Patent application title: Novel Bacteriocins, Transport and Vector System and Method of Use Thereof
Inventors:
Michael E. Stiles (Edmonton, CA)
John C Vederas (Edmonton, CA)
Marius J Van Belkum (Zuidwolde, NL)
Randy W Worobo (Consort, CA)
Rodney J Worobo (Consort, CA)
John K Mccormick (Neepan, CA)
Gordon G. Greer (Lacombe, CA)
Lynn M Mcmullen (Edmonton, CA)
Jorgen J Leisner (Copenhagen N., DK)
Alison Poon (Edmonton, CA)
Charles M.a.p. Franz (Karlsruhe, DE)
IPC8 Class: AC12P2100FI
USPC Class:
435 691
Class name: Chemistry: molecular biology and microbiology micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide
Publication date: 2010-05-27
Patent application number: 20100129864
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Novel Bacteriocins, Transport and Vector System and Method of Use Thereof
Inventors:
Michael E. Stiles
John C Vederas
Marius J van Belkum
Randy W Worobo
Rodney J Worobo
John K McCormick
Gordon G. Greer
Lynn M McMullen
Jorgen J Leisner
Alison Poon
Charles M.A.P. Franz
Agents:
WILLIAM J BUNDREN;THE LAW OFFICE OF WILLIAM J BUNDREN
Assignees:
Origin: MILLERSVILLE, MD US
IPC8 Class: AC12P2100FI
USPC Class:
435 691
Publication date: 05/27/2010
Patent application number: 20100129864
Abstract:
New bacteriocins capable of inhibiting the growth of bacteria are
disclosed, along with methods of obtaining secretion of proteins from
lactic acid bacteria, and methods for protecting foodstuffs.Claims:
1. A secretion vector, for providing secretion of a heterologous protein
from a microbial host cell, said secretion vector comprising:a first
polynucleotide encoding a heterologous protein;a second polynucleotide
encoding a bacteriocin processing peptide operable in said host cell,
operably linked to said polynucleotide encoding said heterologous
protein; anda promoter operable in said host cell, operably linked to
said polynucleotide encoding said heterologous protein.
2. The secretion vector of claim 1, wherein said bacteriocin processing peptide comprises a divergicin A processing peptide or an operable mutein thereof.
3. The secretion vector of claim 1, wherein said first polynucleotide encodes a heterologous bacteriocin.
4. The secretion vector of claim 3, further comprising an immunity gene which confers immunity from said heterologous bacteriocin to said host cell.
5. The secretion vector of claim 3, wherein said vector encodes a plurality of different bacteriocins.
6. The vector pCD3.4 (SEQ ID NO:14).
7. A host cell transformed with the secretion vector of claim 5.
8. A host cell transformed with a plurality of secretion vectors of claim 5.
9. A host cell transformed with the secretion vector of claim 5.
10. A method for obtaining secretion of a protein from a microorganism, said method comprising:providing a secretion vector comprising a promoter operable in said microorganism, operably linked to a polynucleotide encoding a bacteriocin processing peptide operable in said microorganism, operably linked to a polynucleotide encoding said protein;transforming said microorganism with said secretion vector; andculturing said transformed microorganism under conditions that induce expression and secretion.
11. The method of claim 10, wherein said bacteriocin processing peptide comprises a divergicin A processing peptide.
12. A secretion vector for providing secretion of a heterologous protein from a lactic acid host, said secretion vector comprisinga first polynucleotide encoding a heterologous protein;a second polynucleotide encoding a processing peptide suitable for expressing said heterologous protein and operably linked to said first polynucleotide; anda promoter operable in said host cell and operably linked to said first polynucleotide.
13. The secretion vector of claim 12 wherein the processing peptide is a signal peptide.
14. The secretion vector of claim 13 wherein the signal peptide is from divergicin A.
15. A method of expressing a heterologous protein by applying an expression vector as defined in claim 12.
Description:
[0001]This application is a divisional of 09/883,343 filed Jun. 19, 2001;
which is a continuation of Ser. No. 08/924,629 filed Sep. 5, 1997 (now is
U.S. Pat. No. 6,403,082); which claims the benefit of 60/026,257 filed
Sep. 5, 1996.
FIELD OF INVENTION
[0002]This invention relates to novel polypeptides, bacteriocins, immunity genes obtained from lactic acid bacteria and a method of use thereof.
BACKGROUND: OF THE INVENTION
[0003]With the current consumer demand for fresh (i.e., never frozen) foods, it is important that methods be developed for safe storage of these products especially for fresh meats which are manufactured locally but are marketed around the world. The lactic microflora (lactic acid bacteria) of vacuum packaged meats delays spoilage for weeks or months, as opposed to meats packaged under aerobic conditions which develop a putrefactive microflora that causes spoilage within days.
[0004]Vacuum packaged meats have an extended but unpredictable storage life dependent on the types of lactics that dominate the microflora. Meat lactics can cause severe spoilage problems, such as sulphide odors or greening by some Lactobacillus species and gas or slime production by Leuconostoc species. Other lactics exert a preservative effect, extending storage life and enhancing meat safety by competitive growth, by producing organic acids, and by producing antagonistic substances known as bacteriocins (peptides or proteins that inhibit the growth of other, usually closely related, bacteria).
[0005]Nisin is a bacteriocin produced by lactics used for ˜'cheese manufacture, and is the only bacteriocin licensed for use as a food preservative. Nisin is unusual because it is active 5 against a wide range of gram-positive bacteria, including the spores of Clostridium botulinum; unfortunately, its producer strain does not grow in chill-stored meats, and nisin does not function in meat systems.
[0006]Class II bacteriocins are characterized as small, heat stable, hydrophobic peptides with a high isoelectric point. They are produced as precursors with an N-terminal extension of 18 to 24 amino acids. This extension is cleaved at the C-terminus side of two glycine residues to give the mature bacteriocin. Sequence alignment of the N-termini revealed a remarkable degree of similarity in their hydropathic profiles (Fremaux et al. 1993).
[0007]The nucleotide sequences of the structural genes for several class II bacteriocins have been published, including pediocin PA-1/AcH (Bukhtiyarova et al. 1994, Marugg et al. 1992), sakacin A and P (Holck et al, 1989, Tichaczek at al. 1994), lactacin F (Fremaux et al. 1993, Muriana and Klaenhammer 1991), leucocin A (Hastings at al. 1991), lactococcins A. B., and M (Holo at al. 1991; Stoddard at al. 1992; van Belkum et al. 1991; van Belkum et al. 1992), plantaricin A (Diep et al. 1994) and carnobacteriocins A, BM1, and B2 (Quadri et al, 1994; Worobo at al. 25 1994). However, the additional genes necessary for bacteriocin production have only been determined for the lactococcins and pediocin PA-1/AcH and, in the case of the some of the lactococcins, the gene for immunity has also been confirmed. The genetic characterization of the lactococcin and pediocin gene clusters indicates that they have similar features. They both have genes for bacteriocin production in an operon structure, although the structural and immunity genes for the lactococcins can be transcribed independent of the other genes in the operon. Furthermore, one of the genes in each of the lactococcin and pediocin operons encodes a protein which belongs to the H1yBfamily of ATP-binding cassette (ABC) transporters (Higgins 1992). This protein is thought to be involved in the signal sequenceindependent secretion of the bacteriocins. Recently, genes encoding proteins which resemble members of a two-component signal transduction system have been identified which are involved in the expression of plantaricin A and sakacin A (Axelsson et al. 1993; Diep et al. 1994).
SUMMARY OF THE INVENTION
[0008]One aspect of the invention is a new bacteriocin, brochocin-C: peptide A (SEQ ID NO:23), peptide B (SEQ ID NO:25) and its corresponding immunity peptide (SEQ ID NO:27). Another aspect of the invention is a polynucleotide encoding the brochocin-C operon (SEQ ID NO:21), peptide A (SEQ ID NO:22), peptide B (SEQ ID NO:24), or immunity (SEQ ID NO:26).
[0009]Another aspect of the invention is a polynucleotide encoding a new bacteriocin enterocin 900 (SEQ ID NO:28), a polynucleotide encoding the first enterocin 900 peptide (SEQ ID NO:29), and the enterocin 900 peptide (SEQ ID NO:30). Another aspect of the invention is a method far inhibiting pathogenic bacteria by providing a bacteriocin selected from the group consisting of brochocin-C and enterocin 900, either as a composition or by providing a bacterial source of brochocin-C or enterocin 900. For example, one may inhibit spoilage bacteria in foodstuffs, such as meat, inhibit pathogenic-bacteria topically on animals, including humans, and inhibit bacteria infection of fermentation reactors.
[0010]Another aspect of the invention is an expression vector for obtaining secretion of proteins from lactics, comprising a promoter functional in the lactic host, a polynucleotide encoding a divergicin signal peptide (SEQ ID NO:19), and a structural gene. Another aspect of the invention is the vector which comprises a plurality of structural genes, each operably linked to a polynucleotide encoding a divergicin signal peptide.
[0011]Another aspect of the invention is a method to attach bacteriocin structural and immunity genes to a signal peptide or leader peptide gene so that the bacteriocins can be exported from the host cell.
[0012]Another aspect of the invention is a novel food-grade plasmid that can be used as a plasmid vector for genes including, but not limited to, bacteriocins, other polypeptides, enzymes or proteins in organisms for use in food products or as a probiotic. Another aspect of the invention is a method to preserve food by adding bacteriocin-producing bacteria.
BRIEF DESCRIPTION OF FIGURES
[0013]FIG. 1. Deferred inhibition tests against C. piscicola LV17C (A) and C. divergens LV13 (B) by divergin A and _carnobacteriocin B2. I.C. piscicola LV17C containing pMG36e: 2.C. piscicola LV17C containing pRW19e: 3. C. piscicola LV17C containing pJKM14.
[0014]FIG. 2. Schematic representation of the 12.3 kb HindIII insert of pMJ4 and its subclones. Partial restriction maps of some of the inserts are shown. Not all of the HpaII restriction sites on the insert of pMJG are indicated. The positions and direction of transcription of 1caA. 1caB. 1caC. 1caD. and 1caE on--the insert of pMJ6 are shown. The asterisks on pMJ20 and pMJ26 indicate frameshift mutations of 1caB and 1caE, respectively./
[0015]FIG. 3. Deferred inhibition of leucocin A transformants with C. piscicola LV17C as the indictor strain (A) and lactococcin A transformants with L. lactis IL1403 as the indicator strain (B). (A) a. L. gelidum UAL1877-22; b. L. lactis IL1403; c. L. gelidum UAL187-13; d. L. lactis IL1403 (pMJ6); e. L. gelidum UAL187-13 (pMJ6). APT was used as solid medium. (B) a. L. gelidum UAL187-22)pMB553); b. L. gelidum UAL 187-13 (pMB553); c. L. gelidum UAL187-22; d. L. gelidum UAL187-13. Glucose-M17 was used as solid medium.
[0016]FIG. 4. Schematic representation of the two-step PCR strategy to replace the signal peptide of divergicin A with the double-glycine type leader peptides of leucocin A, lactococcin A or colicin V. In the first PCR step, the leucocin A (A and B) or lactococcin A (A) gene was used as a template to obtain a megaprimer containing the leucocin A (A), the lactococcin A (A), or the colicin V leader peptide (B). These megaprimers were used to amplify the divergicin structural and immunity gene in a second PCR step. Divergicin A without a leader or signal peptide was constructed by first amplifying the region upstream of the leucocin A gene (C) and using the resulting PCR product to amplify the diverigicin gene in the second PCR step. Further information is detailed in the text. Abbreviations: L.P.: DNA encoding the double-type glycine leader peptides; BAC: DNA encoding the mature part of leucocin A or lactococcin A; S.P.: DNA encoding the signal peptide of divergicin A; DIV: DNA encoding the mature part of divergicin A; IMM: immunity gene for divergicin A; S.: SacI restriction site; H: HindIII restriction site.
[0017]FIG. 5. Antagonistic activity of L. gelidum 187-22 (A), L. lactis IL1403(pMB500) (B), and E. coli MC4100 (pHK22) (C) transformed with pLEDI (a), pLAD6 (b), pCOD1 (c) or pMG36e (d). In panel (B) also antagonistic activity of L. lactis IL1403 transformed with pLAD6 (e). C. divergens UAL278 was used as indicator strain.
[0018]FIG. 6. Detection of antagonistic activity by divergicin A fused to the lactococcin A leader peptide in a tricine-SDS-polyacrylamide gel. C. divergens UAL278 was used as the indicator strain by the overlay test. Lane 1: supernatant of L. gelidum 187-22 carrying pLED1. Lanes 2, 3 and 4: lysates of E. coli BL21(DE3) containing plasmids pHK22 and pTLA1, pTLA1, pTLA1, or pT713 and pHK22, respectively, Abbreviations: M: mature divergicin A; P: divergicin A precursor containing the lactococcin A leader peptide.
[0019]FIG. 7, Colicin V production in L. lactis. Deferred inhibition test by L. lactis IL1403(pMB500) transformed with (a) pLEC1 or (b) pMG36e using E. coli DHSa as the indicator strain.
[0020]FIG. 8. Two restriction site maps plasmid pCD3.4. The location of the Divergicin structural and immunity genes are marked in B as dvnA and dviA respectively.--
[0021]FIG. 9. Bacteriocin activity and growth of Lactobacillus sake 1218 in mixed culture with variants of Leuconostoc gelidum at 25° C. in mAPT with 0.1% glucose and the initial pH adjusted to 5.6. (a) Bacteriocin activity in arbitrary units (AU) per milliliter of supernatant for mixed cultures of L. sake 1218 and L. gelidum UAL187 (A) and mixed cultures of L. sake 1218 and L. gelidum UAL187-22 (0). (b) Growth of L. sake 1218 with L. gelidum UAL187(A), L. gelidum UAL187-22(0), and Leuc. gelidum UAL187-13(0).
[0022]FIG. 10. Bacteriocin activity and growth of Lactobacillus sake 1218 in mixed culture with variants of Leuconostoc gelidum at 2° C. in mAPT with 0.1% glucose and the initial pH adjusted to 5.6. See FIG. 9 for definitions of symbols.
[0023]FIG. 11. Loglo CFU of variants of L. gelidum grown in mixed culture with L. sake 1218 per square centimeter of vacuumpackaged beef stored at 2° C., (0), L. gelidum UAL187; (0), UAL187-13; (O), UAL187-22. The data represent the means of three trials.
[0024]FIG. 12. Log10 CFU of L. sake 1218 showing growth and survival in mixed culture with variants of L. gelidum per square centimeter of vacuum-packaged beef stored at 2° C. (0), L. sake 1218 alone; (A), L. sake with L. gelidum UAL187; (0), L. sake with UAL187-13; (O), L. sake with UAL187-22. The solid arrow indicates the sampling time at which a sulfide odor was first detected in samples inoculated with L. sake 1218; the open arrow indicates the sampling time at which a sulfide odor was first detected in samples inoculated with L. sake 1218 and L. gelidum UAL187-13 or UAL187-22. The data represent the means of three trials.
[0025]FIG. 13. The method of use of this invention is illustrated by the following schematics. The signal peptide gene or leader peptide gene(s) is illustrated as vertical or horizontal hatching. As schematic A indicates, a signal or leader peptide is attached to a bacteriocin gene devoid of its natural leader peptide or signal peptide gene. A plasmid can contain a single bacteriocin with its immunity gene. The spacing between the structural gene and the immunity gene is not important and the immunity gene does not necessarily have to follow the structural gene providing the immunity gene is also expressed and prevents the bacteriocin from killing its host. As schematic B illustrates a plasmid can contain more than one copy of a bacteriocin or more than one type of bacteriocin. The vector can contain many bacteriocins. In scheme B, the leader or signal peptide genes can be different or the same providing that leader peptide or signal peptide is compatible with the transport system in the cell. If the transport system is not compatible with the leader then a transport system can also be introduced into the vector or plasmid (C) or (D), For multiple bacteriocins or proteins each structural gene needs to be attached to a leader or signal peptide.
[0026]FIG. 14. Examples of other leader or signal peptides that could be used in this invention and names of other bacteriocins that could utilize these signal peptides or other signal or leader peptides included herein. The best host for a vector containing a bacteriocin gene with a leader or signal peptide gene attached is the organism from which the leader peptide was derived but other closely related organisms frequently also work with particular leader peptides. Additional information about these bacteriocins and leader peptides can be obtained from Quadri and associates (1994) or references therein. Comparisons of the sequence similarities is also provides. The vertical arrow indicates the cleavage site in the prebacteriocins.
Abbreviations
[0027]The abbreviations in the nucleotide sequences are cytidine (c); adenosine (a); thymidine (t); guanosine (g); and in amino acid sequences alanine (A): arginine (R) asparagine (N); aspartic acid"(D); cysteine (C); glutamine (Q): glutamic acid (E); glycine (G); histidine (H); isoleucine (I); leucine (L); lysine (K); methionine (M); phenylalanine (F); proline (P); serine (S); threonine (T); tryptophan (W); tyrosine (Y) and valine (V).
[0028]Other abbreviations used include: carnobacteriocin 26 (cbn 26); carnobacteriocin A (cbnA); carnobacteriocin B (cbnB); Leucocin A (Leu A); Brochocin-C (Broch C)
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0029]The term "gene" used herein refers to a DNA sequence including but not limited to a DNA sequence that can be transcribed into mRNA which can be translated into polypeptide chains, transcribed into rRNA or tRNA or serve as recognition sites for enzymes and other proteins involved in DNA replication, transcription and regulation. These genes include, but are not 20 limited to, structural genes, immunity genes and secretory (transport) genes.
[0030]The term "vector" used herein refers to any DNA material capable of transferring genetic material into a host organism. The vector may be linear or circular in topology and includes but is not limited to plasmids, food grade plasmids, DNA bacteriophages or DNA viruses. The vector may include amplification genes, enhancers or selection markers and may or may not be integrated into the genome of the host organism. The term "secretion vector" refers to a vector designed to provide secretion of a protein from the host organism.
[0031]The term "plasmid vector" herein refers to a vector that has been genetically modified to insert one or more genes.
[0032]The term "signal peptide" herein refers to a N-terminal amino acid sequence which, when attached to a target polypeptide, permits the export of the target polypeptide from the cell and cleavage of the signal peptide. The signal peptide accesses the general protein secretion pathway. An example of a signal peptide is the Divergicin A signal peptide described in amino acid SEQ ID NO:7. Other signal peptides can be used and are known to those skilled in the art. See SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13.
[0033]The term "leader peptide" herein refers to a N-terminal amino acid sequence which, when attached to a target polypeptide, permits the export of the target polypeptide from the cell and cleavage of the leader peptide. The leader peptides include but are not limited to a sequence of 15-24 amino acids that are able to be direct export of polypeptides from the cell using the cell's dedicated transport system. The leader peptide sequences shares similarity on their primary structure and contain a I conserved processing site of glycine-glycine residues or glycinealanine residues at positions -2 and -1 of the processing site. The dedicated transport system includes but is not limited to the ATP binding cassette (ABC) transporter required for leader peptide-dependent transport. There are many different leader i peptides that could be used including, but not limited to, leucocin A, Colicin V, carnobacteriocin A, carnobacteriocin B2, enterocin 900 or carnobacteriocin BM1.
[0034]A "processing peptide" includes both leader peptides and signal peptides, and may refer to both simultaneously; as used herein.
[0035]The term "cassette" herein refers to a DNA sequence containing a series of bacteriocin genes and if necessary their respective immunity genes, appropriate promoters, ribosomal binding site (RBS) and terminating sequences and if necessary other regulatory DNA sequences. The cassette consists of two or more nucleotide sequences encoding a structural (bacteriocin or other substrate) gene linked directly to an N-terminal signal peptide DNA sequence compatible for export through the cell's general export pathway or linked to the leader peptide DNA, sequence compatible for export through the dedicated transport system of the cell or through a compatible dedicated transport system also inserted into a vector used to transform the cell.
[0036]The term "food-grade" herein refers to the origin of the DNA material. Food-grade indicates that a regulatory agency would consider the substance as coming from a "food" source and therefore suitable for inclusion in food or food products. Organisms that are food-grade, such as lactic acid bacteria and other established genera of starter organisms, can be added directly to food without concern for pathogenicity.
[0037]The term "bacteriocin" herein refers to polypeptides and proteins that inhibit one or more bacterial species. This includes, but is not limited to, polypeptides or proteins that were derived from specific strains of bacteria, proteins that were derived from other types of organisms or proteins developed through genetic engineering. The bacteriocin can be bacteriostatic or bactericidal.
[0038]The term "class II bacteriocin" herein refers to a bacteriocin which includes but is not limited to small or moderate sized polypeptides. This includes but is not limited to heat resistant polypeptides and heat sensitive polypeptides that do not undergo post-translational modification except for cleavage of the leader or signal peptide and in some cases formation of disulfide bridges. This protein must have suitable size and properties so that it can be exported from a cell. Class II bacteriocins include, without limitation, carnobacteriocin UAL26, leucocin A, brochocin-C, enterocin 900, divergicin A, carnobacteriocins A and B2.
[0039]The term "class II protein" herein refers to a small protein or polypeptide which does not undergo post-translational modification except for cleavage of the leader or signal peptide and in some cases the formation of disulfide bridges. This protein must be a suitable size and physico-chemical properties so that it can be exported from a cell. Many such proteins or polypeptides are known. One of ordinary skill in the art can determine which proteins would be suitable without undue experimentation. These proteins include, but are not limited to, enzymes, inhibitors that are polypeptides or other regulatory polypeptides or proteins.
[0040]The term "immunity gene" herein refers to a gene that produces protein that protects the host organism against the bacteriocin that it produces.
[0041]The term "host organism" herein refers to a living bacterium or microorganism capable of taking up the plasmid vector, expressing the genes and producing the desired peptide(s). If the secretion of the desired polypeptide is required, the host organism must have functional transport proteins compatible with the signal or leader peptide attached to the polypeptide to be exported or it must be able to incorporate the dedicated transport protein(s) necessary for the leader peptide-dependent export of the substrate generated from vector DNA. Host organism capable of utilizing the divergicin A signal peptide use the general secretory (sec-) pathway of the cell (for additional information see Pugsley (1993) and Simonen and Palva (1993) and references therein).
[0042]The term "transport proteins" herein refers to proteins that are in most cases are incorporated into the cell membrane of the host organism and facilitate the export of protein(s) with a signal or leader peptide specific for the transport protein to the outside of the organism. Additional regulatory components, binding sites or enzymes may also be required for the functioning of the transporter. The ABC transporter of a specific protease can cleave the signal or leader peptide.
[0043]The term "homologous transporter system" indicates that the transport system and the leader peptide or signal peptide>used to export polypeptides arise from the same host.
[0044]The term "heterologous transporter system" indicates that the transport system and the leader peptide or signal peptide used to export polypeptides arise from the different hosts. Divergicin A, for example of a signal peptide that can be used in 0 heterologous transport systems. Homologous transporter systems can used in homologous or heterologous bacteria if the transport system is introduced into the host organism.
[0045]The term "meat" herein refers to muscle and fat tissue obtained from animal, fish, fowl or seafood including, without limitation, poultry, cattle, swine, sheep, deer, moose, fish and shellfish. The meat can be accompanied by bones, skin or internal organs. Meat can include other additives including but not limited to fillers, dyes, preservatives, natural or artificial flavoring. Meat can be raw, cooked, frozen, cured or canned. The meat would normally but not necessarily be packaged under vacuum or in a modified atmosphere containing elevated levels of carbon dioxide, i.e. vacuum or modified atmosphere (MAP).
