding tissue. Activated CD4+ T cells stimulate osteoclastogenesis that can also contribute to joint damage. The activated T cells also stimulate B cells present in the synovium via the CD40 pathway to differentiate into antibody secreting cells producing rheumatoid factor, which may also contribute to disease pathology.
[0005]Many of the cytokines found in rheumatoid synovium have been directly linked to disease pathology. For example, TNF-α promotes inflammation by inducing secretion of other inflammatory cytokines including IL-1, IL-6, IL-8, GM-CSF, as well as by upregulating adhesion molecule expression on endothelial cells and synovial fibroblasts. These two events promote increased migration of lymphocytes including neutrophils, monocytes, and T cells into the synovium. Neutrophils release elastase and proteases that degrade proteoglycan and contribute to joint destruction. Therapies targeting TNF-α include the use of soluble TNF-α receptor (Etanercept) and neutralizing antibodies specific for TNF-α (Infliximab), and result in a significant decrease in the number of swollen joints, as well as the numbers of T cells and plasma cells in the synovium of RA patients. Such therapies also result in a decrease in the expression of VCAM-1 and IL-1 in the synovium of treated patients (Bathon, et al., New Engl. J. Med. 343:1586-1593 (2000); Lipsky, et al., New Engl. J. Med. 343:1594-1602 (2000); Richard-Miceli, et al., Biodrugs 15:251-259 (2001)).
[0006]IL-1 has also been closely linked to the pathophysiology of RA. IL-1 induces synovial cell proliferation and activates MMP and prostaglandin production in vitro (Mizel et al., Proc. Natl. Acad. Sci. USA 78:2474-2477 (1981)). In several mouse models of arthritis, IL-1 is believed to play a dominant role in cartilage destruction, whereas TNF-α is primarily proinflammatory (Joosten et al., J. Immunol. 163:5049-5055 (1999)). Transgenic mice constitutively expressing human IL-1α in various organs develop a severe polyarthritic phenotype with a predominance of neutrophils and macrophages in the diseased joints (Niki et al., J. Clin. Invest. 107:1127-1135 (2001)). Synovitis developed within two weeks of birth, followed by pannus formation and cartilage destruction within 8 weeks after birth. Treatment of RA patients with a natural inhibitor of IL-1, recombinant human IL-1 receptor antagonist (IL-1Ra), significantly reduced clinical symptoms and the rate of progressive joint damage (Jiang et al., Arthritis Rheum. 43:1001-1009 (2000); Bresnihan et al., Biodrugs 15:87-97 (2001)).
[0007]A number of studies have sought to identify genes whose expression is associated with the development of RA. cDNA microarrays have been used to compare expression profiles between tissue samples derived from RA and inflammatory bowel disease patients. Such studies have found that prominently upregulated genes in RA samples include: IL-6; the MMPs stromelysin-1, collagenase-1, gelatinase A, and human matrix metallo-elastase; tissue inhibitors of metalloproteinases, including TIMP-1 and TIMP-3; the adhesion molecule VCAM-1; and chemokines including MCP-1, MIF, and RANTES (Heller et al. Proc. Natl. Acad. Sci. USA 94: 2150-2155 (1997)). Further, a cDNA library has been generated from monocytes obtained from a RA patient with active disease (Stuhlmuller et al., Arthritis Rheum. 43:775-790 (2000)). Genes found to be upregulated in these cells include IL-1α, IL-1β, IL-6, TNF-α, growth-related oncogene α, macrophage inflammatory protein 2, ferritin, α1-antitrypsin, lysozyme, transaldolase, Epstein-Barr virus-encoded RNA 1-associated protein, thrombospondin 1, angiotensin receptor II C-terminal homologue, and RNA polymerase II elongation factor.
[0008]In one study, a cDNA library was generated by subtracting cDNA derived from noninflammatory osteoarthritis (OA) synoviocytes from cDNA derived from cultured RA fibroblastoid synoviocytes (Seki et al., Arthritis Rheum. 41:1356-1364 (1998)). Genes found to be constitutively overexpressed in the rheumatoid synoviocyte line include: chemokine stromal cell-derived factor 1α; adhesion molecule VCAM-1; interferon-inducible 56-kD protein; 2'-5'-oligoadenylate synthetase; Mac-2 binding protein; extracellular matrix components biglycan, lumican, and IGFBP5; and semaphorin VI.
[0009]Studies have also been conducted using suppression subtractive hybridization to identify genes that are highly expressed in RA synovium relative to OA synovium (Justen et al., Mol. Cell. Biol. Res. Comm. 3:165-172 (2000)). Genes found to be specifically upregulated in RA synovium include: cytoskeletal γ-actin; the extracellular matrix components fibronectin and collagen IIIα1; superficial zone protein; elongation factor α1; granulin precursor; interferon-γ inducible lysosomal thiol reductase; the protease cathepsin B; phospholipase A2 group IIA; and annexin II.
[0010]Accordingly, there is a continuing need to identify genes whose expression is associated with the development and progression of RA. The identification of such genes permits the development of clones expressing such genes, thereby permitting the identification of compounds capable of modulating the activity of such genes and/or their expression products. Such compounds may have therapeutic utility in the diagnosis and/or treatment of RA and related disease states. The present invention is directed to meeting these and other needs.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]FIGS. 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 69, 71, 74, 76, 79, 82 and 85 show microarray data for genes of the present invention shown to be upregulated and downregulated in rheumatoid arthritis synovial fluid.
[0012]FIGS. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 68, 70, 72, 75, 77, 80, 83 and 86 show polynucleotide sequences for genes of the present invention shown to be upregulated and downregulated in rheumatoid arthritis synovial fluid.
[0013]FIGS. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 73, 78, 81, 84 and 87 show amino acid sequences for the expression product of genes of the present invention shown to be upregulated and downregulated in rheumatoid arthritis synovial fluid.
[0014]FIG. 88 shows the regulation of GBP-1 and GBP-5 expression by NFkB.
[0015]FIG. 89 shows the time course of GBP-1 and GBP-5 expression.
[0016]FIG. 90 shows GBP-1 and GBP-5 expression in mouse embryonic fibroblast lines derived from NFkB and IkBα germline knockouts.
[0017]FIG. 91 shows tissue expression patterns of GBP-1 and GBP-5.
[0018]FIG. 92 shows expression of GBP-1 and GBP-5 in resting and stimulated THP-1 monocytes.
[0019]FIG. 93 shows expression of GBP-1 and GBP-5 in resting and stimulated human microvascular endothelial cells.
[0020]FIG. 94 shows expression of GBP-1 and GBP-5 in resting and stimulated fibroblasts derived from rheumatoid arthritis synovium.
[0021]FIG. 95 shows expression of GBP-1 and GBP-5 in resting and stimulated peripheral blood T cells.
SUMMARY OF THE INVENTION
[0022]In one aspect, the present invention is directed to an assay for identifying a compound that modulates the activity of a gene associated with rheumatoid arthritis, including the steps of: (1) providing a cell expressing a gene associated with rheumatoid arthritis, wherein the nucleic acid sequence of the gene associated with rheumatoid arthritis is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:73, and SEQ ID NO:74; (2) contacting the cell expressing the gene associated with rheumatoid arthritis with a test compound; and (3) determining whether the test compound modulates the activity of the gene associated with rheumatoid arthritis. The assay may be cell-based assay or may be a cell-free assay, such as a ligand-binding assay. The test compound desirably modulates the activity of the gene associated with rheumatoid arthritis, may be an antagonist or an agonist of the gene associated with rheumatoid arthritis, and may bind to the gene associated with rheumatoid arthritis. The assay is desirably useful for identifying compounds which are useful for the treatment of rheumatoid arthritis.
[0023]In another aspect, the present invention is directed to an assay for identifying a compound that modulates the activity of a protein associated with rheumatoid arthritis, including the steps of: (1) providing a cell expressing a gene associated with rheumatoid arthritis, wherein the gene encodes a polypeptide having an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:72, and SEQ ID NO:75; (2) contacting the cell expressing the gene associated with rheumatoid arthritis with a test compound; and (3) determining whether the test compound modulates the activity of the protein associated with rheumatoid arthritis. The test compound desirably modulates the activity of the protein associated with rheumatoid arthritis, may be an antagonist or an agonist of the protein associated with rheumatoid arthritis, and may bind to the protein associated with rheumatoid arthritis. The assay is desirably useful for identifying compounds which are useful for the treatment of rheumatoid arthritis.
[0024]In another aspect, the present invention is directed to a method for the treatment of rheumatoid arthritis, including the steps of: (1) identifying a patient suffering from rheumatoid arthritis; and (2) administering to the patient a therapeutically effective amount of a modulator of a gene associated with rheumatoid arthritis, wherein the gene associated with rheumatoid arthritis has a nucleic acid sequence which is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:73, and SEQ ID NO:74. The patient is desirably identified as suffering from rheumatoid arthritis by measuring the expression level of the gene associated with rheumatoid arthritis in the patient. The modulator is desirably an antagonist of a gene associated with rheumatoid arthritis.
[0025]In another aspect, the present invention is directed to a method for the treatment of rheumatoid arthritis, including the steps of: (1) identifying a patient suffering from rheumatoid arthritis; and (2) administering to the patient suffering from rheumatoid arthritis a therapeutically effective amount of a modulator of a polypeptide associated with rheumatoid arthritis, wherein the polypeptide associated with rheumatoid arthritis has an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:72, and SEQ ID NO:75. The patient is desirably identified as suffering from rheumatoid arthritis by measuring the expression level of the polypeptide associated with rheumatoid arthritis. The modulator is desirably an antagonist of a polypeptide associated with rheumatoid arthritis.
[0026]In another aspect, the present invention is directed to a method for the prevention of rheumatoid arthritis, including the steps of: (1) identifying a patient at risk for rheumatoid arthritis; and (2) administering to the patient at risk for rheumatoid arthritis a therapeutically effective amount of a modulator of a gene associated with rheumatoid arthritis, wherein the gene associated with rheumatoid arthritis has a nucleic acid sequence which is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:73, and SEQ ID NO:74. The patient is desirably identified as being at risk for rheumatoid arthritis by measuring the expression level of the gene associated with rheumatoid arthritis in the patient.
[0027]In another aspect, the present invention is directed to a method for the prevention of rheumatoid arthritis, including the steps of: (1) identifying a patient at risk for rheumatoid arthritis; and (2) administering to the patient at risk for rheumatoid arthritis a therapeutically effective amount of a modulator of a polypeptide associated with rheumatoid arthritis, wherein the polypeptide associated with rheumatoid arthritis has an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:72, and SEQ ID NO:75. The patient is desirably identified as being at risk for rheumatoid arthritis by measuring the expression level of the polypeptide associated with rheumatoid arthritis in the patient.
[0028]In another aspect, the present invention is directed to a compound useful for the treatment of rheumatoid arthritis, wherein the compound is identified by: (1) providing a cell expressing a gene associated with rheumatoid arthritis, wherein the gene associated with rheumatoid arthritis has a nucleic acid sequence which is at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:73, and SEQ ID NO:74; (2) contacting the cell expressing the gene associated with rheumatoid arthritis with the compound; and (3) determining whether the compound modulates the activity of the gene associated with rheumatoid arthritis.
[0029]In another aspect, the present invention is directed to a compound useful for the treatment of rheumatoid arthritis, wherein the compound is identified by: (1) providing a cell expressing a polypeptide associated with rheumatoid arthritis, wherein the polypeptide associated with rheumatoid arthritis has an amino acid sequence which is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:72, and SEQ ID NO:75; (2) contacting the cell expressing the polypeptide associated with rheumatoid arthritis with the compound; and (3) determining whether the compound modulates the activity of the polypeptide associated with rheumatoid arthritis.
DETAILED DESCRIPTION OF THE INVENTION
[0030]The present invention is directed to the identification of genes associated with Rheumatoid Arthritis (RA). Such genes and their polypeptide expression products are hereinafter referred to as "RA-associated genes and polypeptides". In the present invention, RA-associated genes and polypeptides have been identified by probing Affymetrix chips (describe) with mRNA derived from the synovia of RA patients, as set forth in Section A of "Materials and Methods", hereinbelow. Gene expression patterns were compared to those obtained using mRNA derived from synovia of control joint trauma patients. Several genes were identified as having significantly increased expression in the RA synovium relative to the controls, as further described hereinbelow. Several genes have also been identified as having significantly decreased expression in the RA synovium relative to the controls, as further described hereinbelow.
[0031]The present invention provides synthetic methods for producing RA-associated genes and polypeptides. Also provided are diagnostic methods for detecting diseases, disorders, and/or conditions related to RA-associated genes and polypeptides, and therapeutic methods for treating such diseases, disorders, and/or conditions. The invention further relates to screening methods for identifying binding partners of RA-associated genes and polypeptides.
[0032]Examples of functional assays useful in the present invention include LPS-induced TNFα and TNFα-induced IL-1β secretion by THP-1 monocytes, anti-CD3/anti-CD28-induced IL-2 secretion by Jurkat T cells, TNFα-induced IL-1β secretion by synovial fibroblasts, TNFα-induced E-selectin expression by endothelial cells, and anti-CD40-induced homotypic aggregation of Raji B cells.
[0033]One of skill in the art will recognize that RA-associated genes and polypeptides of the present invention are desirably marine or human, but may be from any suitable organism. The genomic and protein sequences of RA-associated genes and polypeptides from these organisms are readily accessed via Genbank or The National Center for Biotechnology Information.
[0034]Further, derivatives and homologues of RA-associated genes and polypeptides may be used in the present invention. For example, nucleic acid sequences of RA-associated genes of the present invention may be altered by substitutions, additions, or deletions that provide for functionally equivalent-conservative variants of such genes. Further, one or more amino acid residues within the amino acid sequence of RA-associated polypeptides can be substituted by another amino acid of similar properties, such as, for example, positively charged amino acids (arginine, lysine, and histidine); negatively charged amino acids (aspartate and glutamate); polar neutral amino acids; and non-polar amino acids.
[0035]Other conservative amino acid substitutions can be taken from the Table 1, below.
TABLE-US-00001 TABLE 1 Conservative Amino Acid Replacements For Amino Acid Code Replace with any of: Alanine A D-Ala, Gly, beta-Ala, L-Cys, D-Cys Arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, Met, Ile, D- Met D-Ile, Orn, D-Orn Asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln Aspartic Acid D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr Glutamine Q D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp Glutamic Acid E D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln Glycine G Ala, D-Ala, Pro, D-Pro, β-Ala, Acp Isoleucine I D-Ile, Val, D-Val, Leu, D-Leu, Met, D-Met Leucine L D-Leu, Val, D-Val, Met, D-Met Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-Ile, Orn, D-Orn Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu, Val, D-Val Phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D-Trp, Trans- 3,4, or 5-phenylproline, cis-3,4, or 5-phenylproline Proline P D-Pro, L-1-thioazolidine-4-carboxylic acid, D- or L-1- oxazolidine-4-carboxylic acid Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, Met(O), D- Met(O), L-Cys, D-Cys Threonine T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, Met(O), D- Met(O), Val, D-Val Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met
[0036]Other analogs within the present invention are those with modifications which increase protein stability; such analogs may contain, for example, one or more non-peptide bonds (which replace the peptide bonds) in the protein sequence. Also included are analogs that include residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., β or γ amino acids.
[0037]RA-associated polypeptides of the present invention may be modified by, for example, phosphorylation, sulfation, acylation, or other protein modifications. They may also be modified with a label capable of providing a detectable signal, either directly or indirectly, including, but not limited to, radioisotopes and fluorescent compounds.
[0038]It will be apparent to one of skill in the art that conventional screening assays may be used in methods of the present invention for the identification of modulators of RA-associated genes and polypeptides.
[0039]In the present invention, techniques for screening large gene libraries may include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the genes under conditions for detection of a desired activity. Techniques known in the art are amenable to high throughput analysis for screening large numbers of sequences created, e.g., by random mutagenesis techniques. High throughput assays can be followed by secondary screens in order to identify further biological activities which will, e.g., allow one skilled in the art to differentiate agonists from antagonists. The type of a secondary screen used will depend on the desired activity that needs to be tested.
[0040]Drug screening assays are also provided in the present invention. By producing purified and recombinant forms of RA-associated genes and polypeptides of the present invention, or fragments thereof, one skilled in the art can use these to screen for drugs which are either agonists or antagonists of the normal cellular function or their role in cellular signaling. In one aspect, the assay evaluates the ability of a compound to modulate binding between RA-associated genes and polypeptides of the present invention and a naturally occurring ligand. The term "modulating" encompasses enhancement, diminishment, activation or inactivation of activity of RA-associated genes and polypeptides. Assays useful for identifying ligands to RA-associated genes and polypeptides of the present invention are encompassed herein. Such ligands include peptides, proteins, small molecules, and antibodies, which are capable of binding to RA-associated genes and polypeptides of the present invention and modulating their activity. A variety of assay formats may be used in the present invention and are known by those skilled in the art.
[0041]In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins, are often preferred as primary screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound.
[0042]Compounds identified using assays, as discussed hereinabove, may be antagonists or agonists of RA-associated genes and polypeptides. These compounds are useful in modulating the activity of RA-associated genes and polypeptides and in treating disorders associated with RA-associated genes and polypeptides.
[0043]"Disorders associated with RA-associated genes and polypeptides" refers to any disorder or disease state in which RA-associated genes and polypeptides play a regulatory role in the metabolic pathway of that disorder or disease. As used herein, the term "treating" refers to the alleviation of symptoms of a particular disorder in a patient, the improvement of an ascertainable measurement associated with a particular disorder, or the prevention of a particular immune, inflammatory or cellular response.
[0044]A compound which acts as a modulator of RA-associated genes and polypeptides may be administered for therapeutic use as a raw chemical or may be the active ingredient in a pharmaceutical formulation. Such formulations of the present invention may contain other therapeutic agents as described below, and may be formulated, for example, by employing conventional solid or liquid vehicles or diluents, as well as pharmaceutical additives of a type appropriate to the mode of desired administration (for example, excipients, binders, preservatives, stabilizers, flavors, etc.) according to techniques such as those well known in the art of pharmaceutical formulation.
[0045]Compounds of the present invention may be administered by any suitable means, for example, orally, such as in the form of tablets, capsules, granules or powders; sublingually; buccally; parenterally, such as by subcutaneous, intravenous, intramuscular, or intrasternal injection or infusion techniques (e.g., as sterile injectable aqueous or non-aqueous solutions or suspensions); nasally such as by inhalation spray; topically, such as in the form of a cream or ointment; or rectally such as in the form of suppositories; in dosage unit formulations containing non-toxic, pharmaceutically acceptable vehicles or diluents.
[0046]Such compounds may, for example, be administered in a form suitable for immediate release or extended release. Immediate release or extended release may be achieved by the use of suitable pharmaceutical compositions comprising compounds of the present invention, or, particularly in the case of extended release, by the use of devices such as subcutaneous implants or osmotic pumps. Compounds of the present invention may also be administered liposomally.
[0047]Exemplary compositions for oral administration include suspensions which may contain, for example, microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners or flavoring agents such as those known in the art; and immediate release tablets which may contain, for example, microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and/or lactose and/or other excipients, binders, extenders, disintegrants, diluents and lubricants such as those known in the art.
[0048]Compounds of the present invention may also be delivered through the oral cavity by sublingual and/or buccal administration. Molded tablets, compressed tablets or freeze-dried tablets are exemplary forms which may be used. Exemplary compositions include those formulating the compound(s) of the present invention with fast dissolving diluents such as mannitol, lactose, sucrose and/or cyclodextrins.
[0049]Also included in such formulations may be high molecular weight excipients such as celluloses (avicel) or polyethylene glycols (PEG). Such formulations may also include an excipient to aid mucosal adhesion such as hydroxy propyl cellulose (HPC), hydroxy propyl methyl cellulose (HPMC), sodium carboxy methyl cellulose (SCMC), maleic anhydride copolymer (e.g., Gantrez), and agents to control release such as polyacrylic copolymer (e.g., Carbopol 934). Lubricants, glidants, flavors, coloring agents and stabilizers may also be added for ease of fabrication and use.
[0050]Exemplary compositions for nasal aerosol or inhalation administration include solutions in saline which may contain, for example, benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, and/or other solubilizing or dispersing agents such as those known in the art.
[0051]Exemplary compositions for parenteral administration include injectable solutions or suspensions which may contain, for example, suitable non-toxic, parenterally acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride solution, or other suitable dispersing or wetting and suspending agents, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
[0052]Exemplary compositions for rectal administration include suppositories which may contain, for example, a suitable non-irritating excipient, such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquefy and/or dissolve in the rectal cavity to release the drug.
[0053]Exemplary compositions for topical administration include a topical carrier such as Plastibase (mineral oil gelled with polyethylene).
[0054]The effective amount of a compound of the present invention may be determined by one of ordinary skill in the art, and includes exemplary dosage amounts for an adult human of from about 0.1 to 100 mg/kg of body weight of active compound per day, which may be administered in a single dose or in the form of individual divided doses, such as from 1 to 4 times per day. It will be understood that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition. Preferred subjects for treatment include animals, most preferably mammalian species such as humans, and domestic animals such as dogs, cats and the like, subject to disorders associated with RA-associated genes and polypeptides.
[0055]The compounds of the present invention may be employed alone or in combination with each other and/or other suitable therapeutic agents useful in the treatment of disorders associated with RA-associated genes and polypeptides.
[0056]In another aspect, the present invention relates to the use of an isolated nucleic acid in "antisense" therapy. As used herein, "antisense" therapy refers to administration or in situ generation of oligonucleotides or their derivatives which specifically hybridize under cellular conditions with the cellular mRNA and/or genomic DNA of RA-associated genes so as to inhibit expression of the proteins encoded by such genes, e.g., by inhibiting transcription and/or translation. In general, "antisense" therapy refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences.
[0057]Gene constructs useful in antisense therapy may be administered may be administered in any biologically effective carrier, e.g., any formulation or composition capable of effectively delivering a nucleic acid sequence to cells in vivo. Approaches include insertion of the subject gene in viral vectors including recombinant retroviruses, adenoviruses, adeno-associated viruses, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; an advantage of infection of cells with a viral vector is that a large proportion of the targeted cells can receive the nucleic acid. Several viral delivery systems are known in the art and can be utilized by one practicing the present invention.
[0058]In addition to viral transfer methods, non-viral methods may also be employed. Most non-viral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes. Nucleic acid sequences may also be introduced to cell(s) by direct injection of the gene construct or by electroporation.
[0059]In clinical settings, the gene delivery systems can be introduced into a patient by any of a number of methods, each of which is known in the art. For instance, a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g., by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.
[0060]The pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the complete gene delivery system can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
[0061]The following sections sets forth the materials and methods utilized in the present invention.
Materials and Methods
A. Microarray Experimentation
1. RNA Isolation
[0062]Human knee biopsy samples were homogenized in 3 ml TRIZOL® Reagent (Life Technologies, Rockville, Md.) and frozen in liquid nitrogen. The samples were thawed, one-third (1 ml) of the sample was removed and mixed with 1 ml TRIZOL®. The mixture was then homogenized and snap frozen in liquid nitrogen. Following a thaw, the samples were spun at 14,000 rpm for 10 minutes at 4° C. The supernatants were transferred to new microfuge tubes, extracted with chloroform, and precipitated with isopropanol overnight at -20° C. The RNA was pelleted by centrifugation at 14,000 rpm for 30 minutes. The supernatant was aspirated, and the samples washed two times with 75% ethanol. Following the last spin, the pellets were air-dried, and resuspended in 20 ul of ultra-pure RNase-free water. The RNA samples were further purified using Qiagen RNease mini columns (Qiagen Inc., Valencia Calif.), according to manufacturer's instructions. The RNA was eluted with 50 ul of RNase-free water.
2. Probe Preparation
[0063]The RNA was treated in a total reaction volume of 100 ul with RNase Inhibitor (Invitrogen Corp., Carlsbad, Calif.), DNase I (Ambion, Houston, Tex.) for 30 minutes at 37° C. The treated RNA was purified using Qiagen RNease mini columns, according to the manufacturer's instructions.
[0064]For the first strand cDNA synthesis, the RNA was incubated with T7-(dT)24 primer, having the sequence: 5'GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGTTTTTTTTTTT TTTTTTTTTTTTT3' (SEQ ID NO:1) for 10 minutes at 70° C., followed by one minute on ice. First strand buffer, DTT, dNTP and RNase were added, and the samples incubated for 2 minutes at 45° C. Superscript II reverse transcriptase (Invitrogen Corp, Carlsbad, Calif.) was added, and the samples incubated for an additional 60 minutes at 45° C.
[0065]For the second strand synthesis, the first strand cDNA was incubated with second strand buffer, dNTPs, E. coli ligase, E. coli RNase H, E. coli Polymerase I in a total volume of 150 ul for two hours at 16° C. T4 polymerase was added, and the incubation continued for an additional 5 minutes. Following this incubation, EDTA was added, and the samples placed on ice. The cDNA samples were extracted with phenol:chloroform:isoamyl alcohol and precipitated by addition of 0.5 volumes of 7.5 M ammonium acetate and 2.5 volumes of 100% ethanol. The samples were pelleted by a 30 minute room temperature spin at 12,000×g. The pelleted samples were washed with 0.5 ml 80% ethanol, spun for 10 minutes at 12,000×g, and air dried. The samples were resuspended in 12 ul RNase free water.
[0066]The cDNA was labeled using the Enzo Bio Array High Yield RNA transcript labeling kit (Enzo Therapeutics, Farmingdale, N.Y.). The cDNA was incubated with HY reaction buffer, biotin labeled NTP, DTT, RNase mix, and T7 DNA polymerase for six hours at 37° C. Unincorporated nucleotides were removed using Qiagen RNeasy columns according to manufacturer's instructions. The cRNA was fragmented by addition of fragmentation buffer, and incubated for 35 minutes at 95° C. The fragmented tRNA (0.05 mg/ml) was added to a hybridization solution master mix that included 0.1 mg/ml herring sperm DNA, 5 nM oligo B2, 1× standard curve pool, 0.5 mg/ml acetylated BSA, 1×MES hybridization buffer.
[0067]The Affymetrix human U95v2 A, B, and C GeneChips® were probed with the hybridization master mix. The hybridization, washing, and Phycoerythrin streptavidin staining were performed using the Affymetrix hybridization oven and fluidics workstation according to manufacturer's instructions. Stained chips were scanned on the Affymetrix GeneChip scanner, and data was analyzed using the Affymetrix GeneChip software to determine the specifically hybridizing signal for each gene. The differentially expressed genes demonstrated at least a three-fold change in signal when comparing between tissue samples. The differences were all statistically significant (p<0.001) when compared to controls using a T-test.
3. Real Time PCR Analysis
[0068]Reverse transcription reactions were performed using up to 3.6 ug mRNA. The RNA was incubated for five minutes at 70° C. and then chilled on ice. A master mix was added containing dNTPs, RT buffer (259 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2), dithiothreitol, random hexamers, RNasin, and reverse transcriptase (Life Technologies, Rockville, Md.). The reactions were incubated for 60 minutes at 37° C., denatured for 5 minutes at 90° C., then chilled on ice for 5 minutes. PCR reactions were performed on ABI Prism® 5700 Sequence Detection System with SYBR green core reagents (PE Applied Biosystem, Foster City, Calif.). All PCR was done at 40 cycles with a pre-incubation period of 50° C. for 2 minutes followed by 95° C. for 10 minutes. Cycling conditions were 95° C. for 15 seconds, 55° C. for 20 seconds, and 75° C. for one minute. Some reactions were done with cycling conditions of 95° C. for 15 seconds and 60° C. for 60 seconds. All data was normalized relative to the signal for the housekeeping gene human hypoxanthine phosphoribosyltransferase I ("HPRT") (Accession No. BC000578; GI: 12653602) (SEQ ID NO:2), the nucleotide sequence of which is set forth in Table 2, below.
TABLE-US-00002 TABLE 2 Human Hypoxanthine Phosphoribosyltransferase I: Nucleotide Sequence Accession No. BC000578; GI: 12653602 (SEQ ID NO: 2) 1 ggcacgaggc ctcctgagca gtcagcccgc gcgccggccg gctccgttat ggcgacccgc 61 agccctggcg tcgtgattag tgatgatgaa ccaggttatg accttgattt attttgcata 121 cctaatcatt atgctgagga tttggaaagg gtgtttattc ctcatggact aattatggac 181 aggactgaac gtcttgctcg agatgtgatg aaggagatgg gaggccatca cattgtagcc 241 ctctgtgtgc tcaagggggg ctataaattc tttgctgacc tgctggatta catcaaagca 301 ctgaatagaa atagtgatag atccattcct atgactgtag attttatcag actgaagagc 361 tattgtaatg accagtcaac aggggacata aaagtaattg gtggagatga tctctcaact 421 ttaactggaa agaatgtctt gattgtggaa gatataattg acactggcaa aacaatgcag 481 actttgcttt ccttggtcag gcagtataat ccaaagatgg tcaaggtcgc aagcttgctg 541 gtgaaaagga ccccacgaag tgttggatat aagccagact ttgttggatt tgaaattcca 601 gacaagtttg ttgtaggata tgcccttgac tataatgaat acttcaggga tttgaatcat 661 gtttgtgtca ttagtgaaac tggaaaagca aaatacaaag cctaagatga gagttcaagt 721 tgagtttgga aacatctgga gtcctattga catcgccagt aaaattatca atgttctagt 781 tctgtggcca tctgcttagt agagcttttt gcatgtatct tctaagaatt ttatctgttt 841 tgtactttag aaatgtcagt tgctgcattc ctaaactgtt tatttgcact atgagcctat 901 agactatcag ttccctttgg gcggattgtt gtttaacttg taaatgaaaa aattctctta 961 aaccacagca ctattgagtg aaacattgaa ctcatatctg taagaaataa agagaagata 1021 tattagtttt ttaattggta ttttaatttt tatatatgca ggaaagaata gaagtgattg 1081 aatattgtta attataccac cgtgtgttag aaaagtaaga agcagtcaat tttcacatca 1141 aagacagcat ctaagaagtt ttgttctgtc ctggaattat tttagtagtg tttcagtaat 1201 gttgactgta ttttccaact tgttcaaatt attaccagtg aatctttgtc agcagttccc 1261 ttttaaatgc aaatcaataa attcccaaaa atttaaaaaa aaaaaaaaaa aaaaaa
Primer sets were as follows:
TABLE-US-00003 HPRT: Forward: GGTATACTGCCTGACCAAGG (SEQ ID NO: 3) Reverse: CGAGATGTGATGAAGGAGATGG (SEQ ID NO: 4) Name: gi475254 homo sapiens transcription factor ISGF-3 mRNA Forward exon 3 CCCCATGGAAATCAGACAGT (SEQ ID NO: 5) Reverse exon 4 TTGCTTTTCCGTATGTTGTG (SEQ ID NO: 6) Name: gi28965 human alpha-1-antitrypsin gene (S variant) Forward TGAAGAGCGTCCTGGGTC (SEQ ID NO: 7) Reverse CGTCGATGGTCAGCACAG (SEQ ID NO: 8) Name: gi5595355 human ADO37 protein Forward GCCCATCAGTGACAGCAAG (SEQ ID NO: 9) Reverse CCCAGGCAATGTTGAGGAG (SEQ ID NO: 10) Name: gi2185828 human hypothetical protein FLJ14834 Forward 417-436 CCTTCCCCTGTCATTGTTC Tm = 58 (SEQ ID NO: 11) Reverse 515-534 GACAGTAACCCTGCCACAC Tm = 60 (SEQ ID NO: 12) Name: gi183001 human guanylate binding protein isoform I Forward 124-132 GGCGACTGATGGCGAATC Tm = 58 (SEQ ID NO: 13) Reverse 264-282 CACCGTGGAGCCCAGAGA Tm = 60 (SEQ ID NO: 14) Name: gi2138110 human cysteine dioxygenease Forward 321-341 exon 1 GGCGATGAGGTCAATGTAGA Tm = 60 (SEQ ID NO: 15) Reverse 473-493 exon 2 CTGTGTCCTTCACCCCAACA Tm = 62 (SEQ ID NO: 16) Name: gi180278 IgG Fc Receptor I Forward GGACACCACAAAGGCAGTGAT (SEQ ID NO: 17) Reverse GCAGATGGAGCACCTCACAGT (SEQ ID NO: 18) Name: gi1382379 MRP-14 Forward AGCTCAGCTGCTTGTCTGCAT (SEQ ID NO: 19) Reverse TTCAAAGAGCTGGTGCGAAA (SEQ ID NO: 20) Name: gi1382285 Early B Cell Factor Forward GGCCAGGGCAATGTTATGC (SEQ ID NO: 21) Reverse ACATTCTGGCCCTCTGATCCT (SEQ ID NO: 22) Name: gi2185828 human hypothetical protein FLJ14834 Forward 417-436 CCTTCCCCTGTCATTGTTC (SEQ ID NO: 23) Reverse 515-534 GACAGTAACCCTGCCACAC (SEQ ID NO: 24)
B. Further Characterization of GBP-1 (SEQ ID NOS. 41 and 42): and GBP-5 (SEQ ID NOS. 61 and 62)
1. Cell Culture
[0069]For real time PCR analyses, THP-1 cells (107/group) were cultured at 106/ml in RPMI containing 10% heat inactivated fetal calf serum, 2 mM L-glutamine with either medium, BMS-205820 (2 uM), or dexamethasone (100 nM) for 30 minutes at 37° C. in 5% CO2. LPS was added to each group (100 ng/ml), and the incubation continued for 0.5-8 hr. At the end of each time point, cells were pelleted, washed one time with 10 ml PBS, and stored at -80° C.
[0070]Wild type 3T3 fibroblasts and immortalized fibroblast lines derived from p65 and IkBα germline knockouts were cultured in DMEM with 10% calf serum, glutamax and penicillin/streptomycin. Primary embryonic fibroblasts derived from germline knockouts of relB and p50 were cultured in DMEM with 10% fetal calf serum, glutamax and penicillin/streptomycin. The fibroblasts were plated at 5×105/well of a 6 well plate and cultured overnight at 37° C. in 5%© CO2. Cells were stimulated for 2 or 8 hours with either medium, human TNFα(10 ng/ml) or PMA (10 ng/ml). At each time point, cells were harvested using trypsin/EDTA, washed one time with PBS, and stored at -80° C.