[0046]The term "susceptible bacteria" refers to a species or strain of bacteria that is inhibited by the presence of one or more bacteriocins in its environment. Preferred susceptible bacteria are inhibited by brochin-C and/or enterocin 900. The term "antibody" refers to antisera, monoclonal antibodies, antibody fragments, single chain antibodies and other functional equivalents capable of binding a bacteriocin of the invention. Preferred antibodies of the invention are capable of binding specifically to a bacteriocin of the invention without significant cross-reactivity with other bacteriocins. Antibodies of the invention are prepared by conjugating the polypeptide to a suitable carrier, such as keyhole limpet hemocyanin, and immunizing a suitable mammal (for example, mouse, rat, horse, goat, rabbit, and the like). It is preferred to employ an adjuvant to obtain an enhanced immune response. After time is permitted for antibodies to develop, they may be fractionated from blood. If desired, monoclonal antibodies may be prepared by generating hybridomas from splenocytes obtained from the immunized animal. Similarly, one may sequence antibodies and determine the sequence of the specific binding domain, for preparation of single-chain antibodies and the like.
[0047]The term "mutein" as used herein refers to a conservative variation of a bacteriocin of the invention. In general, a mutein will have an amino acid sequence that differs from the native sequence by 1-4 amino acid residues (including insertions and deletions) Muteins are easily prepared using modern cloning techniques, or may be synthesized by solid state methods. All muteins must exhibit bacteriocinogenic activity of at least a substantial fraction of the native sequence bacteriocins activity (although not necessarily against the same susceptible bacteria), and may be tested using the methods described below.
General Methods
[0048]We have studied the fundamental characteristics and genetics of bacteriocin production and applied aspects of bacteriocins in meats. We have studied eight new bacteriocins from meat lactics which show promising antagonistic activity. We have also developed "bacteriocin cassettes" (a series of DNA fragments encoding two or more bacteriocins) that would be equivalent to or better than nisin. The ability to do this is limited by fragment size at present due to difficulties of cloning large fragments of DNA.
[0049]By using the tools and techniques described herein, we have developed a system whereby one can select a range of bacteriocins against target bacteria, using the producer bacterium to deliver the antagonistic effect. This is applicable anywhere that lactic acid bacteria can grow without harming the environment to which they are added.
[0050]An important area of application for this innovative technique is in the preservation of meats and meat products. This advance will allow production of vacuum packaged meats and meat products with a predictable and longer storage life.
[0051]The carnobacteriocins disclosed herein are genetically complex and involve much as 10 kb of DNA for their production. In contrast, leucocin A, produced by Leuconostoc gelidum, involves 4.5 kb of DNA. Leucccin-producing L. gelidum stops the spoilage of meat by sulfide-producing Lactobacillus sake; it inhibits the growth of pathogenic Listeria monocyfogenes; and, when added to commercially produced ground beef, extends the color and odor storage life of retail ground beef.
[0052]Bacteriocins are synthesized in the, cells as prepeptides consisting of a leader component of 15 to 24 amino acids that is cleaved to release the mature bacteriocin. In addition to this structural protein, bacteriocins like leucocin A require an immunity protein for protection of the cell from its own bacteriocin and two dedicated secretion proteins for export of the bacteriocin from the cell.
[0053]Most bacteriocins have dedicated bacteriocin secretion systems and if their genes are incorporated into another host organism they usually can not secrete the polypeptide or can only secrete the polypeptides to a lesser extent. Using the methods described herein an expanded antibacterial spectrum can be achieved by producing multiple bacteriocins in one bacterium such that the bacteriocins can be secreted.
[0054]We have also identified an important bacteriocin, divergicin A, produced by the meat lactic Carnobacterium divergens. The production of divergicin involves only 0.5 kb of DNA, because the leader peptide of divergicin accesses the general pathway for protein export from the cell. By fusing the structural and immunity genes of other bacteriocins behind the signal peptide of gene sequence of divergicin A, we have achieved production of bacteriocin(s) by host and heterologous bacteria. Utilizing the cell's secretory mechanism means that the dedicated secretory proteins of other bacteriocins do not need to be included in the bacteriocin cassette and leucocin A and other bacteriocins can be produced with only 0.5 kb of DNA each instead I of 4.5 kb of DNA. This is an important breakthrough for the success of the bacteriocin cassette strategy.
[0055]We have also been able to produce and export a variety of bacteriocins or other proteins by placing their respective gene sequence (s) behind the divergicin signal peptide sequence in a plasmid and inside meat lactic organisms. This protocol has been tested and demonstrated to work using Divergicin A signal peptide as a leader to several polypeptides including but not limited to Carnobacteriocin B2, colicin V, Leucocin A. Brochocin-C and alkaline phosphatase.
[0056]Carnobacteriocin B2 is a well characterized class II bacteriocin produced by a 61-kb plasmid from Carnobacterium piscicola LV17. Export of this bacteriocin depends on a specific ABC (ATP-binding cassette) secretion protein. Divergicin A is a strongly hydrophobic, narrow spectrum bacteriocin produced by a 3.4-kb plasmid from C. divergens LV13 with a signal peptide that utilizes the general secretory pathway for export (Worobo et al., 1995). Fusion of the carnobacteriocin B2 structural gene (devoid of its natural leader peptide) behind the signal peptide of divergicin A permitted production and export of active carnobacteriocin B2 in the absence of its specific secretion genes. The immunity gene for carnobacteriocin B2 was included immediately downstream of the structural gene. Correct processing of the prebacteriocin occurred following the Ala-SerAla cleavage site of the signal peptide. Carnobacteriocin B2 was produced by the wild type strain of C. divergens LV13 and in C. piscicola LV17C, the nonbacteriocinogenic plasmidless variant of the original carnobacteriocin B2 producer strain and other heterologous hosts. Both of the host strains are sensitive to carnobacteriocin B2 and they both acquired immunity when they were transformed with this construct
[0057]An alternative approach to the use of signal peptide Divergicin A was also tested. Many nonlantibiotic bacteriocins of lactic acid bacteria are produced as precursors with a Nterminal leader peptide that share similarities, in amino acid sequence and contain a conserved processing site of two glycine residues in positions -1 and -2 of the cleavage site. A dedicated ATP-binding cassette (ABC) transporter is responsible for the proteolytic cleavage of the leader peptides and subsequent translocation of the bacteriocins across the cytoplasmic membrane. To investigate the role that these leader peptides play in the recognition of the precursor by the ABC trans locators, the leader peptides of leucocin A. lactococcin A or colicin V were fused to divergicin A, a bacteriocin from Carnobacterium divergens that is secreted via the cell's general secretion pathway. Production of divergicin was monitored when these fusion constructs were introduced into Leuconostoc gelidum, Lactococcus lactis and Escherichia coli that carry the secretion apparatus for leucocin A, lactococcins and colicin V, respectively, The different leader peptides directed the production of divergicin in the homologous hosts. In some cases production of divergicin was also observed when the leader peptides were used in heterologous hosts.
[0058]For ABC transporter-dependent secretion in E. coli, the outer membrane protein TolC was required: this is not found in lactic acid bacteria. Using the leader peptide strategy, colicin V was produced in L. lactis by fusing this bacteriocin behind the leader peptide of leucocin A. By fusing colicin V, which is normally produced by the Gram-negative bacterium E. coli, behind the Leucocin A leader peptide and inserting the plasmid into lactic acid bacteria, we have been able to get lactic acid bacteria to produce and export active colicin V. Similarly, by fusing other bacteriocins behind the leucocin leader, we have used the leucocin leader to direct the secretion of other bacteriocins by the leaders dedicated transport system. This is an important accomplishment because it enables the use of bacteriocins of Gram-negative origin in lactics (Gram-positive bacteria) or other Gram-positive organisms. For example, this enables the design of Food-Grade organisms to target Gram negative pathogens such as Salmonella and E. coli, or for the design of organisms with specific fairly narrow or broad spectra of antibacterial activity.
[0059]The small amount of genetic material required using either the leader peptide or the signal peptide approach for independent bacteriocin expression permits the addition of multiple bacteriocins into the vector.
[0060]Chill stored, vacuum packaged beef inoculated with sulfide-producing Lactobacillus sake strain 1218 developed a distinct sulfurous odor within three weeks of storage at 1° C., at which time the bacteria had reached maximum numbers of 106 CFU cm-2. Co-inoculation of the meat with the wild type, bacteriocinogenic (Bac+) strain of Leuconostoc gelidum UAL187 delayed the spoilage by Lb. sake 1218 for up to 8 weeks of storage. Co-inoculation of meat samples with an isogenic, slow growing Bac+ variant UAL187-22 or with the Bac- variant UAL187-13 did not delay the onset of spoilage by Lb. sake 1218. The study showed that spoilage of chill stored, vacuum packaged beef by a susceptible target organism could be dramatically delayed by the Bac+ wild type strain of Leuc. gelidum UAL187 Inoculation with Lb. sake 1218 can be used as a model system to determine the efficacy of biopreservation of vacuum packaged meats (Leisner et al., 1996). Using the methods described herein, other bacteriocins and a food-grade vector, the breadth of antibacterial activity can be increased and the temperature range of protection broadened for this and other food applications.
[0061]The use of the methods described herein will enable the meat industry to reliably predict the storage life of vacuum packaged fresh meats.
[0062]This-same technology can be applied for preservation of animal feeds such as silage; as animal and human probiotics; as a control for Salmonella in poultry intestines; and for human therapy against infections of mucosal tissue where lactics are acceptable microflora.
[0063]We have identified bacteriocins with a spectrum of antagonistic activity against both Gram-negative and Gram-positive organisms. Described herein is a method to prepare and use gene cassettes with a broad spectrum of antagonistic activity. Using methods described herein a plasmid containing a cassette of genes containing two or more bacteriocin genes can be constructed and transformed into a host organism, resulting in export of the bacteriocins from the cell. The leader peptide can be specific for the dedicated secretion system(s) of the host organism or a common signal peptide suitable for a broader spectrum of host organisms (i.e. Divergicin A signal peptide). Using these strategies, the antibacterial spectrum of the>producer strain can be tailored to target a range of spoilage or pathogenic bacteria, including E. coli and Salmonella. Producer strains that grow in the target environment can be selected and specific bacteria can be targeted. Broad range bacteriocins that have been identified and characterized will be used as well as other bacteriocins that target specific organisms.
[0064]This invention refers to the tailoring of specific lactic acid bacteria that grow in hospitable environments, including human/food, animal feed, the mouth, the gastrointestinal tract of humans and animals, and the female genital tract. Using the technology of multiple bacteriocin production and delivery using lactic acid bacteria, a range of bacteriocins will be produced by the bacteria in situ. The principle of multiple bacteriocin production is based on using signal sequence of divergicin A produced by Camobactenum divergens LV13 or leader peptides from other bacteria and fusing structural components of bacteriocin genes and their immunity genes behind the signal peptide or leader peptide. The bacteriocins that can be exported include, but are not limited to, several from lactic acid (or closely related) bacteria and colicin V from Escherichia coli.
[0065]This invention includes, but is not limited to the following:
[0066]A method to export bacteriocins from cells using Divergicin A as the signal peptide sequence. This method involves fusing the signal peptide sequence of divergicin A produced by Carnobacterium divergens LV13 to the structural component of a bacteriocin gene devoid of its leader peptide followed for most bacteriocins by a region containing its immunity gene, inserting this into a vector then transforming a host organism. For most bacteriocins, its immunity gene must also be included in the plasmid or vector but its does not have to be directly attached to either the structural protein or the signal peptide.
[0067]A plasmid vector consisting of four DNA sequences operably linked together. The first sequence encodesa plasmid 0.0 replication and maintenance sequence, the second DNA sequence encodes a signal peptide or leader peptide sequence which is attached directly to a third DNA sequence which encodes the polypeptide sequence of a bacteriocin protein devoid of its leader sequence, the fourth sequence encodes the immunity gene specific for said bacteriocin protein.
[0068]A method to prepare the plasmid vector described above and insert the vector into the host organism. The host organism possesses a transport pathway which utilizes the signal peptide encoded by the signal peptide sequence.
[0069]A plasmid vector, pCD3.4 (SEQ ID NO:14), which is a foodgrade plasmid and method of use thereof.
[0070]A plasmid vector as described above wherein the signal peptide sequence is SEQ ID NO:7.
[0071]A plasmid vector as described above wherein the i bacteriocin and immunity gene are class II bacteriocin.
[0072]A plasmid vector consisting of three DNA sequences operably linked together. The first sequence encodes a plasmid replication and maintenance sequence, the second DNA sequence encodes a signal peptide or leader peptide sequence which is attached directly to a third DNA sequence which encodes the polypeptide sequence of a Class Type II protein or polypeptide devoid of its leader sequence.
[0073]An insertion vector as described above wherein the third DNA sequence encodes an enzyme.
[0074]A plasmid vector containing at least five DNA sequences operably linked together. The first sequence encodes a plasmid replication and maintenance sequence, the second DNA sequence encodes a signal peptide which is attached directly to a third DNA sequence which encodes the polypeptide sequence of a bacteriocin protein, the fourth sequence encodes the immunity gene specific for said bacteriocin protein and the fifth sequence encodes a polypeptide sequence for a transport protein system compatible with the signal peptide.
[0075]A method as described above wherein the plasmid contains more than one bacteriocin.
[0076]A plasmid vector as described above wherein the sequence encoding for the transporter system is the Leucocin A transporter system and the leader is from Leucocin A.
[0077]The signal peptide or leader peptide for the methods described above can be selected from leucocin A, lactococcin A, divergicin A, colicin V or other sequences described herein or any other dedicated secretion proteins that are compatible with the host organism.
[0078]A novel plasmid pCD3.4 (SEQ ID NO:14) for transforming food grade bacteria,
[0079]A method to preserve beef by adding Leuconostoc gelidum UAL187.
[0080]A method of preserving meat using food grade bacterium genetically modified with an plasmid vector containing one or more bacteriocins.
[0081]A method wherein plasmid vector is pCD3.4 (SEQ ID NO:14) is used as a vector.
[0082]A method for using food grade bacterium for the protection or preservation of food.
[0083]A method for using food grade bacterium transfected with a vector containing one or more bacterium for the protection or preservation of food.
[0084]A method for treating bacterial infections in animals or humans using food grade bacterium containing a naturally occurring bacteriocin.
[0085]A method for treating bacteria infections in animals or humans using food grade bacterium which has been genetically modified as described herein using one or more bacteriocins.
[0086]A method for treating bacteria infections in animals or humans using a food grade bacterium which has been genetically modified as described herein.
[0087]A method to inhibit the growth of gram-negative and/or gram positive bacteria using one or more bacteriocins.
[0088]A method to inhibit the growth of gram-negative and/or gram-positive bacteria using a genetically modified host organism.
[0089]Brochocin-C bacteriocin genes and methods of use thereof.
[0090]Enterocin 900 bacteriocin genes and methods of use thereof.
[0091]A method to export class II polypeptides using a leader peptide sequence.
[0092]A method to export class II polypeptides using a signal peptide sequence.
[0093]Novel bacteriocins and leader peptides and a method of use thereof.
[0094]Method of using Leucocin A transporter genes.
[0095]A food-grade plasmid and method of use thereof. A method to increase the shelf life of meat.
[0096]A method to test organisms for preservation of meat, dairy products or other food products.
[0097]A method to purify certain bacteriocins,
[0098]A method to export bacteriocins using a leader peptide sequence.
[0099]A method to export other polypeptides using a leader peptide sequence.
[0100]A method to introduce immunity to particular bacteriocins into host organisms.
EXAMPLES
[0101]The following examples are provided as a guide for those of skill in the art, and are not to be construed as limiting the claimed invention in any way.
Example 1
Bacteriocins, Sources, Methods to Propagate
[0102]Table 1 describes many different bacterial strains and plasmids, the bacteriocins they contain and references which provide additional information about the bacterocin or bacterial strain. For information on the best method to grow a particular organism refer to the appropriate reference or reference therein.
Example 2
Method to Use Signal Peptide to Direct the Secretion of Substrates Example Using Divergicin A Signal Peptide and Carnobacteriocin B2 as Substrate
[0103]Bacterial strains and media. Bacterial strains and plasmids used in this study are listed in Table 1. Carnobacteria were grown in APT broth (Difco Laboratories, Detroit, Mich.) at 25° C. without agitation. E. coli was grown in Luria Bertani (LB) medium at 37° C. on a rotary shaker. Agar plates were made by addition of 1.5% (wt/vol) agar to broth media. Antibiotics were added as selective agents when appropriate, as follows: erythromycin 200 μg ml-1 and ampicillin 100 μg ml-1 for E. coli and erythromycin 10 μg ml-1 for carnobacteria. Stock cultures of the bacterial strains were stored at -70° C. in the appropriate broth containing 20% (vol/vol) glycerol.
[0104]Oligonucleotide primer synthesis and amplification reactions. In the 3' region of the nucleotide sequence encoding the signal peptide of divergicin A there is a HindIII restriction site located 10 nucleotides upstream of the sequence encoding mature divergicin A (Worobo at al, 1995). A 35-mer oligonucleotide designed to facilitate an in-frame fusion between the signal peptide of divergicin A and the structural gene of carnobacteriocin B2 was synthesized on a DNA synthesizer (Applied Biosystems 391 PCR Mate) for use as a PCR primer (JMc7; 5'-CCCAAGCTTCTGCTGTAAATTATGGTAATGGTGTT-3'). The first 9 nucleotides of JMc7 regenerate the HindIII restriction endonuclease cleavage site followed by nucleotides encoding the carboxy-terminus of the divergicin A signal peptide. The last 21 nucleotides of the primer are complementary to the 5' sequence corresponding to the N-terminal sequence of the carnobacteriocin B2 structural gene (cbnB2) immediately following the Gly-Gly cleavage site of the leader peptide. The reverse primer for the PGR amplification (ImmR) was based on the 3' nucleotide sequence of the immunity gene for carnobactenocin B2 (cbiB2) and contains an overhang of 9 nucleotides to accommodate an XbaI restriction endonuclease site (Pugsley, 1993). DNA was amplified in a 100 μl reaction using a temperature cycler (OmniGene, InterSciences Inc., Markham, Ont.), PCR mixtures contained 1.0 μM of each primer, 200 μM of dNTPs, 5 mM MgCl2, 2.5 units of Tli DNA polymerase (Promega) and 1× reaction buffer (Promega), pLQ24 was used as template DNA for the reaction (Pugsley, 1993). DNA was amplified with 36 cycles (denaturation, 93° C. 1 min; annealing, 48° C., 1 min; extension, 75° C., 2 min) followed by a final extension step at 75° C. for 5 min.
[0105]DNA isolation, manipulation and sequence determination. Isolation of plasmid DNA from E. coli and carnobacteria was done as previously described (Sambrook et al, 1989; Worobo et al, 1994) Miniprep plasmid extractions for E. coli MH1 included a phenol-chloroform step which was necessary for restriction endonuclease analysis. Standard methods were used for restriction enzyme digestion, ligations, gel electrophoresis and E. coli transformation (Sambrook et al, 1989). Transformation of carnobacteria was done as described by Worobo and associates (1995). DNA was sequenced by Taq DyeDeoxy Cycle sequencing (Applied Biosystems 373A). Sequences were determined bidirectionally in pUC118 using universal primers.
[0106]Production of and immunity to divergicin A and carnobacteriocin B2. Carnobacteria transformed with either pRW19e or pJKM14 were tested for bacteriocin production using the deferred antagonism assay as described by Ahn and Stiles (1990) and references therein. Strains containing pMG36e were used as negative controls. Immunity to divergicin A and carnobacteriocin B2 was determined with the transform ants as indicators in deferred inhibition assays. To confirm that the zones of inhibition were caused by a proteinaceous compound, they were inactivated by spotting Pronase E (1 mg ml-1; Sigma) prior to overlayering with the sensitive indicator strain.
[0107]Purification and N-terminal sequencing of carnobacteriocin B2. Partial purification of carnobacteriocin B2 was done with a 1% inoculum of an overnight culture of C. divergens LV13 containing pJKM14 grown in 2 liters of APT broth for 21 h maintained at pH 6.2 with a pH stat (Chem-Cadet; Cole Palmer). The culture was heated (70° C., 35 min) and cells were removed by centrifugation. Supernatant was loaded onto an Amberlite XAD-8 column (4×40 cm; BDH Chemicals, Poole, England) equilibrated with 0.05% trifluoroacetic acid (TEA). The column was washed successively with 3 liters of 10, 35 and 40% ethanol. C. divergens LV13 containing pJKM14 produces carnobacteriocin B2 and divergicin A, hence C. divergens LV13 was used as the sensitive indicator strain to eliminate inhibition zones produced by divergicin A. The active fraction was eluted with 3 liters of 50% ethanol. This fraction was concentrated by rotary evaporation to approximately 50 ml, and 10 ml was applied to a Sephadex G-50 column (2.5×120 cm, Pharmacia) with a running buffer of 0.05% TFA, Contents of tubes with inhibitory activity were collected, pooled and concentrated by rotary evaporation to 1 ml. Various amounts of partially purified carnobacteriocin B2 were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted onto polyvinylidene difluoride membrane (Bio-Rad), A duplicate polyacrylamide gel was washed twice with 1 liter of water and the gel was placed onto an APT plate and overlayered with soft APT agar inoculated with 1% of C. divergens LV13. The band corresponding to inhibitory activity was excised from the membrane and used for N-terminal sequencing by Edman degradation as described by Worobo at al. (Worobo at al, 1995).
[0108]Construction of plasmids pRW19e and pJKM14. The bacteriocinogenic plasmids pRW19e and pJKM14 were constructed for use in this study. Both plasmids are derivatives of the lactococcal expression vector pMG36e (Van de Guchte at al, 1989) and transcription of the bacteriocin genes is under control of the P32 promoter. for construction of pRW19e, a 514-bp EcoRV-AccI fragment of pCD3.4 containing both the structural and immunity genes for divergicin A (Worobo et al, 1995) was cloned into the SmaI and AccI sites of pMG36e. When C. piscicola LV17C was transformed with pRW19e the inhibitory spectrum matched that of C. divergens LV13 (Table 5). Zones of inhibition were inactivated by pronase E. C. piscicala LV17C with pRW19e also acquired immunity to divergicin A (Table 5). For construction of pJKM14, a 528-bp fragment was amplified by PCR from pLQ24 using the primers JMc7 and ImmR. This fragment was cloned into the HindIII and XbaI sites of pUC118 to create the plasmid pJKM05 and sequenced in both directions to confirm the fidelity of the reaction. An internal EcoR1 site located in the 5' region of cbiB2 was utilized to generate two subclones for completion of the overlapping sequence. No errors were detected (data not shown) in the nucleotide sequence compared with nucleotide sequence of the structural and immunity genes for carnobacteriocin B2 (Quadri et al, 1994). The 528-bp fragment was excised from pJKM05 using HindIII and KpnI and cloned into these sites in pRW19e, replacing the divergicin A structural and immunity genes, The SacI-EcoR1 fragment from pJKM14 containing the fusion between the divergicin A signal peptide and the carnobacteriocin B2 structural gene was cloned into pUC118 and sequenced to confirm that the correct reading frame was maintained (data not shown).