[0071]For the microarray analyses, THP-1 cells (107/group) were cultured at 106/ml as above for 1, 6, 24, or 48 hours with either medium, TNFα: (10 ng/ml), IFN-γ (100 U/ml), or LPS (100 ng/ml). At each time point, mRNA was isolated, labeled, and used to probe Affymetrix HG_U95Av2, HG_U95B, and HG_U95C chips.
[0072]Human microvascular endothelial cells from three different donors were obtained from Clonetics (Walkersville, Md.), and cultured in EGM-2 medium (Clonetics). Cells were cultured in 100 mm dishes coated with mouse type IV collagen and allowed to grow to approximately 80% confluency. The cells were then stimulated for 1, 6, or 24 hours with either medium, TNFα (10 ng/ml), or IL-113 (10 ng/ml). At each time point, mRNA was isolated, labeled and used to probe Affymetrix HG_U95Av2 and HG_U95B chips.
[0073]For VEGF and bFGF stimulations, microvascular endothelial cells from three independent donors were obtained, cultured in 100 mm dishes coated with mouse type IV collagen and allowed to grow to 30% confluency. At this time, the media was replaced with DMEM containing 2% fetal calf serum, and the cells were cultured an additional day. The cells were stimulated for 1, 6, or 24 hours with either medium, VEGF (30 ng/ml) or bFGF (10 ng/ml). At each time point, mRNA was isolated, labeled, and used to probe Affymetrix chips as described above.
[0074]Synovial fibroblasts were obtained from Cell Applications, Inc. (San Diego, Calif.), and cultured for 1, 6, or 24 hours with either medium, TNFα (10 ng/ml), IL-1α (10 ng/ml, Peprotech), IL-17 (10 ng/ml, R&D Systems, Minneapolis, Minn.), or IL-17β-Ig fusion protein (5 ng/ml). The IL-17β protein was produced by fusing the full length IL-17β sequence (Shi et al., J. Biol. Chem. 275:19167-19176 (2000)) to the human IgG1 Fc region. At each time point, mRNA was isolated, labeled, and used to probe Affymetrix HG_U95Av2, HG_U95B, HG_U95C, HG_U95D, and HG_U95E chips.
[0075]T cells were isolated from the blood of 4 donors. Lymphocytes were isolated by centrifugation over Accu-prep lymphocyte separation medium (Accurate Chemical and Scientific Corporation, Westbury, N.Y.). The T cells were isolated by rosetting with sheep red blood cells. The isolated. T cells were cultured for 6 hours with either medium, or immobilized anti-CD3 (1 ug/ml) plus soluble anti-CD28 (1 ug/ml) antibodies. After 6 hours, mRNA was isolated, labeled, and used to probe Affymetrix HG_U133A and HG_U133B chips.
2. cDNA Synthesis for Real Time PCR Analysis
[0076]Total RNA was isolated from cells using the RNeasy° Kit from Qiagen (Valencia, Calif.), including the on-the-column DNase digestion procedure. RNA quality and quantity were evaluated using UV spectrometry. Total RNA was used for first-strand cDNA synthesis using the SuperScript® First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, Calif.) following the manufacturer's instructions with 50 ng of random hexamers.
[0077]For tissue expression analyses, Human Multiple Tissue cDNA Panel I and Human Immune System MTC Panels were obtained from Clontech (Palo Alto, Calif.). PCR reactions were performed using 2 microliters of cDNA sample (diluted with six microliters of water).
3. Primers
[0078]Gene specific primers were designed using the Primer Express software and synthesized by Sigma Genosys (The Woodlands, Tex.).
Primer sets were as follows:
TABLE-US-00004 Name: mGBP-1 Forward GGAACAGGAAAGACTTCTCAAGCA (SEQ ID NO: 82) Reverse CTTGACGTAGTTGCAAGCTCTCA (SEQ ID NO: 83) Name: mGBP-5 Forward GCTGAAGCAAGGTAGCGATGA (SEQ ID NO: 84) Reverse CCTCGTTGCTGAGTGTTGGA (SEQ ID NO: 85) Name: mHPRT Forward TCAGACTGAAGAGCTACTGTAATGATCA (SEQ ID NO: 86) Reverse CAACAATCAAGACATTCTTTCCAGTT (SEQ ID NO: 87) Name: hGBP-5 Forward TGCTTTCACTTGTGCCTCTTTC (SEQ ID NO: 88) Reverse CAGGCTCTCACAGAGACGGAA (SEQ ID NO: 89) Name: hGAPDH Forward AGCCGAGCCACATCGCT (SEQ ID NO: 90) Reverse GTGACCAGGCGCCCAATAC (SEQ ID NO: 91)
3. PCR Assay Conditions
[0079]Reactions were performed in a total volume of 40 μl. The master mix contained SYBR Green I Dye, 50 mM Tris-HCl pH8.3, 75 mM KCl, DMSO, Rox reference dye, 5 mM MgCl2, 2 mM dNTP, Platinum Tag High Fidelity (1 U/reaction), and 0.5 μM of each primer. Eight microliters of diluted cDNA was used in each PCR reaction. The amplification program consisted of a 10 minute incubation at 95° C. followed by forty cycles of incubations at 95° C. for 15 seconds and 60° C. for 1 minute. Amplification was followed by melting curve analysis at 60° C. to demonstrate that the amplification was specific to a single amplicon. A negative control without cDNA template was run to assess the overall specificity.
4. Data Analysis
[0080]A relative value for the initial target concentration in each reaction was determined using the TaqMan 5700 software. The threshold value was set to 0.5 to obtain cycle threshold values that were used to assign relative message levels for each target. The message levels of hGAPDH were used to normalize all other genes tested from the same cDNA. Message levels from the mouse fibroblast experiment were normalized using mouse HPRT values.
Example 1
Upregulated Genes and Downregulated Genes in RA
1. α-1 Antitrypsin Expression
[0081]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of α-1 antitrypsin were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 1. The polynucleotide sequence (SEQ ID NO:25) and amino acid sequence (SEQ ID NO:26) of α-1 antitrypsin are shown in FIGS. 2 and 3, respectively.
[0082]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of α-1 antitrypsin in the RA synovium, the results of which are set forth in Table 3, below. As used in Table 3 and hereinafter, "OA" stands for "Osteoarthritis".
TABLE-US-00005 TABLE 3 α-1 antitrypsin: Real Time PCR Results Expression Level T test Normal 1 OA 1.02 0.9574 RA 5.94 0.0034
[0083]α-1 Antitrypsin is the major endogenous inhibitor of the serine protease elastase. It also inhibits other circulating proteases including cathepsin G, thrombin, trypsin, and chymotrypsin. α-1 Antitrypsin is primarily synthesized by the liver. However, neutrophils, monocytes, and alveolar macrophages also increase expression of α-1 antitrypsin in response to proinflammatory stimuli including TNF-α, IL-6 and endotoxin (Knoell, et al., Am. J. Respir. Crit. Care Med. 157:246-255 (1998)). The deficiency of α-1 antitrypsin is associated with connective tissue destruction and the development of emphysema (Crystal, J. Clin. Invest. 85:1343-1352 (1990)).
[0084]At physiological concentrations, α-1 antitrypsin is a potent stimulator of fibroblast proliferation and collagen production (Dabbagh et al., J. Cell Physiol. 186:73-81 (2001)). High levels of the elastase-α-1 antitrypsin complex have been measured in the serum and synovial fluid of RA patients (Beyeler, et al., J. Rheumatol. 27:15-19 (2000)). α-1 Antitrypsin has also been isolated in a subtraction library examining genes upregulated in monocytes from RA patients (Stuhlmuller, et al., Arthritis Rheum. 43:775-790 (2000)).
2. B Lymphocyte Stimulator Expression
[0085]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of B Lymphocyte Stimulator (BLyS, TNSF13B) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 4. The polynucleotide sequence (SEQ ID NO:27) and amino acid sequence (SEQ ID NO:28) of BLyS are shown in FIGS. 5 and 6, respectively.
[0086]BLyS is a member of the TNF family produced by activated T cells, monocytes, and dendritic cells that stimulates B cell expansion and function. Serum BLyS levels have been shown to be elevated in patients with systemic autoimmune diseases, including lupus erythematosus (Zhang, et al., J. Immunol. 166:6-10 (2001)) and RA (Cheema, et al., Arthritis Rheum. 44:1313-1319 (2001)). Mice deficient for the BLyS receptor are resistant to collagen-induced arthritis (Wang, et al., Nature Immunol. 2:632-637 (2001)).
3. Fc Gamma RI Expression
[0087]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Fc gamma RI were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 7. The polynucleotide sequence (SEQ ID NO:29) and amino acid sequence (SEQ ID NO:30) of Fc gamma RI are shown in FIGS. 8 and 9, respectively.
[0088]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of Fe gamma RI in the RA synovium, the results of which are set forth in Table 4, below.
TABLE-US-00006 TABLE 4 Fc gamma RI: Real Time PCR Results Expression Level T test Normal 1 1 OA 1.89 0.35 RA 6.57 0.02
[0089]Fc gamma RI receptors bind IgG immune complexes and trigger cell activation and IL-8 secretion (Salmon, et al., Arthritis Rheum. 44:739-750 (2001)). The expression of Fc gamma RI was increased on monocytes derived from RA patients as compared to healthy controls. A significant correlation between Fc gamma RI, C-reactive protein, and blood platelet count was found in the RA patients. Furthermore, treatment with the steroid prednisolone induced down-regulation of Fc gamma RI expression suggesting that increased expression is associated with disease activity (Torsteinsdottir et al. (1999) Clin. Exp. Immunol. 115:554-560). Mice lacking functional Fc gamma RI and RIII receptors are resistant to collagen-induced arthritis (Kleinau et al. (2000) J. Exp. Med. 191:1611-1616).
4. Migration Inhibitory Factor-Related Protein 14 Expression
[0090]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Migration inhibitory factor-related protein 14 (MRP-14) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 10. The polynucleotide sequence (SEQ ID NO:31) and amino acid sequence (SEQ ID NO:32) of MRP-14 are shown in FIGS. 11 and 12, respectively.
[0091]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of MRP-14 in the RA synovium, the results of which are set forth in Table 5, below.
TABLE-US-00007 TABLE 5 MRP-14: Real Time PCR Results Expression Level T test Normal 1 1 OA 0.64 0.49 RA 4.37 0.07
[0092]MRP-14 is a calcium binding protein expressed primarily by circulating neutrophils and monocytes that belongs to the S100 family of proteins (Kerkhoff, et al., Biochim. Biophys. Acta 1448:200-211 (1998); Hessian, et al., J. Leuk. Biol. 53:197-204 (1993)). MRP-14 is strongly expressed by infiltrating neutrophils and monocytes within the inflamed joints of juvenile RA patients (Youssef, et al., J. Rheumatol. 26:2523-2528 (1999)). MRP14 is specifically released during the interaction of monocytes with inflammatory activated endothelium, and is found in high concentrations in the synovial fluid of juvenile RA patients (Frosch, et al., Arthritis Rheum. 43:628-637 (2000)).
5. Skin Collagenase Expression
[0093]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Skin Collagenase (MMP-1) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 13. The polynucleotide sequence (SEQ ID NO:33) and amino acid sequence (SEQ ID NO:34) of MRP-14 are shown in FIGS. 14 and 15, respectively.
[0094]MMP-1 is an enzyme that degrades interstitial collagens types I, II, and III. Elevated expression of MMP-1 was detected in synovium from patients with early inflammatory arthritis and with established erosive arthritis. Little expression was detected in normal synovium (Cunnane, et al., Rheumatology 38:34-42 (1999)). Primary cultures of rheumatoid synoviocytes produced MMP-1 as detected using immunohistochemistry. Expression has also been detected in the rheumatoid lesion (Tetlow, et al., Br. J. Rheum. 37:64-70 (1998)).
6. Cysteine Dioxygenase Expression
[0095]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of cysteine dioxygenase were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 16. The polynucleotide sequence (SEQ ID NO:35) and amino acid sequence (SEQ ID NO:36) of cysteine dioxygenase are shown in FIGS. 17 and 18, respectively.
[0096]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of Cysteine Dioxygenase in the RA synovium, the results of which are set forth in Table 6, below.
TABLE-US-00008 TABLE 6 Cysteine Dioxygenase: Real Time PCR Results Expression Level T test Normal 1 OA 1.21 0.77 RA 0.19 0.06
[0097]Cysteine dioxygenase is an enzyme involved in sulphate metabolism whose activity has been shown to be decreased in RA patients (Bradley, et al., J. Rheumatol. 21:1192-1196 (1994)).
Example 2
Upregulated Genes and Downregulated Genes in RA
1. HLA-DR2/Dw12 Expression
[0098]Using the materials and methods described hereinabove (Materials and Methods, Section A), significant increases in expression of HLA-DR2/Dw12 were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 19. The polynucleotide sequence (SEQ ID NO:37) and amino acid sequence (SEQ ID NO:38) of HLA-DR2/Dw12 are shown in FIGS. 20 and 21, respectively.
[0099]Upregulation of MHC class II alleles, specifically HLA-DRB1 and HLA-DR4 subtypes, has previously been associated with development of RA (Kerlan-Candon, et al., Arthritis Rheum. 44:1281-1292 (2001)). Evidence suggests that expression of the DRB1*0401 and related haplotypes predisposes individuals to RA (Nepom, Adv. Immunol. 68:315-332 (1998)). This allele is also associated with the most severe form of RA leading to extraarticular manifestations (Weyand, et al., J. Clin. Invest. 89:2033-2039 (1992)). Specific associations of HLA-DR2 expression with RA, shown in the present invention, have not been previously demonstrated.
2. Stimulator of Iron Transport Expression
[0100]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Stimulator of Iron Transport were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 22. The polynucleotide sequence (SEQ ID NO:39) and amino acid sequence (SEQ ID NO:40) of Stimulator of Iron Transport are shown in FIGS. 23 and 24, respectively.
[0101]Stimulator of Iron Transport is a regulator of ferric and ferrous iron uptake (Yu et al., J. Biol. Chem. 273:21380-21385 (1998); Gutierrez, et al., J. Cell Biol. 139:895-905 (1997)).
3. Guanylate Binding Protein Isoform I Expression
[0102]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Guanylate Binding Protein Isoform I (GBP-1) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 25. The polynucleotide sequence (SEQ ID NO:41) and amino acid sequence (SEQ ID NO:42) of GBP-1 are shown in FIGS. 26 and 27 respectively.
[0103]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of GBP-1 in the RA synovium, the results of which are set forth in Table 7, below.
TABLE-US-00009 TABLE 7 Guanylate Binding Protein Isoform 1: Real Time PCR Results Expression Level T test Normal 1 OA 1.00 0.985 RA 3.89 0.003
[0104]GBP-1 is an interferon-inducible protein that binds guanine nucleotides and possesses GTPase activity (Cheng, et al., Mol. Cell. Biol. 11:4717-4725 (1991)).
[0105]The regulation of GBP-1 was further characterized using the materials and methods described hereinabove (Materials and Methods, Section B), the results of which are set forth in Example 3 below.
4. ISGF-3 p91 (STAT1) Expression
[0106]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of ISGF-3 p91 (STAT1) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 28. The polynucleotide sequence (SEQ ID NO:43) and amino acid sequence (SEQ ID NO:44) of ISGF-3 p91 (STAT1) are shown in FIGS. 29 and 30, respectively.
[0107]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of ISGF-3 p91 in the RA synovium, the results of which are set forth in Table 8, below.
TABLE-US-00010 TABLE 8 ISGF-3 p91: Real Time PCR Results Expression Level T test Normal 1 OA 0.93 0.720 RA 3.91 0.002
[0108]ISGF-3 p91 (STAT1) is a transcription factor involved in interferon signaling pathways (Schindler, et al., Proc. Nat. Acad. Sci. 89:7836-7839 (1992)). Continuous activation of STAT1 has been seen in synovial fluid cells derived from RA but not osteoarthritis patients (Yokota, et al., J. Rheumatol. 28:1952-1959 (2001)).
5. Mad Protein Homolog-3 Expression
[0109]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of Mad Protein Homolog (MAD-3) were detected in the RA synovium. MAD-3 is also known as Mothers Against Decapentaplegic Homolog 3 (Small-3). This decreased expression is shown in the microarray data in FIG. 31. The polynucleotide sequence (SEQ ID NO:45) and amino acid sequence (SEQ ID NO:46) of MAD-3 are shown in FIGS. 32 and 33, respectively.
[0110]Mad-3 is an intracellular mediator downstream of the TGF-β/activin receptors that appears to be important for monocyte chemotaxis in response to TGF-β (Zhang, et al., Nature 383:168-172 (1996); Ashcroft, et al., Nature Cell Biol. 1:260-266 (1999).
6. Human Transforming Growth Factor-Beta Type III Receptor Expression
[0111]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of Human Transforming Growth Factor-Beta Type III Receptor (TGF-β type III receptor) were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 34. The polynucleotide sequence (SEQ ID NO:47) and amino acid sequence (SEQ ID NO:48) of TGF-β type III receptor are shown in FIGS. 35 and 36, respectively.
7. Early B Cell Factor Expression
[0112]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of Early B Cell Factor (EBF) were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 37. The polynucleotide sequence (SEQ ID NO:49) and amino acid sequence (SEQ ID NO:50) of EBF are shown in FIGS. 38 and 39, respectively.
[0113]Using the materials and methods described hereinabove (Materials and Methods, Section A), Real Time PCR was conducted to quantify the expression of EBF in the RA synovium, the results of which are set forth in Table 9, below.
TABLE-US-00011 TABLE 9 EBF: Real Time PCR Results Expression Level T test Normal 1 1 OA 0.72 0.66 RA 0.20 0.05
[0114]EBF is a transcription factor required for B cell differentiation (Gisler, et al., Blood 96:1457-1464 (2000)).
8. Duodenal Cytochrome b Expression
[0115]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of Duodenal Cytochrome b were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 40. The polynucleotide sequence (SEQ ID NO:51) and amino acid sequence (SEQ ID NO:52) of Duodenal Cytochrome b are shown in FIGS. 41 and 42, respectively.
[0116]Duodenal cytochrome b is a protein localized to the duodenal mucosa possessing ferric reductase activity (McKie, et al., Science 291:1755-1759 (2001)).
9. Nuclear LIM Interactor-Interacting Factor Expression
[0117]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of Nuclear LIM Interactor-Interacting Factor (NLI-IF) were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 43. The polynucleotide sequence (SEQ ID NO:53) and amino acid sequence (SEQ ID NO:54) of NLI-IF are shown in FIGS. 44 and 45, respectively.
[0118]The NLI-IF amino acid sequence has homology to the nuclear Lim interactor interacting factor from Gallus gallas. It is one of a family of four related proteins of unknown function (Marquet, et al., Mamm. Genome 11:755-762 (2000)).
10. Deleted in Liver Cancer 1 Expression
[0119]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of Deleted in Liver Cancer 1 (DLC1) were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 46. The polynucleotide sequence (SEQ ID NO:55) and amino acid sequence (SEQ ID NO:56) of DLC1 are shown in FIGS. 47 and 48, respectively.
[0120]DLC1 is a candidate tumor suppressor gene possessing a high degree of sequence similarity to the rat p122 RhoGap gene (Yuan, et al., Cancer Res. 58:2196-2199 (1998); Ng, et al., Cancer Res. 60:6581-6584 (2000)).
11. GI: 12005907
[0121]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of the polynucleotide identified by Genbank Accession No. AF260335 (GI: 12005907) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 49. The polynucleotide sequence (SEQ ID NO:57) and amino acid sequence (SEQ ID NO:58) are shown in FIGS. 50 and 51, respectively.
[0122]Further, Real Time PCR was conducted to quantify the expression of this polynucleotide in the RA synovium, the results of which are set forth in Table 10.
TABLE-US-00012 TABLE 10 GI: 12005907: Real Time PCR Results Expression Level T test Normal 1 OA 1.44 0.34 RA 2.39 0.04
12. Apolipoprotein L Expression
[0123]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Apolipoprotein L (APOL) (Genbank Accession No. NM 003661) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 52. The polynucleotide sequence (SEQ ID NO:59) and amino acid sequence (SEQ ID NO:60) of APOL are shown in FIGS. 53 and 54, respectively.
[0124]Apolipoprotein L is a component of human plasma lipoproteins (Duchateau, et al., J. Biol. Chem. 272:25576-25582 (1997)).
13. Homo Sapiens Guanylate Binding Protein 5 Expression
[0125]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Homo Sapiens Guanylate Binding Protein 5 (Genbank Accession No. AF288815) (GBP-5) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 55. The polynucleotide sequence (SEQ ID NO:61) and amino acid sequence (SEQ ID NO:62) of Homo Sapiens GBP-5 are shown in FIGS. 56 and 57, respectively. GBP-5 is highly homologous to GBP-1 described above (SEQ ID NO: 42).
[0126]The regulation of GBP-5 was further characterized using the materials and methods described hereinabove (Materials and Methods, Section B), the results of which are set forth in Example 3 below.
14. Human Proteasome Activator hPA28 Subunit Beta Expression
[0127]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of HPA28 subunit beta (HPA28) (Genbank Accession No. D45248) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 58. The polynucleotide sequence (SEQ ID NO:63) and amino acid sequence (SEQ ID NO:64) of HPA28 are shown in FIGS. 59 and 60, respectively.
[0128]HPA28 beta subunits associate with alpha subunits to form PA28, an activator of the 20S proteasome. Both subunits are coordinately regulated by interferon-γ (Ahn, et al., FEBS Lett. 366:37-42 (1995)).
15. Homo Sapiens FYN Binding Protein
[0129]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Homo Sapiens FYN Binding Protein (Genbank Accession No. AF001862) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 61. The polynucleotide sequence (SEQ ID NO:65) and amino acid sequence (SEQ ID NO:66) of Homo Sapiens FYN Binding Protein are shown in FIGS. 62 and 63, respectively.
[0130]FYN Binding Protein is a hematopoietic specific adapter protein that associates in a T cell receptor-inducible manner with another hematopoietic-specific adapter, SLP-76 (daSilva, et al., Proc. Natl. Acad. Sci. USA 94:7493-7498 (1997)). T cells from mice lacking FYN Binding Protein exhibit impaired proliferative responses and impaired integrin clustering following T cell receptor crosslinking (Peterson, et al., Science 293:2263-2265 (2001)).
16. VAMP5
[0131]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of VAMP5 (GI: 4027902) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 64. The polynucleotide sequence (SEQ ID NO:67) and amino acid sequence (SEQ ID NO:68) of VAMP5 are shown in FIGS. 65 and 66, respectively.
[0132]VAMP5 is a novel synaptobrevin protein that is preferentially expressed in skeletal muscle and heart. Its expression is increased during myogenesis and it localizes to the plasma membrane as well as intracellular perinuclear and peripheral vesicular structures of myotubes (Zeng, et al., Mol. Biol. Cell 9:2423-2437 (1998)).
17. GI: 2466183
[0133]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of the polynucleotide identified by GI: 2466183 were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 67. The sequence of this polynucleotide is shown in FIG. 68 (SEQ ID NO:69).
18. GI: 2219283
[0134]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of the polynucleotide identified by GI: 2219283 were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 69. The sequence of this polynucleotide is shown in FIG. 70 (SEQ ID NO:70).
19. Hypothetical Protein FLJ20152 (GI: 9506660)
[0135]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of the Hypothetical Protein FLJ20152 identified by GI: 9506660 were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 71. The polynucleotide sequence (SEQ ID NO:71) and amino acid sequence (SEQ ID NO:72) of Hypothetical Protein FLJ20152 are shown in FIGS. 72 and 73, respectively.
20. GI: 5876137
[0136]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of the polynucleotide identified by GI: 5876137 were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 74. The sequence of this polynucleotide is shown in FIG. 75 (SEQ ID NO:73).
21. GI: 2185828
[0137]Using the materials and methods described hereinabove (Materials and Methods, Section A), decreases in expression of the polynucleotide identified by GI: 2185828 were detected in the RA synovium. This decreased expression is shown in the microarray data in FIG. 76. The polynucleotide sequence (SEQ ID NO:74) and amino acid sequence (SEQ ID NO:75) are shown in FIGS. 77 and 78, respectively.
[0138]Further, Real Time PCR was conducted to quantify the expression of this polynucleotide in the RA synovium, the results of which are set forth in Table 11.
TABLE-US-00013 TABLE 11 GI: 2185828 Real Time PCR Results Expression Level T test Normal 1 OA 0.87 0.632 RA 0.21 0.014
22. Homo sapiens Proteasome (Prosome, Macropain) Subunit, Beta Type, 9
[0139]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of the Homo sapiens proteasome (prosome, macropain) subunit, beta type, 9 (GI: 14754802) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 79. The polynucleotide sequence (SEQ ID NO:76) and amino acid sequence (SEQ ID NO:77) of homo sapiens proteasome (prosome, macropain) subunit, beta type, 9 are shown in FIGS. 80 and 81, respectively.
[0140]The of homo sapiens proteasome (prosome, macropain) subunit, beta type, 9 is encoded by a gene within the major histocompatibility complex. This subunit replaces beta subunit PSMB6 following interferon gamma stimulation, thereby altering the proteasome specificity.
23. TYRO Protein Tyrosine Kinase Binding Protein (TYROBP); GI: 4507754
[0141]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of the TYRO protein tyrosine kinase binding protein (TYROBP) (GI: 4507754) were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 82. The polynucleotide sequence (SEQ ID NO:78) and amino acid sequence (SEQ ID NO:79) are shown in FIGS. 83 and 84, respectively.
[0142]TYRO protein tyrosine binding protein (TYROBP) is an ITAM-bearing transmembrane adaptor protein that associates non-covalently with receptors in natural killer and myeloid cells (Lather, et al., Nature 391:703-707 (1998)). Mice deficient for TYROBP have normal lymphoid and myeloid development, however activating Ly49 receptors on NK cells are downregulated and nonfunctional. The TYROBP deficient mice are resistant to induction of experimental autoimmune encephalomyelitis and exhibit decreased interferon-7 production by antigen-primed CD4+ T cells due to inadequate T cell priming in vivo (Bakker, et al., Immunity 13:345-353 (2000)). Humans expressing loss of function mutations in TYROBP exhibit presenile dementia with bone cysts (Paloneva, et al., Nat. Genet. 25:357-361 (2000)).
24. Interleukin 15 Receptor, Alpha
[0143]Using the materials and methods described hereinabove (Materials and Methods, Section A), increases in expression of Interleukin 15 Receptor, alpha were detected in the RA synovium. This increased expression is shown in the microarray data in FIG. 85. The polynucleotide sequence (SEQ ID NO:80) and amino acid sequence (SEQ ID NO:81) are shown in FIGS. 86 and 87, respectively.
[0144]IL-15 is a T cell growth factor that shares many functional similarities with IL-2. The IL-15 receptor consists of a high affinity binding alpha chain and the common IL-2 receptor beta and gamma chains (Anderson, et al., J. Biol. Chem. 270:29862-29869 (1995)). Elevated levels of IL-15 have been detected in the serum from systemic lupus erythematosus patients (Aringer, et al., Rheumatology 40:876-881 (2001)), in the synovial tissue of rheumatoid arthritis patients (Thurkow, et al., J. Pathol. 181:444-450 (1997)), and in synovial fluid from rheumatoid arthritis patients (McInnes, et al., Nat. Med. 2:175-182 (1996)). Administration of soluble IL-15 receptor alpha chain to mice prevented collagen-induced arthritis (Ruchatz, et al., J. Immunol. 160:5654-5660 (1998)), suggesting that IL-15 plays a role in the development of rheumatoid arthritis. Upregulation of the IL-15 receptor alpha chain in rheumatoid arthritis has not been previously described.
Example 3
Characterization of RA-Associated Genes GBP-1 and GBP5
[0145]As stated above, GBP-1 and GBP-5 were further characterized using the materials and methods set forth above (Materials and Methods, Section B).
[0146]GBP-1 has been identified as an interferon-inducible protein in human fibroblasts (Cheng et al., J. Biol. Chem. 258:7746-7750 (1983)). GBP-1 mRNA has been shown to be induced in endothelial cells in response to the pro-inflammatory stimuli, TNFα and IL-1α (Guenzi et al., EMBO J. 20:5568-5577 (2001)). This study also suggested that GBP-1 mediates the anti-proliferative effects of these cytokines.
[0147]As TNFα and IL-1α are known to activate the transcription factor NF-kB, it was determined whether NF-kB was required for induction of GBP-1 and GBP-5 in the human THP-1 monocyte line. THP-1 monocytes were stimulated with lipopolysaccharide (LPS), a known inducer of NF-kB, in the presence and absence of a selective peptide inhibitor of NF-kB nuclear translocation, which is set forth in Fujihara et al., J. Immunol. 165:1004-1012 (2000) and designated "BMS-205820".
[0148]Following a 2 hour stimulation, RNA was isolated from 2 sets of independently treated THPs, and real time PCR was performed using primers specific for either GBP-1 or GBP-5, as shown in FIG. 88. Treatment of THP-1 cells with LPS significantly increased steady-state mRNA levels of both GBP-1 (FIGS. 88A and 88B) and GBP-5 (FIGS. 88C and 88D). Expression of both genes was significantly inhibited by BMS-205820, suggesting that LPS-mediated induction of GBP-1 and GBP-5 expression is dependent on NF-kB activity.
[0149]An extended time course was performed to further characterize GBP-1 and GBP-5 expression, as shown in FIG. 89. THP-1 cells were stimulated for 0.5, 1, 4, 6, and 8 hours with LPS. Some groups included either BMS-205820 or the steroid dexamethasone for 2 or 6 hours. Dexamethasone is also known to inhibit NF-kB activity (Scheinman et al., Mol. Cell. Biol. 15:943-953 (1995)). At each time point, mRNA was isolated and real time PCR was performed using primers specific for either GBP-1 (FIG. 89A) or GBP-5 (FIG. 89B). Steady state mRNA levels for both GBP-1 and GBP-5 peaked at 6 hours post stimulation. Addition of either BMS-205820 or dexamethasone significantly inhibited mRNA induction of both genes at 2 and 6 hours. The ability of two different NF-kB inhibitors to block GBP-1 and GBP-5 expression further confirms that LPS-mediated induction of these genes is dependent on NF-kB activity.
[0150]To further confirm that GBP-1 and GBP-5 are NF-kB target genes, expression in mouse embryonic fibroblasts derived from germline knockouts of members of the NF-kB family was examined (FIG. 90). Wild type 3T3 cells, embryonic fibroblasts derived from knockouts of p65, RelB, p50, and IkBα were stimulated for 2 or 8 hours with either TNRα or PMA. At each time point, mRNA was isolated and real time PCR was performed using primers specific for either mouse GBP-1 (FIG. 90A) or GBP-5 (FIG. 90B). Stimulation with TNFα but not PMA induced increased steady-state levels of both GBP-1 and GBP-5 mRNA. Induction of GBP-1 mRNA was completely ablated in cells lacking either p65 or RelB. GBP-1 mRNA was superinduced in cells lacking either p50 or IkBα, suggesting that these proteins negatively regulate GBP-1 mRNA. IkBα is a known inhibitor of NF-kB activity (Baeuerle et al., Science 242:540-545 (1988)). Homodimers of p50 have also been shown to repress certain genes (Plaksin et al., J. Exp. Med. 177:1651-1662 (1993)).
[0151]Similar to GBP-1, induction of GBP-5 mRNA was completely ablated in cells lacking p65. In contrast to GBP-1, GBP-5 mRNA was superinduced in cells lacking RelB. Similar to GBP-1, GBP-5 mRNA was also superinduced in cells lacking either p50 or IkBα. These data suggest that p65 expression is required for the induction of both GBP-1 and GBP-5. Complexes containing RelB appear to differentially regulate GBP-1 and GBP-5 expression. Taken together, these data are consistent with NF-kB-dependent regulation of GBP-1 and GBP-5 expression.
[0152]The tissue expression profiles of GBP-1 and GBP-5 were further characterized. Human tissue cDNA panels were analyzed by real time PCR with primers selective for GBP-1 (FIG. 91A) and GBP-5 (FIG. 91B). Both genes had very similar patterns of expression. The highest steady state mRNA levels were detected in hematopoietic tissues including spleen, peripheral blood leukocytes, and lymph nodes. Lower levels of expression were detected in lung, followed by liver, thymus, tonsil, bone marrow, placenta, fetal liver, tonsil, and pancreas.
[0153]Based on the high expression detected in hematopoietic tissue, the expression of GBP-1 and GBP-5 in panels of resting and stimulated immune cells was examined. Consistent with the identification of GBP-1 as an interferon response gene (Cheng et al., J. Biol. Chem. 258:7746-7750 (1983)), steady state levels of GBP-1 and GBP-5 mRNA were strongly induced by interferon-γ treatment of THP-1 monocytes, as shown in FIGS. 92A and 92B. Much lower levels of expression were induced by TNFα and LPS.
[0154]Consistent with published reports (Guenzi et al., EMBO J. 20:5568-5577 (2001)), GBP-1 expression was strongly induced by TNFα and IL-113 in human microvascular endothelial cells (FIG. 93A). No induction was seen in response to either VEGF or basic FGF. In contrast to GBP-1, induction of GBP-5 by TNFα and IL-1β was variable (FIG. 93B). Cells from two out of three donors upregulated GBP-5 mRNA in response to TNFα. Only one donor significantly induced GBP-5 mRNA in response to IL-1β.
[0155]Synovial fibroblasts derived from rheumatoid arthritis patients were stimulated with either TNFα, IL-1α, IL-17, or IL-17β. GBP-1 mRNA was induced at 1 and 6 hours by stimulation with either TNFα or IL-1α, but not in response to either IL-17 or IL-17β (FIG. 94A). Low levels of GBP-5 expression were detected in synovial fibroblasts (FIG. 94B). Induction of GBP-5 in response to the different stimuli was variable and not sustained.
[0156]GBP-1 and GBP-5 had similar patterns of expression in T cells (FIG. 95). Peripheral blood T cells were isolated from 4 different donors and stimulated for 6 hours with antibodies to CD3 and CD28 as a mimic of antigen stimulation. Steady state levels of GBP-1 (FIG. 95A) and GBP-5 (FIG. 95B) mRNA were strongly induced by antigen receptor crosslinking.