[0109]Production of and immunity to divergicin A and carnobacteriocin B2. Production of divergicin A and carnobactenocin B2 was detected by deferred antagonism assay against sensitive indicator strains. C. piscicola LV17C and C. divergens LV13 were transformed with the plasmids pMG36e, pRW19e and pJKM14 to compare differences in bacteriocin production with the divergicin A signal peptide, Results of deferred inhibition tests are shown in FIG. 2 and Table 5. C. divergens LV13 is more sensitive to carnobacteriocin B2 than C. piscicola LV17C shown by the large inhibitory zone in FIG. 2B. Zones of inhibition for wild type strains and strains containing pMG36e were identical (data not shown). When C. piscicola LV17C was transformed with pRW19e, divergicin A was produced as indicated by inhibition of strains sensitive to divergicin A No activity was detected against C. divergens LV13. The wild type carnobacteriocin B2 producer C. piscicola LV17B produces at least two bacteriocins (Quadri et al, 1994) making comparison between the inhibitory spectra of C. piscicola LV17B and C. piscicola LV17C containing pJKM14 difficult to interpret. To confirm the identity of the inhibitory substance produced by C. divergens LV13 containing pJKM14, the bacteriocins were purified and N-terminal amino acid sequence of the probable carnobacteriocin B2 peak was determined and shown to be Val-Asn-Tyr-Gly-Asn-Gly-Val. This sequence matches the mature sequence of carnobacteriocin B2 indicating that the inhibitory substance was in fact carnobacteriocin B2, and that proper processing of the bacteriocin occurred following the Ala-Ser-Ala processing site of the divergicin a signal peptide (FIG. 1), Furthermore, production of carnobacteriocin B2 from pJKM14 was also accomplished in the two meat isolates C. divergens AJ and C. piscicofa UAL26, and in Lactococcus lactis subsp, lactis IL1403 (data not shown). Using this strategy production of Leucocin A, Brochocin-C and Colicin V was achieved.
[0110]There are a large number of plasmids that could be used in place of the plasmids described herein. Someone skilled in the art could identify other suitable plasmids and insert the various combinations of other gene sequences described herein into one of these plasmids without undue experimentation.
[0111]Using a Signal Peptide Gene to Export Alkaline Phosphatase from the Host
Using the procedure described herein and the Divergicin A signal peptide gene attached to alkaline phosphatase structural gene, the inventors were able to export active alkaline phosphatase from the host organism, E. coli.
[0112]For amplification of the DNA encoding the mature part of alkaline phosphatase, primers
TABLE-US-00001 KLR 179 (5' GCGCAAGCTTCTGCTCGGACACCAGAAATGCCTGTT 3') and KLR 180 (5' GGCGAAGCTTGCCATTAAGTCTGGTTGCTA 3')
were used with the E. coli C4F1 (Torriani, 1968) alkaline phosphatase gene as a template. Cloning of alkaline phosphatase was essentially as described in example 2 for Carnobacteriocin B2 and Worobo et al. 1995.
[0113]Assay for Alkaline Phosphatase
Cells from 1.5 nil of an overnight culture grown in LB broth were centrifuged (9000×g, 5 min, 25° C.) and washed in an equal volume of STE (50 mM NaCl, 10 mM Tris pH 8.0, 1 mM EDTA pH 8.0). The culture media and periplasmic fractions were assayed for alkaline phosphatase. Periplasm is fractions were prepared by resuspending the washed cells in 0.5 ml of 20% sucrose with 50 μl of 0.5 M EDTA and 25 μl of lysozyme (10 mg/ml) and incubating at room temperature for 15 min. The samples were centrifuged (9000×g, 5 min, 25° C.) and the supernatant was assayed for alkaline phosphatase activity (Torriani, 1968) by absorbance at 405 nm.
Example 3
Method to Use Leader Peptides to Direct Secretion of Substrates Via Dedicated Transport System
[0114]Bacterial strains and media. C. divergens LV13 (Worobo at al., 1995), C. divergens UAL278 (McCormick et al., unpublished), L. gelidum 187-13 and L. gelidum 187-22 (Hastings and Stiles, 1991), and Pediococcus pentosaceus FBB63C (Graham and McKay, 1985) were grown in APT broth (All Purpose Tween; Difco Laboratories Inc.) at 25° C. and 30° C., respectively. L. lactis IL1403 (Chopin at al., 1984) and L. lactis IL1403(pMB500) (van Belkum et al., 1989) were grown in glucose-M17 broth (Terzaghi and Sandine, 1975) at 30 E. coli strains MH1 (Casadaban and Cohen, 1980), DH5((BRL Life Technologies Inc.), BL21(DE3) (Studier and Moffat, 1986), MC4100 (Casadaban, 1976), and ZK796 (Wandersman and Delepelaire, 1990) were grown in TY broth at 37° C. (Rottlander and Trautner, 1970), Solid plating media were prepared by adding 1.2% (wt/vol) agar to the broth media. C. divergens UAL278 cells propagated on agar medium were incubated under anaerobic gas mixture of 90% N2 and 10% CO2. E. coli strains transformed with the colicin V encoding plasmid pHK22 (Gilson at al., 1987) were grown in media that contained 0.2 mM 2,2'-dipyridyl to increase expression of the colicin V operons. When appropriate, antibiotics were added to the media at the following final concentrations: erythromycin (200 (g/ml), ampicillin (150 (g/ml), tetracycline (15 (g/ml) and chloramphenicol (25 (g/ml) for E. coli; erythromycin (5 (g/ml) for L. lactis, C. divergens and L. gelidum; and kanamycin (50 (g/ml) for L. lactis.
[0115]Bacteriocin assay. Bacteriocin production was tested as described previously (van Belkum and Stiles, 1995) To detect divergicin A production, a strain of C. divergens UAL278 that is resistant to leucocin A was used as an indicator. This resistant strain was isolated by exposing it to a sublethal concentration of leucocin A C divergens LV13. L. lactis IL1403, P. pentosaceus FBB63C and E. coli DH5 (were used as indicator strains for leucocin A, lactococcin A, pediocin PA-1 and colicin V, respectively. In some cases, bacteriocin activity was also tested by spotting serial dilutions of the growth medium onto an indicator lawn.
[0116]Purification and N-terminal sequencing of divergicin A. To purify divergicin A from transformants of L. gelidum 187-22, a 1% inoculum of an overnight culture was grown in APT broth, which was maintained at pH 5.5 using a pH stat (Chem-Cadet; Cole Palmer), After 18 h, the culture was heated at 70 for 35 min and centrifuged for 10 min to remove the cells. The supernatant was loaded onto an Amberlite XAD-8 column (4 cm×40 cm; BDH Chemicals) equilibrated with 0.05% trifluoroacetic acid (TFA). The column was washed with equal volumes of 0.05% TFA, and 10%, 35%, and 45% ethanol in 0.05% TFA. The active fraction of divergicin was eluted with 50% ethanol in 0.05% TFA and concentrated 10-fold by rotary evaporation. Samples of 10 ml were loaded onto a Sephadex G-50 column (2.5 cm×120 cm; Pharmacia) that was equilibrated with 0.05% TFA. The active fraction was applied to a sodium dodecyl sulfate (SDS)-polyacrylamide (15%) gel for polyacrylamide gel electrophoresis (PAGE). After electrophoresis, the gel was fixed in 50% methanol and 10% acetic acid for 30 min, washed twice for 1 h with 1 liter of deionized water and overlayered on an APT plate with soft APT agar (0.7% wt/vol) inoculated with 1% of a C. divergens UAL278 culture to screen for divergicin activity. Another sample of the partially purified divergicin obtained from the Sephadex G-50 column was subjected to SOS-PAGE and electroblotted onto a polyvinylidene difluoride membrane (Bio-Rad) and the protein band corresponding to the inhibitory activity of the overlayer test was excised from the gel and used for N-terminal sequencing by Edman degradation, as previously described (Worobo et al., 1995).
[0117]Molecular cloning. Cloning and DNA manipulations were performed as described by Sambrook et al. (1989). Plasmid DNA from E. coli was isolated as described by Birnboim and Doly (1979). With some modifications (van Belkum and Stiles, 1995), the same method was used to isolate plasmid DNA from L. gelidum and L. lactis. Restriction endonucleases, Tli DNA polymerase, the Klenow fragment of E. coli DNA polymerase I, and T4 DNA ligase were obtained from Promega, Bethesda Research Laboratories, Boehringer GmbH, or New England Biolabs, and used as recommended by the suppliers. Competent E. coli cells were transformed as described by Mandel and Higa (1970). Electrotransformations of L. lactis and L. gelidum were done according to the methods of Holo and Nes (1989) and van Belkum and Stiles (1995), respectively.
[0118]Construction of plasmids, A two-step PCR strategy (FIG. 7) was used to obtain a fusion between the leucocin A leader peptide and divergicin A. DNA encoding the leucocin A leader peptide and a 176-bp upstream region was amplified by PCR using plasmid pMJ3 (van Belkum and Stiles, 1995) as a template and MB32 (5'-AATTCGAGCTCGCCCAAATC-3') that is complementary to the upstream region, and MB37 (5'-TGAGTAATTTTCGGTGCAGCACCTCCTACGACTTGTTCGA-3') that is complementary to the leucocin A leader and divergicin A sequence, as primers. This PCR fragment was subsequently used as a megaprimer to amplify the structural gene encoding divergicin A and a downstream region that includes the immunity gene for divergicin, with pCD3.4 (Worobo et al., 1995) as a template and RW58 (5'-TACGCGCAAGAACAGACAAAATC-3') as the reverse primer. Using the SacI restriction site of MB32 and a HindIII restriction site 390-bp downstream of the immunity gene the resulting PCR fragment was cloned into plasmid pMG36e (van de Guchte et al., 1989), giving plasmid pLED1. In a similar way, the sequence encoding the lactococcin A leader peptide and a 375-bp upstream region was fused to the gene encoding divergicin A, except that in the first PCR step, plasmid pMB553 (van Belkum et al., 1991a) was used as a template and MB38 (5'-TGAGTAATTTTCGGTGCAGCTCCTCCGTTAGCTTCTGAAA-3') that is complementary to the lactococcin A leader and divergicin A sequence, and MB39 (5-TACGAATTCGAGCTCGCCC-3') that is complementary to the upstream region, were used as primers. The PCR product containing the resulting gene fusion was cloned into the SacI and HindIII sites of pMG36e, giving plasmid pLAD6. Plasmid pCOD1, that contains a gene fusion between the colicin V leader sequence and divergicin A, was constructed in an identical way to pLED1, except that MB42 was used as a PCR primer instead of MB37 MB42 (5'-ATTTTCGGTGCAGCACCTCCAGAAACAGAATCTAATTCATTTAGAGTCAGAGTTCTCATAATAACTTTC- CTCTTTT-3') is complementary to divergicin A, the entire colicin V leader sequence and a region immediately upstream of the leucocin A leader sequence. Plasmid pLD1 was made in the same way as pLED1, except that MB41 (5'-TGAGTAATTTTCGGTGCAGCCATAATAACTTTCCTCTTTT-3'), a primer complementary to the region immediately upstream of the leucocin A leader sequence was used instead of MB37. In pLD1 the divergicin A is encoded without a leader peptide. To make a fusion between the leucocin A leader peptide and colicin V, the leucocin A leader sequence and the upstream region was amplified by PCR using pMJ3 as template and as primers MB32 and MB43 (5'-ATATCACGCCCTGAAGCACCTCCTACGACTTGTTCGA-3) that is complementary to the leucocin A leader sequence and colicin V. The PCR product was then used as a megaprimer in a second PCR step using pHK22 (Gilson et al., 1987) as a template and MB44 (5-AATTAAGCTTGGATCCTTCTGTGTGGATTGTCCAAT-3') complementary to the downstream region of the structural colicin V gene as the reverse primer. The resulting PCR fragment was cleaved with HindIII, a restriction site that is located in the sequence of MB44, and SacI and cloned into pMG36e, giving plasmid pLEC1. All constructs were sequenced by the dideoxy-chain method of Sanger et al. (1977), Plasmid pTLA1 was constructed by cloning a 0.6 kb SacI-SspI fragment from pLAD6 that encodes the divergicin A gene fused to the lactococcin A leader sequence into the multiple cloning site of plasmid pT713 (Tabor and Richardson, 1985).
[0119]Overexpression of divergicin A precursor in E. coli by T7 RNA polymerase. Cultures of E. coli BL21(DE3) were grown to OD600 of 0.3 in TY broth supplemented with 0.2 mM 2,2'-dipyridyl. The cells were subsequently induced by the addition of IPTG at a final concentration of 0.4 mM, After 2 h of incubation the cells were harvested, washed and concentrated 100-fold in deionized water, and lysed by sonication at 4° C. The lysate was applied to a tricine-SDS-polyacrylamide gel of 16% acrylamide (wt/vol) and 0.5% (wt/vol) bisacrylamide as described by Schagger and von Jagow (1987). After electrophoresis, the gel was fixed for 30 min in 50% methanol and 10% acetic acid and washed twice with 1 liter of deionized water for 1 h each. Antagonistic activity was detected by overlayering the gel on an APT agar plate with soft APT agar containing C. divergens UAL278 as the indicator strain.
[0120]Divergicin production in Leuconostoc gelidum and Lactococcus lactis using leader peptides from leucocin A and lactococcin A. Divergicin A is produced as a prepeptide that consists of a mature peptide of 46 amino acids and a classical N-terminal signal peptide of 29 amino acids (FIG. 6, SEQUENCE NO. 1a). The signal peptide of divergicin A was replaced with the double-glycine type leader peptides from leucocin A and lactococcin A (FIG. 6, SEQUENCE NO. 2b and 3b) by a two-step polymerase chain reaction (PCR) strategy as shown in FIG. 7. The DNA encoding the leucocin A leader peptide and a 176-bp upstream region was amplified by PCR. The resulting PCR fragment was used as a megaprimer to amplify the DNA encoding the mature peptide for divergicin and its immunity protein. The PCR product containing the gene fusion was cloned into the vector pMG36e to give plasmid pLED1. The gene fusion in pLED1 is under the control of the P32 promoter of pMG36e that is functional in a variety of bacteria (van der Vossen et al., 1987). To determine whether the secretion apparatus for leucocin A can recognize this hybrid protein, remove the leader peptide and translocate divergicin A into the external medium, plasmid pLED1 was introduced into Leuconostoc gelidum UAL187-22. The genetic determinants for leucocin A and its transport proteins LcaC and LcaD are located on one of the two plasmids found in this organism (Hastings et al., 1991; van Belkum and Stiles, 1995). Carnobacterium divergens UAL278 was used as a sensitive indicator strain to monitor divergicin production. Because C. divergens UAL278 is sensitive to leucocin A, a strain of UAL278 that is resistant to leucocin A was isolated by exposing C. divergens UAL278 to a sublethal concentration of leucocin A. This strain was used in subsequent studies to detect divergicin production. Production of divergicin A using this fusion construct was also monitored in Lactococcus lactis IL1403 carrying plasmid pMB500, This plasmid contains genes for the lactococcin transport proteins LcnC and LcnD and the structural and immunity genes for lactococcins A and B (van Belkum et al., 1989; Stoddard et al., 1992). Lactococcins A and B are only active against lactococci and do not inhibit the growth of C. divergens. When L. gelidum UAL187-22 and L. lactis IL1403(pMB500) were transformed with pLED1, production of divergicin A was observed (FIGS. 8 and 9). However, transferring pLED1 into L. gelidum 187-13, a derivative of UAL187-22 that has been cured of the leucocin plasmid (Hastings and Stiles, 1991), or into L. lactis IL1403, production of divergicin did not occur (data not shown).
[0121]In a similar way, divergicin A was fused to the lactococcin A leader peptide. DNA encoding the lactococcin A leader sequence and a 375-bp upstream region was amplified. The resulting PCR product was used in a second PCR reaction to fuse the lactococcin A leader sequence to the divergicin gene. This PCR product was cloned into pMG36e, resulting in pLAD6. Transformation of pLAD6 into L. gelidum 187-22 or L. lactis IL1403(pMB500) resulted again in production of divergicin (FIGS. 8 and 9). Apparently, the leucocin A and lactococcin A leader peptides can direct the secretion of divergicin using the leucocin A as well as the lactococcin A transport proteins, respectively. The data shown in FIGS. 8 and 9 illustrate that L. gelidum 187-22 produced somewhat more divergicin with pLED1 than with pLAD6, while in L. lactis IL1403(pMB500) the opposite effect was observed. This was confirmed when divergicin activity in the supernatant of cultures of L. gelidum 187-22 and L. lactis IL1403(pMB500) transformed with these two plasmids were compared. A culture of L. gelidum 187-22 transformed with pLED1 produced four times more divergicin than with pLAD6, while L. lactis IL1403(pMB500) transformed with pLAD6 doubled the production of divergicin compared with pLEDI.
[0122]To confirm that inhibition of C. divergens UAL278 by L. gelidum 187-22 carrying pLED1 or pLAD6 was caused by divergicin A production and not by leucocin A, the inhibitory compound was partially purified and the N-terminal amino acid sequence was determined. The N-terminal amino acid sequence of Ala-Ala-Pro-Lys-Ile from the purified peptide indicated that the active compound was indeed divergicin A (Worobo et al., 1995) and that proteolytic cleavage occurred at the C-terminus of the two glycine residues of the leucocin A and lactococcin A leader peptides. This demonstrated that LcaC, the ABC transporter for leucocin A, correctly processed these leader peptides fused to divergicin A.
[0123]Some divergicin was produced when L. lactis IL1403 that did not contain pMB500 was transformed with pLAD6 (FIG. 9). It has recently been shown that L. lactis IL1403 carries a set of secretion genes on the chromosome that are homologous to the lactococcin secretion genes IcnC and IcnD of pMB500 (Venema et al., 1996). These results indicate that the transport proteins encoded on the chromosome of IL1403 recognize the hybrid protein containing the lactococcin A leader peptide but not when it contains the leucocin A leader peptide.
[0124]Divergicin A production using the colicin V secretion apparatus. To determine whether divergicin A fused to the leucocin A or lactococcin A leader peptides could be secreted by E. coli using the transport proteins for colicin V pLED1 and pLAD6 were transformed into E. coli MC4100 carrying pHK22. Plasmid pHK22 contains the structural gene of, and the immunity gene for, colicin V as well as the genes encoding the two inner membrane transport proteins CvaA and CvaB for colicin V (Gilson et al., 1990). With plasmid pLED1, but not with pLAD6, divergicin could be produced in E. coil MC4100(pHK22) (FIG. 10). To compare the efficiency of divergicin secretion by the colicin V secretion apparatus using the leucocin A leader peptide with that when the colicin V leader peptide was used (FIG. 6), plasmid pCOD1 was constructed. Plasmid pCOD1 is identical to pLED1 except that the leucocin A leader peptide was replaced by the colicin V leader peptide (FIG. 7), The zone of inhibition of C. divergens UAL278 formed by E. coli MC4100 carrying pHK22 and pCOD1 was slightly larger than that produced by E. coli cells carrying the two plasmids pHK22 and pLED1 (FIG. 10). Divergicin production was not observed when pLED1 or pCOD1 were transformed into MC4100 that did not contain pHK22 (data not shown). The iron chelator 2,2'-dipyridyl was used in the medium to induce the colicin V promoters (Chehade and Braun, 1988; Gilson et al., 1990). Omitting this inducer from the medium greatly reduced production of colicin V as well as divergicin A.
[0125]When L. gelidum 187-22 and L. lactis IL1403(pMB500) were transformed with pCOD1, production of divergicin was observed in UAL187-22 but not in IL1403(pMB500) (FIGS. 8 and 9). The colicin V leader peptide was not as efficient as the leucocin leader in directing the secretion of divergicin in L. gelidum 187-22 (FIG. 8).
[0126]As a negative control, pLD2 was constructed. It is identical to pLED1 or pCOD1 except that leader peptides that precede the mature part of the divergicin A peptide were excluded. E. coli MC4100 (pHK22) cells transformed with pLD2 did not inhibit the growth of C. divergens UAL278. Furthermore, the introduction of pLED1, pLAD6 or pCOD1 into L. gelidum 187-22, L. lactis IL1403(pMB500) and E. coli MC4100(pHK22) did not affect the production of leucocin A, lactococcins and colicin V, respectively (data not shown).
[0127]TolC is required for ABC transporter-dependent transport. For translocation of colicin V across the outer membrane in E. coli, the presence of the minor outer membrane protein TolC is required (Gilson et al., 1990). To determine whether TolC is essential for divergicin A production in E. coli, pHK22 in combination with pCOD1 or pLED1 were introduced into E. coli ZK796, a TolC-D derivative of MC4100 (Wandersman and Delepelaire, 1990). E. coli ZK796(pHK22) containing pLED1 or pCOD1 did not produce divergicin A, indicating that divergicin A requires the TolC protein for the ABC protein-dependent secretion pathway in E. coli.
[0128]Colicin V secretion in Lactococcus lactis. The results described above indicate that leader peptides of the double-glycine type can direct the secretion of heterologous substrates using ABC transporters. To determine whether colicin V. a bacteriocin of 88 amino acids that is produced by E. coli, can be exported by lactic acid bacteria using the leucocin A leader peptide, the leucocin A leader peptide was fused to colicin V. The same DNA sequence encoding the leucocin A leader peptide plus the 176-bp upstream region present in pLED1 was amplified by PCR and was used as a megaprimer to amplify the DNA encoding the mature part of colicin V and a downstream region of 54 bp. The resulting PCR product was cloned into pMG36e, giving plasmid pLEC2. When L. lactis IL1403(pMB500) was transformed with pLEC2, colicin V production was observed using E. coli DH5α as the sensitive indicator strain. No inhibition was observed when DH5α carrying pHK22 was used as the indicator strain. However, transformation of L. gelidum 187-22 with pLEC2 did not result in secretion of colicin V (data not shown). Apparently, colicin V can be exported using LcnC and LcnD, but it seems that it cannot access the transport proteins for leucocin A.
[0129]The genes for the N-terminal amino acid extensions described by Worobo and associates (1995) and Quadri and associates (1994) would also be suitable for the using as leader sequences similar to those described herein.
[0130]In summary this protocol can be used to generate plasmids with more than one bacteriocin, or can be used to generate several plasmids with different bacteriocins. Using these techniques in combination with the nucleotide or peptide sequence of the desired leader or signal peptide and the desired bacteriocin someone skilled in the art could determine how to isolate the appropriate genes, identify and prepare the appropriate primers and insert the appropriate genes into a plasmid without undue experimentation. The host cell is the organism that is safe to use in the proposed environment or is responsible for a particular function in the environment. For example, the particular strain of bacteria used to make a particular type of cheese would be a suitable host for making an organism which would inhibit the growth of a variety of undesirable organisms but still make the desired type of cheese. The desired leader sequence or signal peptide would be a leader sequence found associated with a bacteriocin derived from the same species of bacteria or a general signal bacteriocin peptide. The bacteriocin selected would target undesirable organism found in the particular environment. For many application such as preservation of meat, both Gram-negative and a Gram-positive bacteriocins are desired therefore two or more bacteriocins would be required (one derived from a Gram-negative organism and the other derived from a Gram-positive organism.)
[0131]The dedicated secretion and accessory proteins of Leuconostoc gelidum UAL187 can be used to produce several different bacteriocins from one cell. The bacteriocins produced can be targeted against a range of bacteria, and those produced to date include colicin V in combination with one or more bacteriocin derived from leucocin A. carnobacteriocin B2 or other bacteriocins described herein.
Example 4
Methods to Test the Spectrum of Antibiotic Activity of Bacteriocins
[0132]The antibiotic spectrum of a bacteriocin can be determined by a variety of methods including but not limited to direct and deferred antagonism methods or spot-on-the lawn testing as described by Ahn and associates (1990a and b) and van Belkum and Stiles (1995).
[0133]The spectrum of antibiotic activity of individual bacteriocins were determined using partially purified bacteriocins. The bacteriocins were purified by methods specific for the bacterocin (Henderson et al. 1992; Hechard et al 1992; Hastings et al 1991; Quadri et al; 1993; Worobo et al. 1994; UAL-26 and Brochocin-C to be described later) or obtained commercially such as Pediocin PA-1 (Quest; Flavors & Food Ingredients Co., Rochester, N.Y.). Bacteriocins activity was determined using Carnobacterium divergens LV13 grown on ATP agar and expressed in arbitrary units of inhibitory activity (AU) based on the reciprocal of the greatest dilution that is inhibitory to this indicator strain (Ahn and Stiles 1990). Several bacteriocins were tested using 10 μl/spot of 100 AU/ml or 800 AU/ml for inhibition of growth of a variety of strains of bacteria grown on agar (APT for most organisms except for the following: Lactobacilli MRS broth containing 1.5% agar for Lactobacillus and Pediococcus strains; Tryptic Soy Broth containing 1.5% agar (TSB agar) for Bacillus, Staphylococcus and Streptococcus strains; TSB plus 0.6% yeast extract for Listeria strains; or Trypticase Peptone Glucose Yeast extract for Clostridium strains and the results are summarized in Tables 2, 3 and 4.
[0134]This procedure can be used to test the ability of specific bacteriocins to inhibit the growth of specific organisms. With this information partially purified or purified bacteriocins can be identified for the use in the control of the growth of particular organisms, particular groups of organisms or for the treatment of particular diseases.
[0135]Organisms can be engineered as described herein to incorporate one or more of the desired bacteriocins for the inhibition of the growth of particular organisms or groups of organisms using the genetically engineered organism.
[0136]Carnobacteriocin 26, Enterocin 900 and Brochocin-C would be very good inhibitors of a broad range organisms as indicated in Table 2, 3 and 4. Inhibition of the growth of these organisms is important for disease control or to reduce spoilage of agricultural products.
Example 5
Molecular Characterization of Genes Involved in the Production of the Bacteriocin Leucocin A from Leuconostoc gelidum (van Belkum and Stiles, 1995).
[0137].Leueocin A is a bacteriocin produced by Leuconostoc gelidum UAL187 isolated from vacuum packaged meat (Hasting and Stiles; 1991). It inhibits a wide spectrum of LAB as well as some strains of Listeria monocytogenes and Enterococcus faecalis. Curing experiments of UAL187 showed that the genetic determinant for leucocin A was located on one of the three plasmids found in this organism. The bacteriocin was purified and shown to contain 37 amino acids (Hastings et al. 1991). A degenerate oligonucleotide was used for hybridization with plasmid DNA of UAL187-22 which has only two of the three plasmids, pLG7.6 and pLG9.2, and still produces bacteriocin (Hastings and Stiles 1991). A 2.9-kb HpaII fragment of pLG7.6 showing homology was cloned and sequenced revealing the structural gene for leucocin A (IcnA) and a second open reading frame (ORF). It was postulated that this second ORF could encode an immunity protein (Hastings et al, 1991), Leucocin A was shown to be produced as a precursor with a 24 amino acid N-terminal extension. Transformation of several LAB with constructs containing the 2.9-kb fragment did not show production of leucocin A. UAL187-13, a cured, bacteriocin-negative derivative of the wild type strain, was refractory to transformation.
[0138]Leucocin A is a small heat stable bacteriocin produced by Leuconostoc gelidum UAL187. A 2.9-kb fragment of plasmid DNA that contains the leucocin structural gene and a second open reading frame (ORF) in an operon was previously cloned (Hastings, et al, 1991). When a 1-kb Oral-HpaI fragment containing this operon was introduced into a bacteriocin-negative variant (UAL187-13), immunity but no leucocin production was detected. Leucocin production was observed when an 8-kb SacI-HindIII fragment of the leucocin plasmid was introduced into Leuc. gelidum UAL187-13 and Lactococcus lactis IL1403. Nucleotide sequence analysis of this 8-kb fragment revealed the presence of three ORFs in an operon upstream and on the opposite strand of the leucocin structural gene. The first ORF (IcaE) encodes a putative protein of 149 amino acids. The second ORF (IcaC) contains 717 codons and encodes a protein that is homologous to members of the HlyB-family of ATP-dependent membrane translocators. The third ORF (IcaD) contains 457 codons that encodes a protein with strong resemblance to LcnD, a protein essential for the expression of the lactococcal bacteriocin lactococcin A. Deletion mutations in IcaC and IcaD resulted in loss of leucocin production, indicating that LcaC and LcaD are involved in the translocation and production of leucocin A. A mutation in IcaE did not affect leucocin production. The secretion apparatus for lactococcin A did not complement mutations in the IcaCD operon to express leucocin A in L. lactis, but lactococcin A production was observed when the structural and immunity genes for this bacteriocin were introduced into a leucocin producer of Leuc. gelidum UAL187, indicating that lactococcin A could access the leucocin A secretion machinery.
[0139]To prevent confusion with nomenclature used for the genes involved in the expression of lactococcins, IcnA and ORF2 (Hastings et al. 1991) have been renamed IcaA and IcaB, respectively. We report the cloning and nucleotide sequence analysis of a second operon which is located adjacent to, and on the opposite strand of, the IcaAB operon. A construct containing the two operons was successfully transferred into Leuc. gelidum UAL187-13 and resulted in leucocin production.
[0140]Bacterial strains, plasmids and media. The bacterial strains and plasmids used in this study are listed in Table 1, Escherichia coli was grown in TY broth (Rotlander and Trautner, 1970) at 37° C.; L. lactis was grown in Glucose-M17 broth (Terzaghi and Sandine 1975) at 30° C.; and Leuc. gelidum and Carnobacterium piscicola were grown in APT broth (All Purpose Tween; Difco Laboratories Inc., Detroit, Mich.) at 25° C. Broth media were supplemented with 1.2% (wt/vol) agar for solid plating media. Selective concentrations of erythromycin for growth of E. coli, L. lactis and Leuc. gelidum containing recombinant plasmids were 200, 5 and 5 mg/ml, respectively. When appropriate, ampicillin was used at a final concentration of 150 mg/ml for E. coli', and kanamycin was used at a final concentration of 50 mg/ml for L. lactis
[0141]Bacteriocin Assay. To test for production of leucocin, cells of L gelidum or L. lactis were inoculated, unless otherwise stated, onto APT and glucose-M17 agar plates, respectively, and incubated at 25° C. for 18 h. Soft APT agar (0.7% [wt/vol]) containing C. piscicola LV17C as the indicator strain was then poured onto the surface. After 15 h of incubation, the plates were examined for zones of inhibition. Immunity or resistance of the different strains to leucocin was determined by a spot-on-lawn test of 0.5 μg of the bacteriocin (Ahn & Stiles, 1990). Lactococcin production was tested as described above with L. lactis IL1403 as the indicator strain in soft glucose-M17 agar (0.7% [wt/vol]).
[0142]Molecular cloning. Plasmids from E. coli were isolated by the method described by Birnboim and Doly (1979). With some modifications, the same method was used to isolate plasmids from L. gelidum and L. lactis. Cells were lysed at 37° C. in 50 mM Tris-HCl (pH 8)-10 mM EDTA containing 5 mg of lysozyme and 100 μg of mutanolysin (Sigma. St. Louis, Mo.) per ml for 20 min. Restriction endonucleases, the Klenow fragment of the E. coli DNA polymerase I, and T4 DNA ligase were obtained from Promega (Madison, Wis.). Bethesda Research Laboratories (Burlington, Ontario, Canada), Boehringer Mannheim (Dorval, Quebec, Canada), or New England Biolabs (Mississauga, Ontario, Canada), and used as recommended by the supplier. Cloning and DNA manipulations were performed as described by Sambrook et al. (Sambrook et al., 1989). Competent E. coli cells were transformed by the method of Mandel and Higa (Mandel & Higa, 1970). Transformation of L. lactis by electroporation was performed with a Bio-Rad gene pulser (Bio-Rad Laboratories. Richmond, Calif.) by the method of Holo and Nes (Holo & Nes 1989). For transformation of L. gelidum, cells were cultivated in APT broth supplemented with 3% (wt/vol) glycine. Exponentially growing cells were harvested, washed once with water and twice with ice-cold electroporation buffer (5 mM potassium phosphate buffer [pH 7], 3 mM MgCl2, in 1 M sucrose), and concentrated 100-fold in the same buffer. Subsequently, 50 μl of the cell suspension was mixed with 2 μl of plasmid DNA and held on ice for 5 min prior to electroporation. Immediately after electroporation, cells were diluted in 1 ml of APT containing 0.5M sucrose and 20 mM MgCl2 and incubated for 3 h at 25° C. Cells were plated on APT agar containing the appropriate antibiotic, and transform ants were visible after 3 to 4 days of incubation at 25° C.
[0143]Southern hybridization. For Southern hybridization, DNA was transferred to Hybond N (Amersham Canada Ltd., Oakville, Ontario, Canada), as described by Sambrook et al (Sambrook et al. 1989). Nonradioactive DNA probes were made with a random-primed labeling and detection kit (Boehringer Mannheim). Hybridization and immunological detection were performed as recommended by the supplier.
[0144]DNA sequencing. Nucleotide sequence analysis was performed by sequencing the DNA in both orientations by the dideoxy-chain method of Sanger et al. (Sanger et al., 1977). DNA was sequenced by Tag Dye Deoxy Cycle sequencing on an Applied Biosystems 373A DNA sequencer (Applied Biosystems, Foster City, Calif.), for sequencing, stepwise deletion derivatives of cloned DNA fragments were made with the Erase-a-Base system from Promega. In addition, a primer-walking strategy was used for nucleotide sequencing. Synthetic oligonucleotides were make with an Applied Biosystmens 391 PCR-Mate DNA synthesizer, Analysis of the nucleotide sequence was performed with a software program (DNASTAR, Inc., Madison, Wis.) The search for homology of the predicted amino acid sequences with those of proteins in the Swiss-Prot protein sequence database (release 30) was based on the FASTA algorithm of Pearson and Lipman (Pearson & Lipman, 1988).
[0145]Nucleotide sequence accession number. The entire nucleotide sequence is sequence number is presented in the paper (van Belkum and Stiles, 1995.) and some important sections of this gene are included in FIG. 5 (accession number L40491).
[0146]Cloning of the genes involved in the production of leucocin A. The 2.9-kb HpaII fragment containing the IcaAB operon was previously cloned in pUC118, resulting in pJH6.1F, and in the shuttle vector pNZ19 to form the plasmid pJH8.6L Attempts to transform Leuc. gelidum UAL187-13 with pJH8.6L were unsuccessful (Hastings et al. 1991). Therefore, a different vector was used to introduce the 2.9-kb fragment (FIG. 3) into strain UAL187-13. Using the multiple cloning site of pUC118, the 2.9-kb insert in plasmid pJH6.1F was excised by digestion with EcoRI and HindIII and cloned into the EcoRI-HindIII sites of pGKV210. The resulting plasmid, pMJ1, was used to transform strain UAL187-13. However, all of the transformants examined showed the presence of spontaneous deletion derivatives of pMJ1. When a 1-kb DraI-HpaI fragment containing IcaA and IcaB was subcloned from the 2.9-kb fragment into the SmaI site of pGKV210, the resulting recombinant plasmid pMJ3 (FIG. 3) formed a stable transformant in Leuc. gelidum UAL187-13. This transformant was immune to leucocin A but did not produce the bacteriocin. Apparently, additional information encoded on pLG7.6 is required for expression of the bacteriocin phenotype. The plasmid pMJ20 (FIG. 3) was constructed by introducing a frame shift mutation in IcaB, by filling in the unique ClaI site with Klenow DNA polymerase. Immunity was not observed in UAL187-13 carrying this plasmid, indicating that IcaB encodes the protein necessary for immunity to leucocin A.
[0147]Because additional genetic information is required for leucocin A production, regions adjacent to the IcaAB operon (FIG. 3) were cloned. It was previously reported that the producer strain UAL187-22 contains plasmids pLG7.6 and pLG9.2 of 7.6 and 9.2 MDa, respectively (Hastings and Stiles, 1991). Restriction analysis of plasmid DNA from UAL187-22 revealed that the actual sizes of pLG7.6 and pLG9.2 were 18 and 21 kb, respectively (data not shown). To localize the IcaAB genes, Southern analysis of plasmid DNA with the 1-kb DraI-HpaI fragment as probe detected a 12.3 kb HindIII fragment that was cloned into pUC118 to give pMJ4. Subclones of this fragment into a shuttle vector gave pMJ6 and pMJ10 (FIG. 3).
[0148]Plasmids pMJ6 and pMJ10 were transformed into L. lactis IL1403 and screened for leucocin A production. Transformants containing pMJ6 but not pMJ10 inhibited the growth of the indicator strain C. piscicola LV17C. However, the zones of inhibition of these transformants were clearly smaller than those formed by Leuc. gelidum 187-22 (FIG. 4A). L. lactis has natural resistance to leucocin (data not shown), therefore, the immunity phenotype to leucocin A could not be detected in L. lactis. Transformation of the bacteriocin-negative strain Leuc. gelidum UAL187-13 with pMJ6 resulted in several transformants containing deletion derivatives of pMJ6 that did not show production of the bacteriocin. A transformant of UAL187-13 which contained a plasmid with the expected size and restriction pattern of pMJ6 produced a zone of inhibition comparable to that formed by UAL187-22 (FIG. 4A). These results indicate that the genes responsible for the production of leucocin A are located on an 8-kb SacI-HindIII fragment of pLG7.6.
[0149]Nucleotide sequence analysis. Restriction analysis of pMJ6 revealed the location and orientation of the IcaAB operon on the 8-kb fragment (FIG. 3). The nucleotide sequence of the region upstream of the IcaAB operon was determined in both directions by the dideoxy-chain termination method. The nucleotide sequence in van Belkum and Stiles paper (1995) and partly in FIG. 5 shows a 4.3-kb segment located adjacent to the previously reported nucleotide sequence containing the IcaAB operon as well as part of this previously reported nucleotide sequence (Hastings et al, 1991). The start of an open reading frame (ORF) was identified 151 bases from, and on the opposite strand to, the start codon of IcaA. This ORF, designated IcaE, could encode a protein of 149 amino acids and is followed by a TAA stop codon. Immediately downstream of IcaE, a second ORF (IcaC) was found that contained 717 codons. The TAA stop codon of IcaC is immediately followed by an ORF that could encode a protein of 457 amino acids and has a TAG stop codon. All three ORFs are preceded by probable ribosomal binding sites. A possible promoter sequence was found upstream of IcaE (van Belkum and Stiles, 1995). However, a putative promotor sequence was also found within the IcaE gene. The sequence of its -35 (TGGACT) and -10 (TACAAT) regions closely resembles the consensus sequence of constitutive promoters found in other LAB (van de Guchte et al. 1992). The spacing of 16 and 19 bases between the -35 and -10 regions of these promotor sequences agrees with that of the usual spacing found in LAB promoters. An imperfect inverted repeat was found 6 bases downstream of the stop codon of IcaD which has the characteristics of a possible rho-independent terminator. No other ORFs and palindromic structures were found in either strand in this 4.3-kb region.
[0150]Similarity of LcaC and LcaD to bacterial transport proteins. The hydrophobicity plot of the putative LcaC protein revealed that the N-terminal region contains several hydrophobic domains. A homology search with other amino acid sequences in the SwissProt database showed that LcaC belongs to the HlyB-like family of ABC transporters (Blight and Holland 1990; Higgins 1992). These proteins contain a highly conserved ATP binding domain in the C-terminal region and several membrane spanning domains in the N-terminal half of the sequence. Homology comparison of HlyB, which is involved in the secretion of hemolysin A, and LcaC revealed that 58% of the amino acids were similar when conserved residue substitutions are included and 27% were identical. However, LcaC has a much higher degree of homology with several other ABC transporters, ComA,a protein from Streptococcus pneumoniae that is required for competence induction for genetic transformation (Hui and Morrison 1991) shares 59% identity and 82% similarity with LcaC. Comparison of LcaC with LcnC, a protein that is implicated in the secretion of the lactococcal bacteriocin lactococcin A and possibly in the secretion of lactococcins B and M (Stoddard et al. 1992, van Belkum 1994), and PedD, which is involved in the production of pediocin PA-1 (Marugg et al. 1992), revealed 81% similarity and 57% identity, and 73% similarity and 51% identity at the amino acid level, respectively. The databank search showed further that LcaC was very homologous to SapT (82% similarity, 57% identity) and SapT (81% similarity, 58% identity), proteins that are encoded by DNA sequences linked to sakacin A and P. respectively, The highest score however, was found with MesC, a protein encoded in a DNA sequence linked to mesentericin Y that was nearly identical to LcaC with 99% similarity and 98% identity.
[0151]Analysis of the hydropathy profile of LcaD showed a largely hydrophilic protein with the exception of a strong hydrophobic region at the N-terminus. Homology search in the data bank revealed that LcaD is similar to LcnD, another protein that is essential for lactococcin production in L. lactis (Stoddard et al. 1992). LcaD showed 35% identity and 54% similarity to LcnD. Additional homologues of LcaD that were found were SspE (62% similarity, 32% identity), SapE (65% similarity, 35% identity) and MesY (96% similarity, 87% identity) whose genes are linked to the genetic determinants for sakacin A, P and mesentericin Y, respectively. Two other proteins that showed similarity with the LcaD protein were ComB from S. pneumoniae (Hui et al. 1995) with 61% similarity and 29% identity and the ORF1 protein encoded by Lactobacillus johnsonii (Fremaux at al. 1993). The ORF1 protein has similarity with the N- and C-termini of LcaD (data not shown). The ORF1 protein is encoded by a 5' end truncated ORF of 540 bases located upstream of the bacteriocin operon responsible for lactacin F production (Fremaux at al. 1993).
[0152]The hydropathy profile of the putative protein LcaE showed a rather hydrophilic protein (data not shown). Search of the databank revealed only similarity of LcaE to MesE, a protein encoded by a DNA sequence linked to mesentericin Y production.
[0153]Functional and complementation analyses of LcaC and LcaD. To establish whether IcaE, IcaC and IcaD are essential for leucocin production, deletion and mutation derivatives of pMJ6 were constructed in E. coli (FIG. 3). Deletion of the BstEII-StuI fragment in IcaC resulted in plasmid pMJ17. Cells of Leuc. gelidum UAL187-13 containing this construct were immune to leucocin but bacteriocin was not produced. If we assume that the deletion had no polar effect on IcaD, the result would indicate that IcaC is involved in leucocin production. Two deletion constructs in IcaD were made, namely pMJ16 and pMJ18. In plasmid pMJ16 an EcoRV-BamHI fragment was deleted, whereas an EcoRV-HindIII fragment was deleted in pMJ18. A frame shift mutation in IcaE was made using the NsiI restriction site, giving plasmid pMJ26. Several attempts to introduce pMJ16, pMJ18 and pMJ26 into UAL187-13 were unsuccessful. When pMJ16 and pMJ17 were introduced into L. lactis IL1403, bacteriocin production was not detected. However, transformation of L. lactis IL1403 with pMJ26 did not affect leucocin production. These results indicate that LcaD, but not LcaE, is essential for leucocin production. Given the high degree of similarity between LcaC and LcaD of Leuc. gelidum and LcnC and LcnD of L. lactis, it was decided to determine whether the mutations in IcaC and IcaD could be complemented by the lactococcin A gene cluster in L. lactis IL1403 carrying pMB500 (Stoddard et al. 1992: van Belkum et al 1989). Plasmids pMJ3, pMJ16 and pMJ17 were used to transform IL1403(pMB500). Although the different plasmids contain the same replicon as pMB500, transformants can be selected for erythromycin resistance and pMB500 can be selectively retained by its own lactococcin production and resistance to kanamycin. However, leucocin production was not observed in these transformants, indicating that proper complementation by the lactococcin secretion apparatus was not possible. Only transformation of IL1403(pMB500) with pMJ6 resulted in a zone of inhibition (data not shown) In contrast, transformation of Leuc. gelidum UAL187-22 with plasmid pMB553, which carries the structural and immunity genes for lactococcin A showed a small zone of inhibition using L. lactis IL1403 as an indicator (FIG. 4B). Lactococcin A is only active against lactococci (Holo et al. 1991). No such zone of inhibition was observed when UAL187-13 was transformed with pMB553 Apparently, the leucocin secretion system is able to complement the IcnC and IcnD genes for the secretion of lactococcin A to a limited extent.
Example 6
Novel Bacteriocin Nucleotide and Amino Acid Sequences (Brochocin-C)
[0154]Brochothrix campestris ATCC 43754 isolated from soil as reported by Siragusa and Nettles Cutter ( ) to produce a broad spectrum bacteriocin. They did not characterize the bacteriocin and did not show that it is active against C. botulinum. The inventors demonstrated that this is a two-component bacteriocin that is chromosomally produced and that the translation products of the two genes responsible for activity and an immunity gene (FIGS. 13, 14, 15 and 16).
Biochemical and Genetic Characterization of Brochocin-C, a Bacteriocin Produced by Brochothrix campestris ATCC 43754
[0155]Brochocin-C is a strongly hydrophobic bacteriocin produced by Brochothrix campestris ATCC 43754 that is active against a broad spectrum of Gram-positive bacteria (Table 2 and 3). Crude brochocin-C was thermostable up to 121° C. for 15 min, pH stable from 2 to 9, and inactivated by proteolytic enzymes. The bacteriocin was purified, its nucleotide (FIG. 13, SEQUENCE no. 7) and amino acid sequence determined, and a site-specific 23-mer oligonucleotide probe was synthesized which hybridized to a 4.2-kb EcoRI genomic DNA fragment. The two components of the bacteriocin, brochocin A (nucleotide sequence herein referred to as SEQUENCE NO, 8 and amino acid sequence herein referred to as SEQUENCE NO. 9 in FIG. 14) and B (nucleotide sequence herein referred to as SEQUENCE NO. 10 and amino acid sequence herein referred to as SEQUENCE NO. 11 in FIG. 15), and their immunity gene (nucleotide sequence herein referred to as SEQUENCE NO. 12 and amino acid sequence herein referred to as SEQUENCE NO. 13 in FIG. 16) have been cloned separately and fused behind the signal peptide of divergicin A and produced in different hosts. Both Brochocin A and B contain a N-terminal leader peptide that gets cleaved after a double glycine motif to yield mature a bacteriocin and a leader peptide. This leader peptide bears significant homology to leader peptides of the class II bacteriocins of lactic acid bacteria.
Bacterial Strains and Plasmids
[0156]The bacterial strains and plasmids used in these studies are listed in Table 8, These include strains from the American Type Culture Collection (ATCC), Brochothrix strains from G. G. Greer isolated from meat at the Lacombe Research Centre and from our laboratory culture collection (UAL). All strains with the exception of Escherichia coli were stored at -70° C. in All Purpose Tween (APT) broth (Difco Laboratories Inc., Michigan) adjusted to pH 6.5, supplemented with 20% glycerol (v/v). Cultures for use in experimental studies were obtained by inoculation of frozen cells into APT broth at pH 6.5, and subcultured for two successive transfers at 25° C. after 18 to 24 h before being used. Growth experiments and (or) bacteriocin production from B. campestris were done in APT broth, Cooked Meat Medium (CMM; Ditco), or semi-defined casamino acids medium (CM), described by Hastings et al. (1991). CAA medium was used for the purification of the bacteriocin.