[0157]The induction of GBP-1 and GBP-5 by pro-inflammatory stimuli including LPS, IL-1, TNFα, and antigen receptor crosslinking is consistent with NF-kB-dependent regulation of these genes. Overexpression of these genes in synovium from rheumatoid arthritis patients is also consistent with NP-kB-dependent regulation. NF-kB is activated in the inflamed synovium of rheumatoid arthritis patients (Marok et al., Arthritis Rheum. 39:583-591 (1996)) and animal models of arthritis (Miagkov et al., Proc. Natl. Acad. Sci. USA 95:13859-13864 (1998)). The regulation of GBP-1 and GBP-5 by NF-kB coupled with the involvement of NF-kB in the development of arthritis indicates that these genes play a role in disease pathology.
[0158]While the invention has been described in connection with specific embodiments therefore, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims. All references cited herein are expressly incorporated in their entirety.
Sequence CWU
1
91163DNAArtificial SequenceSynthetic primer 1ggccagtgaa ttgtaatacg
actcactata gggaggcggt tttttttttt tttttttttt 60ttt
6321316DNAhomo sapiens
2ggcacgaggc ctcctgagca gtcagcccgc gcgccggccg gctccgttat ggcgacccgc
60agccctggcg tcgtgattag tgatgatgaa ccaggttatg accttgattt attttgcata
120cctaatcatt atgctgagga tttggaaagg gtgtttattc ctcatggact aattatggac
180aggactgaac gtcttgctcg agatgtgatg aaggagatgg gaggccatca cattgtagcc
240ctctgtgtgc tcaagggggg ctataaattc tttgctgacc tgctggatta catcaaagca
300ctgaatagaa atagtgatag atccattcct atgactgtag attttatcag actgaagagc
360tattgtaatg accagtcaac aggggacata aaagtaattg gtggagatga tctctcaact
420ttaactggaa agaatgtctt gattgtggaa gatataattg acactggcaa aacaatgcag
480actttgcttt ccttggtcag gcagtataat ccaaagatgg tcaaggtcgc aagcttgctg
540gtgaaaagga ccccacgaag tgttggatat aagccagact ttgttggatt tgaaattcca
600gacaagtttg ttgtaggata tgcccttgac tataatgaat acttcaggga tttgaatcat
660gtttgtgtca ttagtgaaac tggaaaagca aaatacaaag cctaagatga gagttcaagt
720tgagtttgga aacatctgga gtcctattga catcgccagt aaaattatca atgttctagt
780tctgtggcca tctgcttagt agagcttttt gcatgtatct tctaagaatt ttatctgttt
840tgtactttag aaatgtcagt tgctgcattc ctaaactgtt tatttgcact atgagcctat
900agactatcag ttccctttgg gcggattgtt gtttaacttg taaatgaaaa aattctctta
960aaccacagca ctattgagtg aaacattgaa ctcatatctg taagaaataa agagaagata
1020tattagtttt ttaattggta ttttaatttt tatatatgca ggaaagaata gaagtgattg
1080aatattgtta attataccac cgtgtgttag aaaagtaaga agcagtcaat tttcacatca
1140aagacagcat ctaagaagtt ttgttctgtc ctggaattat tttagtagtg tttcagtaat
1200gttgactgta ttttccaact tgttcaaatt attaccagtg aatctttgtc agcagttccc
1260ttttaaatgc aaatcaataa attcccaaaa atttaaaaaa aaaaaaaaaa aaaaaa
1316320DNAArtificial SequenceSynthetic primer 3ggtatactgc ctgaccaagg
20422DNAArtificial
SequenceSynthetic primer 4cgagatgtga tgaaggagat gg
22520DNAArtificial SequenceSynthetic primer
5ccccatggaa atcagacagt
20620DNAArtificial SequenceSynthetic primer 6ttgcttttcc gtatgttgtg
20718DNAArtificial
SequenceSynthetic primer 7tgaagagcgt cctgggtc
18818DNAArtificial SequenceSynthetic primer
8cgtcgatggt cagcacag
18919DNAArtificial SequenceSynthetic primer 9gcccatcagt gacagcaag
191019DNAArtificial
SequenceSynthetic primer 10cccaggcaat gttgaggag
191119DNAArtificial SequenceSynthetic primer
11ccttcccctg tcattgttc
191219DNAArtificial SequenceSynthetic primer 12gacagtaacc ctgccacac
191318DNAArtificial
SequenceSynthetic primer 13ggcgactgat ggcgaatc
181418DNAArtificial SequenceSynthetic primer
14caccgtggag cccagaga
181520DNAArtificial SequenceSynthetic primer 15ggcgatgagg tcaatgtaga
201620DNAArtificial
SequenceSynthetic primer 16ctgtgtcctt caccccaaca
201721DNAArtificial SequenceSynthetic primer
17ggacaccaca aaggcagtga t
211821DNAArtificial SequenceSynthetic primer 18gcagatggag cacctcacag t
211921DNAArtificial
SequenceSynthetic primer 19agctcagctg cttgtctgca t
212020DNAArtificial SequenceSynthetic primer
20ttcaaagagc tggtgcgaaa
202119DNAArtificial SequenceSynthetic primer 21ggccagggca atgttatgc
192221DNAArtificial
SequenceSynthetic primer 22acattctggc cctctgatcc t
212319DNAArtificial SequenceSynthetic primer
23ccttcccctg tcattgttc
192419DNAArtificial SequenceSynthetic primer 24gacagtaacc ctgccacac
19251371DNAhomo sapiens
25ctgcaggggg gggggggggc tgggacagtg aatcgacaat gccgtcttct gtctcgtggg
60gcatcctcct gctggcaggc ctgtgctgcc tggtccctgt ctccctggct gaggatcccc
120agggagatgc tgcccagaag acagatacat cccaccatga tcaggatcac ccaaccttca
180acaagatcac ccccaacctg gctgagttcg ccttcagcct ataccgccag ctggcacacc
240agtccaacag caccaatatc ttcttctccc cagtgagcat cgctacagcc tttgcaatgc
300tctccctggg gaccaaggct gacactcacg atgaaatcct ggagggcctg aatttcaacc
360tcacggagat tccggaggct cagatccatg aaggcttcca ggaactcctc cgtaccctca
420accagccaga cagccagctc cagctgacca ccggcaatgg cctgttcctc agcgagggcc
480tgaagctagt ggataagttt ttggaggatg ttaaaaagtt gtaccactca gaagccttca
540ctgtcaactt cggggacacc gaagaggcca agaaacagat caacgattac gtggagaagg
600gtactcaagg gaaaattgtg gatttggtca aggagcttga cagagacaca gtttttgctc
660tggtgaatta catcttcttt aaaggcaaat gggagagacc ctttgaagtc aaggacaccg
720aggaagagga cttccacgtg gaccaggtga ccaccgtgaa ggtgcctatg atgaagcgtt
780taggcatgtt taacatccag cactgtaaga agctgtccag ctgggtgctg ctgatgaaat
840acctgggcaa tgccaccgcc atcttcttcc tgcctgatga ggggaaacta cagcacctgg
900aaaatgaact cacccacgat atcatcacca agttcctgga aaatgaagac agaaggtctg
960ccagcttaca tttacccaaa ctgtccatta ctggaaccta tgatctgaag agcgtcctgg
1020gtcaactggg catcactaag gtcttcagca atggggctga cctctccggg gtcacagagg
1080aggcacccct gaagctctcc aaggccgtgc ataaggctgt gctgaccatc gacgagaaag
1140ggactgaagc tgctggggcc atgtttttag aggccatacc catgtctatc ccccccgagg
1200tcaagttcaa caaacccttt gtcttcttaa tgattgaaca aaataccaag tctcccctct
1260tcatgggaaa agtggtgaat cccacccaaa aataactgcc tctcgctcct caacccctcc
1320cctccatccc tggccccctc cctggatgac attaaagaag ggttgagctg g
137126417PRThomo sapiens 26Met Pro Ser Ser Val Ser Trp Gly Ile Leu Leu
Ala Gly Leu Cys Cys1 5 10
15Leu Val Pro Val Ser Leu Ala Glu Asp Pro Gln Gly Asp Ala Ala Gln20
25 30Lys Thr Asp Thr Ser His His Asp Gln Asp
His Pro Thr Phe Asn Lys35 40 45Ile Thr
Pro Asn Leu Ala Glu Phe Ala Phe Ser Leu Tyr Arg Gln Leu50
55 60Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe Ser
Pro Val Ser Ile65 70 75
80Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr Lys Ala Asp Thr His85
90 95Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn
Leu Thr Glu Ile Pro Glu100 105 110Ala Gln
Ile His Glu Gly Phe Gln Glu Leu Leu Arg Thr Leu Asn Gln115
120 125Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn Gly
Leu Phe Leu Ser130 135 140Glu Gly Leu Lys
Leu Val Asp Lys Phe Leu Glu Asp Val Lys Lys Leu145 150
155 160Tyr His Ser Glu Ala Phe Thr Val Asn
Phe Gly Asp His Glu Glu Ala165 170 175Lys
Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly Thr Gln Gly Lys Ile180
185 190Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr
Val Phe Ala Leu Val195 200 205Asn Tyr Ile
Phe Phe Lys Gly Lys Trp Glu Arg Pro Phe Glu Val Lys210
215 220Asp Thr Glu Asp Glu Asp Phe His Val Asp Gln Val
Thr Thr Val Lys225 230 235
240Val Pro Met Met Lys Arg Leu Gly Met Phe Asn Ile Gln His Cys Lys245
250 255Lys Leu Ser Ser Trp Val Leu Leu Met
Lys Tyr Leu Gly Asn Ala Thr260 265 270Ala
Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu Gln His Leu Glu Asn275
280 285Glu Leu Thr His Asp Ile Ile Thr Lys Phe Leu
Glu Asn Glu Asp Arg290 295 300Arg Ser Ala
Ser Leu His Leu Pro Lys Leu Ser Ile Thr Gly Thr Tyr305
310 315 320Asp Leu Lys Ser Val Leu Gly
Gln Leu Gly Ile Thr Lys Val Phe Ser325 330
335Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu Ala Pro Leu Lys Leu340
345 350Ser Lys Ala Val His Lys Ala Val Leu
Thr Ile Asp Glu Lys Gly Thr355 360 365Glu
Ala Ala Gly Ala Met Phe Leu Glu Ala Ile Pro Met Ser Ile Pro370
375 380Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe
Leu Met Ile Glu Gln385 390 395
400Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val Val Asn Pro Thr
Gln405 410 415Lys27858DNAHomo Sapiens
27atggatgact ccacagaaag ggagcagtca cgccttactt cttgccttaa gaaaagagaa
60gaaatgaaac tgaaggagtg tgtttccatc ctcccacgga aggaaagccc ctctgtccga
120tcctccaaag acggaaagct gctggctgca accttgctgc tggcactgct gtcttgctgc
180ctcacggtgg tgtctttcta ccaggtggcc gccctgcaag gggacctggc cagcctccgg
240gcagagctgc agggccacca cgcggagaag ctgccagcag gagcaggagc ccccaaggcc
300ggcttggagg aagctccagc tgtcaccgcg ggactgaaaa tctttgaacc accagctcca
360ggagaaggca actccagtca gaacagcaga aataagcgtg ccgttcaggg tccagaagaa
420acagtcactc aagactgctt gcaactgatt gcagacagtg aaacaccaac tatacaaaaa
480ggatcttaca catttgttcc atggcttctc agctttaaaa ggggaagtgc cctagaagaa
540aaagagaata aaatattggt caaagaaact ggttactttt ttatatatgg tcaggtttta
600tatactgata agacctacgc catgggacat ctaattcaga ggaagaaggt ccatgtcttt
660ggggatgaat tgagtctggt gactttgttt cgatgtattc aaaatatgcc tgaaacacta
720cccaataatt cctgctattc agctggcatt gcaaaactgg aagaaggaga tgaactccaa
780cttgcaatac caagagaaaa tgcacaaata tcactggatg gagatgtcac attttttggt
840gcattgaaac tgctgtga
85828285PRThomo sapiens 28Met Asp Asp Ser Thr Glu Arg Glu Gln Ser Arg Leu
Thr Ser Cys Leu1 5 10
15Lys Lys Arg Glu Glu Met Lys Leu Lys Glu Cys Val Ser Ile Leu Pro20
25 30Arg Lys Glu Ser Pro Ser Val Arg Ser Ser
Lys Asp Gly Lys Leu Leu35 40 45Ala Ala
Thr Leu Leu Leu Ala Leu Leu Ser Cys Cys Leu Thr Val Val50
55 60Ser Phe Tyr Gln Val Ala Ala Leu Gln Gly Asp Leu
Ala Ser Leu Arg65 70 75
80Ala Glu Leu Gln Gly His His Ala Glu Lys Leu Pro Ala Gly Ala Gly85
90 95Ala Pro Lys Ala Gly Leu Glu Glu Ala Pro
Ala Val Thr Ala Gly Leu100 105 110Lys Ile
Phe Glu Pro Pro Ala Pro Gly Glu Gly Asn Ser Ser Gln Asn115
120 125Ser Arg Asn Lys Arg Ala Val Gln Gly Pro Glu Glu
Thr Val Thr Gln130 135 140Asp Cys Leu Gln
Leu Ile Ala Asp Ser Glu Thr Pro Thr Ile Gln Lys145 150
155 160Gly Ser Tyr Thr Phe Val Pro Trp Leu
Leu Ser Phe Lys Arg Gly Ser165 170 175Ala
Leu Glu Glu Lys Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr180
185 190Phe Phe Ile Tyr Gly Gln Val Leu Tyr Thr Asp
Lys Thr Tyr Ala Met195 200 205Gly His Leu
Ile Gln Arg Lys Lys Val His Val Phe Gly Asp Glu Leu210
215 220Ser Leu Val Thr Leu Phe Arg Cys Ile Gln Asn Met
Pro Glu Thr Leu225 230 235
240Pro Asn Asn Ser Cys Tyr Ser Ala Gly Ile Ala Lys Leu Glu Glu Gly245
250 255Asp Glu Leu Gln Leu Ala Ile Pro Arg
Glu Asn Ala Gln Ile Ser Leu260 265 270Asp
Gly Asp Val Thr Phe Phe Gly Ala Leu Lys Leu Leu275 280
285291128DNAhomo sapiens 29atgtggttct tgacaactct gctcctttgg
gttccagttg atgggcaagt ggacaccaca 60aaggcagtga tcactttgca gcctccatgg
gtcagcgtgt tccaagagga aaccgtaacc 120ttgcactgtg aggtgctcca tctgcctggg
agcagctcta cacagtggtt tctcaatggc 180acagccactc agacctcgac ccccagctac
agaatcacct ctgccagtgt caatgacagt 240ggtgaataca ggtgccagag aggtctctca
gggcgaagtg accccataca gctggaaatc 300cacagaggct ggctactact gcaggtctcc
agcagagtct tcacggaagg agaacctctg 360gccttgaggt gtcatgcgtg gaaggataag
ctggtgtaca atgtgcttta ctatcgaaat 420ggcaaagcct ttaagttttt ccactggaat
tctaacctca ccattctgaa aaccaacata 480agtcacaatg gcacctacca ttgctcaggc
atgggaaagc atcgctacac atcagcagga 540atatctgtca ctgtgaaaga gctatttcca
gctccagtgc tgaatgcatc tgtgacatcc 600ccactcctgg aggggaatct ggtcaccctg
agctgtgaaa caaagttgct cttgcagagg 660cctggtttgc agctttactt ctccttctac
atgggcagca agaccctgcg aggcaggaac 720acatcctctg aataccaaat actaactgct
agaagagaag actctgggtt atactggtgc 780gaggctgcca cagaggatgg aaatgtcctt
aagcgcagcc ctgagttgga gcttcaagtg 840cttggcctcc agttaccaac tcctgtctgg
tttcatgtcc ttttctatct ggcagtggga 900ataatgtttt tagtgaacac tgttctctgg
gtgacaatac gtaaagaact gaaaagaaag 960aaaaagtggg atttagaaat ctctttggat
tctggtcatg agaagaaggt aatttccagc 1020cttcaagaag acagacattt agaagaagag
ctgaaatgtc aggaacaaaa agaagaacag 1080ctgcaggaag gggtgcaccg gaaggagccc
cagggggcca cgtagcag 112830374PRThomo sapiens 30Met Trp Phe
Leu Thr Thr Leu Leu Leu Trp Val Pro Val Asp Gly Gln1 5
10 15Val Asp Thr Thr Lys Ala Val Ile Thr
Leu Gln Pro Pro Trp Val Ser20 25 30Val
Phe Gln Glu Glu Thr Val Thr Leu His Cys Glu Val Leu His Leu35
40 45Pro Gly Ser Ser Ser Thr Gln Trp Phe Leu Asn
Gly Thr Ala Thr Gln50 55 60Thr Ser Thr
Pro Ser Tyr Arg Ile Thr Ser Ala Ser Val Asn Asp Ser65 70
75 80Gly Glu Tyr Arg Cys Gln Arg Gly
Leu Ser Gly Arg Ser Asp Pro Ile85 90
95Gln Leu Glu Ile His Arg Gly Trp Leu Leu Leu Gln Val Ser Ser Arg100
105 110Val Phe Thr Glu Gly Glu Pro Leu Ala Leu
Arg Cys His Ala Trp Lys115 120 125Asp Lys
Leu Val Tyr Asn Val Leu Tyr Tyr Arg Asn Gly Lys Ala Phe130
135 140Lys Phe Phe His Trp Asn Ser Asn Leu Thr Ile Leu
Lys Thr Asn Ile145 150 155
160Ser His Asn Gly Thr Tyr His Cys Ser Gly Met Gly Lys His Arg Tyr165
170 175Thr Ser Ala Gly Ile Ser Val Thr Val
Lys Glu Leu Phe Pro Ala Pro180 185 190Val
Leu Asn Ala Ser Val Thr Ser Pro Leu Leu Glu Gly Asn Leu Val195
200 205Thr Leu Ser Cys Glu Thr Lys Leu Leu Leu Gln
Arg Pro Gly Leu Gln210 215 220Leu Tyr Phe
Ser Phe Tyr Met Gly Ser Lys Thr Leu Arg Gly Arg Asn225
230 235 240Thr Ser Ser Glu Tyr Gln Ile
Leu Thr Ala Arg Arg Glu Asp Ser Gly245 250
255Leu Tyr Trp Cys Glu Ala Ala Thr Glu Asp Gly Asn Val Leu Lys Arg260
265 270Ser Pro Glu Leu Glu Leu Gln Val Leu
Gly Leu Gln Leu Pro Thr Pro275 280 285Val
Trp Phe His Val Leu Phe Tyr Leu Ala Val Gly Ile Met Phe Leu290
295 300Val Asn Thr Val Leu Trp Val Thr Ile Arg Lys
Glu Leu Lys Arg Lys305 310 315
320Lys Lys Trp Asp Leu Glu Ile Ser Leu Asp Ser Gly His Glu Lys
Lys325 330 335Val Ile Ser Ser Leu Gln Glu
Asp Arg His Leu Glu Glu Glu Leu Lys340 345
350Cys Gln Glu Gln Lys Glu Glu Gln Leu Gln Glu Gly Val His Arg Lys355
360 365Glu Pro Gln Gly Ala
Thr37031586DNAhomo sapiens 31aaaacactct gtgtggctcc tcggctttga cagagtgcaa
gacgatgact tgcaaaatgt 60cgcagctgga acgcaacata gagaccatca tcaacacctt
ccaccaatac tctgtgaagc 120tggggcaccc agacaccctg aaccaggggg aattcaaaga
gctggtgcga aaagatctgc 180aaaattttct caagaaggag aataagaatg aaaaggtcat
agaacacatc atggaggacc 240tggacacaaa tgcagacaag cagctgagct tcgaggagtt
catcatgctg atggcgaggc 300taacctgggc ctcccacgag aagatgcacg agggtgacga
gggccctggc caccaccata 360agccaggcct cggggagggc accccctaag accacagtgg
ccaagatcac agtggccacg 420gccacggcca cagtcatggt ggccacggcc acagccacta
atcaggaggc caggccaccc 480tgcctctacc caaccagggc cccggggcct gttatgtcaa
actgtcttgg ctgtggggct 540aggggctggg gccaaataaa gtctcttcct ccaagtcagt
gctctg 58632114PRThomo sapiens 32Met Thr Cys Lys Met
Ser Gln Leu Glu Arg Asn Ile Glu Thr Ile Ile1 5
10 15Asn Thr Phe His Gln Tyr Ser Val Lys Leu Gly
His Pro Asp Thr Leu20 25 30Asn Gln Gly
Glu Phe Lys Glu Leu Val Arg Lys Asp Leu Gln Asn Phe35 40
45Leu Lys Lys Glu Asn Lys Asn Glu Lys Val Ile Glu His
Ile Met Glu50 55 60Asp Leu Asp Thr Asn
Ala Asp Lys Gln Leu Ser Phe Glu Glu Phe Ile65 70
75 80Met Leu Met Ala Arg Leu Thr Trp Ala Ser
His Glu Lys Met His Glu85 90 95Gly Asp
Glu Gly Pro Gly His His His Lys Pro Gly Leu Gly Glu Gly100
105 110Thr Pro331970DNAhomo sapiens 33atattggagc
agcaagaggc tgggaagcca tcacttacct tgcactgaga aagaagacaa 60aggccagtat
gcacagcttt cctccactgc tgctgctgct gttctggggt gtggtgtctc 120acagcttccc
agcgactcta gaaacacaag agcaagatgt ggacttagtc cagaaatacc 180tggaaaaata
ctacaacctg aagaatgatg ggaggcaagt tgaaaagcgg agaaatagtg 240gcccagtggt
tgaaaaattg aagcaaatgc aggaattctt tgggctgaaa gtgactggga 300aaccagatgc
tgaaaccctg aaggtgatga agcagcccag atgtggagtg cctgatgtgg 360ctcagtttgt
cctcactgag ggaaaccctc gctgggagca aacacatctg aggtacagga 420ttgaaaatta
cacgccagat ttgccaagag cagatgtgga ccatgccatt gagaaagcct 480tccaactctg
gagtaatgtc acacctctga cattcaccaa ggtctctgag ggtcaagcag 540acatcatgat
atcttttgtc aggggagatc atcgggacaa ctctcctttt gatggacctg 600gaggaaatct
tgctcatgct tttcaaccag gcccaggtat tggaggggat gctcattttg 660atgaagatga
aaggtggacc aacaatttca gagagtacaa cttacatcgt gttgcggctc 720atgaactcgg
ccattctctt ggactctccc attctactga tatcggggct ttgatgtacc 780ctagctacac
cttcagtggt gatgttcagc tagctcagga tgacattgat ggcatccaag 840ccatatatgg
acgttcccaa aatcctgtcc agcccatcgg cccacaaacc ccaaaagcgt 900gtgacagtaa
gctaaccttt gatgctataa ctacgattcg gggagaagtg atgttcttta 960aagacagatt
ctacatgcgc acaaatccct tctacccgga agttgagctc aatttcattt 1020ctgttttctg
gccacaactg ccaaatgggc ttgaagctgc ttacgaattt gccgacagag 1080atgaagtccg
gtttttcaaa gggaataagt actgggctgt tcagggacag aatgtgctac 1140acggataccc
caaggacatc tacagctcct ttggcttccc tagaactgtg aagcatatcg 1200atgctgctct
ttctgaggaa aacactggaa aaacctactt ctttgttgct aacaaatact 1260ggaggtatga
tgaatataaa cgatctatgg atccaagtta tcccaaaatg atagcacatg 1320actttcctgg
aattggccac aaagttgatg cagttttcat gaaagatgga tttttctatt 1380tctttcatgg
aacaagacaa tacaaatttg atcctaaaac gaagagaatt ttgactctcc 1440agaaagctaa
tagctggttc aactgcagga aaaattgaac attactaatt tgaatggaaa 1500acacatggtg
tgagtccaaa gaaggtgttt tcctgaagaa ctgtctattt tctcagtcat 1560ttttaacctc
tagagtcact gatacacaga atataatctt atttatacct cagtttgcat 1620atttttttac
tatttagaat gtagcccttt ttgtactgat ataatttagt tccacaaatg 1680gtgggtacaa
aaagtcaagt ttgtggctta tggattcata taggccagag ttgcaaagat 1740cttttccaga
gtatgcaact ctgacgttga tcccagagag cagcttcagt gacaaacata 1800tcctttcaag
acagaaagag acaggagaca tgagtctttg ccggaggaaa agcagctcaa 1860gaacacatgt
gcagtcactg gtgtcaccct agataggcaa gggataactc ttctaacaca 1920aaataagtgt
tttatgtttg gaataaagtc aaccttgttt ctactgtttt 197034469PRThomo
sapiens 34Met His Ser Phe Pro Pro Leu Leu Leu Leu Leu Phe Trp Gly Val
Val1 5 10 15Ser His Ser
Phe Pro Ala Thr Leu Glu Thr Gln Glu Gln Asp Val Asp20 25
30Leu Val Gln Lys Tyr Leu Glu Lys Tyr Tyr Asn Leu Lys
Asn Asp Gly35 40 45Arg Gln Val Glu Lys
Arg Arg Asn Ser Gly Pro Val Val Glu Lys Leu50 55
60Lys Gln Met Gln Glu Phe Phe Gly Leu Lys Val Thr Gly Lys Pro
Asp65 70 75 80Ala Glu
Thr Leu Lys Val Met Lys Gln Pro Arg Cys Gly Val Pro Asp85
90 95Val Ala Gln Phe Val Leu Thr Glu Gly Asn Pro Arg
Trp Glu Gln Thr100 105 110His Leu Thr Tyr
Arg Ile Glu Asn Tyr Thr Pro Asp Leu Pro Arg Ala115 120
125Asp Val Asp His Ala Ile Glu Lys Ala Phe Gln Leu Trp Ser
Asn Val130 135 140Thr Pro Leu Thr Phe Thr
Lys Val Ser Glu Gly Gln Ala Asp Ile Met145 150
155 160Ile Ser Phe Val Arg Gly Asp His Arg Asp Asn
Ser Pro Phe Asp Gly165 170 175Pro Gly Gly
Asn Leu Ala His Ala Phe Gln Pro Gly Pro Gly Ile Gly180
185 190Gly Asp Ala His Phe Asp Glu Asp Glu Arg Trp Thr
Asn Asn Phe Arg195 200 205Glu Tyr Asn Leu
His Arg Val Ala Ala His Glu Leu Gly His Ser Leu210 215
220Gly Leu Ser His Ser Thr Asp Ile Gly Ala Leu Met Tyr Pro
Ser Tyr225 230 235 240Thr
Phe Ser Gly Asp Val Gln Leu Ala Gln Asp Asp Ile Asp Gly Ile245
250 255Gln Ala Ile Tyr Gly Arg Ser Gln Asn Pro Val
Gln Pro Ile Gly Pro260 265 270Gln Thr Pro
Lys Ala Cys Asp Ser Lys Leu Thr Phe Asp Ala Ile Thr275
280 285Thr Ile Arg Gly Glu Val Met Phe Phe Lys Asp Arg
Phe Tyr Met Arg290 295 300Thr Asn Pro Phe
Tyr Pro Glu Val Glu Leu Asn Phe Ile Ser Val Phe305 310
315 320Trp Pro Gln Leu Pro Asn Gly Leu Glu
Ala Ala Tyr Glu Phe Ala Asp325 330 335Arg
Asp Glu Val Arg Phe Phe Lys Gly Asn Lys Tyr Trp Ala Val Gln340
345 350Gly Gln Asn Val Leu His Gly Tyr Pro Lys Asp
Ile Tyr Ser Ser Phe355 360 365Gly Phe Pro
Arg Thr Val Lys His Ile Asp Ala Ala Leu Ser Glu Glu370
375 380Asn Thr Gly Lys Thr Tyr Phe Phe Val Ala Asn Lys
Tyr Trp Arg Tyr385 390 395
400Asp Glu Tyr Lys Arg Ser Met Asp Pro Gly Tyr Pro Lys Met Ile Ala405
410 415His Asp Phe Pro Gly Ile Gly His Lys
Val Asp Ala Val Phe Met Lys420 425 430Asp
Gly Phe Phe Tyr Phe Phe His Gly Thr Arg Gln Tyr Lys Phe Asp435
440 445Pro Lys Thr Lys Arg Ile Leu Thr Leu Gln Lys
Ala Asn Ser Trp Phe450 455 460Asn Cys Arg
Lys Asn465352995DNAhomo sapiens 35tcttcctcag catttcctgc caaccctttt
ctggtttctg tttcttcaac ctctttttgt 60tttatggtcc cttttatggt attttctctt
atttctagga aaacattaat gataggtttt 120tgaacacttc ccctgagtag tctctgttgc
aggttgcttt tttgtttgct ctgccctctg 180tctttcatac tagaggcctt gctcaaatgt
ctggtgacct tggcaatgtg ctaatattta 240aaaaccaaga acaaaaaaat taattggtaa
ccctgaacat gagtggagct tgtcaactgg 300atttcacttt ttgatagtct ggcagagact
ttttcttcag gaacttccag cgacaatatc 360tttaaagctt ttttcttgag ccaatcagat
tctctgagaa gttgcttcct atcttctgcc 420cggaaagaaa aatcttgtct ggcagcattc
tcgcagctag gtgatgacta aagcagggat 480ttttaccatt cagtatggaa gcttttgttt
aattcacctg tttttcacct gatttccatc 540agtcccaagt tgatctctta cactctttct
agagactaga ccttactctg ctgctgaaaa 600gaaagaagag agagaattgg taaaagggtt
ttgagactct acttcataaa caagctttaa 660accagttctt atatctacag cctatcttta
ccctcatttc cagaagtacc tggtgctgtc 720aattcctgtg ctatttggag tttcaagata
taaatcaggt tatttcttgg ttttctccat 780ggatagctta ggatttagct ttctctgctc
tgtaaagcta tccatcttac tttctaagct 840ttcaaatttt tggtagggtt ttctctttcc
ctatttggct ttgtatattg atgtcttttt 900tattttttta ctgccattgg agagggtttt
caggaaggag cagaggctaa tgcatgcgtg 960tcacttacta tctttaactg caagttcaat
tctaattaat atctattcca tttgcatcac 1020aattgattca tgatctcaga tgactcacag
agattttacc tacagctgtt atctaggctc 1080ctttatctat ttttccttcc cggatattgt
ttagattcca ttggcttaca tcgagtagag 1140aacatcagcc atacggaacc tgctgtgagc
cttcacttgt acagtccacc ttttgataca 1200tgccatgcct ttgatcaaag aacaggacat
aaaaacaaag tcacaatgac attccatagt 1260aaatttggaa tcagaactcc aaatgtgagt
ataatttctt ctaggtttaa atgctctgta 1320ggttggcact gttacactgc atgtatgcaa
agaatgagat gagtcttaat tcatggataa 1380ggcccaatat atcttgattg ttttatttaa
ctttagcgac tatcttttca atttattttt 1440aaaaacttat tatgttagat ccaaacatta
gttgagaaat ttcaaaatgt atgcttgttt 1500ttaaagaaaa tgttttcatt tacttgggaa
atgagagtga aaactattat ttgatataac 1560tgttactgcc atggcttact atgcataggt
ctaatttgct gggccaacag ggataagttg 1620cataattaac ctttgtaaag gttattggct
gatgatataa ctaaagcaaa ttgtctgttt 1680tgtttgccaa tgttgcttat tcttagagtt
gttatgccat ttataccaca aataagaata 1740gactatacta acatgttcct ccttgagaaa
caagcatttc ctaccaaaaa taaaaaggca 1800accaacacta atatagcagg gcagtcttct
acctctgaaa taagtttgtc atttagagga 1860atagtcttta attatcagaa tatccagaaa
tagacaatgt gtgaaaatgg agacccaagc 1920aatccttgag tcttaatgaa agcgcagcct
ctgagggaag ccagggcaga attttctcat 1980tatcgctccg cttcatcttt atcttccaca
ttccaaaccc taagagatat tcttattgcg 2040ggaaaaacaa caaggctccc ttgcccttgc
tgagttttca tacactgcta caaaagcaga 2100actatttaga aggagttaaa atgtcttttg
taaagtttct tacacagctt tctttttttc 2160ccttttttac aggcaacttc gggctcgctg
gagaacaact aaggggcacc aaagccctct 2220gaggttttac tttaaggttc gctgtatgtt
tgccttggac aaaaaggcta cctaccacgt 2280gctatccagt aatatactta aataagccaa
tacttagatc tactgtaagg cagatgctaa 2340ttataaggca ttaagtaagc aaatagtgcc