[0157]E. coli strains were stored at -70° C. in Luria-Bertani (LB) broth (Sambrook et al. 1989) supplemented with 40% glycerol (v/v). Inoculation of E. coli strains was done from frozen cultures into LB broth with ampicillin or erythromycin added to a final concentration of 200 mg/mL and propagated at 37° C. with shaking (250 rpm). Potential pUC118 recombinants were identified by the blue-white colour selection from growth on LB plates (1.5% w/v granulated agar) supplemented with ampicillin (200 mg/mL) and used with X-gal (5-bromo-4-chloro-
TABLE-US-00002 TABLE 8 Bacterial strains and plasmids used in this study Reference Organism Bacillus macerans ATCC 7048 ATCC B. cereus ATCC 14579 ATCC Brochothrix campestris ATCC 43754 ATCC B. campestris MT This study B. thermosphacta ATCC 11509 ATCC B. thermosphacta I41 UAL B. thermosphacta B1-B5, B7-B16 GGG (inclusive) Carnobacterium piscicola LV17 Shaw C. piscicola LV17A Ahn and Stiles (1990n) C. piscicola LV17B Ahn and Stiles (1990b) C. piscicola LV17C Ahn and Stiles (1990b) C. piscicola C2/8B Quadri et al. (1994) C. piscicola C2/8A Quadri et al. (1994) C. piscicola UAL26 Burns (1987) C. piscicola UAL26/8A Ahn and Stiles (1990b) C. piscicola UAL26/8B Quadri et al. (1994) C. divergens LV13 Shaw C. divergens 9/8A Quadri et al. (1994) C. divergens 9/8B Quadri et al. (1994) Clostridium bifermentans ATCC 19299 ATCC C. butyricum ATCC 8260 ATCC C. pasteurianum ATCC 6013 ATCC Enterococcus faecalis ATCC 19433 ATCC E. faecalis ATCC 7080 ATCC E. faecium ATCC 19434 ATCC E. durans ATCC 11576 ATCC Lactobacillus sake Lb706 Schillinger L. plantarum ATCC 4008 ATCC Lactococcus lactis ATCC 11454 ATCC L. lactis UAL 245 UAL L. lactis UAL 276 UAL Leuconostoc gelidum UAL 187 Hastings et al. (1991) L. gelidum UAL 187.13 Hastings et al. (1991) L. gelidum UAL 187.22 Hastings et al. (1991) L. mesenteroides ATCC 23386 ATCC L. mesenteroides Y105 Cenatiempo Listeria innocua ATCC 33090 ATCC L. monocytogenes Scott A ATCC L. monocytogenes I42 UAL L. monocytogenes ATCC 15313 ATCC Pediococcus acidilactici ATCC 8042 ATCC P. acidilactici PAC 1.0 Vandenbergh Staphylococcus aureus S6 HPB S. aureus S13 HPB Escherichia coli DH5-a BRL Laboratories Life Technologies Inc. E. coli AP4.7 (DH5-a containing pAP4.7) This study E. coli AP7.4-32 (DH5-a containing This study pAP7.4) E. coli AP4.6-8 (DH5-a containing This study pAP4.6) Plasmids pUC118 (3.2 kb; AmpR; lac Z') Vieira and Messing, (1982) pGKV210 (4.4 kb; EmR) van der Vossen et al. (1985) pAP4.7 (pUC118; 1.6 kb EcoRI-PstI This study fragment) pAP7.4 (pUC118; 4.2 kb EcoRI fragment) This study pAP4.6 (pUC118; 1.4 kb PstI fragment) This study pAP8.6 (pGKV210; 4.2 kb EcoRI This study fragment) ATCC = American Type Culture Collection BRL = Bethesda Research Laboratories Life Technologies Inc. UAL = University of Alberta Food Microbiology culture collection GGG = G. Gordon Greer (Lacombe Research Centre, Alberta, Canada) HPB = Health Protection Branch (Ottawa, Ontario, Canada) Shaw = B. G. Shaw (AFRC Institute of Food Research, Bristol, UK) Vandenbergh = P. A. Vandenbergh (Quest International, Sarasota, US) Burns = K. Burns (M. Sc. thesis, 1987, University of Alberta, Edmonton, AB) Schillinger = U. Schillinger (Institute of Hygiene and Toxicology, Federal Research Centre for Nutrition, Karlsruhe, Germany) Cenatiempo = Y. Cenatiempo (Institut de Biologie Moleculaire et d'Ingenierie G netique, Centre National de la Recherche Scientifique, Universite de Poitiers, France) 3-indolyl-β-D-galactopyranoside) and IPTG (isopropylthio-β-D-galactopyranoside) at final concentrations of each at 1.6 mg/mL. Erythromycin-resistant (EmR) transformants of E. coli with pGKV210 were selected on either LB or YT (yeast extract, tryptone; Difco) agar with erythromycin (200 mg/mL).
[0158]Bacteriocin assays. Antagonistic bacteriocin activity against different indicator strains was determined by direct or deferred inhibition assays (Ahn and Stiles, 1990b). For direct inhibition tests, broth cultures were inoculated onto APT agar (1.5%) plates using a Cathra replicator, allowed to dry, and immediately overlayered with 7.5 mL of molten APT agar (0.75% agar) at 45° C., seeded with a 1% inoculum of the indicator strain. For deferred inhibition tests, inoculated cells were incubated at 25° C. for 15 to 18 h before being overlayered with the indicator strain as described above. In both instances, overlayered plates were placed in an anaerobic jar (BBL) filled with a 10% CO2 and 90% N2 atmosphere and incubated at 25° C. for 16 to 24 h before analyzing the results.
[0159]Bacteriocin activity of B. campestris ATCC 43754 was detected or quantified by the spot-on-lawn method (Ahn and Stiles, 1990b) against C. piscicola LV17C, Doubling dilutions (1:1) of cell supernatants (heat treated at 65° C. for 30 min) were prepared in sterile water and 10 or 20 mL of each dilution was spotted onto an APT plate freshly overlayered with the indicator lawn. Activity was determined by taking the reciprocal of the highest dilution which showed a distinct zone of inhibition of the indicator strain, and expressed as arbitrary activity units (AU) per mL.
[0160]Stability of brochocin-C. The effects of pH and heat treatment on the activity of crude brochocin-C were determined. Cultures grown in APT broth were centrifuged (8000×g for 15 min) and the supernatant was adjusted to pH 2 through 9 using either 5 N HCl or NaOH. The pH-adjusted supernatant was heated at 65° C. for 30 minutes before doing a spot-on-lawn assay. Heat stability of brochocin-C in pH-adjusted supernatant was determined by heating at 65° C. for 30 min, 100° C. for 15 min, or 121° C. for 15 min before testing the residual activity of each sample and comparing it with the activity in unheated supernatant. To test the effect of organic solvents on the activity of brochocin-C, preparations of brochocin-C partially purified by butanol extraction (see below) were diluted in either 0.1% trifluoroacetic acid (TFA), 95% ethanol, 100% methanol, or 100% acetonitrile to give an initial concentration of 10 AU/mL. Tubes were incubated at 25 and 4° C. for selected time intervals before a 10 mL aliquot of each treatment was removed and spotted onto a freshly overlayered lawn of C. piscicola LV17C. Sizes of the zones of inhibition were measured and compared to that at time zero for each treatment.
[0161]Plasmid curing. Overnight cultures of B. campestris were inoculated at 107 cfu/mL into APT broth containing different concentrations of the curing agents novobiocin, acriflavin, and sodium-dodecyl sulphate (SOS) and grown at 25° C. for 24 h to determine the minimum inhibitory concentration of each.
[0162]The loss of bacteriocin production was determined from cultures grown in acriflavin by heating a 500 mL aliquot of the culture at 65° C. for 30 min and spotting it onto a lawn of C. piscicola LV17C. A negative control of sterile APT broth with the different concentrations of acriflavin was also spotted onto the indicator lawn to ensure that the acriflavin did not have an inhibitory effect on the indicator cells. Curing was attempted using a combination of acriflavin and elevated growth temperature (30° C.) using an inoculum of 104 cfu/mL in APT broth with the selected acriflavin concentration. The culture was grown until turbidity was detected and then it was subcultured an additional 1 to 6 times at inocula of 103 or 104 cfu/mL in APT broth containing the same acriflavin concentrations. Dilutions of these cultures were made in sterile 0.1% peptone (Difco) water and plated onto APT plates. Plates were incubated in anaerobic jars at 25° C. for 2 d and replica-plated onto two other APT plates, allowed to grow for 2 d before overlayering one plate with C. piscicola LV17C and the other with Listeria monocytogenes 33090. Colonies showing a loss of bacteriocin production with both of the indicator strains were inoculated into APT broth for small-scale plasmid isolation (see below). The wild-type strain was also included in the small-scale plasmid isolations to serve as a positive control.
[0163]Purification of brochocin-C. A flask containing five liters of sterile CAA medium (Hastings et al., 1991) with 2.5% glucose was inoculated with 2% of an overnight culture of B. campestris ATCC 43754, and grown at a constant pH of 6.7 with a Chemcadet (Cole-Parmer, Chicago, Ill.) by addition of filter-sterilized (0.22 mm) 2 M NaOH. Growth of the culture was monitored and stopped after 22 h of incubation at 25° C. Cells were removed from the culture broth by centrifugation at 8000×g for 20 min. The supernatant (approximately 5.5 liters) was extracted twice with 1.5 liters of n-butanol, The extract was diluted with water (approximately 11), concentrated on a vacuum evaporator at 35° C. and evaporated repeatedly to remove the last traces of butanol. The extract was suspended in water (approximately 150 mL), precipitated with 1.7 liters of cold (-60° C.) acetone and stored at 5° C. for 24 h. The precipitate was separated by centrifugation (10,000×g for 15 min), dissolved in 10 mL of 0.1% TFA and loaded onto a Sephadex G50 (Pharmacia) column (2.5×120 cm) that had been pre-equilibrated with 0.1% TFA. The column was washed with 0.1% TEA at a flow rate of approximately 0.6 mL/min. Absorbance of collected fractions was monitored at 220 nm. Fractions showing antimicrobial activity by spot-on-lawn assay were concentrated and lyophilized. The purity of the sample was confirmed by mass spectrum analysis and sodium-dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).
[0164]Sodium-dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Brochocin-C preparations were examined on 20% polyacrylamide gels with the buffer system described by Laemmli (1970) in 3M Tris-HCl. Electrophoresis was done at 20 mA constant current for 3 h. After electrophoresis, gels were fixed in 50% methanol, 10% acetic acid for 1 h and stained with Coomassie blue (Bio-Rad) or assayed for antimicrobial activity by overlayering with C. piscicola LV17C as the indicator strain by the method of Barefoot and Klaenhammer (1983).
[0165]Inhibition by brochocin-C. Partially purified preparations of brochocin-C were obtained by butanol extraction of supernatant fluids of an overnight culture of B. campestris ATCC 43754 grown in CAA medium with constant pH regulation at 6.7. All traces of butanol were removed by rotary evaporation. The partially purified bacteriocin was added to APT broth (pH 6.5) and to phosphate buffer (50 mM, pH 7.0) containing 106 cfu per mL of C. piscicola LV17C. The bacteriocin was added to give a final concentration of 100 AU/mL and the tubes were incubated at 25° C. Viable counts were determined by enumeration on APT agar at selected time intervals and cell lysis was checked by monitoring the optical density at 600 nm. For enumeration, cultures grown in APT broth and phosphate buffer were diluted in sterile 0.1% peptone water and 50 mM phosphate buffer (pH 7.0) respectively. Growth of the indicator strain without addition of bacteriocin was also included as a control.
Determination of the Amino Acid Sequence and the Amino Acid Content of Brochocin-C.
[0166]The N-terminal amino acid sequence of brochocin-C was determined by the Alberta Peptide Institute (API; University of Alberta, Edmonton, AB) by automated Edman degradation with a gas-phase sequencer (Applied Biosystems model 470A) with on-line phenylthiohydantoin-derivative identification by HPLC (Applied Biosystems model 120A chromatograph). They also determined the amino acid content of purified brochocin-C by derivitization with phenylisothiocyanate on an Applied Biosystems 420A derivatizer and separation with a C18 column by HPLC (Applied Biosystems model 130A chromatograph).
[0167]The mass spectrum of purified brochocin-C was measured by plasma desorption and fast atom bombardment (FAB).
[0168]DNA isolation, manipulation, and hybridization. Small-scale plasmid isolation of B. campestris was done by previously established methods (Ahn and Stiles, 1990b). Cells from an overnight culture grown in APT broth were recovered by centrifugation at 14,000×g for 5 min, washed once with cold 0.5% NaCl (500 mL), and resuspended in 100 mL of solution A (25% sucrose, 50 mM Tris-HCl, 5 mM EDTA, pH 8.0) containing lysozyme (10 mg/mL). After incubation for 1 h at 37° C., 200 mL of solution C (0.9% glucose, 3% SDS, 50 mM Tris-HCl, 5 mM EDTA, pH 8.0) containing 0.2 N NaOH was added and the tubes were gently inverted several times until the cell lysate cleared. Solutions of 2 M Tris-HCl, pH 7.0 (50 mL) and 5 M NaCl (70 mL) were added to the tubes and mixed by inversion. The DNA was extracted once with 3% NaCl-saturated phenol/chloroform and once with chloroform/isoamyl-alcohol (241), before overnight precipitation at -20° C. with 95% ethanol. Large-scale preparation of plasmid DNA was done by scaling up (100×) of the small-scale method using cells from 750 mL of an overnight culture grown in APT broth and purified by CsCl ethidium bromide density gradient ultracentrifugation. The CsCl salt was removed by dialysis in 10 mM Tris-HCl, 1 mM EDTA (TE buffer, pH 8.0; Sambrook et al., 1989), Chromosomal DNA preparation of B. campestris was done as described by Quadri et al. (1994), but was resuspended in a final volume of 1 mL TE buffer. An equal volume of chloroform was added to preserve the DNA from bacterial contamination and to remove any residual proteins.
[0169]Plasmid and genomic DNA from B. campestris was digested with restriction enzymes compatible with the multiple cloning site (MCS) of pUC118 (Vieira and Messing, 1982). Restriction endonucleases from Boehringer-Mannheim (Dorval, Quebec, Canada), Promega (Madison, Wis.; Burlington, Ontario, Canada), and New England Biolabs (Mississauga, Ontario, Canada) were used as recommended by the suppliers. DNA fragments were separated in either 0.65% 40 mM Tris-acetate/1 mM EDTA (TAE) or 0.7% 90 mM Tris-borate/2 mM EDTA (TBE) agarose gels run at 8.5V/cm and blotted by the method of Southern (1975) onto Hybond N (Amersham Corp.) nylon membranes. Molecular weights of fragments were determined by multiple regression analysis based on mobility standards of EcoRI HindIII digests of bacteriophage lambda (Promega).
[0170]For colony blots, Hybond N membrane was placed on top of the colonies, lifted off the plate, incubated for 6 to 8 h on a new LB-ampicillin plate, where necessary, to allow growth of the cells, and the colonies were lysed on the membrane in situ.
[0171]A degenerate 23-mer oligonucleotide probe, (APO-1; 5'-AAAGATATTGG(ATC)AAAGG(ATC)ATTGG-3') based on residues 8 to 15 of the amino acid sequence, was used to locate the brochocin-C structural gene (brcA) in both Southern and colony blot hybridizations. Oligonucleotides based upon derived nucleotide sequences were synthesized as needed (Department of Biological Sciences, University of Alberta, Edmonton, AB) on an Applied Biosystems 391 PCR Mate synthesizer, quantified, and used for hybridizations or as primers for nucleotide sequencing without further purification. DNA probes were radioactively end-labelled with [gamma-32P]ATP (Amersham) with T4 polynucleotide kinase (PNK; Promega) or nonradioactively by random-primed labelling with digoxigenin-dUTP (Boehringer-Mannheim). A reaction volume of 10 mL of the labelled oligonucleotide mixture (6 mL distilled water, 1 mL 10×PNK buffer, 1 mL [1 pmol] APO-1 probe, 1 mL PNK, 1 mL [gamma-32P] ATP) was added for every 3 mL of hybridization solution. The mixture was purified through a Sephadex G50 column to remove unincorporated ATP or added directly to the hybridization solution. Hybridizations were done at 37° C. overnight in hybridization solution containing 6×SSPE buffer, 5×Denhardt's Reagent (Sambrook et al., 1989) and 0.5% (v/v) SDS. After hybridization, two washes were done sequentially (25° C. for 25 min, 39° C. for 15 min) in 2×SSPE buffer, 0.1% SOS. Where necessary, probes were stripped off membranes by washing at 95° C. for 2 min in 0.5% SOS and rehybridized, Autoradiograms were exposed 24 to 48 h before developing in a Fuji film processor.
[0172]Isolation of small-scale plasmid DNA from E. coli strains was performed by the lysis by boiling method and large-scale DNA preparation by alkaline lysis (Sambrook et al., 1989). Large-scale plasmid DNA was purified by equilibrium centrifugation at 49 000 rpm (Ti 70.1 rotor) for 20 h in a CsCl-ethidium bromide gradient and dialyzed in TE buffer.
[0173]Cloning of the brcA gene. Genomic DNA was digested to completion with EcoRI. Fragments of 4.2 kb corresponding to the hybridization signal identified with APO-1 were excised from the gel and placed in 6,000 to 8,000 molecular weight cut-off Spectrapor (Los Angeles, Calif.) dialysis tubing. The DNA was electroeluted from the gel and into the tubing by electrophoresis at 200V for 20 min in 0.5% TBE buffer, The DNA was purified by extracting once with phenol/chloroform:isoamyl alcohol (24:1), once with chloroform; isoamyl alcohol, and precipitated with 2 volumes of 95% ethanol and one-tenth volume of 3 M sodium acetate (pH 5.2). The resulting fragments were cloned into the EcoRI site of the MCS in pUC118 using T4 DNA ligase (Promega) at 25° C. for 3 h in ligation buffer without polyethylene glycol and dithiothreitol. Colonies were screened by a-complementation (Vieira and Messing, 1982). Colony blots were done to discriminate the white colonies for the correct DNA insert. Small-scale plasmid isolations were done on presumptive positive clones and the plasmids were digested with TaqI. The clones were grouped into classes based on similarities in their restriction patterns. Clones were digested with EcoRI, blotted by the method of Southern (1975), and hybridized with APO-1 to confirm the presence of the brcA gene. The plasmid identified to carry the correct 4.2 kb insert in pUC118 was named pAP7.4. A smaller PstI fragment of 1.4 kb was further identified from this plasmid to hybridize to APO-1 and this was subcloned into pUC118 (pAP4.6).
[0174]Nucleotide sequencing of plasmid DNA. The plasmid pAP4.6 served as the initial template DNA for nucleotide sequencing by Tag DyeDeoxy Cycle sequencing (Department of Biochemistry, University of Alberta, Edmonton, AB) on an Applied Biosystems 373A sequencer using the universal forward and reverse primers of pUC118. Site-specific 18-mer primers based on newly sequenced DNA were synthesized for further sequencing. The recombinant plasmid, pAP7.4, was used as the template DNA in subsequent sequencing runs to deduce the complete sequence of the structural gene (brcA), the regions flanking the structural gene, and for sequencing of the complementary strand.
[0175]Heterologous and homologous expression studies of brochocin-C. The 4.2 kb insert in pAP7.4 was subcloned into the EcoRI site of the shuttle vector pGKV210 to create the recombinant plasmid pAP8.6. This plasmid was subsequently used to transform selected strains by electroporation with a Gene-Pulser (Bio-Rad Laboratories Canada Ltd., Mississauga, ON) at 25 mFD and 200 ohms resistance.
TABLE-US-00003 TABLE 9 Inhibitory spectrum of Brochothrix campestris ATCC 43754 determined by direct and deferred antagonism on APT agar Indicator Direct Deferred Bacillus macerans ATCC 7048 ff ff B. cereus ATCC 14579 ++ +++ Brochothrix campestris ATCC 43754 ff ff B. thermosphacta B1 ++ ++++ B. thermosphacta B2 ++ ++++ B. thermosphacta B3 ++ ++++ B. thermosphacta B4 ++ ++++ B. thermosphacta B5 ++ ++++ B. thermosphacta B7 ++ ++++ B. thermosphacta B8 ++ ++++ B. thermosphacta B9 ++ ++++ B. thermosphacta B10 ++ ++++ B. thermosphacta B11 ++ ++++ B. thermosphacta B12 + ++++ B. thermosphacta B13 ++ ++++ B. thermosphacta B14 + ++++ B. thermosphacta B15 ++ ++++ B. thermosphacta B16 + ++++ B. thermosphacta L90 + ++++ B. thermosphacta NF4 ++ ++++ B. thermosphacta C420 + ++++ B. thermosphacta I41 ++ +++ Carnobacterium piscicola LV17 ++++ ++++ C. piscicola LV17A ++++ ++++ C. piscicola LV17B ++++ ++++ C. piscicola LV17C ++++ ++++ C. piscicola C2/8B ++++ ++++ C. piscicola C2/8A ++++ ++++ C. piscicola UAL26 +++ ++++ C. piscicola UAL26/8A +++ ++++ C. piscicola UAL26/8B ++++ ++++ C. divergens LV13 +++ ++++ C. divergens 9/8A +++ ++++ C. divergens 9/8B +++ ++++ Clostridium bifermentans ATCC 19299 +++ ++++ C. butyricum ATCC 8260 ND +++ C. pasteurianum ATCC 6013 ND +++ Enterococcus faecalis ATCC 19433 +++ ++++ E. faecalis ATCC 7080 +++ +++ E. faecium ATCC 19434 +++ ++++ E. durans ATCC 11576 +++ ++++ Lactobacillus sake Lb706 +++ ++++ L. plantarum ATCC 4008 ff ff Lactococcus lactis ATCC 11454 ff + L. lactis UAL 245 + + L. lactis UAL 276 ND + Leuconostoc gelidum UAL 187 ++ +++ L. gelidum UAL 187.13 + ++ L. gelidum UAL 187.22 ++ +++ L. mesenteroides ATCC 23386 ff ff L. mesenteroides Y105 ff ++ Listeria innocua ATCC 33090 ++ +++ L. monocytogenes Scott A +++ ++++ L. monocytogenes UAL 42 ++ +++ L. monocytogenes ATCC 15313 + ++ Pediococcus acidilactici ATCC 8042 + ++ Staphylococcus aureus S6 ++ ++ S. aureus S13 ++++ ++++ ++++ = zone of inhibition_20 mm +++ = zone of inhibition 15 to 19 mm ++ = zone of inhibition 10 to 14 mm + = zone of inhibition 5 to 9 mm f = no inhibition zone ND = not determined
Example 7
Novel Bacteriocin Nucleotide and Amino Acid Sequences (Enterocin 900)
[0176]Enterococcus faecium 900 produces a chromosomally mediated broad spectrum bacteriocin The forward operon is included in FIG. 17 herein referred to as SEQUENCE NO. 14 and the reverse Operon is included in FIG. 18 herein referred to as SEQUENCE 15. The bacteriocin consists of 71 amino acids herein referred to as SEQUENCE NUMBER 17 and its nucleotide sequence is herein referred to as SEQUENCE NO. 16. This bacteriocin has activity against other strains of Enterococcus species as well as many other organisms as indicated in Tables 3 and 4.