ctcagctact gcagaagaaa agtcccactg 2400aggaaaagaa agtcttgtga tttttaaagg
caagttttca agtgctctca tagttctatc 2460ctctaattcc attaaatcca tactaggagc
gtcagtgagg gttttcatag cttttggaaa 2520tactttggtc tctgaactgt aattagcgca
agaagtaaaa acagaaacgt caaacgtcaa 2580atgtttgctt tgttacctgg aggactaaat
gtagatgtct ttagtatact ttgtatgttc 2640ttaaatattg gaagataatt ttgtgaatct
gtagatttta ttttttcagt cttaccttac 2700aaatttcttt tctatgaata atagaggaac
tcacggcact ctgccacttg ttaatgaaag 2760gaagtgcaga ggatttagaa aagtacatga
tccccagacc acaacaaacc aaaacataaa 2820ctcatgtctg tgtcccatgg tcatagtcaa
agattttgta ctgctaaaat taccaaataa 2880tttaaataaa gtggatttga acacaatttg
aaggtgtctt tctgattaac atgatagaaa 2940cttcacataa atcagtttct tagatctaga
tatacaaaag cactgtgaca aatgg 299536200PRThomo sapiens 36Met Glu Gln
Thr Glu Val Leu Lys Pro Arg Thr Leu Ala Asp Leu Ile1 5
10 15Arg Ile Leu His Gln Leu Phe Ala Gly
Asp Glu Val Asn Val Glu Glu20 25 30Val
Gln Ala Ile Met Glu Ala Tyr Glu Ser Asp Pro Ile Glu Trp Ala35
40 45Met Tyr Ala Lys Phe Asp Gln Tyr Arg Tyr Thr
Arg Asn Leu Val Asp50 55 60Gln Gly Asn
Gly Lys Phe Asn Leu Met Ile Leu Cys Trp Gly Glu Gly65 70
75 80His Gly Ser Ser Ile His Asp His
Thr Asn Ser His Cys Phe Leu Lys85 90
95Met Leu Gln Gly Asn Leu Lys Glu Thr Leu Phe Ala Trp Pro Asp Lys100
105 110Lys Ser Asn Glu Met Val Lys Lys Ser Glu
Arg Val Leu Arg Glu Asn115 120 125Gln Cys
Ala Tyr Ile Asn Asp Ser Ile Gly Leu His Arg Val Glu Asn130
135 140Ile Ser His Thr Glu Pro Ala Val Ser Leu His Leu
Tyr Ser Pro Pro145 150 155
160Phe Asp Thr Cys His Ala Phe Asp Gln Arg Thr Gly His Lys Asn Lys165
170 175Val Thr Met Thr Phe His Ser Lys Phe
Gly Ile Arg Thr Pro Asn Ala180 185 190Thr
Ser Gly Ser Leu Glu Asn Asn195 200371763DNAhomo sapiens
37gcactggact gagaaccttc accaaaaaaa tgtctgccca gagacagatg aggtccttca
60gctccagtgc tgattggttc ttttccaaag gcccatctaa tcctaccacg cacggaaata
120tccacaggtt tttattcttt ctgccagcta catcagatcc atcaggtccg agctgagttg
180actaccacta cttttccctt tgtctcaatt atgtcttgga agaaggcttt gcggatcccc
240ggaggccttc gggcaccaac tgtgaccttg atgctggcga tgctgagcac cccagtggct
300gagggcagag accctcccga ggatttcgtg ctccagttta aggccatgtg ctacttcacc
360aatgggacgg agcgcgtgcg ttatgtgacc agatacatct ataaccgaga ggaggacgtg
420cgcttcgaca gcgacgtggg ggtgtatcgg gcggtgacgg cgcaggggcg gcctgacgcc
480gagtactgga acagccagaa ggacatcctg gagaggaccc gagcggagtt ggacacggtg
540tgcagacaca actacgaggt ggcgttccgc gggatcttgc agaggagagt ggagcccaca
600gtgaccatct ccccatccag gacagaggcc ctcaaccacc acaacctgct ggtctgctcg
660gtgacagatt tctatccagg ccagatcaaa gtccggtggt ttcggaatga ccaggaggag
720acagctggcg ttgtgtccac cccccttatt aggaacggtg actggacctt ccagatcctg
780gtgatgctgg aaatgactcc ccagcatgga gacgtctaca cctgccacgt ggagcacccc
840agcctccaga gccccatcac cgtggagtgg cgggctcagt ctgaatctgc ccagaacaag
900atgctgagtg gcattggagg cttcgtgctg gggctgatct tcctcgggct gggccttatc
960atccgtcaaa ggagtcagaa aggacctcaa gggcctccac cagcagggct tctgcactga
1020ctcctgagac tattttaact aggattggtt atcactcttc tgtgatgcct gcttgtgcct
1080gcccagaatt cccagctgcc tgtgtcagct tgtcccccga gatcaaagtc ctacagtggc
1140tgtcacgcag ccaccaggtc atctcctttc atccccaccc caaggcgctg gctgtgactc
1200tgcttcctgc actgacccag agcctctgcc tgtgcacggc cagctgcgtc tactcaggtc
1260ccaaggggtt tctgtttcta ttctctcctc agactgctca agagaagcac atgaaaaaca
1320ttacctgact ttagagcttt tttacataat taaacatgat cctgagttaa aaaaaaaaaa
1380ggaaatcgct gcagaatgaa ggaatatccc ttgaggtgac ccagccaacc tgtggccaga
1440aggagggttg taccttgaaa agaccactga aagcattttg gggtgtcaag taagggtggg
1500cagaggaggt agaaaatcaa ttcaattgtc gcatcattca tggttcttta atattgatgc
1560tcagtgcatt ggccttagaa tatcccagcc tctcttctgg tttggtgagt gctgtgtaag
1620taagcatggt agaattgttt ggagacatat atagtgatcc ttggtcactg gtgtttcaaa
1680cattctggaa agtcacatcg atcaagaata ttttttattt ttaagaaagc ataaccagca
1740ataaaaatac tatttttgag tct
176338269PRThomo sapiens 38Met Ser Trp Lys Lys Ala Leu Arg Ile Pro Gly
Gly Leu Arg Ala Pro1 5 10
15Thr Val Thr Leu Met Leu Ala Met Leu Ser Thr Pro Val Ala Glu Gly20
25 30Arg Asp Pro Pro Glu Asp Phe Val Leu Gln
Phe Lys Ala Met Cys Tyr35 40 45Phe Thr
Asn Gly Thr Glu Arg Val Arg Tyr Val Thr Arg Tyr Ile Tyr50
55 60Asn Arg Glu Glu Asp Val Arg Phe Asp Ser Asp Val
Gly Val Tyr Arg65 70 75
80Ala Val Thr Ala Gln Gly Arg Pro Asp Ala Glu Tyr Trp Asn Ser Gln85
90 95Lys Asp Ile Leu Glu Arg Thr Arg Ala Glu
Leu Asp Thr Val Cys Arg100 105 110His Asn
Tyr Glu Val Ala Phe Arg Gly Ile Leu Gln Arg Arg Val Glu115
120 125Pro Thr Val Thr Ile Ser Pro Ser Arg Thr Glu Ala
Leu Asn His His130 135 140Asn Leu Leu Val
Cys Ser Val Thr Asp Phe Tyr Pro Gly Gln Ile Lys145 150
155 160Val Arg Trp Phe Arg Asn Asp Gln Glu
Glu Thr Ala Gly Val Val Ser165 170 175Thr
Pro Leu Ile Arg Asn Gly Asp Trp Thr Phe Gln Ile Leu Val Met180
185 190Leu Glu Met Thr Pro Gln His Gly Asp Val Tyr
Thr Cys His Val Glu195 200 205His Pro Ser
Leu Gln Ser Pro Ile Thr Val Glu Trp Arg Ala Gln Ser210
215 220Glu Ser Ala Gln Asn Lys Met Leu Ser Gly Ile Gly
Gly Phe Val Leu225 230 235
240Gly Leu Ile Phe Leu Gly Leu Gly Leu Ile Ile Arg Gln Arg Ser Gln245
250 255Lys Gly Pro Gln Gly Pro Pro Pro Ala
Gly Leu Leu His260 265391404DNAhomo sapiens 39gaattcggct
gtcgcactta ctgttcaata gtatatactc tgtatttgaa aaatagatgt 60atatattcta
ggtgataaat taaaaatgaa agaatttaat cattggaaag tattaaatat 120atattgctta
tcttctccaa ggaagaggag ttctctcgta cccatccaaa ctgacctaat 180tctcaagctg
cttcatcttg cttgtactgt aggttcattt gcaatttgta gattatgctc 240cttcaggatt
ggcttttgta aatttctgtt agaagctggt ttctgcattt ttgatttttg 300tgtatttgga
tacattttca tattgtgcag agaaatccat gagttaaaaa attatttttc 360cctgttttat
ttctgcatga acctaagtca cattgaccca gtaattgata tatgtgtgat 420tattgcaatt
aagtataaga aggtagaata tatagtttta ttagacagat gcttcctgaa 480atattatttt
gtatgttttt actatatcct ttttgtgtat ctacagatac aacagacatg 540caagagaatg
gactcagaaa tatgcaatgt aaaaatcaaa aacattttca tatataacca 600gagtactgta
aaatctaggt tttttttcaa cattagcagt aaattgagca ctgtttacct 660gtttcattgt
accatgaaac catttgattt ttaccatttt aaatgtgtct caagcaagac 720aaaacaaact
tccaaaaata cccttaagac tgtgatgaga gcatttatca ttttgtatgc 780attgagaaag
acatttatta tggtttttaa gatacttgga catctgcatc ttcagcttac 840aagatctaca
atgcagctga aaaagcaacc aaattatttt ttgctgaaaa ctagatgttt 900tttacatgag
aaaatactgt atgtgtgtct aagatgtcag ttttataaat ctgtattcag 960atttcatcct
ttgttagctc actttataat ttgtattttt tttctgtata gaactaaata 1020tattctattt
acatgtatgt caactcatta cttttttcct gtgaacagta ttgaaaaccc 1080caaccggctg
ataattaagt gaattaactg tgtctccctt gtcttaggat attctgtaga 1140ttgattgcag
atttcttaaa tctgaaatga ctttacactg taattctcag catactgatt 1200atggagaaca
cttgttttga attttgttat acttgactta actttattgc aatgtgaatt 1260aattgactgc
taagtaggaa gatgtgtaac ttttatttgt tgctattcac atttgaattt 1320tttcctgtat
aggcaatatt atattgacac cttttacaga tcttactgta gcaaaaacca 1380tataaataaa
atgctttttc tgct 140440338PRThomo
sapiens 40Met Lys Glu Phe Asn His Trp Lys Val Leu Asn Ile Tyr Cys Leu
Ser1 5 10 15Ser Pro Arg
Lys Arg Ser Ser Leu Val Pro Ile Gln Thr Asp Leu Ile20 25
30Leu Lys Leu Leu His Leu Ala Cys Thr Val Gly Ser Phe
Ala Ile Cys35 40 45Arg Leu Cys Ser Phe
Arg Ile Gly Phe Cys Lys Phe Leu Leu Glu Ala50 55
60Gly Phe Cys Ile Phe Asp Phe Cys Val Phe Gly Tyr Ile Phe Ile
Leu65 70 75 80Cys Arg
Glu Ile His Glu Leu Lys Asn Tyr Phe Ser Leu Phe Tyr Phe85
90 95Cys Met Asn Leu Ser His Ile Asp Pro Val Ile Asp
Ile Cys Val Ile100 105 110Ile Ala Ile Lys
Tyr Lys Lys Val Glu Tyr Ile Val Leu Leu Asp Arg115 120
125Cys Phe Leu Lys Tyr Tyr Phe Val Cys Phe Tyr Tyr Ile Leu
Phe Val130 135 140Tyr Leu Gln Ile Gln Gln
Thr Cys Lys Arg Met Asp Ser Glu Ile Cys145 150
155 160Asn Val Lys Ile Lys Asn Ile Phe Ile Tyr Asn
Gln Ser Thr Val Lys165 170 175Ser Arg Phe
Phe Phe Asn Ile Ser Ser Lys Leu Ser Thr Val Tyr Leu180
185 190Phe His Cys Thr Met Lys Pro Phe Asp Phe Tyr His
Phe Lys Cys Val195 200 205Ser Ser Lys Thr
Lys Gln Thr Ser Lys Asn Thr Leu Lys Thr Val Met210 215
220Arg Ala Phe Ile Ile Leu Tyr Ala Leu Arg Lys Thr Phe Ile
Met Val225 230 235 240Phe
Lys Ile Leu Gly His Leu His Leu Gln Leu Thr Arg Ser Thr Met245
250 255Gln Leu Lys Lys Gln Pro Asn Tyr Phe Leu Leu
Lys Thr Arg Cys Phe260 265 270Leu His Glu
Lys Ile Leu Tyr Val Cys Leu Arg Cys Gln Phe Tyr Lys275
280 285Ser Val Phe Arg Phe His Pro Leu Leu Ala His Phe
Ile Ile Cys Ile290 295 300Phe Phe Leu Tyr
Arg Thr Lys Tyr Ile Leu Phe Thr Cys Met Ser Thr305 310
315 320His Tyr Phe Phe Pro Val Asn Ser Ile
Glu Asn Pro Asn Arg Leu Ile325 330 335Ile
Lys412881DNAhomo sapiens 41acagaagtgc tagaagccag tgctcgtgaa ctaaggagaa
aaagaacaga caagggaaca 60gcctggacat ggcatcagag atccacatga caggcccaat
gtgcctcatt gagaacacta 120atgggcgact gatggcgaat ccagaagctc tgaagatcct
ttctgccatt acacagccta 180tggtggtggt ggcaattgtg ggcctctacc gcacaggcaa
atcctacctg atgaacaagc 240tggctggaaa gaaaaagggc ttctctctgg gctccacggt
gcagtctcac actaaaggaa 300tctggatgtg gtgtgtgccc caccccaaga agccaggcca
catcctagtt ctgctggaca 360ccgagggtct gggagatgta gagaagggtg acaaccagaa
tgactcctgg atcttcgccc 420tggccgtcct cctgagcagc accttcgtgt acaatagcat
aggaaccatc aaccagcagg 480ctatggacca actgtactat gtgacagagc tgacacatag
aatccgatca aaatcctcac 540ctgatgagaa tgagaatgag gttgaggatt cagctgactt
tgtgagcttc ttcccagact 600ttgtgtggac actgagagat ttctccctgg acttggaagc
agatggacaa cccctcacac 660cagatgagta cctgacatac tccctgaagc tgaagaaagg
taccagtcaa aaagatgaaa 720cttttaacct gcccagactc tgtatccgga aattcttccc
aaagaaaaaa tgctttgtct 780ttgatcggcc cgttcaccgc aggaagcttg cccagctcga
gaaactacaa gatgaagagc 840tggaccccga atttgtgcaa caagtagcag acttctgttc
ctacatcttt agtaattcca 900aaactaaaac tctttcagga ggcatccagg tcaacgggcc
tcgtctagag agcctggtgc 960tgacctacgt caatgccatc agcagtgggg atctgccgtg
catggagaac gcagtcctgg 1020ccttggccca gatagagaac tcagctgcag tgcaaaaggc
tattgcccac tatgaacagc 1080agatgggcca gaaggtgcag ctgcccacag aaagcctcca
ggagctgctg gacctgcaca 1140gggacagtga gagagaggcc attgaagtct tcatcaggag
ttccttcaaa gatgtggacc 1200atctatttca aaaggagtta gcggcccagc tagaaaaaaa
gcgggatgac ttttgtaaac 1260agaatcagga agcatcatca gatcgttgct caggtttact
tcaggtcatt ttcagtcctc 1320tagaagaaga agtgaaggcg ggaatttatt cgaaaccagg
gggctatcgt ctctttgttc 1380agaagctaca agacctgaag aaaaagtact atgaggaacc
gaggaagggg atacaggctg 1440aagagattct gcagacatac ttgaaatcca aggagtctat
gactgatgca attctccaga 1500cagaccagac tctcacagaa aaagaaaagg agattgaagt
ggaacgtgtg aaagctgagt 1560ctgcacaggc ttcagcaaaa atgttgcagg aaatgcaaag
aaagaatgag cagatgatgg 1620aacagaagga gaggagttat caggaacact tgaaacaact
gactgagaag atggagaacg 1680acagggtcca gttgctgaaa gagcaagaga ggaccctcgc
tcttaaactt caggaacagg 1740agcaactact aaaagaggga tttcaaaaag aaagcagaat
aatgaaaaat gagatacagg 1800atctccagac gaaaatgaga cgacgaaagg catgtaccat
aagctaaaga ccagagcctt 1860cctgtcaccc ctaaccaagg cataattgaa acaattttag
aatttggaac aagcgtcact 1920acatttgata ataattagat cttgcatcat aacaccaaaa
gtttataaag gcatgtggta 1980caatgatcaa aatcatgttt tttcttaaaa aaaaaaaaaa
gactgtaaat tgtgcaacaa 2040agatgcattt acctctgtat caactcagga aatctcataa
gctggtacca ctcaggagaa 2100gtttattctt ccagatgacc agcagtagac aaatggatac
tgagcagagt cttaggtaaa 2160agtcttggga aatatttggg cattggtctg gccaagtcta
caatgtccca atatcaagga 2220caaccaccct agcttcttag tgaagacaat gtacagttat
ccattagatc aagactacac 2280ggtctatgag caataatgtg atttctggac attgcccatg
tataatcctc actgatgatt 2340tcaagctaaa gcaaaccacc ttatacagag atctagaatc
tctttatgtt ctccagagga 2400aggtggaaga aaccatgggc aggagtagga attgagtgat
aaacaattgg gctaatgaag 2460aaaacttctc ttattgttca gttcatccag attataactt
caatgggaca ctttagacca 2520ttagacaatt gacactggat taaacaaatt cacataatgc
caaatacaca atgtatttat 2580agcaacgtat aatttgcaaa gatggacttt aaaagatgct
gtgtaactaa actgaaataa 2640ttcaattact tattatttag aatgttaaag cttatgatag
tcttttctaa ttcttaacac 2700tcatacttga aatctttccg agtttcccca gaagagaata
tgggattttt tttgacattt 2760ttgacccatt taataatgct cttgtgttta cctagtatat
gtagactttg tcttatgtgt 2820caaaagtcct aggaaagtgg ttgatgtttc ttatagcaat
taaaaattat ttttgaactg 2880a
288142592PRThomo sapiens 42Met Ala Ser Glu Ile His
Met Thr Gly Pro Met Cys Leu Ile Glu Asn1 5
10 15Thr Asn Gly Arg Leu Met Ala Asn Pro Glu Ala Leu
Lys Ile Leu Ser20 25 30Ala Ile Thr Gln
Pro Met Val Val Val Ala Ile Val Gly Leu Tyr Arg35 40
45Thr Gly Lys Ser Tyr Leu Met Asn Lys Leu Ala Gly Lys Lys
Lys Gly50 55 60Phe Ser Leu Gly Ser Thr
Val Gln Ser His Thr Lys Gly Ile Trp Met65 70
75 80Trp Cys Val Pro His Pro Lys Lys Pro Gly His
Ile Leu Val Leu Leu85 90 95Asp Thr Glu
Gly Leu Gly Asp Val Glu Lys Gly Asp Asn Gln Asn Asp100
105 110Ser Trp Ile Phe Ala Leu Ala Val Leu Leu Ser Ser
Thr Phe Val Tyr115 120 125Asn Ser Ile Gly
Thr Ile Asn Gln Gln Ala Met Asp Gln Leu Tyr Tyr130 135
140Val Thr Glu Leu Thr His Arg Ile Arg Ser Lys Ser Ser Pro
Asp Glu145 150 155 160Asn
Glu Asn Glu Val Glu Asp Ser Ala Asp Phe Val Ser Phe Phe Pro165
170 175Asp Phe Val Trp Thr Leu Arg Asp Phe Ser Leu
Asp Leu Glu Ala Asp180 185 190Gly Gln Pro
Leu Thr Pro Asp Glu Tyr Leu Thr Tyr Ser Leu Lys Leu195
200 205Lys Lys Gly Thr Ser Gln Lys Asp Glu Thr Phe Asn
Leu Pro Arg Leu210 215 220Cys Ile Arg Lys
Phe Phe Pro Lys Lys Lys Cys Phe Val Phe Asp Arg225 230
235 240Pro Val His Arg Arg Lys Leu Ala Gln
Leu Glu Lys Leu Gln Asp Glu245 250 255Glu
Leu Asp Pro Glu Phe Val Gln Gln Val Ala Asp Phe Cys Ser Tyr260
265 270Ile Phe Ser Asn Ser Lys Thr Lys Thr Leu Ser
Gly Gly Ile Gln Val275 280 285Asn Gly Pro
Arg Leu Glu Ser Leu Val Leu Thr Tyr Val Asn Ala Ile290
295 300Ser Ser Gly Asp Leu Pro Cys Met Glu Asn Ala Val
Leu Ala Leu Ala305 310 315
320Gln Ile Glu Asn Ser Ala Ala Val Gln Lys Ala Ile Ala His Tyr Glu325
330 335Gln Gln Met Gly Gln Lys Val Gln Leu
Pro Thr Glu Ser Leu Gln Glu340 345 350Leu
Leu Asp Leu His Arg Asp Ser Glu Arg Glu Ala Ile Glu Val Phe355
360 365Ile Arg Ser Ser Phe Lys Asp Val Asp His Leu
Phe Gln Lys Glu Leu370 375 380Ala Ala Gln
Leu Glu Lys Lys Arg Asp Asp Phe Cys Lys Gln Asn Gln385
390 395 400Glu Ala Ser Ser Asp Arg Cys
Ser Gly Leu Leu Gln Val Ile Phe Ser405 410
415Pro Leu Glu Glu Glu Val Lys Ala Gly Ile Tyr Ser Lys Pro Gly Gly420
425 430Tyr Arg Leu Phe Val Gln Lys Leu Gln
Asp Leu Lys Lys Lys Tyr Tyr435 440 445Glu
Glu Pro Arg Lys Gly Ile Gln Ala Glu Glu Ile Leu Gln Thr Tyr450
455 460Leu Lys Ser Lys Glu Ser Met Thr Asp Ala Ile
Leu Gln Thr Asp Gln465 470 475
480Thr Leu Thr Glu Lys Glu Lys Glu Ile Glu Val Glu Arg Val Lys
Ala485 490 495Glu Ser Ala Gln Ala Ser Ala
Lys Met Leu Gln Glu Met Gln Arg Lys500 505
510Asn Glu Gln Met Met Glu Gln Lys Glu Arg Ser Tyr Gln Glu His Leu515
520 525Lys Gln Leu Thr Glu Lys Met Glu Asn
Asp Arg Val Gln Leu Leu Lys530 535 540Glu
Gln Glu Arg Thr Leu Ala Leu Lys Leu Gln Glu Gln Glu Gln Leu545
550 555 560Leu Lys Glu Gly Phe Gln
Lys Glu Ser Arg Ile Met Lys Asn Glu Ile565 570
575Gln Asp Leu Gln Thr Lys Met Arg Arg Arg Lys Ala Cys Thr Ile
Ser580 585 590434003DNAhomo sapiens
43attaaacctc tcgccgagcc cctccgcaga ctctgcgccg gaaagtttca tttgctgtat
60gccatcctcg agagctgtct aggttaacgt tcgcactctg tgtatataac ctcgacagtc
120ttggcaccta acgtgctgtg cgtagctgct cctttggttg aatccccagg cccttgttgg
180ggcacaaggt ggcaggatgt ctcagtggta cgaacttcag cagcttgact caaaattcct
240ggagcaggtt caccagcttt atgatgacag ttttcccatg gaaatcagac agtacctggc
300acagtggtta gaaaagcaag actgggagca cgctgccaat gatgtttcat ttgccaccat
360ccgttttcat gacctcctgt cacagctgga tgatcaatat agtcgctttt ctttggagaa
420taacttcttg ctacagcata acataaggaa aagcaagcgt aatcttcagg ataattttca
480ggaagaccca atccagatgt ctatgatcat ttacagctgt ctgaaggaag aaaggaaaat
540tctggaaaac gcccagagat ttaatcaggc tcagtcgggg aatattcaga gcacagtgat
600gttagacaaa cagaaagagc ttgacagtaa agtcagaaat gtgaaggaca aggttatgtg
660tatagagcat gaaatcaaga gcctggaaga tttacaagat gaatatgact tcaaatgcaa
720aaccttgcag aacagagaac acgagaccaa tggtgtggca aagagtgatc agaaacaaga
780acagctgtta ctcaagaaga tgtatttaat gcttgacaat aagagaaagg aagtagttca
840caaaataata gagttgctga atgtcactga acttacccag aatgccctga ttaatgatga
900actagtggag tggaagcgga gacagcagag cgcctgtatt ggggggccgc ccaatgcttg
960cttggatcag ctgcagaact ggttcactat agttgcggag agtctgcagc aagttcggca
1020gcagcttaaa aagttggagg aattggaaca gaaatacacc tacgaacatg accctatcac
1080aaaaaacaaa caagtgttat gggaccgcac cttcagtctt ttccagcagc tcattcagag
1140ctcgtttgtg gtggaaagac agccctgcat gccaacgcac cctcagaggc cgctggtctt
1200gaagacaggg gtccagttca ctgtgaagtt gagactgttg gtgaaattgc aagagctgaa
1260ttataatttg aaagtcaaag tcttatttga taaagatgtg aatgagagaa atacagtaaa
1320aggatttagg aagttcaaca ttttgggcac gcacacaaaa gtgatgaaca tggaggagtc
1380caccaatggc agtctggcgg ctgaatttcg gcacctgcaa ttgaaagaac agaaaaatgc
1440tggcaccaga acgaatgagg gtcctctcat cgttactgaa gagcttcact cccttagttt
1500tgaaacccaa ttgtgccagc ctggtttggt aattgacctc gagacgacct ctctgcccgt
1560tgtggtgatc tccaacgtca gccagctccc gagcggttgg gcctccatcc tttggtacaa
1620catgctggtg gcggaaccca ggaatctgtc cttcttcctg actccaccat gtgcacgatg
1680ggctcagctt tcagaagtgc tgagttggca gttttcttct gtcaccaaaa gaggtctcaa
1740tgtggaccag ctgaacatgt tgggagagaa gcttcttggt cctaacgcca gccccgatgg
1800tctcattccg tggacgaggt tttgtaagga aaatataaat gataaaaatt ttcccttctg
1860gctttggatt gaaagcatcc tagaactcat taaaaaacac ctgctccctc tctggaatga
1920tgggtgcatc atgggcttca tcagcaagga gcgagagcgt gccctgttga aggaccagca
1980gccggggacc ttcctgctgc ggttcagtga gagctcccgg gaaggggcca tcacattcac
2040atgggtggag cggtcccaga acggaggcga acctgacttc catgcggttg aaccctacac
2100gaagaaagaa ctttctgctg ttactttccc tgacatcatt cgcaattaca aagtcatggc
2160tgctgagaat attcctgaga atcccctgaa gtatctgtat ccaaatattg acaaagacca
2220tgcctttgga aagtattact ccaggccaaa ggaagcacca gagccaatgg aacttgatgg
2280ccctaaagga actggatata tcaagactga gttgatttct gtgtctgaag ttcacccttc
2340tagacttcag accacagaca acctgctccc catgtctcct gaggagtttg acgaggtgtc
2400tcggatagtg ggctctgtag aattcgacag tatgatgaac acagtataga gcatgaattt
2460ttttcatctt ctctggcgac agttttcctt ctcatctgtg attccctcct gctactctgt
2520tccttcacat cctgtgtttc tagggaaatg aaagaaaggc cagcaaattc gctgcaacct
2580gttgatagca agtgaatttt tctctaactc agaaacatca gttactctga agggcatcat
2640gcatcttact gaaggtaaaa ttgaaaggca ttctctgaag agtgggtttc acaagtgaaa
2700aacatccaga tacacccaaa gtatcaggac gagaatgagg gtcctttggg aaaggagaag
2760ttaagcaaca tctagcaaat gttatgcata aagtcagtgc ccaactgtta taggttgttg
2820gataaatcag tggttattta gggaactgct tgacgtagga acggtaaatt tctgtgggag
2880aattcttaca tgttttcttt gctttaagtg taactggcag ttttccattg gtttacctgt
2940gaaatagttc aaagccaagt ttatatacaa ttatatcagt cctctttcaa aggtagccat
3000catggatctg gtagggggaa aatgtgtatt ttattacatc tttcacattg gctatttaaa
3060gacaaagaca aattctgttt cttgagaaga gaatattagc tttactgttt gttatggctt
3120aatgacacta gctaatatca atagaaggat gtacatttcc aaattcacaa gttgtgtttg
3180atatccaaag ctgaatacat tctgctttca tcttggtcac atacaattat ttttacagtt
3240ctcccaaggg agttaggcta ttcacaacca ctcattcaaa agttgaaatt aaccatagat
3300gtagataaac tcagaaattt aattcatgtt tcttaaatgg gctactttgt cctttttgtt
3360attagggtgg tatttagtct attagccaca aaattgggaa aggagtagaa aaagcagtaa
3420ctgacaactt gaataataca ccagagataa tatgagaatc agatcatttc aaaactcatt
3480tcctatgtaa ctgcattgag aactgcatat gtttcgctga tatatgtgtt tttcacattt
3540gcgaatggtt ccattctctc tcctgtactt tttccagaca cttttttgag tggatgatgt
3600ttcgtgaagt atactgtatt tttacctttt tccttcctta tcactgacac aaaaagtaga
3660ttaagagatg ggtttgacaa ggttcttccc ttttacatac tgctgtctat gtggctgtat
3720cttgtttttc cactactgct accacaacta tattatcatg caaatgctgt attcttcttt
3780ggtggagata aagatttctt gagttttgtt ttaaaattaa agctaaagta tctgtattgc
3840attaaatata atatcgacac agtgctttcc gtggcactgc atacaatctg aggcctcctc
3900tctcagtttt tatatagatg gcgagaacct aagtttcagt tgattttaca attgaaatga
3960ctaaaaaaca aagaagacaa cattaaaaac aatattgttt cta
400344750PRThomo sapiens 44Met Ser Gln Trp Tyr Glu Leu Gln Gln Leu Asp
Ser Lys Phe Leu Glu1 5 10
15Gln Val His Gln Leu Tyr Asp Asp Ser Phe Pro Met Glu Ile Arg Gln20
25 30Tyr Leu Ala Gln Trp Leu Glu Lys Gln Asp
Trp Glu His Ala Ala Asn35 40 45Asp Val
Ser Phe Ala Thr Ile Arg Phe His Asp Leu Leu Ser Gln Leu50
55 60Asp Asp Gln Tyr Ser Arg Phe Ser Leu Glu Asn Asn
Phe Leu Leu Gln65 70 75
80His Asn Ile Arg Lys Ser Lys Arg Asn Leu Gln Asp Asn Phe Gln Glu85
90 95Asp Pro Ile Gln Met Ser Met Ile Ile Tyr
Ser Cys Leu Lys Glu Glu100 105 110Arg Lys
Ile Leu Glu Asn Ala Gln Arg Phe Asn Gln Ala Gln Ser Gly115
120 125Asn Ile Gln Ser Thr Val Met Leu Asp Lys Gln Lys
Glu Leu Asp Ser130 135 140Lys Val Arg Asn
Val Lys Asp Lys Val Met Cys Ile Glu His Glu Ile145 150
155 160Lys Ser Leu Glu Asp Leu Gln Asp Glu
Tyr Asp Phe Lys Cys Lys Thr165 170 175Leu
Gln Asn Arg Glu His Glu Thr Asn Gly Val Ala Lys Ser Asp Gln180
185 190Lys Gln Glu Gln Leu Leu Leu Lys Lys Met Tyr
Leu Met Leu Asp Asn195 200 205Lys Arg Lys
Glu Val Val His Lys Ile Ile Glu Leu Leu Asn Val Thr210
215 220Glu Leu Thr Gln Asn Ala Leu Ile Asn Asp Glu Leu
Val Glu Trp Lys225 230 235
240Arg Arg Gln Gln Ser Ala Cys Ile Gly Gly Pro Pro Asn Ala Cys Leu245
250 255Asp Gln Leu Gln Asn Trp Phe Thr Ile
Val Ala Glu Ser Leu Gln Gln260 265 270Val
Arg Gln Gln Leu Lys Lys Leu Glu Glu Leu Glu Gln Lys Tyr Thr275
280 285Tyr Glu His Asp Pro Ile Thr Lys Asn Lys Gln
Val Leu Trp Asp Arg290 295 300Thr Phe Ser
Leu Phe Gln Gln Leu Ile Gln Ser Ser Phe Val Val Glu305
310 315 320Arg Gln Pro Cys Met Pro Thr
His Pro Gln Arg Pro Leu Val Leu Lys325 330
335Thr Gly Val Gln Phe Thr Val Lys Leu Arg Leu Leu Val Lys Leu Gln340
345 350Glu Leu Asn Tyr Asn Leu Lys Val Lys
Val Leu Phe Asp Lys Asp Val355 360 365Asn
Glu Arg Asn Thr Val Lys Gly Phe Arg Lys Phe Asn Ile Leu Gly370
375 380Thr His Thr Lys Val Met Asn Met Glu Glu Ser
Thr Asn Gly Ser Leu385 390 395
400Ala Ala Glu Phe Arg His Leu Gln Leu Lys Glu Gln Lys Asn Ala
Gly405 410 415Thr Arg Thr Asn Glu Gly Pro
Leu Ile Val Thr Glu Glu Leu His Ser420 425
430Leu Ser Phe Glu Thr Gln Leu Cys Gln Pro Gly Leu Val Ile Asp Leu435
440 445Glu Thr Thr Ser Leu Pro Val Val Val
Ile Ser Asn Val Ser Gln Leu450 455 460Pro
Ser Gly Trp Ala Ser Ile Leu Trp Tyr Asn Met Leu Val Ala Glu465
470 475 480Pro Arg Asn Leu Ser Phe
Phe Leu Thr Pro Pro Cys Ala Arg Trp Ala485 490
495Gln Leu Ser Glu Val Leu Ser Trp Gln Phe Ser Ser Val Thr Lys
Arg500 505 510Gly Leu Asn Val Asp Gln Leu
Asn Met Leu Gly Glu Lys Leu Leu Gly515 520
525Pro Asn Ala Ser Pro Asp Gly Leu Ile Pro Trp Thr Arg Phe Cys Lys530
535 540Glu Asn Ile Asn Asp Lys Asn Phe Pro
Phe Trp Leu Trp Ile Glu Ser545 550 555
560Ile Leu Glu Leu Ile Lys Lys His Leu Leu Pro Leu Trp Asn
Asp Gly565 570 575Cys Ile Met Gly Phe Ile
Ser Lys Glu Arg Glu Arg Ala Leu Leu Lys580 585
590Asp Gln Gln Pro Gly Thr Phe Leu Leu Arg Phe Ser Glu Ser Ser
Arg595 600 605Glu Gly Ala Ile Thr Phe Thr
Trp Val Glu Arg Ser Gln Asn Gly Gly610 615
620Glu Pro Asp Phe His Ala Val Glu Pro Tyr Thr Lys Lys Glu Leu Ser625
630 635 640Ala Val Thr Phe
Pro Asp Ile Ile Arg Asn Tyr Lys Val Met Ala Ala645 650
655Glu Asn Ile Pro Glu Asn Pro Leu Lys Tyr Leu Tyr Pro Asn
Ile Asp660 665 670Lys Asp His Ala Phe Gly
Lys Tyr Tyr Ser Arg Pro Lys Glu Ala Pro675 680
685Glu Pro Met Glu Leu Asp Gly Pro Lys Gly Thr Gly Tyr Ile Lys
Thr690 695 700Glu Leu Ile Ser Val Ser Glu
Val His Pro Ser Arg Leu Gln Thr Thr705 710
715 720Asp Asn Leu Leu Pro Met Ser Pro Glu Glu Phe Asp
Glu Val Ser Arg725 730 735Ile Val Gly Ser
Val Glu Phe Asp Ser Met Met Asn Thr Val740 745
750452303DNAhomo sapiens 45cccggcgtcc cgtcgagccc agccccgccg
ggggcgctcc tcgccgcccg cacgccctcc 60ccagccatgt cgtccatcct gcctttcact
cccccgatcg tgaagcgcct gctgggctgg 120aagaagggcg agcagaacgg gcaggaggag
aaatggtgcg agaaggcggt caagagcctg 180gtcaagaaac tcaagaagac ggggcagctg
gacgagctgg agaaggccat caccacgcag 240aacgtcaaca ccaagtgcat caccatcccc
aggtccctgg atggccggtt gcaggtgtcc 300catcggaagg ggctccctca tgtcatctac
tgccgcctgt ggcgatggcc agacctgcac 360agccaccacg agctgcgggc catggagctg
tgtgagttcg ccttcaatat gaagaaggac 420gaggtctgcg tgaatcccta ccactaccag
agagtagaga caccagttct acctcctgtg 480ttggtgccac gccacacaga gatcccggcc
gagttccccc cactggacga ctacagccat 540tccatccccg aaaacactaa cttccccgca
ggcatcgagc cccagagcaa tattccagag 600accccacccc ctggctacct gagtgaagat
ggagaaacca gtgaccacca gatgaaccac 660agcatggacg caggttctcc aaacctatcc
ccgaatccga tgtccccagc acataataac 720ttggacctgc agccagttac ctactgcgag
ccggccttct ggtgctccat ctcctactac 780gagctgaacc agcgcgtcgg ggagacattc
cacgcctcgc agccatccat gactgtggat 840ggcttcaccg acccctccaa ttcggagcgc
ttctgcctag ggctgctctc caatgtcaac 900aggaatgcag cagtggagct gacacggaga
cacatcggaa gaggcgtgcg gctctactac 960atcggagggg aggtcttcgc agagtgcctc
agtgacagcg ctatttttgt ccagtctccc 1020aactgtaacc agcgctatgg ctggcacccg
gccaccgtct gcaagatccc accaggatgc 1080aacctgaaga tcttcaacaa ccaggagttc
gctgccctcc tggcccagtc ggtcaaccag 1140ggctttgagg ctgtctacca gttgacccga
atgtgcacca tccgcatgag cttcgtcaaa 1200ggctggggag cggagtacag gagacagact
gtgaccagta ccccctgctg gattgagctg 1260cacctgaatg ggcctttgca gtggcttgac
aaggtcctca cccagatggg ctccccaagc 1320atccgctgtt ccagtgtgtc ttagagacat
caagtatggt aggggagggc aggcttgggg 1380aaaatggcca tacaggaggt ggagaaaatt
ggaactctac tcaacccatt gttgtcaagg 1440aagaagaaat ctttctccct caactgaagg
ggtgcaccca cctgttttct gaaacacacg 1500agcaaaccca gaggtggatg ttatgaacag
ctgtgtctgc caaacacatt taccctttgg 1560ccccactttg aagggcaaga aatggcgtct
gctctggtgg cttaagtgag cagaacaggt 1620agtattacac caccggcacc ctccccccag
actctttttt tgagtgacag ctttctggga 1680tgtcacagtc caaccagaaa cgcccctctg
tctaggactg cagtgtggag ttcaccttgg 1740aagggcgttc taggtaggaa gagcccgcac
gatgcagacc tcatgcccag ctctctgacg 1800cttgtgacag tgcctcttcc agtgaacatt
cccagcccag ccccgccccg ttgtgagctg 1860gatagacttg ggatggggag ggagggagtt
ttgtctgtct ccctcccctc tcagaacata 1920ctgattggga ggtgcgtgtt cagcagaacc
tgcacacagg acagcgggaa aaatcgatga 1980gcgccacctc tttaaaaact cacttacgtt
gtcctttttc actttgaaaa gttggaagga 2040ctgctgaggc ccagtgcata tgcaatgtat
agtgtctatt atcacattaa tctcaaagag 2100attcgaatga cggtaagtgt tctcatgaag
caggaggccc ttgtcgtggg atggcatttg 2160gtctcaggca gcaccacact gggtgcgtct
ccagtcatct gtaagagctt gctccagatt 2220ctgatgcata cggctatatt ggtttatgta
gtcagttgca ttcattaaat caactttatc 2280atatgctcaa aaaaaaaaaa aag
230346425PRThomo sapiens 46Met Ser Ser
Ile Leu Pro Phe Thr Pro Pro Ile Val Lys Arg Leu Leu1 5
10 15Gly Trp Lys Lys Gly Glu Gln Asn Gly
Gln Glu Glu Lys Trp Cys Glu20 25 30Lys
Ala Val Lys Ser Leu Val Lys Lys Leu Lys Lys Thr Gly Gln Leu35
40 45Asp Glu Leu Glu Lys Ala Ile Thr Thr Gln Asn
Val Asn Thr Lys Cys50 55 60Ile Thr Ile
Pro Arg Ser Leu Asp Gly Arg Leu Gln Val Ser His Arg65 70
75 80Lys Gly Leu Pro His Val Ile Tyr
Cys Arg Leu Trp Arg Trp Pro Asp85 90
95Leu His Ser His His Glu Leu Arg Ala Met Glu Leu Cys Glu Phe Ala100
105 110Phe Asn Met Lys Lys Asp Glu Val Cys Val
Asn Pro Tyr His Tyr Gln115 120 125Arg Val
Glu Thr Pro Val Leu Pro Pro Val Leu Val Pro Arg His Thr130
135 140Glu Ile Pro Ala Glu Phe Pro Pro Leu Asp Asp Tyr
Ser His Ser Ile145 150 155
160Pro Glu Asn Thr Asn Phe Pro Ala Gly Ile Glu Pro Gln Ser Asn Ile165
170 175Pro Glu Thr Pro Pro Pro Gly Tyr Leu
Ser Glu Asp Gly Glu Thr Ser180 185 190Asp
His Gln Met Asn His Ser Met Asp Ala Gly Ser Pro Asn Leu Ser195
200 205Pro Asn Pro Met Ser Pro Ala His Asn Asn Leu
Asp Leu Gln Pro Val210 215 220Thr Tyr Cys
Glu Pro Ala Phe Trp Cys Ser Ile Ser Tyr Tyr Glu Leu225
230 235 240Asn Gln Arg Val Gly Glu Thr
Phe His Ala Ser Gln Pro Ser Met Thr245 250
255Val Asp Gly Phe Thr Asp Pro Ser Asn Ser Glu Arg Phe Cys Leu Gly260
265 270Leu Leu Ser Asn Val Asn Arg Asn Ala
Ala Val Glu Leu Thr Arg Arg275 280 285His
Ile Gly Arg Gly Val Arg Leu Tyr Tyr Ile Gly Gly Glu Val Phe290
295 300Ala Glu Cys Leu Ser Asp Ser Ala Ile Phe Val
Gln Ser Pro Asn Cys305 310 315
320Asn Gln Arg Tyr Gly Trp His Pro Ala Thr Val Cys Lys Ile Pro
Pro325 330 335Gly Cys Asn Leu Lys Ile Phe
Asn Asn Gln Glu Phe Ala Ala Leu Leu340 345
350Ala Gln Ser Val Asn Gln Gly Phe Glu Ala Val Tyr Gln Leu Thr Arg355
360 365Met Cys Thr Ile Arg Met Ser Phe Val
Lys Gly Trp Gly Ala Glu Tyr370 375 380Arg
Arg Gln Thr Val Thr Ser Thr Pro Cys Trp Ile Glu Leu His Leu385
390 395 400Asn Gly Pro Leu Gln Trp
Leu Asp Lys Val Leu Thr Gln Met Gly Ser405 410
415Pro Ser Ile Arg Cys Ser Ser Val Ser420
425474208DNAhomo sapiens 47tctttaagat ttgtagctac taagaaagaa aggagctttt
tttccttggg ccttcaaact 60gaaagaaccg catgagcctg acggcgcatg gtcttaacat
caggctgtgc aggaagaagc 120tatctgcaga tggatgccag cacacacaag gaagcagagc
tctggcaaca ttgagtcaaa 180gcaaggacac aacatcagag ggacggcaga gaatccttgt
gtgtagtctt tggtggcagt 240ttgaaaattg caaggaggga ctttaagact acttctgatt
tgcaaagatg gtctgtgctc 300cgagcaggct aaagtgactg gacgagacgc actgttggag
aaataaaaat gacttcccat 360tatgtgattg ccatctttgc cctgatgagc ttctgtttag
ccactgcagg tccagagcct 420ggtgcactgt gtgaactgtc acctgtcagt gcctcccatc
ctgtccaggc cttgatggag 480agcttcactg ttttgtcagg ctgtgccagc agaggcacaa
ctgggctgcc acaggaggtg 540catgtcctga atctcgcact gcgccagggg cctggccagc
tacagagaga ggtcacactt 600cacctgaatc ccatctcctc agtccacatc caccacaagt
ctgttgtgtt cctgctcaac 660tccccacacc ccctggtgtg gcatctgaag acagagagac
ttgccactgg ggtctccaga 720ctgtttttgg tgtctgaggg ttctgtggtc cagttttcat
cagcaaactt ctccttgaca 780gcagaaacag aagaaaggaa cttcccccat ggaaatgaac
atctgttaaa ttgggcccga 840aaagagtatg gagcagttac ttcattcacc gaactcaaga
tagcaagaaa catttatatt 900aaagtggggg aagatcaagt gttccctcca aagtgcaaca
tagggaagaa ttttctctca 960ctcaattacc ttgctgagta ccttcaaccc aaagcagcag
aagggtgtgt gatgtccagc 1020cagccccaga atgaggaagt acacatcatc gagctaatca
cccccaactc taacccctac 1080agtgctttcc aggtggatat aacaattgat ataagacctt
ctcaagagga tcttgaagtg 1140gtcaaaaatc tcatcctgat cttgaagtgc aaaaagtctg
tcaactgggt gatcaaatct 1200tttgatgtta agggaagcct gaaaattatt gctcctaaca
gtattggctt tggaaaagag 1260agtgaaagat ctatgacaat gaccaaatca ataagagatg
acattccttc aacccaaggg 1320aatctggtga agtgggcttt ggacaatggc tatagtccaa
taacttcata cacaatggct 1380cctgtggcaa tagtatttca tcttcggctt gaaaataatg
aggagatggg agatgaggaa 1440gtccacacta ttcctcctga gctacggatc ctgctggacc
ctggtgccct gcctgccctg 1500cagaacccgc ccatccgggg aggggaaggc caaaatggag
gccttccgtt tcctttccca 1560gatatttcca ggagagtctg gaatgaagag ggagaagatg
ggctccctcg gccaaaggac 1620cctgtcattc ccagcataca actgtttcct ggtctcagag
agccagaaga ggtgcaaggg 1680agcgtggata ttgccctgtc tgtcaaatgt gacaatgaga
agatgatcgt ggctgtagaa 1740aaagattctt ttcaggccag tggctactcg gggatggacg
tcaccctgtt ggatcctacc 1800tgcaaggcca agatgaatgg cacacacttt gttttggagt
ctcctctgaa tggctgcggt 1860actcggcccc ggtggtcagc ccttgatggt gtggtctact
ataactccat tgtgatacag 1920gttccagccc ttggggacag tagtggttgg ccagatggtt
atgaagatct ggagtcaggt 1980gataatggat ttccgggaga tatggatgaa ggagatgctt
ccctgttcac ccgacctgaa 2040atcgtggtgt ttaattgcag ccttcagcag gtgaggaacc
ccagcagctt ccaggaacag 2100ccccacggaa acatcacctt caacatggag ctatacaaca
ctgacctctt tttggtgccc 2160tcccagggcg tcttctctgt gccagagaat ggacacgttt
atgttgaggt atctgttact 2220aaggctgaac aagaactggg atttgccatc caaacgtgct
ttatctctcc atattcgaac 2280cctgatagga tgtctcatta caccattatt gagaatattt
gtcctaaaga tgaatctgtg 2340aaattctaca gtcccaagag agtgcacttc cctatcccgc
aagctgacat ggataagaag 2400cgattcagct ttgtcttcaa gcctgtcttc aacacctcac
tgctctttct acagtgtgag 2460ctgacgctgt gtacgaagat ggagaagcac ccccagaagt
tgcctaagtg tgtgcctcct 2520gacgaagcct gcacctcgct ggacgcctcg ataatctggg
ccatgatgca gaataagaag 2580acgttcacca agccccttgc tgtgatccac catgaagcag
aatctaaaga aaaaggtcca 2640agcatgaagg aaccaaatcc aatttctcca ccaattttcc
atggtctgga caccctaacc 2700gtgatgggca ttgcgtttgc agcctttgtg atcggagcac
tcctgacggg ggccttgtgg 2760tacatctatt ctcacacagg ggagacagca ggaaggcagc
aagtccccac ctccccgcca 2820gcctcggaaa acagcagtgc tgcccacagc atcggcagca
cgcagagcac gccttgctcc 2880agcagcagca cggcctagcc caacccaggc ccaacccggc
ccaacccagc ccagcccagc 2940tcagctcagc tactccaagg gcaggaccaa tggctgagcc
tcgtgtccag actcagaggg 3000ctggattttg gttcccttgt aaagacagag tgaatttcag
tataaagatc acccgttgta 3060ttcaccccac acccagggct agtataaaca tgaccctggg
cttctgtacc acactagaat 3120tcatgtgaga aagctaaaat ggtggtcttc tccaccagcc
cctcacaggc ttgggggttt 3180tctatgtgaa acacatgcca gtttttaaaa tgctgctttg
tccaggtgag aacatccata 3240atttggggcc ctgagtttta cccagactca aggagttggt
aaagggttaa tagccagata 3300gtagaaccag tgaggagatg cggccaaaga ttctttatat
ctgaaccaag atgtaaaaca 3360agaaatgctt tgaggctttc taagcgatcc tcctgtctaa
tttgcacctt tgtctggatg 3420cactcttctg accttgctgc cacaacctgt ggggtctgat
gtgtcccaag atgggtgctg 3480ccctcaggga ctgcaccctg acaagtgtta aggcaacatt
ccttgcttgt gccctgggcc 3540aaaaccaatg ctgatgacct tatcagcttc ctgtttcttc
ccatactgca tacaccactg 3600caaaatgtct taatgcaaat tttgtatttc ttacaggcct
acagaaattg aaaatgacca 3660aaatcaggaa ccacagattt gtgcccattc ctaatatttt
gttctgcaaa ttaatgtata 3720atttgaggtg aaattcagtt ataaagtcaa ggacgaattt
gcacagtgat atatttctat 3780gtgtatgcaa gtacaagtat ataatatgtc acctggcaca
ttcattttct cagttgaaga 3840agagaaaatt tgaaaatgtc cttatgcttt tagagttgca
acttaagtat atttggtagg 3900gtgagtgttt ccactcaaaa tatgtcaact taaaaaaaaa
taggcccttt cataaaaacc 3960aaactgtagc aagatgcaaa tgcatggcaa atctgtcggt
ctccagttgg ttatctgaat 4020agtgtcacca attccaccaa gacagtgctg agattggaaa
gggcactcat ttggattgcc 4080ttacttctct tgccttaaat atatcccata tatttaatat
gtcaaaaagg gcttgaggtg 4140aatttcatta aatggaataa tatgatgcca ctttgcagct
aaaataagct cagtgatacc 4200tccttgtt
420848849PRThomo sapiens 48Met Thr Ser His Tyr Val
Ile Ala Ile Phe Ala Leu Met Ser Phe Cys1 5
10 15Leu Ala Thr Ala Gly Pro Glu Pro Gly Ala Leu Cys
Glu Leu Ser Pro20 25 30Val Ser Ala Ser
His Pro Val Gln Ala Leu Met Glu Ser Phe Thr Val35 40
45Leu Ser Gly Cys Ala Ser Arg Gly Thr Thr Gly Leu Pro Gln
Glu Val50 55 60His Val Leu Asn Leu Ala
Leu Arg Gln Gly Pro Gly Gln Leu Gln Arg65 70
75 80Glu Val Thr Leu His Leu Asn Pro Ile Ser Ser
Val His Ile His His85 90 95Lys Ser Val
Val Phe Leu Leu Asn Ser Pro His Pro Leu Val Trp His100
105 110Leu Lys Thr Glu Arg Leu Ala Thr Gly Val Ser Arg
Leu Phe Leu Val115 120 125Ser Glu Gly Ser
Val Val Gln Phe Ser Ser Ala Asn Phe Ser Leu Thr130 135
140Ala Glu Thr Glu Glu Arg Asn Phe Pro His Gly Asn Glu His
Leu Leu145 150 155 160Asn
Trp Ala Arg Lys Glu Tyr Gly Ala Val Thr Ser Phe Thr Glu Leu165
170 175Lys Ile Ala Arg Asn Ile Tyr Ile Lys Val Gly
Glu Asp Gln Val Phe180 185 190Pro Pro Lys
Cys Asn Ile Gly Lys Asn Phe Leu Ser Leu Asn Tyr Leu195
200 205Ala Glu Tyr Leu Gln Pro Lys Ala Ala Glu Gly Cys
Val Met Ser Ser210 215 220Gln Pro Gln Asn
Glu Glu Val His Ile Ile Glu Leu Ile Thr Pro Asn225 230
235 240Ser Asn Pro Tyr Ser Ala Phe Gln Val
Asp Ile Thr Ile Asp Ile Arg245 250 255Pro
Ser Gln Glu Asp Leu Glu Val Val Lys Asn Leu Ile Leu Ile Leu260
265 270Lys Cys Lys Lys Ser Val Asn Trp Val Ile Lys
Ser Phe Asp Val Lys275 280 285Gly Ser Leu
Lys Ile Ile Ala Pro Asn Ser Ile Gly Phe Gly Lys Glu290
295 300Ser Glu Arg Ser Met Thr Met Thr Lys Ser Ile Arg
Asp Asp Ile Pro305 310 315
320Ser Thr Gln Gly Asn Leu Val Lys Trp Ala Leu Asp Asn Gly Tyr Ser325
330 335Pro Ile Thr Ser Tyr Thr Met Ala Pro
Val Ala Ile Val Phe His Leu340 345 350Arg
Leu Glu Asn Asn Glu Glu Met Gly Asp Glu Glu Val His Thr Ile355
360 365Pro Pro Glu Leu Arg Ile Leu Leu Asp Pro Gly
Ala Leu Pro Ala Leu370 375 380Gln Asn Pro
Pro Ile Arg Gly Gly Glu Gly Gln Asn Gly Gly Leu Pro385
390 395 400Phe Pro Phe Pro Asp Ile Ser
Arg Arg Val Trp Asn Glu Glu Gly Glu405 410
415Asp Gly Leu Pro Arg Pro Lys Asp Pro Val Ile Pro Ser Ile Gln Leu420
425 430Phe Pro Gly Leu Arg Glu Pro Glu Glu
Val Gln Gly Ser Val Asp Ile435 440 445Ala
Leu Ser Val Lys Cys Asp Asn Glu Lys Met Ile Val Ala Val Glu450
455 460Lys Asp Ser Phe Gln Ala Ser Gly Tyr Ser Gly
Met Asp Val Thr Leu465 470 475
480Leu Asp Pro Thr Cys Lys Ala Lys Met Asn Gly Thr His Phe Val
Leu485 490 495Glu Ser Pro Leu Asn Gly Cys
Gly Thr Arg Pro Arg Trp Ser Ala Leu500 505
510Asp Gly Val Val Tyr Tyr Asn Ser Ile Val Ile Gln Val Pro Ala Leu515
520 525Gly Asp Ser Ser Gly Trp Pro Asp Gly
Tyr Glu Asp Leu Glu Ser Gly530 535 540Asp
Asn Gly Phe Pro Gly Asp Met Asp Glu Gly Asp Ala Ser Leu Phe545
550 555 560Thr Arg Pro Glu Ile Val
Val Phe Asn Cys Ser Leu Gln Gln Val Arg565 570
575Asn Pro Ser Ser Phe Gln Glu Gln Pro His Gly Asn Ile Thr Phe
Asn580 585 590Met Glu Leu Tyr Asn Thr Asp
Leu Phe Leu Val Pro Ser Gln Gly Val595 600
605Phe Ser Val Pro Glu Asn Gly His Val Tyr Val Glu Val Ser Val Thr610
615 620Lys Ala Glu Gln Glu Leu Gly Phe Ala
Ile Gln Thr Cys Phe Ile Ser625 630 635
640Pro Tyr Ser Asn Pro Asp Arg Met Ser His Tyr Thr Ile Ile
Glu Asn645 650 655Ile Cys Pro Lys Asp Glu
Ser Val Lys Phe Tyr Ser Pro Lys Arg Val660 665
670His Phe Pro Ile Pro Gln Ala Asp Met Asp Lys Lys Arg Phe Ser
Phe675 680 685Val Phe Lys Pro Val Phe Asn
Thr Ser Leu Leu Phe Leu Gln Cys Glu690 695
700Leu Thr Leu Cys Thr Lys Met Glu Lys His Pro Gln Lys Leu Pro Lys705
710 715 720Cys Val Pro Pro
Asp Glu Ala Cys Thr Ser Leu Asp Ala Ser Ile Ile725 730
735Trp Ala Met Met Gln Asn Lys Lys Thr Phe Thr Lys Pro Leu
Ala Val740 745 750Ile His His Glu Ala Glu
Ser Lys Glu Lys Gly Pro Ser Met Lys Glu755 760
765Pro Asn Pro Ile Ser Pro Pro Ile Phe His Gly Leu Asp Thr Leu
Thr770 775 780Val Met Gly Ile Ala Phe Ala
Ala Phe Val Ile Gly Ala Leu Leu Thr785 790
795 800Gly Ala Leu Trp Tyr Ile Tyr Ser His Thr Gly Glu
Thr Ala Gly Arg805 810 815Gln Gln Val Pro
Thr Ser Pro Pro Ala Ser Glu Asn Ser Ser Ala Ala820 825
830His Ser Ile Gly Ser Thr Gln Ser Thr Pro Cys Ser Ser Ser
Ser Thr835 840 845Ala492181DNAhomo
sapiens 49ggaaagcatc caacggagtg gaagcagcat gaaggaagag ccgctgggca
gcggcatgaa 60cgcggtgcgg acgtggatgc agggcgccgg ggtgctggac gccaacacgg
cggcgcagag 120cggggtgggt ctggcccggg ctcactttga gaagcagccg ccttccaatc
tgcggaaatc 180caacttcttc cacttcgtcc tggccctcta cgacagacag ggccagcccg
tggagatcga 240gaggacagcg tttgtggggt tcgtggagaa ggaaaaagaa gccaacagcg
aaaagaccaa 300taacggaatt cactaccgga ttcagcttct ctacagcaat gggataagga
cggagcagga 360tttctacgtg cgcctcattg actccatgac aaaacaagcc atagtgtatg
aaggccaaga 420caagagccca gaaatgtgcc gagtcttgct cacacatgag atcatgtgca
gccgctgttg 480tgacaagaaa agctgtggca accgaaatga gactccctca gatccagtga
taattgacag 540attcttcttg aaatttttcc tcaaatgtaa ccaaaattgc ctaaagaatg
cgggaaaccc 600acgtgacatg cggagattcc aggtcgtggt gtctacgaca gtcaatgtgg
atggccatgt 660cctggcagct cctgataaca tgtttgtcca taataattcc aagcatgggc
ggagggctcg 720gaggcttgac ccctcggaag gtacgccctc ttatctggaa catgctactc
cctgtatcaa 780agccatcagc ccgagtgaag gatggacgac cggaggtgcg actgtcatca
tcatagggga 840caatttcttt gatgggttac aggtcatatt cggtaccatg ctggtctgga
gtgagttgac 900aggtcctcat tccatccgtg tgcagacccc tcctcggcac atccctggtg
ttgtggaagt 960cacactgtcc tacaaatcta agcagttctg caaaggaaca ccaggcagat
tcatttatac 1020agcgcgcaac gaacccacca tcgattatgg tttccagagg ttacagaagg
tcattcctcg 1080gcaccctggt gaccctgagc gtttgccaaa ggaagtaata ctgaaaaggg
ctgcggatct 1140ggtagaagca ctgtatggga tgccacacaa caaccaggaa atcattctga
agagagcggc 1200cgacattgcc gaggccctgt acagtgtccc ccgcaaccac aaccaactcc
cggcccttgc 1260taacacctcg gtccacgcag ggatgatggg cgtgaattcg ttcagtggac
aactggccgt 1320gaatgtctcc gaggcatcac aagccaccaa tcagggtttc acccgcaact
caagcagcgt 1380atcaccacac gggtacgtgc cgagcaccac tccccagcag accaactata
actccgtcac 1440cacgagcatg aacggatacg gctctgccgc aatgtccaat ttgggtggct
cccccacctt 1500cctcaacggc tcagctgcca actcccccta tgccatagtg ccatccagcc
ccaccatggc 1560ctcctccaca agcctcccct ccaactgcag cagctcctcg ggcatcttct
ccttctcacc 1620agccaacatg gtctcagccg tgaaacagaa gagtgctttc gcaccagtcg
tcagacccca 1680gacctcccca cctcccacct gcaccagcac caacgggaac agcctgcaag
cgatatctgg 1740catgattgtt cctcctatgt gaaagaattg ccttgaagaa ttgtattaat
gaagaggttg 1800gattctgcta cagagagtaa tctgatacaa gtcccagagt ggaactttta
actcaggcct 1860ttataagagg aatcacacaa taactgcaga tttttaaaca aaatcaccga
ccttgcaaat 1920actgaaattg gaagaggaat ctgaaagtgc agggtgttgg ttaaagttgt
acctcccaag 1980tattttgggg atatatttat tctgtattga caaaagcaaa tccacttttt
ctttttcttt 2040ttttttttta agcttaattc tgcaatcatt tgacttttat ataccgtaat
gctctataca 2100agggacacta taaataagac tccatgtttt aatttatgtt tttaaagctg
tgtaaaggaa 2160gaatgaagtg gtgatattta c
218150586PRThomo sapiens 50Glu Ser Ile Gln Arg Ser Gly Ser Ser
Met Lys Glu Glu Pro Leu Gly1 5 10
15Ser Gly Met Asn Ala Val Arg Thr Trp Met Gln Gly Ala Gly Val
Leu20 25 30Asp Ala Asn Thr Ala Ala Gln
Ser Gly Val Gly Leu Ala Arg Ala His35 40
45Phe Glu Lys Gln Pro Pro Ser Asn Leu Arg Lys Ser Asn Phe Phe His50
55 60Phe Val Leu Ala Leu Tyr Asp Arg Gln Gly
Gln Pro Val Glu Ile Glu65 70 75
80Arg Thr Ala Phe Val Gly Phe Val Glu Lys Glu Lys Glu Ala Asn
Ser85 90 95Glu Lys Thr Asn Asn Gly Ile
His Tyr Arg Ile Gln Leu Leu Tyr Ser100 105
110Asn Gly Ile Arg Thr Glu Gln Asp Phe Tyr Val Arg Leu Ile Asp Ser115
120 125Met Thr Lys Gln Ala Ile Val Tyr Glu
Gly Gln Asp Lys Ser Pro Glu130 135 140Met
Cys Arg Val Leu Leu Thr His Glu Ile Met Cys Ser Arg Cys Cys145
150 155 160Asp Lys Lys Ser Cys Gly
Asn Arg Asn Glu Thr Pro Ser Asp Pro Val165 170
175Ile Ile Asp Arg Phe Phe Leu Lys Phe Phe Leu Lys Cys Asn Gln
Asn180 185 190Cys Leu Lys Asn Ala Gly Asn
Pro Arg Asp Met Arg Arg Phe Gln Val195 200
205Val Val Ser Thr Thr Val Asn Val Asp Gly His Val Leu Ala Ala Pro210
215 220Asp Asn Met Phe Val His Asn Asn Ser
Lys His Gly Arg Arg Ala Arg225 230 235
240Arg Leu Asp Pro Ser Glu Gly Thr Pro Ser Tyr Leu Glu His
Ala Thr245 250 255Pro Cys Ile Lys Ala Ile
Ser Pro Ser Glu Gly Trp Thr Thr Gly Gly260 265
270Ala Thr Val Ile Ile Ile Gly Asp Asn Phe Phe Asp Gly Leu Gln
Val275 280 285Ile Phe Gly Thr Met Leu Val
Trp Ser Glu Leu Thr Gly Pro His Ser290 295
300Ile Arg Val Gln Thr Pro Pro Arg His Ile Pro Gly Val Val Glu Val305
310 315 320Thr Leu Ser Tyr
Lys Ser Lys Gln Phe Cys Lys Gly Thr Pro Gly Arg325 330
335Phe Ile Tyr Thr Ala Arg Asn Glu Pro Thr Ile Asp Tyr Gly
Phe Gln340 345 350Arg Leu Gln Lys Val Ile
Pro Arg His Pro Gly Asp Pro Glu Arg Leu355 360
365Pro Lys Glu Val Ile Leu Lys Arg Ala Ala Asp Leu Val Glu Ala
Leu370 375 380Tyr Gly Met Pro His Asn Asn
Gln Glu Ile Ile Leu Lys Arg Ala Ala385 390
395 400Asp Ile Ala Glu Ala Leu Tyr Ser Val Pro Arg Asn
His Asn Gln Leu405 410 415Pro Ala Leu Ala
Asn Thr Ser Val His Ala Gly Met Met Gly Val Asn420 425
430Ser Phe Ser Gly Gln Leu Ala Val Asn Val Ser Glu Ala Ser
Gln Ala435 440 445Thr Asn Gln Gly Phe Thr
Arg Asn Ser Ser Ser Val Ser Pro His Gly450 455
460Tyr Val Pro Ser Thr Thr Pro Gln Gln Thr Asn Tyr Asn Ser Val
Thr465 470 475 480Thr Ser
Met Asn Gly Tyr Gly Ser Ala Ala Met Ser Asn Leu Gly Gly485
490 495Ser Pro Thr Phe Leu Asn Gly Ser Ala Ala Asn Ser
Pro Tyr Ala Ile500 505 510Val Pro Ser Ser
Pro Thr Met Ala Ser Ser Thr Ser Leu Pro Ser Asn515 520
525Cys Ser Ser Ser Ser Gly Ile Phe Ser Phe Ser Pro Ala Asn
Met Val530 535 540Ser Ala Val Lys Gln Lys
Ser Ala Phe Ala Pro Val Val Arg Pro Gln545 550
555 560Thr Ser Pro Pro Pro Thr Cys Thr Ser Thr Asn
Gly Asn Ser Leu Gln565 570 575Ala Ile Ser
Gly Met Ile Val Pro Pro Met580 585511129DNAhomo sapiens
51gtggcccccg cggtgcggag tatggggcgc tgatggccat ggagggctac tggcgcttcc
60tggcgctgct ggggtcggca ctgctcgtcg gcttcctgtc ggtgatcttc gccctcgtct
120gggtcctcca ctaccgagag gggcttggct gggatgggag cgcactagag tttaactggc
180acccagtgct catggtcacc ggcttcgtct tcatccaggg catcgccatc atcgtctaca
240gactgccgtg gacctggaaa tgcagcaagc tcctgatgaa atccatccat gcagggttaa
300atgcagttgc tgccattctt gcaattatct ctgtggtggc cgtgtttgag aaccacaatg
360ttaacaatat agccaatatg tacagtctgc acagctgggt tggactgata gctgtcatat
420gctatttgtt acagcttctt tcaggttttt cagtctttct gcttccatgg gctccgcttt
480ctctccgagc atttctcatg cccatacatg tttattctgg aattgtcatc tttggaacag
540tgattgcaac agcacttatg ggattgacag agaaactgat tttttccctg agagatcctg
600catacagtac attcccgcca gaaggtgttt tcgtaaatac gcttggcctt ctgatcctgg
660tgttcggggc cctcattttt tggatagtca ccagaccgca atggaaacgt cctaaggagc
720caaattctac cattcttcat ccaaatggag gcactgaaca gggagcaaga ggttccatgc
780cagcctactc tggcaacaac atggacaaat cagattcaga gttaaacagt gaagtagcag
840caaggaaaag aaacttagct ctggatgagg ctgggcagag atctaccatg taaaatgttg
900tagagataga gccatataac gtcacgtttc aaaactagct ctacagtttt gcttctccta
960ttagccatat gataattggg ctatgtagta tcaatattta ctttaatcac aaaggatggt
1020ttcttgaaat aatttgtatt gattgaggcc tatgaactga cctgaattgg aaaggatgtg
1080attaatataa ataatagcag atataaatta aaaaaaaaaa aaaagaaaa
112952286PRThomo sapiens 52Met Ala Met Glu Gly Tyr Trp Arg Phe Leu Ala
Leu Leu Gly Ser Ala1 5 10
15Leu Leu Val Gly Phe Leu Ser Val Ile Phe Ala Leu Val Trp Val Leu20
25 30His Tyr Arg Glu Gly Leu Gly Trp Asp Gly
Ser Ala Leu Glu Phe Asn35 40 45Trp His
Pro Val Leu Met Val Thr Gly Phe Val Phe Ile Gln Gly Ile50
55 60Ala Ile Ile Val Tyr Arg Leu Pro Trp Thr Trp Lys
Cys Ser Lys Leu65 70 75
80Leu Met Lys Ser Ile His Ala Gly Leu Asn Ala Val Ala Ala Ile Leu85
90 95Ala Ile Ile Ser Val Val Ala Val Phe Glu
Asn His Asn Val Asn Asn100 105 110Ile Ala
Asn Met Tyr Ser Leu His Ser Trp Val Gly Leu Ile Ala Val115
120 125Ile Cys Tyr Leu Leu Gln Leu Leu Ser Gly Phe Ser
Val Phe Leu Leu130 135 140Pro Trp Ala Pro
Leu Ser Leu Arg Ala Phe Leu Met Pro Ile His Val145 150