[0177]Purification of Enterocin 900. For purification of the Enterococcus faecium BFE 900 bacteriocin the culture was grown in 2.5 I APT broth for 18 h at 30iC. The culture was heated at 70iC for 35 min to inactivate proteases and centrifuged at 10 000 rpm for 40 min. The supernatant was termed fraction I. Fraction I (2.5 I) was loaded onto an amberlite XAD-8 (Pharmacia) hydrophobic interaction chromatography column and the column was washed with 3 I of 0.05% trifluoroacetic acid (TFA), and 2 I of 20% ethanol (EtOH)+005% TFA. Bacteriocin was eluted with 2 I of 40% EtOH+0.05% TEA. The pH of the eluate was adjusted to pH 5.0 and the eluate was reduced to 47 ml at 37iC in a rotary evaporator under vacuum. The resulting fraction (fraction II) was pH adjusted (pH 5.0) and loaded loaded onto a carboxymethylcellulose CM22 (Whatman Biochemicals, Maidstone, Kent, England) cation exchange column (34 cm, 1.3 cm I.D.) that was preequilibrated with 20 mM sodium acetate buffer pH 5.0 (SAB). The column was washed with 100 ml SAB and 60 ml volumes of SAB with 40, 80, and 120 mM NaCl added. Bacteriocin was eluted with 60 ml SAB with 200 mM NaCl added. The bacteriocin containing eluate was loaded onto a Sep Pak C18 reverse phase column (Waters) which was pre-equilibrated according to manufacturers instructions. The column was washed with 20 ml of distilled water and 10 ml of 40% ethanol. Bacteriocin was eluted with 10 ml of 70% ethanol, frozen overnight at -80iC and subsequently freeze dried. The freeze dried protein was resuspended in 1.5 ml 0.05% TFA (fraction III) and purified using a Beckman System Gold HPLC. For HPLC purification 100 μl aliquots were applied to a C18 reverse phase column (Waters Delta-Pak; 8×100 mm; 15 μm particle size; 300 (30 nm) pore size; flow rate 1.0 ml/min; mobile phase, 0.05% TFA [A] and 95% ethanol in 0.05% TFA [B]). Bacteriocin was eluted by a gradient method (first 40% to 60% solvent B in 7 min and then 60 to 70% solvent B in 10 min). Fractions were monitored for A218 and for activity against the indicator strain. The purity of the fraction was determined by tricine gel electrophoresis.
[0178]Bacteriocin activity of fractions I, II and III was determined by the critical dilution method described in section 2.1.1, using Lactobacillus sake DSM 20017 as indicator organism, Protein concentration of these fractions was determined by the dye binding method of Bradford (Bradford, 1976).
[0179]Protein sequencing. Protein sequencing was performed by Edman degradation on an automated sequencer. To determine whether the structural enterocin gene indeed resides on the chromosome an oligonucleotide probe based on the first 11 amino acids of enterocin 900 was constructed and used to probe chromosomal DNA. The probe CF01 consisted of the following 32 nucleotides: GAA AAT GAT CAT (C/A)G(T/A) ATG CC(T/A)AAT GM CT(T/A) AA and had a TM of 82iC. Chromosomal DNA was isolated by the methods of Quadri et al., 1994 and digested with the restriction enzymes EcoRI. PstI and HindIII before running on a 0.7% agarose gel. DNA was transferred to hybond membrane by Southern blotting as described in Sambrook et al. 1989 The probe CF01 was end labelled with 32P-[γ-ATP] and hybridized to the DNA as described by Sambrook et al. 1989. The probe hybridized to a 2.2 kbp HindIII fragment and a 6.5 kbp EcoRI/PstI fragment (results not shown).
[0180]The 2.2 kbp HindIII fragment was cloned into pUC118 contained in E. coli DH5α and sequenced. The nucleotide sequence analysis was performed by sequencing the DNA in both orientations by dideoxy-chain method of Sanger and associates (1977). DNA was sequenced by Tag Dye Deoxy Cycle sequencing on an Applied Biosystems DNA sequencer (Applied Biosystem, Foster City, Calif.).
Example 8
A Food-Grade Plasmid pCD3.4
[0181]Large scale plasmid preparation from C. divergens LV13 was done as previously described for C. piscicola LV17A (Worobo et al 1994). Other DNA manipulations were based on those described by Sambrook et al. (1989). Pfu DNA polymerase (Stratagene, LaJolla, Calif.), restriction endonucleases and 14 DNA ligase were obtained from Promega (Madison, Wis.), Bethesda Research Laboratories (Burlington, ON), Boehringer Mannheim (Dorval, PQ), New England Biolabs (Mississauga, ON) and used according to the suppliers recommended procedures. Step-wise deletion derivatives for sequencing were prepared using the Erase-a-Base® system (Promega) and DNA fragment recovery was done using Geneclean II® (Bio 101 Inc., LaJolla, Calif.). Oligonucleotides prepared as sequencing and PCR primers were synthesized on an Applied Biosystems (model 391) PCR Mate synthesizer. Double stranded DNA was sequenced by Tag DyeDeoxy Cycle sequencing on an Applied Biosystems (model 373A) sequencer.
[0182]The nucleotide sequence is herein referred to as SEQUENCE NO. 6. From the nucleotide sequence and the restriction maps (FIG. 12) someone skilled in the art can identify a variety of suitable locations for inserting other genes without undue experimentation. This plasmid can be use to insert genes for use in probiotics, meat, milk products, food or food products. The bacteriocin Divergicin A was derived from this plasmid (Worobo et al. 1995) and the signal peptide nucleotide sequence is used in other sections of this application is referred to as SEQUENCE NO 5 (FIG. 11) and the corresponding amino acid sequence is SEQUENCE NO. 1b (FIG. 6).
Example 9
Methods for Testing Organisms for Preservation of Meat and Organisms that Will Preserve Meat
[0183]Bacterial Cultures and Identification of Lb. sake 1218.
[0184]The lactic acid bacteria used in this study are listed in Table 1. Lb. sake 1218 is a sulfide-producing LAB isolated from modified atmosphere packaged pork stored at -1° C. (McMullen and Stiles, 1993). The strain was initially identified by McMullen and Stiles (McMullen and Stiles, 1993) using standard techniques (Montel et al., 1991; Schillinger and Lucke, 1987), and its identity was confirmed in this study with the following biochemical and cultural tests: production of slime from sucrose; ability to grow on acetate agar (Cavett, 1963); reduction of tetrazolium (Wilkinson and Jones, 1977); final pH in La-broth (Reuter, 1970; Shaw and Harding, 1984); presence or absence of meso-diaminopimelic acid (Kandler and Weiss, 1986); sugar-fermentation pattern (Shaw and Harding, 1985); and lactic acid isomer determination by an enzymatic-UV method (Boehringer Mannheim, 1987). Lb. sake 1218 was tested for bacteriocinogenic activity against all of the Leuc. gelidum strains by direct and deferred inhibition tests (Ahn and Stiles, 1990a; Ahn and Stiles, 1990b).
[0185]Inhibition of Lb. sake 1218 by Leuc. gelidum strains in APT broth. Growth rates of Leuc. gelidum UAL187 and its variants were determined in pure culture at 2 and 25° C. in APT broth (Difco Laboratories Inc., Detroit, Mich.) containing 2% glucose, or in modified APT broth (mAPT) made according to Difco (Difco Manual, 1984) but containing 0.05 or 0.1% glucose inoculated at 4.2 to 4.3 log CFU ml-1. Initial pH of APT broth was adjusted to 5, 6 or 6.5. Competitive growth studies of Leuc. gelidum UAL187, UAL187-22 or UAL187-13 with Lb. sake 1218 were done in mAPT containing 0.1% glucose and initial pH adjusted to 5.6.
[0186]Inocula for all experiments were grown in APT broth at 25° C. for 18 h. Cells were washed three times by centrifugation at 16,000×g, washed with sterile, 0.1% peptone water and resuspended in peptone water at the desired cell density. Samples for bacterial enumeration were diluted in 0.1% peptone water and surface streaked onto M5 agar, consisting of (grams per liter) tryptone, 10; yeast extract, 5; fructose, 2.5; KH2 PO4 2.5; L-cysteine HCl, 0.5; MgSO4.7H2O, 0.2; MnSO4.H2O, 0.05; calcium pantothenate, 0.01; agar, 20; and (ml per liter) Tween 80, 1; and bromocresol green (0.1 g in 30 ml of 0.01 N NaOH), 20 (Z niga et al., 1993). This medium differentiated the heterofermentative Leuc. gelidum colonies (white color) from homofermentative Lb. sake 1218 colonies (blue color). Representative colonies were checked by their phenotypic characteristics to determine the reliability of the differentiation (see below). MRS (Difco)-sorbic acid agar (Anon, 1987) was used for selective enumeration of Lb. sake 1218. Plates were incubated at 25° C. for 3 days. pH was determined in all samples. Antimicrobial activity of leucocin A in the supernatant was assayed by the spot-on-lawn method (Ahn and Stiles, 1990a; Ahn and Stiles, 1990b) with Carnobacterium divergens LV13 as the indicator strain, All experiments were done in duplicate.
[0187]Inoculation of beef samples. Sterile, lean slices of beef (surface area 20 cm2) were excised aseptically from normal pH, longissimus dorsi muscle as described by Greer and Jones (Greer and Jones, 1991). Beef slices were suspended from sterile clips and immersed for 15 sec in a bacterial suspension containing 105 CFU ml-1 for Leuc. gelidum and 103 CFU ml-1 for Lb. sake, and allowed to air dry at 25° C. for 15 min. This gave an inoculum of approximately 104 CFU cm-2 for Leuc. gelidum and 102 CFU cm-2 for Lb. sake. An equal number of beef slices was immersed in sterile, 0.1% peptone water for use as controls.
[0188]Beef storage. Three inoculated beef slices from each sample were placed in sterile Stomacher bags (Seward Medical, U.K), enclosed in gas impermeable foil laminate bags (Printpac-UEB, Auckland, New Zealand) and vacuum packaged using a Captron III Packaging System (RMF, Grandview, Mo.). Vacuum packaged beef samples were stored at 2° C. for 8 weeks and samples were removed for analysis after 0, 1, 2, 3, 4, 4.5, 5, 6 and 8 weeks of storage. Three or four independent trials were done for microbiological content and sensory analysis of each combination of bacterial inocula, except for meat inoculated with pure cultures of Leuc. gelidum UAL187, UAL187-22 and UAL187-13, for which only one trial was done.
[0189]Bacterial sampling and determination of antimicrobial activity on meat. At each sampling time, three beef slices from one package were homogenized separately in a Colworth Stomacher 400 (Baxter Diagnostics Corp., Canlab Division, Edmonton, AB Canada) in 90 ml of sterile 0.1% peptone water. Samples were diluted and surface plated onto M5 or MRS-sorbic acid agar and incubated at 25° C. for 3 days. The reliability of detection of the Leuconostoc strain was checked by the ability to produce slime on APT agar containing 2% sucrose. An average of 8 colonies of each of the Leuc. gelidum variants was picked from M5 agar plates from meat samples analyzed after 3 or 8 weeks of storage. These colonies were grown in APT broth, and examined for purity by carbohydrate fermentation patterns (Shaw and Harding, 1985), some were also examined for plasmid profiles (Ahn and Stiles, 1990b) and for bacteriocin production by overlayering with the indicator strain. After enumeration, M5 plates were overlayered with soft APT agar (0.75% agar) containing 1% of an overnight culture of C. divergens LV13 or Lb. sake 1218 to determine antimicrobial activity by the deferred inhibition test.
[0190]Production of leucocin A during growth of the producer strain on beef was determined by a modification of the procedure described by Ruiz-Barba et al. (Ruiz-Barba et al., 1994). One beef slice was homogenized in 90 ml of 0.1% peptone water, heated in a boiling water bath for 15 min, cooled rapidly on ice and centrifuged at 8,000×g for 15 min. Ammonium sulfate (Fisher Scientific; Fair Lawn, N.J.) was added to 70% saturation, stirred at 4° C. overnight and centrifuged at 20.000×g for 1 h at 0.5° C. The precipitate was resuspended in 1.5 ml of sodium phosphate buffer (50 mM, pH 7.0) and activity was determined by the spot-on-lawn method (Ahn and Stiles, 1990a; Ahn and Stiles, 1990b) using C. divergens LV13 as indicator. The presence of bacteriocin was confirmed by adding 10 μl of Pronase E (1 mg ml-1; Sigma Chemical Co., St. Louis, Mo.) to appropriate samples of supernatant.
[0191]Sensitivity of Lb. sake 1218 to leucocin A. After 8 weeks of storage under vacuum at 2° C., one of the beef slices from each inoculum type was homogenized in 90 ml of sterile, 0.1% peptone water. From each sample, 75 μl of liquid was withdrawn and mixed with 7.5 ml of "soft" MRS-sorbic acid agar (0.75% agar) and plated on MRS-sorbic acid agar (1.5% agar) for selective growth of Lb. sake 1218. Supernatants of APT broth cultures of Leuc. gelidum UAL187 or UAL187-13 grown at 25° C. for 18 h were adjusted to pH 6.5 with 1 N NaOH and heated at 65° C. for 30 min. From these preparations, 20 μl of appropriate two-fold dilutions was spotted onto the Lb. sake 1218 indicator lawns to be tested for sensitivity to leucocin A. Plates were incubated anaerobically at 25° C. overnight and observed for zones of inhibition.
[0192]Sensory assessment of beef samples. Qualitative analysis of odor acceptability, based on detection of sulfur odors in vacuum packed beef samples, was done as described by McMullen and Stiles (McMullen and Stiles, 1994). An experienced five-member panel was used. Each packaged sample containing three slices of beef was filled with 200 ml helium, and 5 ml of headspace gas was withdrawn for sensory analysis through a "sticky nickel" (Mocon Modern Controls Inc., Minneapolis, Minn.) sampling port with a gas tight syringe (SGE, Mandel Scientific, Guelph, Ontario) equipped with a button lock. Acceptability was judged by absence or presence of sulfur odor. A sample was deemed spoiled if 50% or more of the panelists rejected the sample because of a sulfur odor.
[0193]Characterization and identification of Lb. sake 1218. The Gram-positive, rod-shaped, catalase- and oxidase-negative strain 1218 was classified as Lb. sake based on its following characteristics: no gas from glucose; growth on acetate agar; degradation of arginine: unable to reduce tetrazolium; absence of meso-diaminopimelic acid in the cell wall, production of D- and L-lactic acid isomers; final pH<4.15 in La-broth; and the following carbohydrate fermentation pattern: amygdalin (-), arabinose (+), cellobiose (-), fructose (+), glucose (+), inulin (-), inositol (-), lactose (-), maltose (-), mannitol (-), mannose (+), melezitose (-), melibiose (+), raffinose (-), ribose (+), salicin (-) and sucrose (+). No acids were produced from glycerol or pyruvate. The organism grew in the presence of 6.5% NaCl but not at 45° C. Preliminary experiments showed that Lb. sake 1218 produced strong sulfurous off odors when inoculated onto vacuum packaged beef, but not on beef stored under aerobic conditions. Lb. sake 1218 was not found to be bacteriocinogenic against any of the Leuc. gelidum variants when tested by deferred and spot-on-lawn techniques, M5 agar did not give a reliable differentiation between the test strains. More reliable information was obtained from the counts on MRS-sorbic acid agar to enumerate Lb. sake 1218.
[0194]Inhibition of Lb. sake 1218 by Leuc. gelidum strains in APT broth. At 25° C. the three isogenic variants of Leuc. gelidum UAL187 had identical doubling times of 3.85 h when grown as pure cultures or in combination with Lb. sake 1218. In mAPT with initial glucose concentrations of 0.05, 0.1 or 2% or initial pH values of 5.6 or 6.5 of the growth medium did not affect the growth rate of the Leuc. gelidum variants. At 2° C. the initial doubling times for Leuc. gelidum UAL187, UAL187-13 and UAL187-22 were similar, averaging 1.75 days; but after four to eight days of incubation the doubling time of Leuc. gelidum UAL187-22 increased to 315 days. This change in growth rate could not be attributed to glucose concentration or pH of the growth medium or whether Leuc. gelidum UAL187-22 was grown as pure culture or together with Lb. sake 1218.
[0195]Lb. sake 1218 grown in APT broth in mixed culture with Leuc. gelidum UAL187 or UAL187-22 at 25° C. was inhibited at the time (17 h) that antimicrobial activity was detected in the supernatant (FIG. 20). Growth of Lb. sake 1218 resumed after 21 h, coinciding with a decrease in antimicrobial activity, and reached a population of approximately 107 CFU ml-1 after extended incubation of 100 h at 25° C. (FIG. 20). Lb. sake 1218 grew rapidly in pure culture (results not shown) or in mixed culture with Leuc. gelidum UAL187-13 (FIG. 20). Antimicrobial activity was not detected in these cultures.
[0196]Growth of Lb. sake 1218 in APT broth at 2° C. was inhibited in mixed culture with Leuc. gelidum UAL187 after 8 d of incubation, coinciding with the time that antimicrobial activity was first detected in the supernatant (FIG. 21). The cell density of Lb. sake 1218 decreased to the minimum detection limit after 12 d of incubation, but growth resumed after approximately 30 to 35 d of storage (FIG. 21). Lb. sake 1218 grew rapidly at 2° C. in pure culture (results not shown) and in mixed culture with Leuc. gelidum UAL187-13 (FIG. 21), Antimicrobial activity was not detected in these cultures. Lb. sake 1218 in mixed culture with Leuc. gelidum UAL187-22 grew actively for the first 15 d of incubation; after which a rapid decline in cell counts of Lb. sake 1218 was observed, coinciding with the detection of antimicrobial activity (FIG. 21). After 22 days of incubation there was a loss of antimicrobial activity and Lb. sake 1218 resumed its growth. pH did not change more than 0.2 units from the initial value in any of the experiments done with mAPT.
[0197]Growth of bacteria and detection of bacteriocin on vacuum packaged beef. The data shown in FIG. 22 illustrate the growth of the three isogenic strains of Leuc. gelidum UAL187 inoculated as pure cultures or co-inoculated with Lb. sake 1218 on beef stored under vacuum at 2° C. Leuc. gelidum UAL187 and UAL187-13 again exhibited identical growth rates, while Leuc. gelidum UAL187-22 grew at a considerably slower rate. Growth and survival of Lb. sake 1218 alone or in mixed culture with the isogenic variants of Leuc. gelidum is shown in FIG. 23. Lb. sake 1218 grew rapidly as a pure culture on vacuum packaged beef producing a sulfurous odor within three weeks at Pronounced inhibition of Lb. sake 1218 was observed in three out of four trials in which Lb. sake 1218 was co-inoculated with Leuc. gelidum UAL187 on meat. There was a delay of growth for 5 weeks with a 4 log lower count of Lb. sake 1218 after 8 weeks of incubation. In a fourth trial, there was a delay of two weeks before initiation of growth of Lb. sake 1218 and relatively low maximum count of 105 to 106 log CFU cm-2 was observed. These data were not included in the means calculated for FIG. 23. Similar growth of Lb. sake 1218 but with approximately one log lower maximum count than in pure culture was observed when Lb. sake 1218 was co-inoculated with Leuc. gelidum UAL187-13. A slight delay in initiation of growth and a reduction of 0.5 to 1 log units in maximum count was observed when Lb. sake 1218 was co-inoculated with Leuc. gelidum UAL187-22. Comparison with pure culture studies indicated that growth of Leuc. gelidum UAL187 and its isogenic variants was not affected by the presence of Lb. sake 1218 in any trial. The identity of each variant of Leuc. gelidum was confirmed by comparison of plasmid profiles, carbohydrate fermentation patterns and slime production of colonies isolated after eight weeks of storage from each experiment.
[0198]The possibility that Lb. sake 1218 developed resistance to leucocin A during the trial with extended growth in the presence of Leuc. gelidum UAL187 was tested. Spot-on-lawn tests of isolates of Lb. sake 1218 were done after 8 weeks of storage. Results showed that Lb. sake 1218 was sensitive to 800 AU ml-1 in heat treated supernatant of Leuc. gelidum UAL187 grown in APT. The same sensitivity was observed for isolates of Lb. sake 1218 grown as pure cultures or in mixed culture with Leuc. gelidum UAL187-22 or UAL187-13. Growth of Lb. sake 1218 with extended incubation was apparently due to loss of activity of leucocin A rather than development of resistant strains of Lb. sake 1218.
[0199]Antimicrobial activity that was sensitive to pronase E was demonstrated for extracts prepared from beef samples co-inoculated with Leuc. gelidum UAL187 and Lb. sake 1218. The antibacterial activity on the meat persisted from two up to eight weeks of storage, but the level of activity was near the lowest detectable limit and activity could not be detected on all samples that were tested. At least half of the trials were positive at each sampling time. Antimicrobial activity was also observed on beef co-inoculated with Leuc. gelidum UAL187-22 and Lb. sake 1218 after six weeks of storage. No activity was observed for beef co-inoculated with Leuc. gelidum UAL187-13 and Lb. sake 1218. Leuc. gelidum UAL187 and UAL187-22 retained their bacteriocinogenic potential at all storage intervals when tested for antagonistic activity by the deferred inhibition test.
[0200]Detection of spoilage of beef samples. Leuc. gelidum UAL187 completely inhibited sulfur-mediated spoilage of beef by Lb. sake 1218 for up to eight weeks, except in two of four trials, where spoilage was detected in samples taken at 4.5 weeks but not at 6 and 8 weeks of storage at 2° C. Spoilage produced by Lb. sake 1218 in the presence or absence of Leuc. gelidum UAL187-22 or UAL187-13 was detected within 3 to 4.5 weeks of storage and illustrated by arrows in FIG. 23. No spoilage was detected in beef samples inoculated with pure cultures of Leuc. gelidum UAL187, UAL187-22 or UAL187-13 and stored for up to eight weeks under vacuum at 2° C. (data not shown).
[0201]Preservation of Pork. Application of modified atmosphere packaging for retail marketing of pork cuts was studied. Experiments were designed to determine: (1) effects of storage conditions on keeping quality and the prevailing microflora on the meat cuts; (2) the potential to access distant markets with retail-ready cuts using this technology; and (3) the effect of inoculation of retail cuts with selected lactic acid bacteria (LAB) on keeping quality and the use of headspace gas analysis to monitor spoilage.
[0202]To examine the effects of storage conditions pork loin cuts prepared with two levels of initial bacterial load were packaged in three films of different gas transmission in an atmosphere containing 40% CO2/60% N2 and stored at -1, 4.4 and 10° C. Temperature was the overriding factor influencing storage life. Spoilage at each storage temperature could be attributed to the growth of different groups of bacteria and was influenced by package type, Storage life of pork cuts in packages with low oxygen transmission rates was 5 or 8 weeks at 4.4 or -1° C., respectively. Listeriae were detected as part of the prevalent microflora on samples stored at -1° C., but not on samples stored at 4.4 or 10° C. A total of 162 (30%) of LAB isolated from the meat samples produced inhibitory substances against a range of indicator strains.
[0203]Samples for studies to simulate storage conditions to access distant markets with retail-ready cuts of pork were packaged in 100% CO2 in plastic film with extremely low gas transmission and stored at -1.5° C. for three weeks. Reference samples were held at -1.5° C. for the duration of the study. After transfer of samples to 4 and 7° C., samples remained acceptable for retail sale for 2 and 1 weeks, respectively. Appearance of the cuts was the main factor limiting storage life: however, confinement odor became a potential problem for consumer acceptance of the product with extended storage.
[0204]Studies of inoculated retail-ready cuts of pork packaged in 100% CO2 and stored at 4° C. revealed that the type of bacteriocinogenic LAB affected the storage life of the meat. Sulphur odors were detected on meats inoculated with Camobacterium piscicola LV17 or Leuconostoc gelidum UAL187 but not with Lactobacillus sake Lb706 using methods described for beef. Detection of sulphur compounds in the headspace gas at the time that the sensory panel detected off-odors, indicated that monitoring of these compounds is an objective measure of spoilage.
[0205]The studies demonstrated that there is good potential to apply modified atmosphere packaging technology to retail cuts of pork. With adequate temperature control, storage life can be extended for weeks beyond what is possible with aerobic packaging.
[0206]Assessment of the spoilage potential of selected strains of LAB is imperative before they can be exploited as biopreservatives for achieving a predictable storage life of retail-ready products.
Example 10
Partial Purification of UAL26
[0207]The bacteriocin produced by C. piscicola UAL26 isolated from vacuum packaged ground beef has a broad spectrum of activity that includes Listeria monocytogenes and the spores and vegetative cells of Bacillus and Clostridium species, including strains of Clostridium botulinum. This bacteriocin is chromosomally produced, but it has been difficult to characterize.