155 160Tyr Ser Gly Ile Val Ile Phe Gly Thr
Val Ile Ala Thr Ala Leu Met165 170 175Gly
Leu Thr Glu Lys Leu Ile Phe Ser Leu Arg Asp Pro Ala Tyr Ser180
185 190Thr Phe Pro Pro Glu Gly Val Phe Val Asn Thr
Leu Gly Leu Leu Ile195 200 205Leu Val Phe
Gly Ala Leu Ile Phe Trp Ile Val Thr Arg Pro Gln Trp210
215 220Lys Arg Pro Lys Glu Pro Asn Ser Thr Ile Leu His
Pro Asn Gly Gly225 230 235
240Thr Glu Gln Gly Ala Arg Gly Ser Met Pro Ala Tyr Ser Gly Asn Asn245
250 255Met Asp Lys Ser Asp Ser Glu Leu Asn
Ser Glu Val Ala Ala Arg Lys260 265 270Arg
Asn Leu Ala Leu Asp Glu Ala Gly Gln Arg Ser Thr Met275
280 285532655DNAhomo sapiens 53cgcctagccg cgccggtccc
agaagtggcg aaagccgcag ccgagtccag gtcacgccga 60agccgttgcc cttttaaggg
ggagccttga aacggcgcct gggttccatg tttgcatccg 120cctcgcggga aggaaactcc
atgttgtaac aaagtttcct ccgcgccccc tccctccccc 180tcccccctag aacctggctc
ccctcccctc cggagctcgc ggggatccct ccctcccacc 240cctcccctcc cccccgcgcc
ccgattccgg ccccagccgg gggggaggcc gggcgcccgg 300gccagagtcc ggccggagcg
gagcgcgccc ggccccatgg acagctcggc cgtcattact 360cagatcagca aggaggaggc
tcggggcccg ctgcggggca aaggtgacca gaagtcagca 420gcttcccaga agccccgaag
ccggggcatc ctccactcac tcttctgctg tgtctgccgg 480gatgatgggg aggccctgcc
tgctcacagc ggggcgcccc tgcttgtgga ggagaatgga 540gccatcccta agcagacccc
agtccaatac ctgctccctg aggccaaggc ccaggactca 600gacaagatct gcgtggtcat
cgacctggac gagaccctgg tgcacagctc cttcaagcca 660gtgaacaacg cggacttcat
catccctgtg gagattgatg gggtggtcca ccaggtctac 720gtgttgaagc gtcctcacgt
ggatgagttc ctgcagcgaa tgggcgagct ctttgaatgt 780gtgctgttca ctgctagcct
cgccaagtac gcagacccag tagctgacct gctggacaaa 840tggggggcct tccgggcccg
gctgtttcga gagtcctgcg tcttccaccg ggggaactac 900gtgaaggacc tgagccggtt
gggtcgagac ctgcggcggg tgctcatcct ggacaattca 960cctgcctcct atgtcttcca
tccagacaat gctgtaccgg tggcctcgtg gtttgacaac 1020atgagtgaca cagagctcca
cgacctcctc cccttcttcg agcaactcag ccgtgtggac 1080gacgtgtact cagtgctcag
gcagccacgg ccagggagct agtgagggtg atggggccag 1140gacctgcccc tgaccaatga
tacccacacc tcctcccagg aagactgccc aggcctttgt 1200taggaaaacc catgggccgc
cgccacactc agtgccatgg ggaagcgggc gtctccccca 1260ccagccccac caggcggtgt
aggggcagca ggctgcactg aggaccgtga gctccaggcc 1320ccgtgtcagt gccttcaaac
ctcctcccct attctcaggg gacctggggg gccctgcctg 1380ctgctccctt tttctgtctc
tgtccatgct gccatgtttc tctgctgcca aattgggccc 1440cttggcccct tccggttctg
cttcctgggg gcagggttcc tgccttggac ccccagtctg 1500ggaacggtgg acatcaagtg
ccttgcatag agccccctct tccccgccca gctttcccag 1560gggcacagct ctaggctggg
aggggagaac cagcccctcc ccctgcccca cctcctccct 1620tgggactgag agggccccta
ccaacctttg cctctgcctt ggagggaggg gaggtctgtt 1680accactgggg aaggcagcag
gagtctgtcc ttcaggcccc acagtgcagc ttctccaggg 1740ccgacagctg agggctgctc
cctgcatcat ccaagcaatg acctcagact tctgccttaa 1800ccagccccgg ggcttggctc
ccccagctct gagcgtgggg gcataggcag gacccccctt 1860gtggtgccat ataaatatgt
acatgtgtat atagattttt aggggaagga gagagggaag 1920ggtcagggta gagacacccc
tcccttgccc ctttcctggg cccagaagtt ggggggaggg 1980agggaaagga tttttacatt
ttttaaactg ctattttctg aatggaacaa gctgggccaa 2040ggggcccagg ccctgtcctc
tgtccctcac acccctttgc tccgttcatt cattcaaaaa 2100aacatttctt gagcaccttc
tgtgcccagc atatgctagg cccaccagct aagtgtgtgt 2160ggggggtctc tacgccagct
catcagtgcc tccttgccca tccttcaccg gtgcctttgg 2220gggatctgta ggaggtggga
ccttctgtgg ggtttgggga tctccaggaa gcccgaccaa 2280gctgtcccct tcccctgtgc
caacccatct cctacagccc cctgcctgat cccctgctgg 2340ctgggggcag ctcccaggat
atcctgcctt ccaactgttt ctgaagcccc tcctcctaac 2400atggcgattc cggaggtcaa
ggccttgggc tctccccagg gtctaacggt taaggggacc 2460cacataccag tgccaagggg
gatgtcaagt ggtgatgtcg ttgtgctccc ctcccccaga 2520gcgggtgggc ggggggtgaa
tatggttggc ctgcatcagg tggccttccc atttaagtgc 2580cttctctgtg actgagagcc
ctagtgtgat gagaactaaa gagaaagcca gacccctaaa 2640aaaaaaaaaa aaaaa
265554261PRThomo sapiens
54Met Asp Ser Ser Ala Val Ile Thr Gln Ile Ser Lys Glu Glu Ala Arg1
5 10 15Gly Pro Leu Arg Gly Lys
Gly Asp Gln Lys Ser Ala Ala Ser Gln Lys20 25
30Pro Arg Ser Arg Gly Ile Leu His Ser Leu Phe Cys Cys Val Cys Arg35
40 45Asp Asp Gly Glu Ala Leu Pro Ala His
Ser Gly Ala Pro Leu Leu Val50 55 60Glu
Glu Asn Gly Ala Ile Pro Lys Gln Thr Pro Val Gln Tyr Leu Leu65
70 75 80Pro Glu Ala Lys Ala Gln
Asp Ser Asp Lys Ile Cys Val Val Ile Asp85 90
95Leu Asp Glu Thr Leu Val His Ser Ser Phe Lys Pro Val Asn Asn Ala100
105 110Asp Phe Ile Ile Pro Val Glu Ile
Asp Gly Val Val His Gln Val Tyr115 120
125Val Leu Lys Arg Pro His Val Asp Glu Phe Leu Gln Arg Met Gly Glu130
135 140Leu Phe Glu Cys Val Leu Phe Thr Ala
Ser Leu Ala Lys Tyr Ala Asp145 150 155
160Pro Val Ala Asp Leu Leu Asp Lys Trp Gly Ala Phe Arg Ala
Arg Leu165 170 175Phe Arg Glu Ser Cys Val
Phe His Arg Gly Asn Tyr Val Lys Asp Leu180 185
190Ser Arg Leu Gly Arg Asp Leu Arg Arg Val Leu Ile Leu Asp Asn
Ser195 200 205Pro Ala Ser Tyr Val Phe His
Pro Asp Asn Ala Val Pro Val Ala Ser210 215
220Trp Phe Asp Asn Met Ser Asp Thr Glu Leu His Asp Leu Leu Pro Phe225
230 235 240Phe Glu Gln Leu
Ser Arg Val Asp Asp Val Tyr Ser Val Leu Arg Gln245 250
255Pro Arg Pro Gly Ser260553804DNAhomo sapiens 55gcccgagcga
gggcgcttcg ctcccagcca ggacatggcc gcacctctcc gcatcaggag 60cgccggctca
cggacttctc gcccaactcc ctgagcgctc cctcgtttcg atctttagaa 120aaccccgctt
tctttctggg gccgtgacga ggggcaggga gcggcgagca aggatgcgtt 180gaggaccgcg
agggcgcgcg tctcgggtgc cgccgtgggt cccgacgcgg aagccgagcc 240gcctccgcct
gcctcgactt ccccacagcg cttccgccgc cgcctgccgt gcttgtatgt 300gcagaaagaa
gccggacacc atgatcctaa cacaaattga agccaaggaa gcttgtgatt 360ggctacgggc
aactggtttc ccccagtatg cacagcttta tgaagatttc ctgttcccca 420tcgatatttc
cttggtcaag agagagcatg attttttgga cagagatgcc attgaggctc 480tataggcgtc
taaatacttt aaacaaatgt gcggtgatga agctagaaat tagtcctcat 540cggaaacgag
tgacgattca gacgaggatg agccttgtgc catcagtggc aaatggactt 600tccaaaggga
cagcaagagg tggtcccggc ttgaagagtt tgatgtcttt tctccaaaac 660aagacctggt
ccctgggtcc ccagacgact cccacccgaa ggacggcccc agccccggag 720gcacgctgat
ggacctcagc gagcgccagg aggtgtcttc cgtccgcagc ctcagcagca 780ctggcagcct
ccccagccac gcgcccccca gcgaggatgc tgccaccccc cggactaact 840ccgtcatcag
cgtttgctcc tccagcaact tggcaggcaa tgacgactct ttcggcagcc 900tgccctctcc
caaggaactg tccagcttca gcttcagcat gaaaggccac gaaaaaactg 960ccaagtccaa
gacgcgcagt ctgctgaaac ggatggagag cctgaagctc aagagctccc 1020atcacagcaa
gcacaaagcg ccctcaaagc tggggttgat catcagcggg cccatcttgc 1080aagaggggat
ggatgaggag aagctgaagc agctcaactg cgtggagatc tccgccctca 1140atggcaaccg
catcaacgtc cccatggtac gaaagaggag cgtttccaac tccacgcaga 1200ccagcagcag
cagcagccag tcggagacca gcagcgcggt cagcacgccc agccctgtta 1260cgaggacccg
gagcctcagt gcgtgcaaca agcgggtggg catgtactta gagggcttcg 1320atcctttcaa
tcagtcaaca tttaacaacg tgatggagca gaactttaag aaccgcgaga 1380gctacccaga
ggacacggtg ttctacatcc ctgaagatca caagcctggc actttcccca 1440aagctctcac
caatggcagt ttctccccct cggggaataa cggctctgtg aactggagga 1500cgggaagctt
ccacggccct ggccacatca gcctcaggag ggaaaacagt agcgacagcc 1560ccaaggaact
gaagagacgc aattcttcca gctccatgag cagccgcctg agcatctacg 1620acaacgtgcc
gggctccatc ctctactcca gttcagggga cctggcggat ctggagaacg 1680aggacatctt
ccccgagctg gacgacatcc tctaccacgt gaaggggatg cagcggatag 1740tcaatcagtg
gtcggagaag ttttctgatg agggagattc ggactcagcc ctggactcgg 1800tctctccctg
cccgtcctct ccaaaacaga tacacctgga tgtggacaac gaccgaacca 1860cacccagcga
cctggacagc acaggcaact ccctgaatga accggaagag ccctccgaga 1920tcccggaaag
aagggattct ggggttgggg cttccctaac caggtccaac aggcaccgac 1980tgagatggca
cagtttccag agctcacatc ggccaagcct caactctgta tcactacaga 2040ttaactgcca
gtctgtggcc cagatgaacc tgctgcagaa atactcactc ctaaagctaa 2100cggccctgct
ggagaaatac acaccttcta acaagcatgg ttttagctgg gccgtgccca 2160agttcatgaa
gaggatcaag gttccagact acaaggaccg gagtgtgttt ggggtcccac 2220tgacggtcaa
cgtgcagcgc acaggacaac cgttgcctca gagcatccag caggccatgc 2280gatacctccg
gaaccattgt ttggatcagg ttgggctctt cagaaaatcg ggggtcaagt 2340cccggattca
ggctctgcgc cagatgaatg aaggtgccat agactgtgtc aactacgaag 2400gacagtctgc
ttatgacgtg gcagacatgc tgaagcagta ttttcgagat cttcctgagc 2460cactaatgac
gaacaaactc tcagaaacct ttctacagat ctaccaatat gtgcccaagg 2520accagcgact
gcaggccatc aaggctgcca tcatgctgct gcctgacgag aaccgggagg 2580ttctgcagac
cctgctttat ttcctgagcg atgtcacagc agccgtaaaa gaaaaccaga 2640tgaccccaac
caacctggcc gtgtgcttag cgccttccct cttccatctc aacaccctga 2700agagagagaa
ttcctctccc aggggtaatg caaagaaaac aaagtttggg caaaccagat 2760cagaaagatt
tgaatgaaaa cctagctgcc actcaagggc tggcccatat gatcgccgag 2820tgcaagaagc
ttttccaggt tcccgaggaa atgagccgat gtcgtaattc ctataccgaa 2880caagagctga
agcccctcac tctggaagca ctcgggcacc tgggtaatga tgactcagct 2940gactaccaac
acttcctcca ggactgtgtg gatggcctgt ttaaagaagt caaagagaag 3000tttaaaggct
gggtcagcta ctccacttcg gagcaggctg agctgtccta taagaaggtg 3060agcgaaggac
cccctctgag gctttggagg tcagtcattg aagtccctgc tgtgccagag 3120gaaatcttaa
agcgcctact taaagaacag cacctctggg atgtagacct gttggattca 3180aaagtgatcg
aaattctgga cagccaaact gaaatttacc agtatgtcca aaacagtatg 3240gcacctcatc
ctgctcgaga ctacgttgtt ttaagaacct ggaggactaa tttacccaaa 3300ggagcctgtg
cccttttact aacctctgtg gatcacgatc gcgcacctgt ggtgggtgtg 3360agggttaatg
tgctcttgtc caggtatttg attgaaccct gtgggccagg aaaatccaaa 3420ctcacctaca
tgtgcagagt tgacttaagg ggccacatgc cagaatggta cacaaaatct 3480tttggacatt
tgtgtgcagc tgaagttgta aagatccggg attccttcag taaccagaac 3540actgaaacca
aagacaccaa atctaggtga tcactgaagc aacgcaaccg cttccaccac 3600catggtgttt
gtttctagaa cttttgccag tccttgaaga atgggttctg tgtctaatcc 3660tgaaacaaag
aaaactacaa gctggagtgt aggaattgac tatagcaatt tgatacattt 3720ttaaagctgc
ttcctgtttg ttgagggtct gtattcatag accttgactg gaatatgtaa 3780gactgtgcaa
aaaaaaaaaa aaaa
3804561091PRThomo sapiens 56Met Cys Arg Lys Lys Pro Asp Thr Met Ile Leu
Thr Gln Ile Glu Ala1 5 10
15Lys Glu Ala Cys Asp Trp Leu Arg Ala Thr Gly Phe Pro Gln Tyr Ala20
25 30Gln Leu Tyr Glu Asp Phe Leu Phe Pro Ile
Asp Ile Ser Leu Val Lys35 40 45Arg Glu
His Asp Phe Leu Asp Arg Asp Ala Ile Glu Ala Leu Cys Arg50
55 60Arg Leu Asn Thr Leu Asn Lys Cys Ala Val Met Lys
Leu Glu Ile Ser65 70 75
80Pro His Arg Lys Arg Ser Asp Asp Ser Asp Glu Asp Glu Pro Cys Ala85
90 95Ile Ser Gly Lys Trp Thr Phe Gln Arg Asp
Ser Lys Arg Trp Ser Arg100 105 110Leu Glu
Glu Phe Asp Val Phe Ser Pro Lys Gln Asp Leu Val Pro Gly115
120 125Ser Pro Asp Asp Ser His Pro Lys Asp Gly Pro Ser
Pro Gly Gly Thr130 135 140Leu Met Asp Leu
Ser Glu Arg Gln Glu Val Ser Ser Val Arg Ser Leu145 150
155 160Ser Ser Thr Gly Ser Leu Pro Ser His
Ala Pro Pro Ser Glu Asp Ala165 170 175Ala
Thr Pro Arg Thr Asn Ser Val Ile Ser Val Cys Ser Ser Ser Asn180
185 190Leu Ala Gly Asn Asp Asp Ser Phe Gly Ser Leu
Pro Ser Pro Lys Glu195 200 205Leu Ser Ser
Phe Ser Phe Ser Met Lys Gly His Glu Lys Thr Ala Lys210
215 220Ser Lys Thr Arg Ser Leu Leu Lys Arg Met Glu Ser
Leu Lys Leu Lys225 230 235
240Ser Ser His His Ser Lys His Lys Ala Pro Ser Lys Leu Gly Leu Ile245
250 255Ile Ser Gly Pro Ile Leu Gln Glu Gly
Met Asp Glu Glu Lys Leu Lys260 265 270Gln
Leu Ser Cys Val Glu Ile Ser Ala Leu Asn Gly Asn Arg Ile Asn275
280 285Val Pro Met Val Arg Lys Arg Ser Val Ser Asn
Ser Thr Gln Thr Ser290 295 300Ser Ser Ser
Ser Gln Ser Glu Thr Ser Ser Ala Val Ser Thr Pro Ser305
310 315 320Pro Val Thr Arg Thr Arg Ser
Leu Ser Ala Cys Asn Lys Arg Val Gly325 330
335Met Tyr Leu Glu Gly Phe Asp Pro Phe Asn Gln Ser Thr Phe Asn Asn340
345 350Val Val Glu Gln Asn Phe Lys Asn Arg
Glu Ser Tyr Pro Glu Asp Thr355 360 365Val
Phe Tyr Ile Pro Glu Asp His Lys Pro Gly Thr Phe Pro Lys Ala370
375 380Leu Thr Asn Gly Ser Phe Ser Pro Ser Gly Asn
Asn Gly Ser Val Asn385 390 395
400Trp Arg Thr Gly Ser Phe His Gly Pro Gly His Ile Ser Leu Arg
Arg405 410 415Glu Asn Ser Ser Asp Ser Pro
Lys Glu Leu Lys Arg Arg Asn Ser Ser420 425
430Ser Ser Met Ser Ser Arg Leu Ser Ile Tyr Asp Asn Val Pro Gly Ser435
440 445Ile Leu Tyr Ser Ser Ser Gly Asp Leu
Ala Asp Leu Glu Asn Glu Asp450 455 460Ile
Phe Pro Glu Leu Asp Asp Ile Leu Tyr His Val Lys Gly Met Gln465
470 475 480Arg Ile Val Asn Gln Trp
Ser Glu Lys Phe Ser Asp Glu Gly Asp Ser485 490
495Asp Ser Ala Leu Asp Ser Val Ser Pro Cys Pro Ser Ser Pro Lys
Gln500 505 510Ile His Leu Asp Val Asp Asn
Asp Arg Thr Thr Pro Ser Asp Leu Asp515 520
525Ser Thr Gly Asn Ser Leu Asn Glu Pro Glu Glu Pro Ser Glu Ile Pro530
535 540Glu Arg Arg Asp Ser Gly Val Gly Ala
Ser Leu Thr Arg Ser Asn Arg545 550 555
560His Arg Leu Arg Trp His Ser Phe Gln Ser Ser His Arg Pro
Ser Leu565 570 575Asn Ser Val Ser Leu Gln
Ile Asn Cys Gln Ser Val Ala Gln Met Asn580 585
590Leu Leu Gln Lys Tyr Ser Leu Leu Lys Leu Thr Ala Leu Leu Glu
Lys595 600 605Tyr Thr Pro Ser Asn Lys His
Gly Phe Ser Trp Ala Val Pro Lys Phe610 615
620Met Lys Arg Ile Lys Val Pro Asp Tyr Lys Asp Arg Ser Val Phe Gly625
630 635 640Val Pro Leu Thr
Val Asn Val Gln Arg Thr Gly Gln Pro Leu Pro Gln645 650
655Ser Ile Gln Gln Ala Met Arg Tyr Leu Arg Asn His Cys Leu
Asp Gln660 665 670Val Gly Leu Phe Lys Lys
Ser Gly Val Lys Ser Arg Ile Gln Ala Leu675 680
685Arg Gln Met Asn Glu Gly Ala Ile Asp Cys Val Asn Tyr Glu Gly
Gln690 695 700Ser Ala Tyr Asp Val Ala Asp
Met Leu Lys Gln Tyr Phe Arg Asp Leu705 710
715 720Pro Glu Pro Leu Met Thr Asn Lys Leu Ser Glu Thr
Phe Leu Gln Ile725 730 735Tyr Gln Tyr Val
Pro Lys Asp Gln Arg Leu Gln Ala Ile Lys Ala Ala740 745
750Ile Met Leu Leu Pro Asp Glu Asn Arg Val Val Leu Gln Thr
Leu Leu755 760 765Tyr Phe Leu Cys Asp Val
Thr Ala Ala Val Lys Glu Asn Gln Met Thr770 775
780Pro Thr Asn Leu Ala Val Cys Leu Ala Pro Ser Leu Phe His Leu
Asn785 790 795 800Thr Leu
Lys Arg Glu Asn Ser Ser Pro Arg Val Met Gln Arg Lys Gln805
810 815Ser Leu Gly Lys Pro Asp Gln Lys Asp Leu Asn Glu
Asn Leu Ala Ala820 825 830Thr Gln Gly Leu
Ala His Met Ile Ala Glu Cys Lys Lys Leu Phe Gln835 840
845Val Pro Glu Glu Met Ser Arg Cys Arg Asn Ser Tyr Thr Glu
Gln Glu850 855 860Leu Lys Pro Leu Thr Leu
Glu Ala Leu Gly His Leu Gly Asn Asp Asp865 870
875 880Ser Ala Asp Tyr Gln His Phe Leu Gln Asp Cys
Val Asp Gly Leu Phe885 890 895Lys Glu Val
Lys Glu Lys Phe Lys Gly Trp Val Ser Tyr Ser Thr Ser900
905 910Glu Gln Ala Glu Leu Ser Tyr Lys Lys Val Ser Glu
Gly Pro Arg Leu915 920 925Arg Leu Trp Arg
Ser Val Ile Glu Val Pro Ala Val Pro Glu Glu Ile930 935
940Leu Lys Arg Leu Leu Lys Glu Gln His Leu Trp Asp Val Asp
Leu Leu945 950 955 960Asp
Ser Lys Val Ile Glu Ile Leu Asp Ser Gln Thr Glu Ile Tyr Gln965
970 975Tyr Val Gln Asn Ser Met Ala Pro His Pro Ala
Arg Asp Tyr Val Val980 985 990Leu Arg Thr
Trp Arg Thr Asn Leu Pro Lys Gly Ala Cys Ala Leu Leu995
1000 1005Leu Thr Ser Val Asp His Asp Arg Ala Pro Val
Val Gly Val Arg1010 1015 1020Val Asn
Val Leu Leu Ser Arg Tyr Leu Ile Glu Pro Cys Gly Pro1025
1030 1035Gly Lys Ser Lys Leu Thr Tyr Met Cys Arg Val
Asp Leu Arg Gly1040 1045 1050His Met
Pro Glu Trp Tyr Thr Lys Ser Phe Gly His Leu Cys Ala1055
1060 1065Ala Glu Val Val Lys Ile Arg Asp Ser Phe Ser
Asn Gln Asn Thr1070 1075 1080Glu Thr
Lys Asp Thr Lys Ser Arg1085 1090572501DNAhomo sapiens
57ctggccccga gcagctgaag cctggggtca gcaggcgctg cgggcgcagc tccggtgcaa
60gcgaggacac gacacatgca gtggcttctg gactgcgcga tgactggacg caagtaactt
120ctaggtctgc agacaagagg aagagaagat gaaggaagac tgtctgccga gttctcacgt
180gcccatcagt gacagcaagt ccattcagaa gtcggagctc ttaggcctgc tgaaaaccta
240caactgctac catgagggca agagcttcca gctgagacac cgtgaggaag aagggactct
300gatcatcgag gggctcctca acattgcctg ggggctgagg cggcccatcc ggctgcagat
360gcaggatgac cgggagcagg tgcacctccc ctccacctca tggatgccca gacggcctag
420ctgccctcta aaggagccat cgccccagaa cgggaacatc acagcccagg ggccaagcat
480tcagccagtg cacaaggctg agagttccac agacagctcg gggcccctgg aggaggcaga
540ggaggccccc cagctgatgc ggaccaagag cgacgccagt tgcatgagcc agaggaggcc
600caagtgccgc gcccccggtg aggcccagcg catccggcga caccggttct ctatcaacgg
660ccacttctac aatcataaga cctccgtgtt tactccagcc tatggatccg tgaccaatgt
720gagggtcaac agcaccatga caaccctgca ggtgctcacc ctgctgctga acaaatttag
780ggtggaagat ggccccagtg agttcgcact ctacatcgtt cacgagtctg gggagcggac
840aaaattaaaa gactgcgagt acccgctgat ttccagaatc ctgcatgggc catgtgagaa
900gatcgccagg atcttcctga tggaagctga cttgggcgtg gaagtccccc atgaagtcgc
960tcagtacatt aagtttgaaa tgccggtgct ggacagtttt gttgaaaaat taaaagaaga
1020ggaagaaaga gaaataatca aactgaccat gaagttccaa gccctgcgtc tgacgatgct
1080gcagcgcctg gagcagctgg tggaggccaa gtaactggcc aacacctgcc tcttccaaag
1140tccccagcag tggcaggtgt acactgagcc ctggttgctg gccccggccg gtcacattga
1200ctgatggcca ccgcctgacg aatcgagtgc ctgtgtgtct acctctctga agcctgagca
1260ccatgattcc cacagccagc tcttggctcc aagatgagca cccacaggaa gccgacccag
1320gcctgagggg ccaggaactt gctgggtcag atctgtgtgg ccagccctgt ccacaccatg
1380cctctcctgc actggagagc agtgctggcc cagcccctgc ggcttaggct tcatctgctt
1440gcacattgcc tgtcccagag cccctgtggg tccacaagcc cctgtcctct tccttcatat
1500gagattcttg tctgccctca tatcacgctg ccccacagga atgctgctgg gaaaagcagg
1560gcctgccagc aggtatgaga tctagcctgc tttcagccat caccttgcca cagtgtcccc
1620ggcttctaag cctccaatat caccctgtga gcctcgcaca gctcagcccc aacacagagg
1680tgagaccagg aataaggcca caagtatctc actttctcgc agggaatcaa tcttagcttc
1740agcagagaga cttaaagcga ttctgacaag gagctgctgc aagaaacgcg gtcattcaat
1800cgcattgagg agggtccaca tggcattgag agggtgctgc ccgctcaatg cccagcagca
1860gctctggaag gcagtgctca gccccatcac cactgtcccg tggatgcctg tgtacctctt
1920gccttttctg ggcttgcgtt tctctcctct agtgggtggg gatgactttc aatgactttc
1980aatacttccc ctgaaggaag aatgataagg agaaatgtct gttttgagga aagggctttg
2040aattccccag atactgaaca atttgtgttt gtgactgatg gagaatttca ggaatgaatg
2100agaaagcctt tgcgaaacta tgcaacagtt tacatcagtc atgtgaagta tttgtctaaa
2160acagagcaaa ctgaagacca aattattctc ctgttgaggt ccgtggatgg cagatttaaa
2220gggaagaacc acaaaggctt gcaaagatag gagaggctcc atctctaatg catgtagaag
2280ctccttacgg gtgcccatca agagcatagc ttggaagcca ccatgctgtg cggaactgcg
2340tcagggcaaa tgtcacagca ggatttcccc aacccagctc catcatcaca gacacagaga
2400gctgcagggg aggcctgccc actgttttgt cgactctgcc ctcctctggc agcatagatc
2460cttaggtgct caataaaggt gtgctgtatt gaactgaaga a
250158321PRThomo sapiens 58Met Lys Glu Asp Cys Leu Pro Ser Ser His Val
Pro Ile Ser Asp Ser1 5 10
15Lys Ser Ile Gln Lys Ser Glu Leu Leu Gly Leu Leu Lys Thr Tyr Asn20
25 30Cys Tyr His Glu Gly Lys Ser Phe Gln Leu
Arg His Arg Glu Glu Glu35 40 45Gly Thr
Leu Ile Ile Glu Gly Leu Leu Asn Ile Ala Trp Gly Leu Arg50
55 60Arg Pro Ile Arg Leu Gln Met Gln Asp Asp Arg Glu
Gln Val His Leu65 70 75
80Pro Ser Thr Ser Trp Met Pro Arg Arg Pro Ser Cys Pro Leu Lys Glu85
90 95Pro Ser Pro Gln Asn Gly Asn Ile Thr Ala
Lys Gly Pro Ser Ile Gln100 105 110Pro Val
His Lys Ala Glu Ser Ser Thr Asp Ser Ser Gly Pro Leu Glu115
120 125Glu Ala Glu Glu Ala Pro Gln Leu Met Arg Thr Lys
Ser Asp Ala Ser130 135 140Cys Met Ser Gln
Arg Arg Pro Lys Cys Arg Ala Pro Gly Glu Ala Gln145 150
155 160Arg Ile Arg Arg His Arg Phe Ser Ile
Asn Gly His Phe Tyr Asn His165 170 175Lys
Thr Ser Val Phe Thr Pro Ala Tyr Gly Ser Val Thr Asn Val Arg180
185 190Val Asn Ser Thr Met Thr Thr Leu Gln Val Leu
Thr Leu Leu Leu Asn195 200 205Lys Phe Arg
Val Glu Asp Gly Pro Ser Glu Phe Ala Leu Tyr Ile Val210
215 220His Glu Ser Gly Glu Arg Thr Lys Leu Lys Asp Cys
Glu Tyr Pro Leu225 230 235
240Ile Ser Arg Ile Leu His Gly Pro Cys Glu Lys Ile Ala Arg Ile Phe245
250 255Leu Met Glu Ala Asp Leu Gly Val Glu
Val Pro His Glu Val Ala Gln260 265 270Tyr
Ile Lys Phe Glu Met Pro Val Leu Asp Ser Phe Val Glu Lys Leu275
280 285Lys Glu Glu Glu Glu Arg Glu Ile Ile Lys Leu
Thr Met Lys Phe Gln290 295 300Ala Leu Arg
Leu Thr Met Leu Gln Arg Leu Glu Gln Leu Val Glu Ala305
310 315 320Lys591152DNAhomo sapiens
59atgagtgcac ttttccttgg tgtgggagtg agggcagagg aagctggagc gagggtgcaa
60caaaacgttc caagtgggac agatactgga gatcctcaaa gtaagcccct cggtgactgg
120gctgctggca ccatggaccc agagagcagt atctttattg aggatgccat taagtatttc
180aaggaaaaag tgagcacaca gaatctgcta ctcctgctga ctgataatga ggcctggaac
240ggattcgtgg ctgctgctga actgcccagg aatgaggcag atgagctccg taaagctctg
300gacaaccttg caagacaaat gatcatgaaa gacaaaaact ggcacgataa aggccagcag
360tacagaaact ggtttctgaa agagtttcct cggttgaaaa gtgagcttga ggataacata
420agaaggctcc gtgcccttgc agatggggtt cagaaggtcc acaaaggcac caccatcgcc
480aatgtggtgt ctggctctct cagcatttcc tctggcatcc tgaccctcgt cggcatgggt
540ctggcaccct tcacagaggg aggcagcctt gtactcttgg aacctgggat ggagttggga
600atcacagccg ctttgaccgg gattaccagc agtaccatgg actacggaaa gaagtggtgg
660acacaagccc aagcccacga cctggtcatc aaaagccttg acaaattgaa ggaggtgagg
720gagtttttgg gtgagaacat atccaacttt ctttccttag ctggcaatac ttaccaactc
780acacgaggca ttgggaagga catccgtgcc ctcagacgag ccagagccaa tcttcagtca
840gtaccgcatg cctcagcctc acgcccccgg gtcactgagc caatctcagc tgaaagcggt
900gaacaggtgg agagggttaa tgaacccagc atcctggaaa tgagcagagg agtcaagctc
960acggatgtgg cccctgtaag cttctttctt gtgctggatg tagtctacct cgtgtacgaa
1020tcaaagcact tacatgaggg ggcaaagtca gagacagctg aggagctgaa gaaggtggct
1080caggagctgg aggagaagct aaacattctc aacaataatt ataagattct gcaggcggac
1140caagaactgt ga
115260383PRThomo sapiens 60Met Ser Ala Leu Phe Leu Gly Val Gly Val Arg
Ala Glu Glu Ala Gly1 5 10
15Ala Arg Val Gln Gln Asn Val Pro Ser Gly Thr Asp Thr Gly Asp Pro20
25 30Gln Ser Lys Pro Leu Gly Asp Trp Ala Ala
Gly Thr Met Asp Pro Glu35 40 45Ser Ser
Ile Phe Ile Glu Asp Ala Ile Lys Tyr Phe Lys Glu Lys Val50
55 60Ser Thr Gln Asn Leu Leu Leu Leu Leu Thr Asp Asn
Glu Ala Trp Asn65 70 75
80Gly Phe Val Ala Ala Ala Glu Leu Pro Arg Asn Glu Ala Asp Glu Leu85
90 95Arg Lys Ala Leu Asp Asn Leu Ala Arg Gln
Met Ile Met Lys Asp Lys100 105 110Asn Trp
His Asp Lys Gly Gln Gln Tyr Arg Asn Trp Phe Leu Lys Glu115
120 125Phe Pro Arg Leu Lys Ser Glu Leu Glu Asp Asn Ile
Arg Arg Leu Arg130 135 140Ala Leu Ala Asp
Gly Val Gln Lys Val His Lys Gly Thr Thr Ile Ala145 150
155 160Asn Val Val Ser Gly Ser Leu Ser Ile
Ser Ser Gly Ile Leu Thr Leu165 170 175Val
Gly Met Gly Leu Ala Pro Phe Thr Glu Gly Gly Ser Leu Val Leu180
185 190Leu Glu Pro Gly Met Glu Leu Gly Ile Thr Ala
Ala Leu Thr Gly Ile195 200 205Thr Ser Ser
Thr Met Asp Tyr Gly Lys Lys Trp Trp Thr Gln Ala Gln210
215 220Ala His Asp Leu Val Ile Lys Ser Leu Asp Lys Leu
Lys Glu Val Arg225 230 235
240Glu Phe Leu Gly Glu Asn Ile Ser Asn Phe Leu Ser Leu Ala Gly Asn245
250 255Thr Tyr Gln Leu Thr Arg Gly Ile Gly
Lys Asp Ile Arg Ala Leu Arg260 265 270Arg
Ala Arg Ala Asn Leu Gln Ser Val Pro His Ala Ser Ala Ser Arg275
280 285Pro Arg Val Thr Glu Pro Ile Ser Ala Glu Ser
Gly Glu Gln Val Glu290 295 300Arg Val Asn
Glu Pro Ser Ile Leu Glu Met Ser Arg Gly Val Lys Leu305
310 315 320Thr Asp Val Ala Pro Val Ser
Phe Phe Leu Val Leu Asp Val Val Tyr325 330
335Leu Val Tyr Glu Ser Lys His Leu His Glu Gly Ala Lys Ser Glu Thr340
345 350Ala Glu Glu Leu Lys Lys Val Ala Gln
Glu Leu Glu Glu Lys Leu Asn355 360 365Ile
Leu Asn Asn Asn Tyr Lys Ile Leu Gln Ala Asp Gln Glu Leu370
375 380611761DNAhomo sapiens 61atggctttag agatccacat
gtcagacccc atgtgcctca tcgagaactt taatgagcag 60ctgaaggtta atcaggaagc
tttggagatc ctgtctgcca ttacgcaacc tgtagttgtg 120gtagcgattg tgggcctcta
tcgcactggc aaatcctacc tgatgaacaa gctggctggg 180aagaacaagg gcttctctgt
tgcatctacg gtgcagtctc acaccaaggg aatttggata 240tggtgtgtgc ctcatcccaa
ctggccaaat cacacattag ttctgcttga caccgagggc 300ctgggagatg tagagaaggc
tgacaacaag aatgatatcc agatctttgc actggcactc 360ttactgagca gcacctttgt
gtacaatact gtgaacaaaa ttgatcaggg tgctatcgac 420ctactgcaca atgtgacaga
actgacagat ctgctcaagg caagaaactc acccgacctt 480gacagggttg aagatcctgc
tgactctgcg agcttcttcc cagacttagt gtggactctg 540agagatttct gcttaggcct
ggaaatagat gggcaacttg tcacaccaga tgaatacctg 600gagaattccc taaggccaaa
gcaaggtagt gatcaaagag ttcaaaattt caatttgcct 660cgtctgtgta tacagaagtt
ctttccaaaa aagaaatgct ttatctttga cttacctgct 720caccaaaaaa agcttgccca
acttgaaaca ctgcctgatg atgagctaga gcctgaattt 780gtgcaacaag tgacagaatt
ctgttcctac atctttagcc attctatgac caagactctt 840ccaggtggca tcatggtcaa
tggatctcgt ctaaagaacc tggtgctgac ctatgtcaat 900gccatcagca gtggggatct
gccttgcata gagaatgcag tcctggcctt ggctcagaga 960gagaactcag ctgcagtgca
aaaggccatt gcccactatg accagcaaat gggccagaaa 1020gtgcagctgc ccatggaaac
cctccaggag ctgctggacc tgcacaggac cagtgagagg 1080gaggccattg aagtcttcat
gaaaaactct ttcaaggatg tagaccaaag tttccagaaa 1140gaattggaga ctctactaga
tgcaaaacag aatgacattt gtaaacggaa cctggaagca 1200tcctcggatt attgctcggc
tttacttaag gatatttttg gtcctctaga agaagcagtg 1260aagcagggaa tttattctaa
gccaggaggc cataatctct tcattcagaa aacagaagaa 1320ctgaaggcaa agtactatcg
ggagcctcgg aaaggaatac aggctgaaga agttctgcag 1380aaatatttaa agtccaagga
gtctgtgagt catgcaatat tacagactga ccaggctctc 1440acagagacgg aaaaaaagaa
gaaagaggca caagtgaaag cagaagctga aaaggctgaa 1500gcgcaaaggt tggcggcgat
tcaaaggcag aacgagcaaa tgatgcagga gagggagaga 1560ctccatcagg aacaagtgag
acaaatggag atagccaaac aaaattggct ggcagagcaa 1620cagaaaatgc aggaacaaca
gatgcaggaa caggctgcac agctcagcac aacattccaa 1680gctcaaaata gaagccttct
cagtgagctc cagcacgccc agaggactgt taataacgat 1740gatccatgtg ttttactcta a
176162586PRThomo sapiens
62Met Ala Leu Glu Ile His Met Ser Asp Pro Met Cys Leu Ile Glu Asn1
5 10 15Phe Asn Glu Gln Leu Lys
Val Asn Gln Glu Ala Leu Glu Ile Leu Ser20 25
30Ala Ile Thr Gln Pro Val Val Val Val Ala Ile Val Gly Leu Tyr Arg35
40 45Thr Gly Lys Ser Tyr Leu Met Asn Lys
Leu Ala Gly Lys Asn Lys Gly50 55 60Phe
Ser Val Ala Ser Thr Val Gln Ser His Thr Lys Gly Ile Trp Ile65
70 75 80Trp Cys Val Pro His Pro
Asn Trp Pro Asn His Thr Leu Val Leu Leu85 90
95Asp Thr Glu Gly Leu Gly Asp Val Glu Lys Ala Asp Asn Lys Asn Asp100
105 110Ile Gln Ile Phe Ala Leu Ala Leu
Leu Leu Ser Ser Thr Phe Val Tyr115 120
125Asn Thr Val Asn Lys Ile Asp Gln Gly Ala Ile Asp Leu Leu His Asn130
135 140Val Thr Glu Leu Thr Asp Leu Leu Lys
Ala Arg Asn Ser Pro Asp Leu145 150 155
160Asp Arg Val Glu Asp Pro Ala Asp Ser Ala Ser Phe Phe Pro
Asp Leu165 170 175Val Trp Thr Leu Arg Asp
Phe Cys Leu Gly Leu Glu Ile Asp Gly Gln180 185
190Leu Val Thr Pro Asp Glu Tyr Leu Glu Asn Ser Leu Arg Pro Lys
Gln195 200 205Gly Ser Asp Gln Arg Val Gln
Asn Phe Asn Leu Pro Arg Leu Cys Ile210 215
220Gln Lys Phe Phe Pro Lys Lys Lys Cys Phe Ile Phe Asp Leu Pro Ala225
230 235 240His Gln Lys Lys
Leu Ala Gln Leu Glu Thr Leu Pro Asp Asp Glu Leu245 250
255Glu Pro Glu Phe Val Gln Gln Val Thr Glu Phe Cys Ser Tyr
Ile Phe260 265 270Ser His Ser Met Thr Lys
Thr Leu Pro Gly Gly Ile Met Val Asn Gly275 280
285Ser Arg Leu Lys Asn Leu Val Leu Thr Tyr Val Asn Ala Ile Ser
Ser290 295 300Gly Asp Leu Pro Cys Ile Glu
Asn Ala Val Leu Ala Leu Ala Gln Arg305 310
315 320Glu Asn Ser Ala Ala Val Gln Lys Ala Ile Ala His
Tyr Asp Gln Gln325 330 335Met Gly Gln Lys
Val Gln Leu Pro Met Glu Thr Leu Gln Glu Leu Leu340 345
350Asp Leu His Arg Thr Ser Glu Arg Glu Ala Ile Glu Val Phe
Met Lys355 360 365Asn Ser Phe Lys Asp Val
Asp Gln Ser Phe Gln Lys Glu Leu Glu Thr370 375
380Leu Leu Asp Ala Lys Gln Asn Asp Ile Cys Lys Arg Asn Leu Glu
Ala385 390 395 400Ser Ser
Asp Tyr Cys Ser Ala Leu Leu Lys Asp Ile Phe Gly Pro Leu405
410 415Glu Glu Ala Val Lys Gln Gly Ile Tyr Ser Lys Pro
Gly Gly His Asn420 425 430Leu Phe Ile Gln
Lys Thr Glu Glu Leu Lys Ala Lys Tyr Tyr Arg Glu435 440
445Pro Arg Lys Gly Ile Gln Ala Glu Glu Val Leu Gln Lys Tyr
Leu Lys450 455 460Ser Lys Glu Ser Val Ser
His Ala Ile Leu Gln Thr Asp Gln Ala Leu465 470
475 480Thr Glu Thr Glu Lys Lys Lys Lys Glu Ala Gln
Val Lys Ala Glu Ala485 490 495Glu Lys Ala
Glu Ala Gln Arg Leu Ala Ala Ile Gln Arg Gln Asn Glu500
505 510Gln Met Met Gln Glu Arg Glu Arg Leu His Gln Glu
Gln Val Arg Gln515 520 525Met Glu Ile Ala
Lys Gln Asn Trp Leu Ala Glu Gln Gln Lys Met Gln530 535
540Glu Gln Gln Met Gln Glu Gln Ala Ala Gln Leu Ser Thr Thr
Phe Gln545 550 555 560Ala
Gln Asn Arg Ser Leu Leu Ser Glu Leu Gln His Ala Gln Arg Thr565
570 575Val Asn Asn Asp Asp Pro Cys Val Leu Leu580
58563828DNAhomo sapiens 63gggggagtga aagcgaaagc ccgggcgact
agccgggaga ccagagatct agcgactgaa 60gcagcatggc caagccgtgt ggggtgcgcc
tgagcgggga agcccgcaaa caggtggagg 120tcttcaggca gaatcttttc caggaggctg
aggaattcct ctacagattc ttgccacaga 180aaatcatata cctgaatcag ctcttgcaag
aggactccct caatgtggct gacttgactt 240ccctccgggc cccactggac atccccatcc
cagaccctcc acccaaggat gatgagatgg 300aaacagataa gcaggagaag aaagaagtcc
ctaagtgtgg atttctccct gggaatgaga 360aagtcctgtc cctgcttgcc ctggttaagc
cagaagtctg gactctcaaa gagaaatgca 420ttctggtgat tacatggatc caacacctga
tccccaagat tgaagatgga aatgattttg 480gggtagcaat ccaggagaag gtgctggaga
gggtgaatgc cgtcaagacc aaagtggaag 540ctttccagac aaccatttcc aagtacttct
cagaacgtgg ggatgctgtg gccaaggcct 600ccaaggagac tcatgtaatg gattaccggg
ccttggtgca tgagcgagat gaggcagcct 660atggggagct cagggccatg gtgctggacc
tgagggcctt ctatgctgag ctttatcata 720tcatcagcag caacctggag aaaattgtca
ccccaaaggg tgaagaaaag ccatctatgt 780actgaacccg ggactagaag gaaaataaat
gatctatatg ttgtgtgg 82864239PRThomo sapiens 64Met Ala Lys
Pro Cys Gly Val Arg Leu Ser Gly Glu Ala Arg Lys Gln1 5
10 15Val Glu Val Phe Arg Gln Asn Leu Phe
Gln Glu Ala Glu Glu Phe Leu20 25 30Tyr
Arg Phe Leu Pro Gln Lys Ile Ile Tyr Leu Asn Gln Leu Leu Gln35
40 45Glu Asp Ser Leu Asn Val Ala Asp Leu Thr Ser
Leu Arg Ala Pro Leu50 55 60Asp Ile Pro
Ile Pro Asp Pro Pro Pro Lys Asp Asp Glu Met Glu Thr65 70
75 80Asp Lys Gln Glu Lys Lys Glu Val
Pro Lys Cys Gly Phe Leu Pro Gly85 90
95Asn Glu Lys Val Leu Ser Leu Leu Ala Leu Val Lys Pro Glu Val Trp100
105 110Thr Leu Lys Glu Lys Cys Ile Leu Val Ile
Thr Trp Ile Gln His Leu115 120 125Ile Pro
Lys Ile Glu Asp Gly Asn Asp Phe Gly Val Ala Ile Gln Glu130
135 140Lys Val Leu Glu Arg Val Asn Ala Val Lys Thr Lys
Val Glu Ala Phe145 150 155
160Gln Thr Thr Ile Ser Lys Tyr Phe Ser Glu Arg Gly Asp Ala Val Ala165
170 175Lys Ala Ser Lys Glu Thr His Val Met
Asp Tyr Arg Ala Leu Val His180 185 190Glu
Arg Asp Glu Ala Ala Tyr Gly Glu Leu Arg Ala Met Val Leu Asp195
200 205Leu Arg Ala Phe Tyr Ala Glu Leu Tyr His Ile
Ile Ser Ser Asn Leu210 215 220Glu Lys Ile
Val Thr Pro Lys Gly Glu Glu Lys Pro Ser Met Tyr225 230
235652578DNAhomo sapiens 65cttttgtctc tcagctattt tttgttccct
atgtttgtag gatggaaagg cagatgtaaa 60gtccctcatg gcgaaatata acacgggggg
caacccgaca gaggatgtct cagtcaatag 120ccgacccttc agagtcacag ggccaaactc
atcttcagga atacaagcaa gaaagaactt 180attcaacaac caaggaaatg ccagccctcc
tgcaggaccc agcaatgtac ctaagtttgg 240gtccccaaag ccacctgtgg cagtcaaacc
ttcttctgag gaaaagcctg acaaggaacc 300caagcccccg tttctaaagc ccactggagc
aggccaaaga ttcggaacac cagccagctt 360gaccaccaga gaccccgagg cgaaagtggg
atttctgaaa cctgtaggcc ccaagcccat 420caacttgccc aaagaagatt ccaaacctac
atttccctgg cctcctggaa acaagccatc 480tcttcacagt gtaaaccaag accatgactt
aaagccacta ggcccgaaat ctgggcctac 540tcctccaacc tcagaaaatg aacagaagca
agcgtttccc aaattgactg gggttaaagg 600gaaatttatg tcagcatcac aagatcttga
acccaagccc ctcttcccca aacccgcctt 660tggccagaag ccgcccctaa gtaccgagaa
ctcccatgaa gacgaaagcc ccatgaagaa 720tgtgtcttca tcaaaagggt ccccagctcc
cctgggagtc aggtccaaaa gcggcccttt 780aaaaccagca agggaagact cagaaaataa
agaccatgca ggggagattt caagtttgcc 840ctttcctgga gtggttttga aacctgctgc
gagcagggga ggcccaggtg tctccaaaaa 900tggtgaagaa aaaaaggaag ataggaagat
agatgctgct aagaacacct tccagagcaa 960aataaatcag gaagagttgg cctcagggac
tcctcctgcc aggttcccta aggccccttc 1020taagctgaca gtgggggggc catggggcca
aagtcaggaa aaggaaaagg gagacaagaa 1080ttcagccacc ccgaaacaga agccattgcc
tcccttgttt accttgggtc cacctccacc 1140aaaacccaac agaccaccaa atgttgacct
gacgaaattc cacaaaacct cttctggaaa 1200cagtactagc aaaggccaga cgtcttactc
aacaacttcc ctgccaccac ctccaccatc 1260ccatccggcc agccaaccac cattgccagc
atctcaccca tcacaaccac cagtcccaag 1320cctacctccc agaaacatta aacctccgtt
tgacctaaaa agccctgtca atgaagacaa 1380tcaagatggt gtcacgcact ctgatggtgc
tggaaatcta gatgaggaac aagacagtga 1440aggagaaaca tatgaagaca tagaagcatc
caaagaaaga gagaagaaaa gggaaaagga 1500agaaaagaag aggttagagc tggagaaaaa
ggaacagaaa gagaaagaaa agaaagaaca 1560agaaataaag aagaaattta aactaacagg
ccctattcaa gtcatccatc ttgcaaaagc 1620ttgttgtgat gtcaaaggag gaaagaatga
actgagcttc aagcaaggag agcaaattga 1680aatcatccgc atcacagaca acccagaagg
aaaatggttg ggcagaacag caaggggttc 1740atatggctat attaaaacaa ctgctgtaga
gattgactat gattctttga aactgaaaaa 1800agactctctt ggtgcccctt caagacctat
tgaagatgac caagaagtat atgatgatgt 1860tgcagagcag gatgatatta gcagccacag
tcagagtgga agtggaggga tattccctcc 1920accaccagat gatgacattt atgatgggat
tgaagaggaa gatgctgatg atggtttccc 1980tgctcctcct aaacaattgg acatgggaga
tgaagtttac gatgatgtgg atacctctga 2040tttccctgtt tcatcagcag agatgagtca
aggaactaat tttggaaaag ctaagacaga 2100agaaaaggac cttaagaagc taaaaaagca
ggaaaaagaa gaaaaagact tcaggaaaaa 2160atttaaatat gatggtgaaa ttagagtcct
atattcaact aaagttacaa cttccataac 2220ttctaaaaag tggggaacca gagatctaca
ggtaaaacct ggtgaatctc tagaagttat 2280acaaaccaca gatgacacaa aagttctctg
cagaaatgaa gaagggaaat atggttatgt 2340ccttcggagt tacctagcgg acaatgatgg
agagatctat gatgatattg ctgatggctg 2400catctatgac aatgactagc actcaacttt
ggtcattctg ctgtgttcat taggtgccaa 2460tgtgaagtct ggattttaat tggcatgtta
ttgggtatca agaaaattaa tgcacaaaac 2520cacttattat catttgttat gaaatcccaa
ttatctttac aaagtgttta aagtttga 257866783PRThomo sapiens 66Met Ala Lys
Tyr Asn Thr Gly Gly Asn Pro Thr Glu Asp Val Ser Val1 5
10 15Asn Ser Arg Pro Phe Arg Val Thr Gly
Pro Asn Ser Ser Ser Gly Ile20 25 30Gln
Ala Arg Lys Asn Leu Phe Asn Asn Gln Gly Asn Ala Ser Pro Pro35
40 45Ala Gly Pro Ser Asn Val Pro Lys Phe Gly Ser
Pro Lys Pro Pro Val50 55 60Ala Val Lys
Pro Ser Ser Glu Glu Lys Pro Asp Lys Glu Pro Lys Pro65 70
75 80Pro Phe Leu Lys Pro Thr Gly Ala
Gly Gln Arg Phe Gly Thr Pro Ala85 90
95Ser Leu Thr Thr Arg Asp Pro Glu Ala Lys Val Gly Phe Leu Lys Pro100
105 110Val Gly Pro Lys Pro Ile Asn Leu Pro Lys
Glu Asp Ser Lys Pro Thr115 120 125Phe Pro
Trp Pro Pro Gly Asn Lys Pro Ser Leu His Ser Val Asn Gln130
135 140Asp His Asp Leu Lys Pro Leu Gly Pro Lys Ser Gly
Pro Thr Pro Pro145 150 155
160Thr Ser Glu Asn Glu Gln Lys Gln Ala Phe Pro Lys Leu Thr Gly Val165
170 175Lys Gly Lys Phe Met Ser Ala Ser Gln
Asp Leu Glu Pro Lys Pro Leu180 185 190Phe
Pro Lys Pro Ala Phe Gly Gln Lys Pro Pro Leu Ser Thr Glu Asn195
200 205Ser His Glu Asp Glu Ser Pro Met Lys Asn Val
Ser Ser Ser Lys Gly210 215 220Ser Pro Ala
Pro Leu Gly Val Arg Ser Lys Ser Gly Pro Leu Lys Pro225
230 235 240Ala Arg Glu Asp Ser Glu Asn
Lys Asp His Ala Gly Glu Ile Ser Ser245 250
255Leu Pro Phe Pro Gly Val Val Leu Lys Pro Ala Ala Ser Arg Gly Gly260
265 270Pro Gly Val Ser Lys Asn Gly Glu Glu
Lys Lys Glu Asp Arg Lys Ile275 280 285Asp
Ala Ala Lys Asn Thr Phe Gln Ser Lys Ile Asn Gln Glu Glu Leu290
295 300Ala Ser Gly Thr Pro Pro Ala Arg Phe Pro Lys
Ala Pro Ser Lys Leu305 310 315
320Thr Val Gly Gly Pro Trp Gly Gln Ser Gln Glu Lys Glu Lys Gly
Asp325 330 335Lys Asn Ser Ala Thr Pro Lys
Gln Lys Pro Leu Pro Pro Leu Phe Thr340 345
350Leu Gly Pro Pro Pro Pro Lys Pro Asn Arg Pro Pro Asn Val Asp Leu355
360 365Thr Lys Phe His Lys Thr Ser Ser Gly
Asn Ser Thr Ser Lys Gly Gln370 375 380Thr
Ser Tyr Ser Thr Thr Ser Leu Pro Pro Pro Pro Pro Ser His Pro385
390 395 400Ala Ser Gln Pro Pro Leu
Pro Ala Ser His Pro Ser Gln Pro Pro Val405 410
415Pro Ser Leu Pro Pro Arg Asn Ile Lys Pro Pro Phe Asp Leu Lys
Ser420 425 430Pro Val Asn Glu Asp Asn Gln
Asp Gly Val Thr His Ser Asp Gly Ala435 440
445Gly Asn Leu Asp Glu Glu Gln Asp Ser Glu Gly Glu Thr Tyr Glu Asp450
455 460Ile Glu Ala Ser Lys Glu Arg Glu Lys
Lys Arg Glu Lys Glu Glu Lys465 470 475
480Lys Arg Leu Glu Leu Glu Lys Lys Glu Gln Lys Glu Lys Glu
Lys Lys485 490 495Glu Gln Glu Ile Lys Lys
Lys Phe Lys Leu Thr Gly Pro Ile Gln Val500 505
510Ile His Leu Ala Lys Ala Cys Cys Asp Val Lys Gly Gly Lys Asn
Glu515 520 525Leu Ser Phe Lys Gln Gly Glu
Gln Ile Glu Ile Ile Arg Ile Thr Asp530 535
540Asn Pro Glu Gly Lys Trp Leu Gly Arg Thr Ala Arg Gly Ser Tyr Gly545
550 555 560Tyr Ile Lys Thr
Thr Ala Val Glu Ile Asp Tyr Asp Ser Leu Lys Leu565 570
575Lys Lys Asp Ser Leu Gly Ala Pro Ser Arg Pro Ile Glu Asp
Asp Gln580 585 590Glu Val Tyr Asp Asp Val
Ala Glu Gln Asp Asp Ile Ser Ser His Ser595 600
605Gln Ser Gly Ser Gly Gly Ile Phe Pro Pro Pro Pro Asp Asp Asp
Ile610 615 620Tyr Asp Gly Ile Glu Glu Glu
Asp Ala Asp Asp Gly Phe Pro Ala Pro625 630
635 640Pro Lys Gln Leu Asp Met Gly Asp Glu Val Tyr Asp
Asp Val Asp Thr645 650 655Ser Asp Phe Pro
Val Ser Ser Ala Glu Met Ser Gln Gly Thr Asn Phe660 665
670Gly Lys Ala Lys Thr Glu Glu Lys Asp Leu Lys Lys Leu Lys
Lys Gln675 680 685Glu Lys Glu Glu Lys Asp
Phe Arg Lys Lys Phe Lys Tyr Asp Gly Glu690 695
700Ile Arg Val Leu Tyr Ser Thr Lys Val Thr Thr Ser Ile Thr Ser
Lys705 710 715 720Lys Trp
Gly Thr Arg Asp Leu Gln Val Lys Pro Gly Glu Ser Leu Glu725
730 735Val Ile Gln Thr Thr Asp Asp Thr Lys Val Leu Cys
Arg Asn Glu Glu740 745 750Gly Lys Tyr Gly
Tyr Val Leu Arg Ser Tyr Leu Ala Asp Asn Asp Gly755 760
765Glu Ile Tyr Asp Asp Ile Ala Asp Gly Cys Ile Tyr Asp Asn
Asp770 775 78067618DNAhomo sapiens
67gcggccgctc cgcaggcaga gaagccggga gcgtttgagg cggcggcggc acgagcgatg
60gcaggaatag agttggagcg gtgccagcag caggcgaacg aggtgacgga aattatgcgt
120aacaacttcg gcaaggtcct ggagcgtggt gtgaagctgg ccgaactgca gcagcgttca
180gaccaactcc tggatatgag ctcaaccttc aacaagacta cacagaacct ggcccagaag
240aagtgctggg agaacatccg ttaccggatc tgcgtggggc tggtggtggt tggtgtcctg
300ctcatcatcc tgattgtgct gctggtcgtc tttctccctc agagcagtga cagcagtagt
360gccccacgga cccaggatgc aggcattgcc tcagggcctg ggaactgacc cagctggtcc
420tgaaggagaa gcccaatggc tgcactggcc gattctggtc tccaaggacc ttggtgtttg
480ctctccctga cccagcccag tgagtgccaa agggcagccc caacatgtgc acccctgcat
540tcccgtcatg cacagacttg cccttgagca ggccgctgta ctggccagct gggcaacccc
600cctggagctc ataaaaat
61868116PRThomo sapiens 68Met Ala Gly Ile Glu Leu Glu Arg Cys Gln Gln Gln
Ala Asn Glu Val1 5 10
15Thr Glu Ile Met Arg Asn Asn Phe Gly Lys Val Leu Glu Arg Gly Val20
25 30Lys Leu Ala Glu Leu Gln Gln Arg Ser Asp
Gln Leu Leu Asp Met Ser35 40 45Ser Thr
Phe Asn Lys Thr Thr Gln Asn Leu Ala Gln Lys Lys Cys Trp50
55 60Glu Asn Ile Arg Tyr Arg Ile Cys Val Gly Leu Val
Val Val Gly Val65 70 75
80Leu Leu Ile Ile Leu Ile Val Leu Leu Val Val Phe Leu Pro Gln Ser85
90 95Ser Asp Ser Ser Ser Ala Pro Arg Thr Gln
Asp Ala Gly Ile Ala Ser100 105 110Gly Pro
Gly Asn115691316DNAhomo sapiens 69gggtttgggg tagaagggag ggagggggca
ggacagtgtg gaatctctag ggtgtatggg 60taggtagggg gcacagttag ttctaagtgg
gcttttatgc taaaagcctc tggggatatc 120tgttttgaaa ataaagatag gtgtcccctc
cttgctgtca tctagcccag acactctgct 180tgctctctgg ctgtctgctc cctgggaagg
ctttaggagg accacccagg acaggatgac 240catgctgcca tctgctctgg agctgggtct
cagtgcagag ggacagtgac tgtggatggt 300tgcagtctct ggtgggaggt gaggatagaa
gtgataaaga gctaagagga gcttctggga 360gccttggagg aggtcagtct tgcagtggtg
aagccaggac ataggagatg gagcagggct 420gtgagaggag gagattctga ggaggatgca
ggggaaatct tgtctgttaa tgaaatagga 480gtggggtggg gtttggggtg gggtggtcat
tgccgtttga gctgctgatt ttcatgagtc 540gccttcaaaa ctctcgtgta gggttgacaa
tgtggggggg tgggggatcc agcttattct 600tttattttca agtccattct tggggctggt
ggggaggcag gagaataccc ctccctaagc 660ccttagtgtg tgccgagctt gctttgtgat
gttggcaggg gaggggagac ctgggtggtg 720actgagttcc ctttatcaaa cccttcagtg
ggcacaaaat tgagtgcttg attttaggtt 780ttattttttt atgaatgtcc aaatctgtgt
ttccccctgc cctcccagac tgtgtggcca 840gttgaaagtg tctggtttgt gttcatctct
ccctcatttc tggagcaggg cctgagaccc 900tgccacatct cctatgctct gcatccacgc
ctcttttgga cattaaaggt tgattgatgc 960acctctgcac tgtttgggtc tctttgggga
tgaggggttg gcatggtggc agtggtgcca 1020cacagtgggt gagggtggag agtctccagg
gtggaataga atggggactg aagggaagac 1080cagccactag atactgattg gcctgtagca
gcacttattt gtgcctaggc ttatgcccct 1140taagtagagg aaaactaacc agcagcactc
acccttaagg gctcctgggt tctgccttcc 1200ttggtggtga tggccaggtg aatcatattt
tgtgtctttg ggatagtaac tgctaccttc 1260ccagctgccg tcatggacct gcctgagctt
tgctgcttca acttttgccc aaagct 1316703517DNAhomo sapiens 70ccgtaaagcg
gtggagaatc tcaagcatgt gcatttaatt gaggaatagc agaagggcta 60aagcaaccaa
gaaaagaagt gtgggtattt ttgttaagta aaacagccca agtgcttctg 120gaggtgggtt
tctaccaaga tagaggaaaa gggctgaatt ccctctaagt gggacagccg 180agctcaggat
gtgcttccca gcttcactgg ttaatttgac ctgaacctat ttaaagatcc 240cttctgcccc
tgaagaccta tccgcactca aattctaaca tgaagaaatc tactcgaatg 300catcctttac
tttgaatgag ctctattcgg ttgcatgtta tatgtgattt ccttcctccc 360aactgtttcc
actgagcgca cccagtctcc cctagtcttc ctctgtgggt gtgatttttg 420tgatttttac
aaacaaaacc cttgaagttc ttggcagatg tgtttgtttc tgtttgcatg 480tactgcagat
accccaggac aagcggggga ttcatttttc agccattcag ttgtttcctc 540aataatccgc
agcaaagtga aaatattctt agcactcaga ctgtacttag agtgttttct 600cagtccagtc
tgtacagtct gtaggcagaa ggcctcagaa gaaagtcatg gccactcagt 660gcccactgtg
ggctttgtaa gtcctggctc tcccgtcaag gttacccaga ggtaaaagct 720tcctgggagt
ggggccaggt gtgtttggca ctccagatag aaggcaaaat gctcagattc 780gggcctgtgc
acttgtatgc aacctgtcgg tcgataccta gcatttattt ttccctgaca 840atgaacgacc
tttccctcac ccaccctaag ctcaaagagt ttagcaaaat tctcttttaa 900ataaacagaa
tgccagtaag aggttgaccc ctaccatgga acttctggga tgctaaatac 960ttcctcatga
acaaaataag ttccttatta taagttcctt atactagcag cttcacctaa 1020agaattttct
ctccagcaat attgacttca ctggggaaaa gccaagagtg tgtggtgagt 1080gatttgttct
cactcgacct ggctaggact ggctaggagc tgttttttgt acatgaggga 1140atttgggctt
tcctcagtta tctgaatgtt ttacccaagt gccttcctgc tattgtagca 1200aagtagctca
gcttccttgt ccacagggtg aaaaaggact aatgcatttt ccatcagttt 1260tctaactatg
ttagcaaaaa cggcctcctg gtagctcaac ctcctgtacg cgtgtgtgtg 1320tgtaatacac
acacaaataa acccctctgt ttttctaaga catcttagct ggatattata 1380ggaagcactt
tcataaacaa ctgtaacaaa tcgcaaagga aagagaaaca aaagcattag 1440atttgagaca
taaacaggca agagaaagtg tattaggaac tgacagctat caaggaagtt 1500ttgtcagtta
caaatgctag gaggaaattt tgccaagaag gatggctcat gaaatatttc 1560cagtacggga
agaggcaata agatcctcta agagaatgag aaagtagggg tgtctaaatg 1620gtaaagatgg
gtgtgttgca cgtgtgttag aaggatctca gttgagtgaa ggtttgcact 1680gctacatcta
agttaatgta aatatgtagc actctgacag gtctaccgtg ttgctgaatg 1740tagtatattt
ccaaagtttg caagtcttcc tgtattgtac aaagatgctg ctgcttgata 1800atatgtatag
caatccagat tagtatgtta ttaaatttta ttttcttacc tgtattttta 1860tgctttttac
ctgtcctcaa aatattacac ccctgttgga attagattta tatttataaa 1920tggtcagaaa
tctttttaag tgtctctttt tacacatagg ttgatttttt tttcttaaga 1980gaaatgatgt
attcttgaaa catttgttac tcattccagg aaacaaaaac ccatataata 2040aaacccccac
tcagagcctg ttagtcacct ctctagaaga tggcatctca ggagaaggaa 2100tggctttgtg
gaagaaggaa tcaccttttt cttgctcaag aattatgctg acttcagccc 2160tgagcctgga
tctggtcact gagaatcatc aagtgtctag atcctccccc caaaataact 2220aatttagtag
gtgattttga ttttaaaaaa ttgacaccaa aaccctgcct gcattgtaat 2280ggaattcgaa
aagaattcat gttcacagaa ctcaacgttc aggctaatat ttacagaagg 2340gaccaaatct
aaatcctggt agataactcc tgtatgcttt atccaaagga cacccacagt 2400tttccagcat
agatataacc aaggatgaat tgattccttc aaagaactgg gaggcacgga 2460tattgcattt
tttgtttaca tccagtagcc aagacgcctc agtgagccag tcttgggcag 2520aggctgtcac
atttaggcag attggaagtt ggtatgttct aattctcact ctggactaca 2580gtgaggctga
atttatcatg tcaaaaaaaa aaaaaaaaaa agacctttcc aagtgctttc 2640tattgctcag
aattgaaaga atgttttcat ttcaagttta caagaggcat ggatggagtt 2700gtgacgttct
tgacaagctg ggctaacctt tcccgaactt gtttcccgga ggcaaggtgc 2760tcggtgaccc
agcgcatctt aaccttgggt ctcctaggct cgaggctagg gcattacgtt 2820tcgtggaacc
aaagcagcca attgcatagc aagtattttc ctgcattcca attaaatgct 2880taagaaaaag
cagcatccta taaaattgtg atcataaaca tccatttccc tcagcttttg 2940tgagtgcctt
gacttacagc caacatcact gtttaactca gtctgtttaa aaacaaactt 3000ttctggtggt
tgataacaga gagttgctcc ctgagccatc agggtcctgg gagctggaag 3060tgaaagggtt
attaacattc tacctttatg cagctgttgg ctgaccagaa taaactccct 3120gctgagttca
agctttgaat ggaatggatg caaatgatgt tgtttccatt agagcaggtg 3180ctcacagcat
tctgattggc ctgagcagac cgaggctatg gctgttggga caagcttagc 3240atcctggaca
tcttgtcaaa gaacctcact cacccctctg gcctctacag ccctcagagg 3300agagaaaacc
aattctccaa caaacaggtc tctccaacat ggtggtgctg gcaggcttag 3360gtttagaaaa
tcctgactgt taaaggcgtt tgaatacatc acattcctat gcaaatgttt 3420ttaatctcca
gtttaatgta gtttattttt cctatatgta aagtattttt atacggcttg 3480tatcatgata
gtttagcaat aaaacagttg gaagcaa
3517713720DNAhomo sapiens 71acaccttctc acaggactgg agagagaatg cggggcagct
gggcagggct cacttccagc 60cgcctgtcac agtactggga gtaagaggtg acctatttat
ttttagaagg gggcagtgat 120aataacccag ctcctagctt cattcaaggg aggcaggcgc
tttggaagtt tgtaaacacc 180aactttctga gtaagggagg agcacttttt ttccaaaaag
gaaagaacgt ctctactggg 240tttttttcct cctgatattc agcattagag tagaaaagaa
actattgttt ggccacatta 300gccgtggtta gcaggtgctg cagcctttgc cactgttatt
atttttaaag ggcagaaatg 360cctgaaggtg aagactttgg accaggcaaa agctgggaag
ttatcaattc caaaccagat 420gaaagaccca ggctcagcca ctgtattgca gaatcatgga
tgaatttcag catatttctt 480caagaaatgt ctctttttaa acagcagagc cctggcaagt
tttgtctcct ggtctgtagt 540gtgtgcacat tttttacgat cttgggaagt tacattcctg
gggttatact cagctatcta 600ctgttactgt gtgcattttt gtgtccattg tttaaatgta
atgatattgg acaaaaaatt 660tacagcaaaa ttaagtcagt tctgctgaaa ctggattttg
gaattggaga atatattaat 720cagaagaaac gtgagagatc tgaagcagac aaagaaaaaa