[0208]Its impressive antibacterial spectrum, its enhanced activity against L. monocytogenes when it is transformed with clones of carnobacteriocins A or B (Worobo at al. Quadri at al.), and the ease of transformation of C. pisocola UAL26 with plasmid DNA make this bacteriocin and the producer strain prime candidates for this technology.
[0209]Three liters of CAA were inoculated with 50 ml of C. piscicola UAL26 culture and this culture was incubated for eighteen hours at room temperature (23° C.) at a constant pH of 6.7 using a Chemcadet pH controller. This suspension was then heated at 65° C. for 30 minutes. The solution is then centrifuged at 11,000 rpm for 15 minutes. After the centrifuge, the supernatant was collected and (NH4)2SO4 at 55% concentration was added and the solution stirred overnight at 4° C. The solution was then centrifuged at 13,000 rpm for 30 minutes and the precipitate was collected. The precipitate was dissolved in 0.1% Trifluoroacetic acid (TFA) and then was applied to a Amberlite XAD-2 column. The column was then washed with steps of ethanol (0%, 20%, 40%, 60%, and 80%) containing 0.1% TFA. The active fractions as determined by spot-on-lawn methodology were then combined and rotary evaporated to 15 milliliters. This sample was and then applied to a Sephadex G-50 column. The column was washed with 0.1% TFA. The active fractions were then combined, rotary evaporated and then lyophilized.
Example 11
Method for Using Bacterocins for Treating Infections
[0210]For the treatment of animal or human diseases purified or partially purified bacteriocins could be used for topic application or internal use.
[0211]The bacterocins can be purified or partially purified by a variety of methods for the bacterocin including, but not limited to the methods described herein or those described by Henderson and associates (1992); Hechard and associates (1992); Hasting and associates (1991); Quadri and associates (1993) or Worobo and associates (1994) or may be able to be obtained commercially obtained commercially (Quest; Flavors & Food Ingredients Co., Rochester, N.Y.).
[0212]The formulations for delivery are similar to other bacterocins and someone skilled in the art would know what formulation to use without undue experimentation. The concentration of bacterocin required for one of these formulations can be determined by comparing units/μg of a know bacterocin to the novel bacteriocin. The concentration of the novel bacteriocin should be set so that the concentration of the novel bacteriocin active units/ml is 0.1 to 10 times the activity of the control.
Example 12
Method to Use Organisms Containing Bacteriocin Genes to Preserve Food
[0213]To prevent food poisoning, milk products lactobacterium containing a Gram-negative bacteriocin (i.e. Colicin V) (these organisms could also contain other bacteriocins) can be added to the product. For yoghurt 108 to 109 lactobacillus bacteria are added to milk. To improve the shelf life of this product (0.01% to 100% of these organisms added could contain the desired plasmid). This same method can be used for protection of cheese but the host bacterium and number of organisms incoluated into the milk is dependent on the type of cheese, someone skilled at the art would know what type of organism to use.
Example 13
Treatment of Infections or Bacteria Disorders
[0214]For intestinal infections such as food poisoning due to particular organism (E. coli; Salmonella, etc.), an anti-diarrhea treatment could contain 106 to 108 harmless organisms (i.e. lactobacillus strains) in a buffered solution which could be administered orally. These organisms would contain a bacteriocin, in a food-grade plasmid, that could inhibit the growth of the common diarrhea causing organisms (i.e. bacteriocins active against gram-negative organisms--Colicin V). These same organisms could be added to a buffered ointment suitable for vaginal administration. Someone skilled in the art would know of a suitable formulation without undue experimentation.
TABLE-US-00004 TABLE 1 Bacterial strains and plasmids Bacterial Strain or plasmid Relevant Characteristicsa Reference or source Strains C. divergens LV13 Leucocin A sensitive indicator stain Shawc Carnobacteriocin sensitive indicator strain NCFBb dvn + dvl+ (containing pCD3.4), CbnB25 (NCFB 2855) AJ Dvn5 DbnB25 laboratory isolate C. piscicola LV17C Bac-, plasmidless mutant derived from Ahn & Stiles (1990), C. piscicola Lv17B Dvn5 DbnB25, plasmidless LV17A cbnA (containing pCp49), Bac+Dvn5 Ahn & Stiles (1990), LV17B Bac+, containing pCP40 Ahn & Stiles (1990), cbnB2 and cbnBMI (containing pCP40) UAL26 Dvn5 DbnB25 , Bcn+, plasmidless, Bac+Dvn5 Ahn & Stiles (1990), Shawc Lactococcus lactis subsp, lactis MG1363 Dvnr, plasmidless Gasson (1983) IL1403 Dvnr DvnB2r , plasmidless Chopin et al (1984), Lb. sake 1218 Sulfide producing spoilage organism L. McMullen, U. of Alberta L. gelidum UAL187 bac+ wildtype strain with 5.0, 7.6 and 9.2 MDa Hastings & Stiles (1991) plasmids UAL187-22 bac+ strain with 7.6 and 9.2 MDa plasmids Hastings & Stiles (1991) UAL187-13 bac+ strain with 9.2 MDa plasmid Hastings & Stiles (1991) E. Coli DH5α F endA1 hsdR17 (rk-mk+)supE44 thi-1 1- BRL Life recA1 gyrA96 relA1(argF-lacZYA)U169 Techonologies Inc. f80dlncZ_M15 MH1 MC1061 derivative; araD139 lacX74 galU Casadaban & Cohen (1980), galK hsr hsm+ strA MV1I93 Δ(lac proAB) rpsl, thi endA spcB15 hsdR4 Δ(srl-recA) 306::Tn10(tetr) F[traD36 proAB+ laclq lacZΔM15] LQ5.21 E. coli MV1193 containing pLQ5.21 Quadri et al (1994) LQ7.2 E. coli MV1193 containing pLQ7.2 Quadri et al (1994) Plasmids pCD3.4 dvn+, dvi+ (divergicin A producer), 3.4 kb Worobo et al (1995) pCD4.4 pCD3.4 containing 1.0-kb EcoRI Cmr gene Worobo et al (1995) of pGS30; Cmrdvn+dvi+, 4.4kb pCP40 61-kb plasmid conferring Bac+ 1 mm+ Abn & Stiles (1990) phenotype pGKV210 Emr, 4.4kb van der Vossen et al (1987) pGKV259 Emr Cmr 5.0 kb Van der Vossen (1987) pGS30 pUC7 containing 1.0-kb Pstl Cmr gene of G. Venemad pC194; Cmr, 3.7 kb pJH6.1F pUC118 containing 2.9-kb HpaII fragment Hastings et al (1991) from pLG7.6, Ampr, 6.1 kb pJKM05 528-bp HindIII-Xbal cbnB2, cbiB2 PCR McCormick et al (1996) product in pUC118, Ampr pJKM07 266-bp EcoRI-HindIII fragment of pJKM05 McCormick et al (1996) in pUC118 pJKM08 262-bp EcoRI fragment of pJKM05 in McCormick et al (1996) pUC118 pJKM14 pMG36e containing divergicin A signal McCormick et al (1996) peptide fused to carnobacteriocin B2 structural gene and also containing carnbacteriocin B2 immunity gene, cbnB2+, cbiB2+, Emr pJKM16 335-bp SacI-EcoRI fragment from pJKM14 McCormick et al (1996) cloned in pUC118 pKM1 pUC7 containing 1.3-kb pstI Kmr gene of G. Venemaa pUB110; Kmr, 3.7 kb pLG7.6 Lca-Immr, 18 kb Hasting & Stiles (1991) pLQ5.21 pUC118 containing a 1.9-kb HindIII Quadri et al (1995) fragment of pCP40 pLQ7.2 pUC118 containing a 4.0-kb EcoRI-Pstl Quadri et al (1995) genomic fragment from C. piscicola LV17C pLQ24 pCaT containing 16-kb insert from pCP40, Quadri et al (1995) cbnB2+, cbiB2+, Cmr, 24.5 kb pMB500 Kmr, 18.2 kb; specifying lactococcins van Belkum et al (1989) A and B pMB553 Emr, 18.2 kb; specifying lactococcin A van Belkum et al (1989) pMG36e expression vector, Emr, 3.6 kb van Belkum et al (1989) van de Guchte et al (1989) pMJ1 pGKV210 containing 2.9-kb HpaII fragment van Belkum & Stiles (1995) from pJH6.1F, Emr, 6.8 kb pMJ3 pGKV210 containing 1-kb HpaI-Dral van Belkum & Stiles (1995) fragment from pJH6.1F, Emr, 5.4 kb pMJ4 pUC1I8 containing 12.3-kb HindIII van Belkum & Stiles (1995) fragment from pLG7.6, Ampr, 15.5 kb pMJ6 pMG36e containing the 8-kb SacI-HindIII van Belkum & Stiles (1995) fragment from pMJ4, Emr, 11.6 kb pMJ10 pMG36e containing the 7.9 kb HindIII- van Belkum & Stiles (1995) Nrulfragment from pMJ4, Emr, 11.4 kb pMJ16 EcoRV-BamHI deletion derivative fo pMJ6, van Belkum & Stiles (1995) Emr, 10.6 kb pMJ17 BstE11-Sta-1 deletion derivative of pMJ6, van Belkum & Stiles (1995) Emrm, 10.6 kb pMJ18 EcoRV-HindIII deletion derivative of pMJ6, van Belkum & Stiles (1995) Emr, 8.7 kb pMJ20 Frameshift mutation in CIal site of pMJ3, van Belkum & Stiles (1995) Emr, 5.4 kb pMJ26 Frameshift mutation in NsiI site of pMJ6, van Belkum & Stiles (1995) Emr, 11.6 kb pRW19e pMG36e containing 514-bp EcoRV-AccI McCormick et al (1996) fragment; dvn+, dvi+, Emr pRW5.6 pGKV259 containing 514-bp EcoRV-AccI Worobo et al (1995) fragment; Emrdvn+dvi+, 5.6 kb pRW6.0 pGKV259 containing divergicin signal Worobo et al (1995) peptide fused to alkaline phosphatase pUC118 3.2-kb cloning vector, AmpR, lacZ Veira & Messing (1987) lacZr Ampr, 3.2 kb Veira & Messing (1986) advn+, divergicin A structural gene; dvi+, divergicin A immunity gene; cbnB2+, carnobacteriocin B2 structural gene; cbiB2+, carnobacteriocin B2 immunity gene; Dvns, divergicin A sensitive; Dvnr, divergicin A resistant; CbnB2s, carnobacteriocin B2 sensitive; CbnB2r, carnobacteriocin B2 resistant; Bcn+, bacteriocin producer (unnamed); Ampr, ampicillin resistant; Cmr, chloramphenicol resistant; Emr, erythromycin resistant. bNCFB, National Collection of Food Bacteria, Reading, United Kingdom. cSupplied by Dr. B.G. Shaw, Institute for Food Research, Langford, Bristol, UK. dStrain from the laboratory of G. Venema, Department of Genetics, University of Groningen, Haren, The Netherlands.
TABLE-US-00005 TABLE 2 Spectrum of of Antibiotic Activity of a Variety of Purified Bacteriocins expressed as the Number of strains inhibited/Number of strains tested Bacteriocin cbn 26 cbn A cbn B Leu A Broch C Genus of Strains tested 1AU 8AU 1AU 8AU 1AU 8AU 1AU 8AU 1AU 8AU Bacillus vegetative cells 2/5 5/5 2/5 2/5 2/5 2/5 2/5 2/5 1/5 4/5 spores 5/5 5/5 0/5 0/5 0/8 0/8 0/8 1/8 3/8 3/8 Clostridia vegetative cells 3/8 6/8 0/8 0/8 0/8 0/8 0/8 1/8 3/8 3/8 spores 0/7 4/7 0/7 0/7 0/7 0/7 0/7 0/7 1/7 1/7 Staphylococcus 1/7 1/7 0/7 1/7 1/7 1/7 0/7 6/7 1/7 7/7 Streptococcus 2/3 2/3 0/3 0/3 0/3 0/3 0/3 1/3 1/3 2/3 Listeria 42/42 42/42 4/42 21/42 10/42 26/42 39/42 40/42 0/42 39/42 G negative strains 0/29 0/29 0/29 0/29 0/29 0/29 0/29 0/29 0/29 0/ Brochothrix 14/14 14/14 0/14 0/14 0/14 0/14 0/14 0/14 13/14 13/14 Carnobacteria 0/14 0/14 0/14 0/14 0/14 0/14 14/14 14/14 0/14 0/14 Enterococcus 11/14 13/14 2/14 2/14 3/14 3/14 7/14 9/14 8/14 12/14 Lactobacillus 15/17 16/17 0/17 1/17 0/17 0/17 1/17 1/17 3/17 8/17 Lactococcus 8/8 8/8 0/8 0/8 0/8 0/8 0/8 6/8 0/8 3/8 Leoconostoc 9/9 9/9 1/9 1/9 1/9 1/9 5/9 5/9 1/9 8/9 Pediococcus 2/3 3/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 2/3 indicates data missing or illegible when filed
TABLE-US-00006 TABLE 3 Spectrum of of Antibiotic Activity of a Variety of Purified Bacteriocins expressed as the Number of strains inhibited/Number of strains tested Bacteriocin and Number of units used in the Assay cbn 26 Enterocin Leu A Mesen Y105 Brochocin Nisin Genus of Strains Tested 1AU 8AU 1AU 8AU 1AU 8AU 1AU 8AU Bacillus vegetative cells 2/5 .sup. 2/5a 3/5 5/5 .sup. 3/5p 5/5 5/5 5/5 spores 0/5 0/5 .sup. 5/5b .sup. 5/5b 5/5 5/5 5/5 5/5 Clostridia vegetative cells 0/8 .sup. 1/8c 0/8 .sup. 1/8d .sup. 4/8q 6/8 7/8 8/8 spores 0/7 0/7 0/7 0/7 1/7 4/7f 5/7 7/7 Staphylococcus .sup. 1/7c .sup. 1/7c .sup. 7/7 .sup. 7/7 1/7 7/7 3/7 7/7 Streptococcus 0/3 0/3 0/3 .sup. 3/3k 2/3 2/3 1/3 2/3 Listeria .sup. 39/42h .sup. 40/42 .sup. 36/42h 42/42 42/42 42/42 42/42 42/42 Brochothrix 0/14 0/14 0/14 0/14 14/14 14/14 14/14 14/14 Carnobacteria .sup. 12/19l .sup. 18/19k .sup. 17/19 19/19 19/19 19/19 19/19 19/19 Enterococcus .sup. 7/14 .sup. 9/14l .sup. 3/14l .sup. 9/14l 14/14 14/14 12/14 14/14 Lactobacillus 1/17m 1/17m 1/17m 1/17m 15/17 16/17s 16/17 17/17 Lactococcus 0/8 0/8 0/8 .sup. 1/8n 8/8 8/8 4/8 .sup. 6/8t Leuconostoc 5/9 5/9 5/9 .sup. 6/9o 9/9 9/9 9/9 9/9 Pediococcus 0/3 0/3 0/3 0/3 2/3 3/3 3/3 3/3 Notes for table 3. aNo inhibition against B. cereus ATCC14579, HPB384, HPB948. bSmall cloudy zone cC. pasterianum ATCC6013. dC. bifermentans ATCC19299 eAll inhibited S. aureus S13 fExcept S13, inhibition zones of other indicators were small, cloudy gInhibition to S. sanguis ATCC10556 was stronger than others hBoth had no inhibition to L. monocytogenes L10561, L10507, L028, while Y105 had no activity to L. monocytogenes L10506, L10526, L. innocua L10200 either. iNo inhibition to L10501, L10507 jBoth were inactive to C. piscicola ATCC43225, C. mobile ATCC49516. kNo inhibition to ATCC49516 Leu A did not inhibit C. piscicola LV17, LV17B, LV17C, LVC2/8B lBoth had no inhibition to E. faecalis ATCC33186, faecium ATCC 19434, HPB956, ENSAIA631, Leu A inhibited E. faecalis HPB390, while Y105 did not. mOnly active to L. sake 20017 In direct and deferred antagonism test, Y105 was active to L. confusus ATCC10881 nSmall zone against L. garviae ATCC43921 oInhibit L. paramesenteriodes DSM20288 Other 5 inhibited indicators were the same to Leu A and Mesen Y105 pB. cereus, APB384, HPB948 qATCC35040, ATCC19401, ATCC25784, ATCC7995 rATCC25784, ATCC19401, ATCC6013 sLb. plantarum, BFE905 tUAL245, ATCC11454 indicates data missing or illegible when filed
TABLE-US-00007 TABLE 4 Spectrum of of Antibiotic Activity of a Variety of Purified Bacteriocins expressed as the Number of strains inhibited/Number of strains tested Bactriocin Tested Mesent Y105 Pedi PA-1 Quest Nisin Enterocin 900 Genus of Strains tested 1AU 8AU 1AU 8AU 1AU 8AU 1AU 8AU 1AU 8AU Bacillus vegetative cells 3/5 5/5 2/5 2/5 1/5 2/5 5/5 5/5 0/5 2/5 spores 5/5 5/5 0/5 0/5 8/5 0/5 5/5 5/5 0/5 0/5 Clostridia vegetative cells 6/8 1/8 0/8 0/8 0/8 0/8 7/8 8/8 2/8 3/8 spores 0/7 0/7 0/7 0/7 0/7 0/7 5/7 7/7 0/7 0/7 Staphylococcus 1/7 7/7 0/7 1/7 0/7 1/7 3/7 7/7 1/7 1/7 Streptococcus 0/3 3/3 0/3 0/3 0/3 0/3 1/3 2/3 0/3 0/3 Listeria 36/42 42/42 39/42 40/42 38/42 40/42 41/42 42/42 39/42 39/42 G negative strains 0/29 0/29 0/29 0/29 0/29 0/29 0/29 0/29 0/29 0/29 Brochorthrix 0/14 0/14 0/14 0/14 0/14 0/14 14/14 14/14 0/14 0/14 Carnobacteria 17/19 19/19 7/19 10/19 5/19 7/19 19/19 19/19 1/19 7/19 Enterococcus 3/14 9/14 7/14 11/14 1/14 7/14 12/14 14/14 5/14 8/14 Lactobacillus 1/17 2/17 1/17 2/17 1/17 2/17 16/17 17/17 2/17 5/17 Lactococcus 0/8 1/8 0/8 0/8 0/8 0/8 4/8 6/8 4/8 4/8 Leuconostoc 5/9 6/9 4/9 5/9 1/9 3/9 9/9 9/9 1/9 1/9 Pediococcus 6/3 0/3 0/3 2/3 0/3 0/3 3/3 3/3 0/3 0/3
TABLE-US-00008 TABLE 5 Bacteriocin production by Strain of Carnobacterium Indicator strainsa LV17C LV13 MG36e RW19e JKM14 MG36e RW19e JKM14 Producer strains C. piscicola LV17C.MG36e 0 0 0 0 0 0 LV17C.RW19e 30 0 30 0 0 0 LV17C.JKM14 7 6 0 20 20 0 C. divergens LV13.MG36e 23 0 23 0 0 0 LV13.RW19e 26 0 29 0 0 0 LV13JKM14 24 6 24 19 19 0 azones of inhibition were determined by the deferred antagonism assay and measurements indicate the diameter of the zone of inhibition (cm).
REFERENCES
[0215]Ahn, C., and M. E. Stiles. 1990. Plasmid-associated bacteriocin production by a strain of Carnobacterium piscicola from meat. Appl. Environ. Microbiol. 56:2503-2510. [0216]Allison, G. E., Worobo, R. W., Stiles, M. E, and Klaenhammer, T. R. (1995b) Heterologous expression of the lactacin F peptides by Carnobacterium piscicola LV17 Appl Environ Microbiol. 61: 1371-1377. [0217]Anon. 1987. de Man, Rogosa and Sharpe agar with sorbic acid (MRS-S agar). Int. J. Food Microbiol. 5:230-232. [0218]Axelsson, L., A. Holck, S.-E. Birkland. T. Aukrust. and H. Blom. 1993. Cloning and nucleotide sequence of a gene from Lactobacillus sake Lb706 necessary for sakacin A production and ammunity. Appl. Environ. Microbiol. 59:2868-2875. [0219]Axelsson, L., and A. Holck. 1995. The genes involved in production of and immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706. J. Bacteriol. 177:2125-2137. [0220]Barefoot, S. F., and T. R. Klaenhammer (1983). Detection and activity of lactacin B, a bacteriocin produced by Lactobacillus acidophilus. Appl. Environ. Microbiol. 45:1808-1815. [0221]Birnboim, H. C., and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7:1513-1523. [0222]Blight, M. A., and I. B. Holland. (1990) Structure and function of haemolysin B, P-glycoprotein and other members of a novel family of membrane translocators. Mol Microbiol 4: 873-880. [0223]Boehringer Mannheim. 1987. D(-)-Lactate dehydrogenase (D-LDH). Biochemica information, p. 45 Boehringer Mannheim Biochemicals, Indianapolis, Ind. [0224]Borch, E. and Agerhem, H. (1992) Chemical, microbial and sensory changes during the anaerobic cold storage of beef inoculated with a homofermentative Lactobacillus sp. or a Leuconostoc sp. Int. J. Food Microbiol. 15, 99-108. [0225]Borchert, T. V., and V. Nagarajan. 1991. Effect of signal sequence alterations on export of levansucrase in Bacillus subtilis. J. Bacteriol. 173:276-282. [0226]Bukhtiyarova, M., Rongguang, Y., and Ray, B. (1994) Analysis of the pediocin AcH gene cluster from plasmid pSMB74 and its expression in a pediocin-negative Pediococcus acidilactici strain. Appl Environ Microbiol 60: 3405-3408. [0227]Bureau Central de la CIE, 4, Avenue du Recteur Poincare, 75782 Paris Cedex 16, France. [0228]Cao, G., A. Huhn, and R. E. Dalbey. 1995. The translocation of negatively charged residues across the membrane is driven by the electrochemical potential: evidence for an electrophoresis-like membrane transfer mechanism. EMBO J. 14:866-875. [0229]Casadaban, M. C., and S. N. Cohen. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138:179-207. [0230]Casadaban, M. J. (1976) Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu. J Mol Biol 104: 541-555. [0231]Cavett, J. J. 1963. A diagnostic key for identifying the lactic acid bacteria of vacuum packed bacon. J. Appl. Bacteriol. 26: 453-470. [0232]Chehade, H., and Braun, V. (1988) Iron-regulated synthesis and uptake colicin V. FEMS Microbiol 52: 177-182. [0233]Chopin, A., Chopin, M.-C., Moillo-Batt, A., and Langella, P. (1984) Two plasmid-determined restriction and modification systems in Streptococcus lactis. Plasmid 11:260-263. [0234]CIE (1976) Commission Internationale de l'Eclairage, 18th Session, London, England. September 1975, CIE Publication 36. [0235]Collins, M. D., Rodrigues, U., Ash, C., Aguirre, M., Farrow, J. A. E., Martinez-Murcia, A., Philiips, B. A., Williams, A. M. and Wallbanks, S. (1991) Phylogenetic analysis of the genus Lactobaci/lus and related lactic acid bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Microbiol. Lett. 77, 5-12. [0236]Dainty, R. H, and Mackey, B. M. (1992) The relationship between the phenotypic properties of bacteria from chill-stored meat and spoilage processes, J. Appl. Bacteriol. Symp. Suppi. 73, 1035-1145. [0237]Diep, D. B., L. S. HOEvarstein, J. Nissen-Meyer, and I. F. Nes. 1994. The gene encoding plantaricin A, a bacteriocin from Lactobacillus plantarum C11, is located on the same transcription unit as an agr-like regulatory system. Appl. Environ. Microbiol. 60:160-166. [0238]Difco Manual. 1984. 10th ed., p. 1071. Difco Laboratories Inc., Detroit, Mich. [0239]Dinh, D., I. T. Paulsen, and M. H. Saier, Jr. 1994. A family of extracytoplasmic proteins that allow transport of large molecules across the outer membranes of Gram-negative bacteria. J. Bacteriol. 176:3825-3831, [0240]Edwards, R. A., Dainty, R. H. and Hibbard, C. M. (1985) Putrescine and cadaverine formation in vacuum packed beef. J. Appl. Bacteriol. 58, 13-19. Egan, A F. (1983) Lactic acid bacteria of meat and meat products. Antonie van Leeuwenhoek 49, [0241]Egan, A. F., Ford, A. L. and Shay, B. J. (1980) A comparison of IMicrobacterium thermosphacta and lactobacilli as spoilage organisms of vacuum-packaged sliced luncheon meats. J. Food Sci. 45 1745-1748. [0242]Fath, F. J., and R. Kolter. 1993. ABC transporters: bacterial exporters. Microbiol. Rev. 57:995-1017. [0243]Franke, C. M., Leenhouts, K. J., Haandrikman, A. J., Kok, J., Venema, G., and Venema, K. (1996) Topology of LcnD, a protein implicated in the transport of bacteriocins from Lactococcus lactis. J Bacteriol 178: 1766-1769. [0244]Fremaux, C., Ahn, C., and Klaenhammer, T. R. (1993) Molecular analysis of the lactacin F operon. Appl Environ Microbiol 59: 3906-3915. [0245]Fremaux, C., and T. R. Klaenhammer. 1994. Helveticin J, a large heat-labile bacteriocin from Lactobacillus helveticus, p. 397-418. In L. De Vuyst and E. J. [0246]Gasson, M. J. 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after proptoplast-induced curing. J. Bacteriol. 154:1-9. [0247]Gilson, L., H. K. Mahanty, and R Kolter. 1987. Four plasmid genes are required for colicin V synthesis, export, and immunity. J. Bacteriol. 169:2466-2470. [0248]Gilson, L., H. K. Mahanty, and R. Kolter. 1990. Genetic analysis of an MDR-like export system: the secretion of colicin V. EMBO J. 9:3875-3884. [0249]Gonzalez, B., P. Arca, B. Mayo, and J. E. Suarez. 1994. Detection, purification, and partial characterization of plantaricin C, a bacteriocin produced by a Lactobacillus plantarum strain of dairy origin. Appl. Environ. Microbiol. 60:2158-2163. [0250]Graham, D. C., and McKay, L. L. (1985) Plasmid DNA in strains of Pediococcus cerevisiae and Pediococcus pentosaceus. Appl Environ Microbiol 50: 532-534. [0251]Greer, G. G., and S. D. M. Jones. 1991. Effects of lactic acid and vacuum packaging on beef processed in a research abattoir. Can. Inst. Food Sci. Technol. J. 24:161-168. [0252]Greer, G. G. and Murray, A. C. (1991) Freezing effects on quality, bacteriology and retail case life of pork. J. Food Sci. 56, 891-894. [0253]Greer, G. G., Dilts, B. D. and Jeremiah, L. E. (1993 Bacteriology and retail case life of pork after storage in carbon dioxide. J. Food Prot. 56, 689-693. [0254]Hechard, Y. B. Derijard, F. Letellier, Y. Cenatiempo. 1992. Characterization and purification of mesentericin Y105, an anti-Listeria bacteriocin from Leuconostoc mesenteroides. Journal of General Microbiology. 138:2725-2731. [0255]Hanna. M. O., Savell, J. W., Smith. G. C., Purser, D. E., Gardner. F. A. and Vanderzant, C. (1983) Effect of growth of individual meat bacteria on pH. color and odor of aseptically prepared vacuum-packaged round steaks, J. Food Prot. 42, 216-221.
[0256]Hastings, J. W., M. Sailer, K. Johnson, K. L. Roy, J. C. Vederas, and M. E. Stiles. 1991. Characterization of leucocin A-UAL 187 and cloning of the bacteriocin gene from Leuconostoc gelidum. J. Bacteriol. 173:7491-7500. [0257]Hastings, J. W. and Stiles, M. E. (1991) Antibiosis of Leuconostoc gelidum isolated from meat. J. Appl. Bacteriol. 70, 127-134. [0258]Hastings, J. W., Sailer, M., Johnson, K., Roy, K. L., Vederas, J. C., and Stiles, M. E. (1991) Characterization of leucocin A-UAL 187 and cloning of the bacteriocin gene from Leuconostoc gelidum. J Bacteriol 173: 7491-7500. [0259]Havarstein, L. S., D. B. Diep, and I. F. Nes. 1995. A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol. Microbiol. 16:229-240. [0260]Havarstein, L. S., H, Holo, and I. F. Nes, 1994. The leader peptide of colicin V shares consensus sequences with leader peptides that are common among peptide bacteriocins produced by Gram-positive bacteria. Microbiology 140:2383-2389. [0261]Henderson, J. T., A. L. Chopko, and P. D. van Wassenaar. 1992. Purification and primary structure of pediocin PA-1 produced by Pediococcus acidilactici PAC-1.0. Arch. Biochem. Biophys. 295:5-12. [0262]Higgins, C. F. (1992) ABC transporters: from microorganisms to man. Annu Rev Cell Biol 8: 67-113. [0263]Holo, H, Nilssen, O. and Nes, I. F. (1991) Lactococcin A, a new bacteriocin from Lactococcus lactis subsp. cremoris: isolation and characterization of the protein and its gene. J Bacteriol 173: 3879-3887. [0264]Holo, H., and I. F. Nes. 1989. High-frequency transformation, by electroporation fo Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55:3119-3123. [0265]Hui, F. M., and D. A. Morrison. 1991. Genetic transformation in Streptococcus pneumoniae: nucleotide sequence analysis shows comA, a gene required for competence induction, to be a member of the bacterial ATP-dependent transport family. J. Bacteriol. 173:372-381. [0266]Hui, F. M., L. Zhou, and D. A. Morrison. 1995. Competence for genetic transformation in Streptococcus pneumoniae: organization of a regulatory locus with homology to two lactococcin A secretion genes. Gene 153:25-31. [0267]Izard, J. W, and D. A. Kendall. 1994. Signal peptides: exquisitely designed transport promoters. Mol. Microbiol. 13:765-773. [0268]Jarchau, T., Chakraborty, T., Garcia, F., and Goebel, W. (1994) Selection for transport competence of C-terminal polypeptides derived from Escherichia coil hemolysin: the shortest peptide capable of autonomous HlyB/HlyD-dependent secretion comprises the C-terminal 62 amino acids of HlyA. Mol Gen Genet 245: 53-60. [0269]Joerger, M. C., and T. R. Klaenhammer. 1990. Cloning, expression, and nucleotide sequence of the Lactobacillus helveticus 481 gene encoding the bacteriocin helveticin J. J. Bacteriol. 172:6339-6347. [0270]Jung, G. (1991) in Nisin and Novel Lantibiotics. Jung, G., and Sahl, H.-G. (eds) Leiden:Escom, pp 1-34. [0271]Kandler, O., and O. Weiss. 1986. Regular, nonsporeforming Gram-positive rods, p. 1208-1260. In: P. H. A. Sneath, M. E. Mair, N. S., Sharpe, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. Williams and Wilkins, Baltimore, Md. [0272]Klaenhammer, T. R. 1993. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12:39-85. [0273]Kuipers, O. P., H. S. Rollema, W. M. de Vos, and J. Siezen. 1993. Biosynthesis and secretion of a precursor of nisin Z by Lactococcus lactis, directed by the leader peptide of the homologous lantibiotic subtilin from Bacillus subtilis. FEBS Lett. 330:23-27. [0274]Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. [0275]Lee, C., P. Li, H. Inouye, E. R. Brickman, and J. Beckwith. 1989. Genetic studies on the inability of β-galactosidase to be translocated across the Escherichia coil cytoplasmic membrane. J. Bacteriol. 171:4609-4616. [0276]Leer, R. J., J. M. van der Vossen, M. van Giezen, J. M. van Noort, and P. H. Pouwels. 1995. Genetic analysis of acidocin B, a novel bacteriocin produced by Lactobacillus acidophilus. Microbiology 141:1629-1635. [0277]Leisner, J., G Greer, B. Dilts, M. Stiles. 1994. Effect of growth of selected lactic acid bacteria on storage life of beef stored under vacuum and in air. [0278]Leisner, J., G. Greer, and M. Stiles. 1996. Control of beef spoilage by a sulfide-producing lactobacillus sake strain with bacteriocinogenic leuconostoc gelidum UAL187 during anaerobic storage at 2° C. [0279]Lewus, C. B., Kaiser, A. and Montville. T. (1991) Inhibition of food-borne bacterial pathogens by bacteriocins from lactic acid bacteria isolated from meat. Appl. Environ., Uicrobiol. 57. 1683-1688. [0280]Li, P., J. Beckwith, and H. Inouye. 1988. Alteration of the amino terminus of the mature sequence of a periplasmic protein can severely affect protein export in Escherichia coli. Proc. Natl. Acad. USA 85:7685-7689. [0281]Mandel, M., and A. Higa. 1970, Calcium dependent bacteriophage DNA infection, J. Mol. Biol. 53:159-162. [0282]Marugg, J. D., C. F. Gonzalez, B. S. Kunka, A. M. Ledeboer, M. J. Pucci, M. Y. Toonen, S. A. Walker, L. C. M. Zoetmulder, and P. A. Vandenbergh, 1992. Cloning, expression, and nucleotide sequence of genes involved in production of pediocin PA-1, a bacteriocin from Pediococcus acidilactici PAC1.0. Appl. Environ. Microbiol. 58:2360-2367. [0283]McMullen, L. M., and M. E. Stiles. 1993. Microbiol ecology of fresh pork stored under modified atmosphere at -1, 4.4 and 10° C. Int. J. Food Microbiol. 18:1-14. [0284]McMullen, L. M., and M. E. Stiles. 1994. Quality of fresh retail pork cuts stored in modified atmosphere under temperature conditions simulating export to distant markets. Meat Sci. 38:163-177. [0285]Montel, M.-C., R. Talon, J. Fournaud, and M.-C. Champomier. 1991. A simplified key for identifying homofermentative Lactobacillus and Carnobacterium spp. from meat. J. Appl. Bacteriol. 70: 469-472. [0286]Muriana, P. M., and T. R. Klaenhammer. 1991. Cloning, phenotypic expression, and DNA sequence of the gene for Lactacin F, an antimicrobial peptide produced by Lactobacillus spp. Appl. Environ. Microbiol. 173:1779-1788. [0287]Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448. [0288]Pugsley, A. P. 1993. The complete general secretory pathway in Gram-negative bacteria. Microbiol. Rev. 57:50-108. [0289]Quadri, L. E. N., K. L. Roy, J. C. Vederas, and M. E. Stiles. 1996. J. Bacteriol. submitted. [0290]Quadri, L. E. N., M. Sailer. K. L. Roy, J. C. Vederas, and M. E. Stiles. 1994. Chemical and genetic characterization of bacteriocins produced by Carnobacterium piscicola LV17B. J. Biol. Chem. 269:12204-12211. [0291]Quadri, L. E. N., M. Sailer, M. Terebiznek, K. L. Roy, J. C. Vederas, and M. E. Stiles. 1995. Characterization of the protein conferring immunity to the antimicrobial peptide carnobacteriocin B2 and expression of carnobacteriocins B2 and BM1. J. Bacteriol. 177:1144-1151. [0292]Randall, L. L., and S. J. S. Hardy. 1986. Correlation of competence for export with lack of tertiary structure of the mature species: a study in vivo of maltose binding protein in E. coli. Cell 46:921-928. [0293]Renerre. M. and Montel, M-C. (1986) Inoculation of steaks with Lacrobacillus species and effect on colour and microbial counts. Proceedings of the 3'nd meeting of European Meat Research Workers, pp. 213-216. [0294]Reuter, G. 1970. Laktobazillen und eng verwandte Mikroorganismen in Fleisch und Fleischerzeugnissen 2, Mitteilung: Die charakterisierung der isolierten Laktobazillenstamme. Fleischwirtsch. 50: 954-962. [0295]Rottlander, E., and Trautner, T. A. (1970) Genetic and transfection studies with Bacillus subtilis phage SP50. J Mol Biol 108: 47-60. [0296]Ruhr, E., and Sahl, H.-G. (985) Mode of action of the peptide antibiotic nisin and influence on the membrane potential of whole cells and on cytoplasmic and artificial membrane vesicles. Antimicrob Agents Chemother 27: 841-845. [0297]Ruiz-Barba, J. L., D. P. Cathcart, P. J. Warner, and R. Jimenez-Diaz. 1994. Use of Lactobacillus plantarum LPCO10, a bacteriocin producer, as a starter culture in Spanish-style green olive fermentations. Appl. Environ. Microbiol. 60:2059-2064. [0298]Sahl, H.-G. (1991) In Nisin and novel lantibiotics. Jung, G. and Sahl, H.-G. (eds). Leiden. Escom, pp. 347-358. [0299]Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd. ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press. [0300]Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-termination inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467 [0301]SAS Institute (1985) SAS User's Guide: Statistics. SAS Institute, Inc. Cars. N.C. [0302]Schagger, H., and von Jagow, G. (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Biochem 166: 368-379. [0303]Schillinger, U. and Lucke, F.-K. (1987) Lactic acid bacteria on vacuum-packed meat and their influence on storage life. Fleischwirtsch. 67, 1244-1'48. [0304]Schillinger, U., and F.-K. Lucke. 1987. Identification of lactobacilli from meat and meat products. Food Microbiol. 4:199-208. [0305]Schillinger. U. and Lucke, F.-K. (1989) Antibacterial activity of Lacrobacillus sake isolated from meat Appl. Environ. Microbiol. S5, 1901-1906. [0306]Shaw, B. G., and C. D. Harding. 1984. A numerical taxonomic study of lactic acid bacteria from vacuum packed beef, pork, lamb and bacon. J. Appl. Bacteriol. 56: 25-40. [0307]Shaw, B. G, and C. D. Harding. 1985. Atypical lactobacilli from vacuum packaged meats: Comparison by DNA hybridization, cell composition and biochemical tests with a description of Lactobacillus carnis sp. nov. System. Appl. Microbiol. 6:291-297. [0308]Shay, B. J. and Egan, A. F. (1981) Hydrogen sulphide production and spoilage of vacuum-packed beef by a Lactobacillus In: T. A., Roberts, G. Hobbs, J. H. B. Christian and N. Skovgaard (editors), Psychrotrophic Microorganisms in Spoilage and Pathogenicity. Academic Press. New York. pp. 241-251. [0309]Simonen, M., and I. Palva. 1993. Protein secretion in Bacillus species. Microbiol. Rev. 57:109-137. [0310]Smith, G. C., Hall, L. C. and Vanderzant, C. (1980) Inoculation of beef steaks with Lactobacillus species before vacuum packaging. 11, Effect on meat quality characteristics. J. Food Prot. 43, 842-849.
[0311]Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517. [0312]Stiles, M. E. and Hastings, J. W. (1991) Bacteriocin production by lactic acid bacteria: potential for use in meat preservation. Trends Food Sci. Technol. 2, 247-251. [0313]Stoddard, G. W., Petzel, J. P., van Belkum, M. J., Kok, J., and McKay, L. L. (1992) Molecular analyses of the lactococcin A gene cluster from Lactococcus lactis subsp. lactis biovar. diacetylactis WM4. Appl Environ Microbiol 58: 1952-1961. [0314]Studier, F. W., and Moffat, B. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high level expression of cloned genes. J Mol Biol 189: 113-130. [0315]Tabor, S., and Richardson, C. C. (1985) A bacteriophage T7 RNA polymerase promoter system for controlled exclusive expression of specific genes. Proc Natl Aced Sci USA 82: 1074-1078. [0316]Terzaghi, B. E., and Sandine, W. E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol 29:807-813. [0317]Tichaczek, P. S., R. F. Vogel, and W. P. Hammes. 1994. Cloning and sequencing of sakP encoding sakacin P, the bacteriocin produced by Lactobacillus sake LTH 673. Microbiology 140:361-367. [0318]Van Belkum, M. J., B. J. Hayema, R. E Jeeninga, J. Kok, and G. Venema. 1991. Organization and nucleotide sequences of two lactococcal bacteriocin operons. Appl. Environ. Microbiol. 57:492-498. [0319]Van Belkum, M. J., J. Kok, and G. Venema. 1992. Cloning, sequencing, and expression in Escherichia coli of IcnB, a third bacteriocin determinant from the lactococcal bacteriocin plasmid p9B4-6. Appl. Environ. Microbiol. 58:572-577. [0320]van Belkum. M. J. 1994. Lactococcins, bacteriocins of Lactococcus lactis, p. 301-318. In L. De Vuyst and E. J. Vandamme (ed.), Bacteriocins of Lactic Acid Bacteria: Microbiology, Genetics and Applications. Blackie Academic & Professional, Glasgow. [0321]van Belkum, M. J., and Stiles, M. E. (1995) Molecular characterization of genes involved in the production of the bacteriocin leucocin A from Leuconostoc gelidum. Appl Environ Microbiol 61: 3573-3579. [0322]van Belkum, M. J., Hayema, B. J., Geis, A., Kok, J., and Venema, G. (1989) Cloning of two bacteriocin genes from a lactococcal bacteriocin plasmid. Appl Environ Microbiol 55: 1187-1191. [0323]van Belkum, M. J., Hayema, B. J., Jeeninga, R. E., Kok, J., and Venema, G. (1991a) Organization and nucleotide sequences of two lactococcal bacteriocin operons. Appl Environ Microbiol 57: 492-498. [0324]Van Belkum, M. J., J. Kok, and G. Venema. 1992. Cloning, sequencing, and expression in Escherichia coil of IcnB, a third bacteriocin determinant from the lactococcal bacteriocin plasmid p9B4-6. Appl. Environ. Microbiol. 58:572-577. [0325]van Belkum, M. J., Kok, J., Venema, G., Halo, H., Nes, I. F., Konings, W. N., and Abee, T. (1991b) The bacteriocin lactococcin A specifically increases the permeability of lactococcal cytoplasmic membranes in a voltage-independent, protein-mediated manner. J Bacteriol 173: 7934-7941. [0326]van de Guchte, M., J. Kok, and G. Venema. 1992. Gene expression in Lactococcus lactis. FEMS Microbiol. Rev. 88:73-92. [0327]Van de Guchte, M., J. M, B. M. van der Vossen, J. Kok, and G. Venema. 1989. Construction of a lactococcal expression vector expression of hen egg white lysozyme in Lactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 55:224-228. [0328]van der Meer, J. R., Rollema, H. S., Siezen, R. J., Beerthuyzen, M. M., Kuipers, O. P., and de Vos, W. M. (1994) Influence of amino acid substitutions in the nisin leader peptide on biosynthesis and secretion of nisin by Lactococcus lactis. J Biol Chem 269: 3555-3562. [0329]Van der Vossen, J. M. B. M., D. van der Lelia, and G. Venema. 1987. Isolation and characterization of Streptococcus cremoris WG2-specific promoters. Appl. Environ. Microbiol. 48:2452-2457. [0330]van der Vossen, J. M. B. M., J. Kok, and G Venema (1985). Construction of cloning, promoter-screening, and terminator-screening shuttle vectors for Bacillus subtilis and Streptococcus lactis. Appl. Environ. Microbiol. 50:540-542. [0331]Vandamme (ed.), Bacteriocins of lactic acid bacteria: microbiology, genetics, and applications. Chapman and Hall, Ltd. London. [0332]Venema, K, Dost, M. H. R., Beun, Haandrikman, A. J., Venema, G., and Kok, J. (1996) The genes for secretion and maturation of lactococcins are located on the chromosome of
Lactococcus lactis IL1403. Appl Environ Microbiol 62: 1689-1692. [0333]Venema, K, Kok, J., Marugg, J. D., Toonen, M. Y., Ledeboer, A. M., Venema, G., and Chikindas, M. L. (1995) Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0: PedB is the immunity gene and PedD is the processing enzyme. Mol Microbiol 17: 515-522. [0334]Vieira, J., and J. Messing (1982). The pUC plasmids, an M13mp7-derived system insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268. [0335]Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153:3-11. [0336]Von Heijne, G. 1986. Net N--C charge imbalance may be important for signal sequence function in bacteria. J. Mol. Biol. 192:287-290.
[0337]Wandersman, C., and Delepelaire, P. (1990) TolC, an Escherichia coli outer membrane protein required for hemolysin secretion. Proc Natl Acad Sci USA 87: 4776-4780. [0338]Wilkinson, B. J., and D. Jones, 1977. A numerical taxonomic survey of Listeria and related bacteria. J. Gen. Microbiol. 98: 399-421. [0339]Worobo, R. W., T. Henkel, M. Sailer, K. L. Roy, J. C. Vederas, and M. E. Stiles. 1994. Characteristics and genetic determinant of a hydrophobic peptide bacteriocin, carnobacteriocin A, produced by Carnobacterium piscicola LV17A. Microbiology 140:517-526. [0340]Worobo, R. W., M. J. van Belkum, M. Sailer, K. L. Roy, J. C. Vederas, and M. E. Stiles. 1995. A signal peptide secretion-dependent bacteriocin from Carnobacterium divergens. J. Bacteriol. 177:3143-3149. [0341]Zhang, F., Greig, D. I., and Ling, V. (1993) Functional replacement of the hemolysin A transport signal by a different primary sequence. Proc Natl Acad Sci USA 90: 4211-4215. [0342]Zhang, F., Yin, Y., Arrowsmith, C. H., and Ling, V. (1995a) Secretion and circular dichroism analysis of the C-terminal signal peptides of HlyA and LktA. Biochemistry 34: 4193-4201. [0343]Zhang, L. H., M. J. Fath, H. K. Mahanty, P. C. Tai, and R. Kolter. 1995b. Genetic analysis of the colicin V secretion pathway. Genetics 141:25-32. [0344]Z niga, M., I. Pardo, and S. Ferrer, 1993. An improved medium for distinguishing between homofermentative and heterofermentative lactic acid bacteria. Int. J. Food Microbiol. 18:37-42.
Sequence CWU
1
801184DNADivergicin ARBS(24)..(28) 1atcttggtat cacaaactaa tttggaggtt
ggtatat atg aaa aaa caa att tta 55
Met Lys Lys Gln Ile Leu 1
5aaa ggg ttg gtt ata gtt gtt tgt tta tct ggg gca aca ttt ttc
tca 103Lys Gly Leu Val Ile Val Val Cys Leu Ser Gly Ala Thr Phe Phe
Ser 10 15 20aca cca caa caa
gct tct gct gta aat tat ggt aat ggt gtt tct tgc 151Thr Pro Gln Gln
Ala Ser Ala Val Asn Tyr Gly Asn Gly Val Ser Cys 25
30 35agt aaa aca aaa tgt tca gtt aac tgg gga caa
184Ser Lys Thr Lys Cys Ser Val Asn Trp Gly Gln 40
45249PRTDivergicin Amisc_feature(114)..(119)label=
restriction_site 2Met Lys Lys Gln Ile Leu Lys Gly Leu Val Ile Val Val Cys
Leu Ser1 5 10 15Gly Ala
Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala Val Asn Tyr 20
25 30Gly Asn Gly Val Ser Cys Ser Lys Thr
Lys Cys Ser Val Asn Trp Gly 35 40
45Gln349PRTLeuconostoc lactis 3Met Lys Lys Gln Ile Leu Lys Gly Leu Val
Ile Val Val Cys Leu Ser1 5 10
15Gly Ala Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala Val