gtcacaaaga tgacagtgaa 780ttagactttt cagctctttg tcctaagatt agcctcacgg
ttgctgccaa agagttatct 840gtgtctgaca cagacgtctc agaggtatcc tggactgata
atgggacctt caacctttca 900gaaggataca ctccacagac agacacttct gatgatcttg
accgacccag tgaggaagtt 960ttctctagag atctttcaga ttttccatct ctagaaaatg
gcatgggaac aaatgatgaa 1020gatgaattaa gccttggttt gcccactgag ctcaagagaa
agaaggaaca gttggacagt 1080ggtcacagac caagcaaaga gacgcaatca gcagctggtc
tcacccttcc tctgaacagt 1140gaccaaacct ttcacctgat gagcaacctg gctggggatg
ttatcacagc tgcagtgact 1200gcagctatca aagaccagtt agagggtgtg cagcaagcac
tttctcaggc tgcccccatc 1260ccagaagagg acacagacac tgaagaaggt gatgactttg
aactacttga ccagtcagag 1320ctggatcaaa ttgagagtga attgggactt acacaagacc
aggaagcaga agcacagcaa 1380aataagaagt cttcaggttt cctttcaaat ctgctgggag
gccattaatc taggaatcag 1440cttgcaacag agcacaaaaa acaccaaaaa aatttcaaac
aagaaaaaaa aaaaaaaaag 1500gaaaagaaaa aaattgaact gtaagcttta atgattactt
tagatttgtt ttattttccc 1560tcctgcagtg aattaattgg atatatatca gctgacactg
atagattgat atttctgatc 1620gttatttttg tgtcataagc atggaaatga actttataca
caccactgtg ttgtcagaga 1680taaatattag gggttgtttt taaagcaaaa agaaaaaaac
aaaaaccaaa ctattaaaat 1740cctcctataa atattctttt tctttacagt ttttcaagca
tgcaaaacag tttattgtaa 1800cttactgaaa aatattaaca attaattgtg aatacatgct
gttaccagct tccttattcc 1860taatacctgg aaaatttttt tttcaacgga tagattttga
tgtaaaaaag accgaaatta 1920tcaaggtatc ttagttgaag gacttgggaa atactatcaa
aattaatttc ttaggaaaaa 1980atttaaaagt atatttaagt actctggata gactgaaacg
tttccatgtt atttctgcag 2040ttgtagactt aggcttattt gtaaagaagc atgctccatt
gactgccatc tctagtcttg 2100cagtgggtgg tattaaccca tagaaagcaa gcagttgtgt
atcacataga caatggttat 2160gatgtaaaca gattcagttg ttttgttgtt cattcgtcat
atgtttgtga tagggatgtt 2220gggagcacag ctctattctg cctgctcaga cttaagttag
acccttatct tttatattat 2280gtcatgaaaa aagtctccta aaattgtgaa actagttctt
gatgagtgat gtgatcatca 2340gcaataaaga tataataact ctgttttctt agcctgtata
gaggagagga acttgcttgg 2400ctttaaaata tatttatttg ccatttaagt ataaatatga
aatctgtttc ttattgggaa 2460gatagaatat atatattttc ctttaaactt tttaaggtca
cttttaaata accaaatttg 2520atttatggtt tttaacaaag gactaaagag ctgaaaccaa
cctagttttg tttttgtgat 2580ataaacttta agtgtcgagg gaccatgcca gcaactacca
aaaatctctt aaatcttcag 2640gtacagctgg cattttggca gatgcataga gacatctgag
accctcagaa aggaaggata 2700atccaagaat ataggaaatc tgtgttctct tcctttcatt
ttatccctta tatttctaaa 2760gactaattat aagtaatctg acattttaat gtagctactc
ttatttattt tttctttctg 2820aggtattaaa atatctggac tgagttttgc caaatgttaa
agggagaaga gttactgaag 2880actttgaaca cttgcttttt gtgattgctt atgtcattag
tgcctcatga ctgtgtttga 2940tgtcctttat tgatacaaag tgagcctgtg ccttcattat
cttgcccatt ttaatacaaa 3000tggaaacctg gtgtttgaaa atctctgaac tgtgtgggtt
ttggaggaat atacctgaat 3060tttattcaat aacagtttct ggacaggaag aaaaatacag
ttacatattt ataaaatagt 3120cgttatcagt atttttttat gtgtatgttt ctttctttaa
aacaatattc ttggatataa 3180agtagaaaag tttaaaggtc atttccattt cttcactaag
gagaaaaaaa gttaaataat 3240ccaagtaatt aaagaatata agtcactaga tgaccttaca
ggaagacgaa ctcaagggct 3300gataatctgt ggtggtatga acaataaatc tagaataaaa
tgttaataac tacaaattaa 3360aaggggtgtg aggatgggag gaagttggta gggtagaaaa
atgtgctatt accactattg 3420aggagacatg ccagctctct agggacagca gcattataac
tatgtatgaa ttttaatatt 3480atttgtatat gactgtatga ctacaaattt acacaataca
ataatgggac tttctcacaa 3540ctattaattc aaacaaacac aaggatgttg aaggttcttg
tttgtgtata tgtgtgtttt 3600ggtggtgggg ggtcactgtt tctggtttta aaagatgaag
gagcagatac atttcatatg 3660attgatccag tgtagtagag gactacatgt cctttactat
gagaatataa atagcaatat 372072356PRThomo sapiens 72Met Pro Glu Gly Glu
Asp Phe Gly Pro Gly Lys Ser Trp Glu Val Ile1 5
10 15Asn Ser Lys Pro Asp Glu Arg Pro Arg Leu Ser
His Cys Ile Ala Glu20 25 30Ser Trp Met
Asn Phe Ser Ile Phe Leu Gln Glu Met Ser Leu Phe Lys35 40
45Gln Gln Ser Pro Gly Lys Phe Cys Leu Leu Val Cys Ser
Val Cys Thr50 55 60Phe Phe Thr Ile Leu
Gly Ser Tyr Ile Pro Gly Val Ile Leu Ser Tyr65 70
75 80Leu Leu Leu Leu Cys Ala Phe Leu Cys Pro
Leu Phe Lys Cys Asn Asp85 90 95Ile Gly
Gln Lys Ile Tyr Ser Lys Ile Lys Ser Val Leu Leu Lys Leu100
105 110Asp Phe Gly Ile Gly Glu Tyr Ile Asn Gln Lys Lys
Arg Glu Arg Ser115 120 125Glu Ala Asp Lys
Glu Lys Ser His Lys Asp Asp Ser Glu Leu Asp Phe130 135
140Ser Ala Leu Cys Pro Lys Ile Ser Leu Thr Val Ala Ala Lys
Glu Leu145 150 155 160Ser
Val Ser Asp Thr Asp Val Ser Glu Val Ser Trp Thr Asp Asn Gly165
170 175Thr Phe Asn Leu Ser Glu Gly Tyr Thr Pro Gln
Thr Asp Thr Ser Asp180 185 190Asp Leu Asp
Arg Pro Ser Glu Glu Val Phe Ser Arg Asp Leu Ser Asp195
200 205Phe Pro Ser Leu Glu Asn Gly Met Gly Thr Asn Asp
Glu Asp Glu Leu210 215 220Ser Leu Gly Leu
Pro Thr Glu Leu Lys Arg Lys Lys Glu Gln Leu Asp225 230
235 240Ser Gly His Arg Pro Ser Lys Glu Thr
Gln Ser Ala Ala Gly Leu Thr245 250 255Leu
Pro Leu Asn Ser Asp Gln Thr Phe His Leu Met Ser Asn Leu Ala260
265 270Gly Asp Val Ile Thr Ala Ala Val Thr Ala Ala
Ile Lys Asp Gln Leu275 280 285Glu Gly Val
Gln Gln Ala Leu Ser Gln Ala Ala Pro Ile Pro Glu Glu290
295 300Asp Thr Asp Thr Glu Glu Gly Asp Asp Phe Glu Leu
Leu Asp Gln Ser305 310 315
320Glu Leu Asp Gln Ile Glu Ser Glu Leu Gly Leu Thr Gln Asp Gln Glu325
330 335Ala Glu Ala Gln Gln Asn Lys Lys Ser
Ser Gly Phe Leu Ser Asn Leu340 345 350Leu
Gly Gly His355734052DNAhomo sapiens 73gtaagtattt aaatacaatt atttttttct
ctcaatggta tagcatattc ctatgcttga 60gaagtatagg tctactgaaa aaccattgta
aatggacgtt acaggtatgc tgtatttttg 120aaggtatttt gttgtattaa gtttgatgaa
gctaaaatta gggaactctg aacagatttg 180caggaaaaaa tgttttaaag gctttaaaac
attagggagg cagtctaggg tgataacgaa 240caggggttaa gtattaaata cacgaagtta
catttttgtt catgtttcat tgtccagaaa 300gcagcaggaa actattcagt tgtgatcaag
caggaaaaaa gaaacaccaa cagttgccag 360tgtttttgct ttttagctta aaagcatagt
gaagatgctt gaggaagact ttgctacctg 420gggtgtgtag acagacagac tgagagctat
cagcatttga aggcccagcc cttgactctg 480agacacattt gaattttttc tttcccatca
aatggcatta acaagattgg gcaaagatga 540gtccctcaaa tttctgtgtt ttttgtttgt
ttgtttgttt gttttttctt tgggaactga 600agtcagaggc acgaacacta actcttagca
tttttctgta gactttttct tctggccctt 660gtccctgcca gcaaaacgcc ccttttctga
tcattcgtgc gcagagggcc tcccagtaat 720gccacgctct ccatgctaga gagccttctc
tttcctctga ggtttgaact gatgttctgt 780gtcttcacac cctggcatga cagttacgtg
tggtcagccc gctccccagg cccgtccctg 840ccgccgccag gtgtgggctc taggcaggcc
gacaaggtta cacctcccag agcttgtgat 900cttcattttc tgacagtcaa agtgtgaagg
aacccagact tccccgagcc acggtgttca 960gtcagcccac aggaatatgc aagacccatc
tccaaaagtt tgtctttgat tttttccaag 1020cccttagccc cataagcttt gaatcctgta
gttacagtgg cataaaggac tgacaaaacc 1080tggataagga aaaacctttt ttttctatga
attttttttg ttttttaggg gaaagggatt 1140ctaagaatgt catttaatgt actttgcatc
atgtctctag aaatatcttt gtccatagtg 1200gtggtggagt ctctctctct ctctctcttt
ttgtttgctt ctgttttctt tcttgtcttc 1260attctttctt ttctttttta tttctggtag
caggcctcca tagaacaaat ctaaaacaca 1320accaccatag taatgtaagg agagcttcag
tggcacctca aaacccaccc ttcgagatct 1380gtccaaagac agtctcagaa agctgcactg
cccaccggct cagctttcat tcaaaaaggc 1440ttccaaggcc aattctgtct tgaagtcaat
gcatgtattt actgtttgac agtaaacccg 1500ctctgccttc tccacgtcca aggctgtgca
ttcgtctaat tagcgtcgtg tatgttttcc 1560ttttattttt tccaataaaa aagcagtggg
atgaaaattg ctttgatata tagcaggtaa 1620cattgaagct attccatagc acttaactgt
agtgaatact gtgtcaccaa ttttgaaatc 1680aatttaatgt ttaatgcaaa tccattacat
ggtgctatta taggctgaca aaatgattta 1740cacaaatgtg acaacttggg ctcaattcac
tctgctttcc aacagtgtaa atgcatagca 1800gtgtttatct gcatgagaac tatgcactaa
tctatctgaa gaaaaaaact atatcaactt 1860tggtatctac tttccgttta cttcaatcct
tgcctttttg gtcattgtta taatgccagc 1920tttaggacag aaagaattat aagaaaacca
gcataatacc tgatatatta aaatgtagtg 1980cctgtgaaat ctgtattata ttgctcttct
gaagtaagat ttttctacac cggtagcctt 2040cgctgtctgt cagtcaggac cttctggtat
aggtgatgta aaataaccgt acaatattaa 2100tgcatgcgat tccataatgc ttagtgaact
gtatgaatat tactcaaagt tatgttagtc 2160tttttttccg acttggttct tgtcagctag
gtttaaaggt atttcactga gaacgcaaat 2220tctgtctttt cttgatttcg gctgttttca
gtattttgga ggtatacatt tacttaaatt 2280cagtattact cgtgttttgt ttttgttttt
gttttttgtt ttctttttcc taggggacaa 2340gcatgggtgt ttgatttcag aaatcagtac
ctggcgagat ttttgtctca aaacgactat 2400ttgaatttca agaactgtgc tgcgaagaca
ctctgagaac atttgcaagt caggggcatt 2460ttccttgacc cttgactgat gctatgcgga
gactgataca ttttcttaat ggacaatgtt 2520caagccaggt acccatgctt gatctgtctt
cacaccagac ctcctcatat taaaaggaaa 2580aataagaaaa aaaatgtaag aaatcacatg
gctatttagt ttcatgcaca gttgcaatat 2640tttcttcaaa aataaaactc tgtacaaact
ttgggcccga ttcataagaa aaagaagttt 2700gctattaaca cgggattttt ttaatatact
ttttttggtc taaatttgaa attacttgct 2760tcccaaatta aataaatttc atctcatttt
tttccctaaa ccagcaccca tctgcctttt 2820attccccaaa gagttacctt tcccagatta
gggggatggt atgtggggag cagatagcgg 2880aaatgcttag aaagataagg gggaccaccc
acagctggtc gtgagaacag ggagacagtg 2940tgtgggggtg ggacctcatc tgtgtgcctg
gtatcctgag ttttacatgt agatgcattc 3000gcctatttga ttcagaaaaa taaactttcc
caaaatgtgt ctgaaccaca agagcataca 3060gtggaagtgc tacctctaat ctaaccagag
caccttcatg gtggaagaca cccaccaggt 3120catacaatgt gaacttttgt atctctgcag
tggtttcaag gacaaatagt gtccaatgta 3180ttgggccatt tttcctgctg tttttatact
caacttctca aaatgaaaaa agcttttatt 3240tttcctttga cttatttgtg ttgttcttat
tttttaaatt tttatttttt gataatagtc 3300tgtaagttag cctttttggg tttttttttt
ttttttttgg cttttttttt tgtttgtttt 3360tttttctttt gacattgcaa ccgaaggtca
taaggccgct agctccgctg ggacagaggc 3420ttgagagaac taacggctcg gtgccttctc
cctggtctca gaccatcgtc tctgcactgc 3480gaaggcattt ggtagcctcg ccactgagat
actaactaga cctagactag gagctttatc 3540aggttctagg aggtccttta ggaagactct
caaaggcaaa tccctgatcc cccgccccac 3600ccttagccct gccctctcac cagagcaaaa
ttcactgggg acttttccca ccacacatgg 3660aaatctgtcc actcggaata cctctgtttt
ccatttcaaa ttgtaggggg aggggatgga 3720acacttccag tgatggtaag agatctgtta
tgaaacgaaa caccccccgt gttaataact 3780tggtctgaaa tctgttttta tgagccgggc
cccctgtgcc tctagtatac ttgtattgac 3840tctcatagtt acccttttag ttttactgtg
ttctgtgaaa atttgtaatt ggttgagaat 3900cactgtgggc gtccattctt attcaactaa
atctccacag gttttttgag ctggtgtgga 3960ttagtttaac tcttgtattc aaccattagt
gctaccacct tctcacatta caatacaatt 4020actggaagca agtactgcat ttcctatgca
ac 4052742572DNAhomo sapiens 74ccgctttctc
cgcgcggtgc ctgcagggct cccagcgagt ggcagcttgg gaggggccgc 60ccgggcggtc
agactggcac ctgagcggcc accgcgtccc ggccaggcgg gcagaccgac 120cccctcctca
cctcgcgcgc ggctgacgca ggcagggcgc ccggcccctc ctggggacca 180tcaggtgccg
gctgggggct gtaggcaccg gacggaagca ggcggtgtga ggaccgacga 240cgcgggcatg
gcgggggcgg cctgcgagcc ggtggccagg ccgagcctga cctccatctc 300gtctggggag
cttcgcagcc tgtggacctg cgactgcgag ctggccctgc tgccgctggc 360tcagctgctg
cgcctgcagc ccggtgcctt ccagctgagc ggcgaccagc tcgtggtggc 420caggcccggg
gagccggcgg cggcgcgggg gggcttcaac gtcttcggtg acggcctcgt 480gcgcctcgac
gggcagctct accgcctcag cagctacatc aagaggtatg tggaactgac 540caactactgt
gattataaag actacaggga aactatattg agcaaaccaa tgttgttctt 600tattaatgta
cagaccaaaa aagacacctc aaaagaaagg acgtacgcgt ttcttgtaaa 660cacgaggcac
cccaagataa gaagacagat agagcaaggg atggacatgg tcatctcctc 720agtgattgga
gaaagttacc ggcttcagtc aatgcaatgt tcctctctct ttcagtttga 780ttttcaagag
gcagtgaaga atttcttccc cccaggaaat gaagtggtta atggagaaaa 840tttaagcttt
gcatatgaat tcaaagctga tgcattattt gatttcttct attggtttgg 900gctcagtaat
tccgttgtaa aagtaaatgg aaaagttctg aatttgtcaa gtacaagtcc 960agaaaagaag
gagacgatta agttatttct ggaaaaaatg agtgagcctt taatccgaag 1020gagcagtttc
tctgaccgaa agttcagtgt aacttccaga ggttcaatag atgatgtttt 1080taactgcaat
ctgtcaccca gatcatctct gacagagcct cttttggcag aattaccatt 1140tccaagtgtt
ctggaatctg aagagacacc caaccaattt atctgattga actgaacatt 1200gtagcagttg
ctcccgcact ccaggcctgt gctagactat aggctggggg gagggtagga 1260ggtgggaggc
agatacttcc acctgcgtgt caatctccgg ctcctccatg gcttctatgg 1320aggactcctc
tcttctgctt ctgtggatgt gatgccctgg caggcccagg gcagctgatt 1380cccctaaaac
ttatgattac caggatggaa aggccttggt cccatggcac tgggtggggc 1440tgggggatat
tctctacttt gaacacttct ccaaagaggc agaagggcca cagagttctg 1500ccaccctgaa
catttttctc agttccctgg gagtttttgt ggcagccttt gtgggagtgg 1560tctgactggc
tgttgaccta gcatgcttca taaatcaggg tttggccctc tgcttggagc 1620atccaacccc
ttgaactcaa acctgtcgag caaggggtta agagttctgt tctcttgcca 1680acctggctgg
gcaaaagcct gtgccatctt tcactgggag gcaaatatgt ttttcatcct 1740gccatatgac
acctatgaga aacgttcaca gtgaggagta gccaggttgc taggacagta 1800accctgccac
acactgcctg aaatcggaac tcccttggcc tccctcttaa ctaagtgacc 1860catgtagaag
gaagccagga gatatggtac cgaacaatga caggggaagg gtattggaca 1920cggcagcgtc
ctccttattg aaaacacatt atgtcagttg ggaattttaa ataagctttt 1980agcaaaccta
acactaaaag caaaatagaa gaaagctata ccattaccat aatacatttt 2040tcatctcatg
gctacaatgg aattcttgaa aaggaaaaaa aaatcctatc tacatataaa 2100aacctgcatg
aatgaatcac tacatatgct tataatgagg aagagttatg ggtcctgagt 2160gtaatttttt
atcctttctt aaaaagtttc tgtattatgc attttgataa cactactgat 2220gatccttcca
cttatatttg aaatgttatg taccacattt gcacaattaa aacttttctt 2280agcattcaac
ctagaattga ttaaatttat gactgaggct tcatgtgagc tttccattgt 2340ggtttgtggg
tgttgtattt gccttgtaac ttactgaatt acaataagaa ttgtgggttt 2400tcatagccac
tttctcaaga agcgcctttt gaagaacaag gctatgaagt atttgaagaa 2460aggaaataaa
atttgatact gatctttcag aaaagagaag gggaatgcta cttaataaca 2520gaagatgtta
aacatttatt attacactca ataaaaaatg aagagtatta ac 257275312PRThomo
sapiens 75Met Ala Gly Ala Ala Cys Glu Pro Val Ala Arg Pro Ser Leu Thr
Ser1 5 10 15Ile Ser Ser
Gly Glu Leu Arg Ser Leu Trp Thr Cys Asp Cys Glu Leu20 25
30Ala Leu Leu Pro Leu Ala Gln Leu Leu Arg Leu Gln Pro
Gly Ala Phe35 40 45Gln Leu Ser Gly Asp
Gln Leu Val Val Ala Arg Pro Gly Glu Pro Ala50 55
60Ala Ala Arg Gly Gly Phe Asn Val Phe Gly Asp Gly Leu Val Arg
Leu65 70 75 80Asp Gly
Gln Leu Tyr Arg Leu Ser Ser Tyr Ile Lys Arg Tyr Val Glu85
90 95Leu Thr Asn Tyr Cys Asp Tyr Lys Asp Tyr Arg Glu
Thr Ile Leu Ser100 105 110Lys Pro Met Leu
Phe Phe Ile Asn Val Gln Thr Lys Lys Asp Thr Ser115 120
125Lys Glu Arg Thr Tyr Ala Phe Leu Val Asn Thr Arg His Pro
Lys Ile130 135 140Arg Arg Gln Ile Glu Gln
Gly Met Asp Met Val Ile Ser Ser Val Ile145 150
155 160Gly Glu Ser Tyr Arg Leu Gln Ser Met Gln Cys
Ser Ser Leu Phe Gln165 170 175Phe Asp Phe
Gln Glu Ala Val Lys Asn Phe Phe Pro Pro Gly Asn Glu180
185 190Val Val Asn Gly Glu Asn Leu Ser Phe Ala Tyr Glu
Phe Lys Ala Asp195 200 205Ala Leu Phe Asp
Phe Phe Tyr Trp Phe Gly Leu Ser Asn Ser Val Val210 215
220Lys Val Asn Gly Lys Val Leu Asn Leu Ser Ser Thr Ser Pro
Glu Lys225 230 235 240Lys
Glu Thr Ile Lys Leu Phe Leu Glu Lys Met Ser Glu Pro Leu Ile245
250 255Arg Arg Ser Ser Phe Ser Asp Arg Lys Phe Ser
Val Thr Ser Arg Gly260 265 270Ser Ile Asp
Asp Val Phe Asn Cys Asn Leu Ser Pro Arg Ser Ser Leu275
280 285Thr Glu Pro Leu Leu Ala Glu Leu Pro Phe Pro Ser
Val Leu Glu Ser290 295 300Glu Glu Thr Pro
Asn Gln Phe Ile305 310761010DNAhomo sapiens 76caggcggcga
ggagagcggt gccttgcagg gatgctgcgg gcgggagcac caaccgggga 60cttaccccgg
gcgggagaag tccacaccgg gaccaccatc atggcagtgg agtttgacgg 120gggcattgtg
atgggttctg attcccgagt gtctgcaggc gaggcggtgg tgaaccgagt 180gtttgacaag
ctgtccccgc tgcacgagcg catctactgt gcactctctg gttcagctgc 240tgatgcccaa
gccgtggccg acatggccgc ctaccagctg gagctccatg ggatagaact 300ggaggaacct
ccacttgttt tggctgctgc aaatgtggtg agaaatatca gctataaata 360tcgagaggac
ttgtctgcac atctcatggt agctggctgg gaccaacgtg aaggaggtca 420ggtatatgga
accctgggag gaatgctgac tcgacagcct tttgccattg gtggctccgg 480cagcaccttt
atctatggtt atgtggatgc agcatataag ccaggcatgt ctcccgagga 540gtgcaggcgc
ttcaccacag acgctattgc tctggccatg agccgggatg gctcaagcgg 600gggtgtcatc
tacctggtca ctattacagc tgccggtgtg gaccatcgag tcatcttggg 660caatgaactg
ccaaaattct atgatgagtg aaccttcccc agacttctct ttcttatttt 720gtaataaact
ctctaggacc aaaacctggt atggtcattg ggaaatgagt gctcagggag 780atggagctta
ggggaggtgg gtgcttccct cctagatgtc agcatacact ctttcttctt 840ttgtcccagg
tctaaaacat ctttcctaga gaaaacaaaa gggactaaac tagaaatata 900aagagcccta
tacatgacag gtgatcacgt actgaatgat tttgaagtag tacaaacaat 960aaaaattctc
attccgcatc atcatgcggt ccatgatgat gaggccgcaa 101077219PRThomo
sapiens 77Met Leu Arg Ala Gly Ala Pro Thr Gly Asp Leu Pro Arg Ala Gly
Glu1 5 10 15Val His Thr
Gly Thr Thr Ile Met Ala Val Glu Phe Asp Gly Gly Val20 25
30Val Met Gly Ser Asp Ser Arg Val Ser Ala Gly Glu Ala
Val Val Asn35 40 45Arg Val Phe Asp Lys
Leu Ser Pro Leu His Glu His Ile Tyr Cys Ala50 55
60Leu Ser Gly Ser Ala Ala Asp Ala Gln Ala Val Ala Asp Met Ala
Ala65 70 75 80Tyr Gln
Leu Glu Leu His Gly Ile Glu Leu Glu Glu Pro Pro Leu Val85
90 95Leu Ala Ala Ala Asn Val Val Arg Asn Ile Ser Tyr
Lys Tyr Arg Glu100 105 110Asp Leu Ser Ala
His Leu Met Val Ala Gly Trp Asp Gln Arg Glu Gly115 120
125Gly Gln Val Tyr Gly Thr Leu Gly Gly Met Leu Thr Arg Gln
Pro Phe130 135 140Ala Ile Gly Gly Ser Gly
Ser Thr Phe Ile Tyr Gly Tyr Val Asp Ala145 150
155 160Ala Tyr Lys Pro Gly Met Ser Pro Glu Glu Cys
Arg Arg Phe Thr Thr165 170 175Asp Ala Ile
Ala Leu Ala Met Ser Arg Asp Gly Ser Ser Gly Gly Val180
185 190Ile Tyr Leu Val Thr Ile Thr Ala Ala Gly Val Asp
His Arg Val Ile195 200 205Leu Gly Asn Glu
Leu Pro Lys Phe Tyr Asp Glu210 21578604DNAhomo sapiens
78ccacgcgtcc gcgctgcgcc acatcccacc ggcccttaca ctgtggtgtc cagcagcatc
60cggcttcatg gggggacttg aaccctgcag caggctcctg ctcctgcctc tcctgctggc
120tgtaagtggt ctccgtcctg tccaggccca ggcccagagc gattgcagtt gctctacggt
180gagcccgggc gtgctggcag ggatcgtgat gggagacctg gtgctgacag tgctcattgc
240cctggccgtg tacttcctgg gccggctggt ccctcggggg cgaggggctg cggaggcagc
300gacccggaaa cagcgtatca ctgagaccga gtcgccttat caggagctcc agggtcagag
360gtcggatgtc tacagcgacc tcaacacaca gaggccgtat tacaaatgag cccgaatcat
420gacagtcagc aacatgatac ctggatccag ccattcctga agcccaccct gcacctcatt
480ccaactccta ccgcgataca gacccacaga gtgccatccc tgagagacca gaccgctccc
540caatactctc ctaaaataaa catgaagcac aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
600aaaa
60479113PRThomo sapiens 79Met Gly Gly Leu Glu Pro Cys Ser Arg Leu Leu Leu
Leu Pro Leu Leu1 5 10
15Leu Ala Val Ser Gly Leu Arg Pro Val Gln Ala Gln Ala Gln Ser Asp20
25 30Cys Ser Cys Ser Thr Val Ser Pro Gly Val
Leu Ala Gly Ile Val Met35 40 45Gly Asp
Leu Val Leu Thr Val Leu Ile Ala Leu Ala Val Tyr Phe Leu50
55 60Gly Arg Leu Val Pro Arg Gly Arg Gly Ala Ala Glu
Ala Ala Thr Arg65 70 75
80Lys Gln Arg Ile Thr Glu Thr Glu Ser Pro Tyr Gln Glu Leu Gln Gly85
90 95Gln Arg Ser Asp Val Tyr Ser Asp Leu Asn
Thr Gln Arg Pro Tyr Tyr100 105
110Lys801610DNAhomo sapiens 80cccagagcag cgctcgccac ctccccccgg cctgggcagc
gctcgcccgg ggagtccagc 60ggtgtcctgt ggagctgccg ccatggcccc gcggcgggcg
cgcggctgcc ggaccctcgg 120tctcccggcg ctgctactgc tgctgctgct ccggccgccg
gcgacgcggg gcatcacgtg 180ccctcccccc atgtccgtgg aacacgcaga catctgggtc
aagagctaca gcttgtactc 240cagggagcgg tacatttgta actctggttt caagcgtaaa
gccggcacgt ccagcctgac 300ggagtgcgtg ttgaacaagg ccacgaatgt cgcccactgg
acaaccccca gtctcaaatg 360cattagagac cctgccctgg ttcaccaaag gccagcgcca
ccctccacag taacgacggc 420aggggtgacc ccacagccag agagcctctc cccttctgga
aaagagcccg cagcttcatc 480tcccagctca aacaacacag cggccacaac agcagctatt
gtcccgggct cccagctgat 540gccttcaaaa tcaccttcca caggaaccac agagataagc
agtcatgagt cctcccacgg 600caccccctct cagacaacag ccaagaactg ggaactcaca
gcatccgcct cccaccagcc 660gccaggtgtg tatccacagg gccacagcga caccactgtg
gctatctcca cgtccactgt 720cctgctgtgt gggctgagcg ctgtgtctct cctggcatgc
tacctcaagt caaggcaaac 780tcccccgctg gccagcgttg aaatggaagc catggaggct
ctgccggtga cttgggggac 840cagcagcaga gatgaagact tggaaaactg ctctcaccac
ctatgaaact cggggaaacc 900agcccagcta agtccggagt gaaggagcct ctctgcttta
gctaaagacg actgagaaga 960ggtgcaagga agcgggctcc aggagcaagc tcaccaggcc
tctcagaagt cccagcagga 1020tctcacggac tgccgggtcg gcgcctcctg cgcgagggag
caggttctcc gcattcccat 1080gggcaccacc tgcctgcctg tcgtgccttg gacccagggc
ccagcttccc aggagagacc 1140aaaggcttct gagcaggatt tttatttcat tacagtgtga
gctgcctgga atacatgtgg 1200taatgaaata aaaaccctgc cccgaatctt ccgtccctca
tcctaacttg cagttcacag 1260agaaaagtga catacccaaa gctctctgtc aattacaagg
cttctcctgg cgtgggagac 1320gtctacaggg aagacaccag cgtttgggct tctaaccacc
ctgtctccag ctgctctgca 1380cacatggaca gggacctggg aaaggtggga gagatgctga
gcccagcgaa tcctctccat 1440tgaaggattc aggaagaaga aaactcaact cagtgccatt
ttacgaatat atgcgtttat 1500atttatactt ccttgtctat tatatctata cattatatat
tatttgtatt ttgacattgt 1560accttgtata aacaaaataa aacatctatt ttcaatattt
ttaaaatgca 161081267PRThomo sapiens 81Met Ala Pro Arg Arg
Ala Arg Gly Cys Arg Thr Leu Gly Leu Pro Ala1 5
10 15Leu Leu Leu Leu Leu Leu Leu Arg Pro Pro Ala
Thr Arg Gly Ile Thr20 25 30Cys Pro Pro
Pro Met Ser Val Glu His Ala Asp Ile Trp Val Lys Ser35 40
45Tyr Ser Leu Tyr Ser Arg Glu Arg Tyr Ile Cys Asn Ser
Gly Phe Lys50 55 60Arg Lys Ala Gly Thr
Ser Ser Leu Thr Glu Cys Val Leu Asn Lys Ala65 70
75 80Thr Asn Val Ala His Trp Thr Thr Pro Ser
Leu Lys Cys Ile Arg Asp85 90 95Pro Ala
Leu Val His Gln Arg Pro Ala Pro Pro Ser Thr Val Thr Thr100
105 110Ala Gly Val Thr Pro Gln Pro Glu Ser Leu Ser Pro
Ser Gly Lys Glu115 120 125Pro Ala Ala Ser
Ser Pro Ser Ser Asn Asn Thr Ala Ala Thr Thr Ala130 135
140Ala Ile Val Pro Gly Ser Gln Leu Met Pro Ser Lys Ser Pro
Ser Thr145 150 155 160Gly
Thr Thr Glu Ile Ser Ser His Glu Ser Ser His Gly Thr Pro Ser165
170 175Gln Thr Thr Ala Lys Asn Trp Glu Leu Thr Ala
Ser Ala Ser His Gln180 185 190Pro Pro Gly
Val Tyr Pro Gln Gly His Ser Asp Thr Thr Val Ala Ile195
200 205Ser Thr Ser Thr Val Leu Leu Cys Gly Leu Ser Ala
Val Ser Leu Leu210 215 220Ala Cys Tyr Leu
Lys Ser Arg Gln Thr Pro Pro Leu Ala Ser Val Glu225 230
235 240Met Glu Ala Met Glu Ala Leu Pro Val
Thr Trp Gly Thr Ser Ser Arg245 250 255Asp
Glu Asp Leu Glu Asn Cys Ser His His Leu260
2658224DNAArtificial SequenceSynthetic primer 82ggaacaggaa agacttctca
agca 248323DNAArtificial
SequenceSynthetic primer 83cttgacgtag ttgcaagctc tca
238421DNAArtificial SequenceSynthetic primer
84gctgaagcaa ggtagcgatg a
218520DNAArtificial SequenceSynthetic primer 85cctcgttgct gagtgttgga
208628DNAArtificial
SequenceSynthetic primer 86tcagactgaa gagctactgt aatgatca
288726DNAArtificial SequenceSynthetic primer
87caacaatcaa gacattcttt ccagtt
268822DNAArtificial SequenceSynthetic primer 88tgctttcact tgtgcctctt tc
228921DNAArtificial
SequenceSynthetic primer 89caggctctca cagagacgga a
219017DNAArtificial SequenceSynthetic primer
90agccgagcca catcgct
179119DNAArtificial SequenceSynthetic primer 91gtgaccaggc gcccaatac
19
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: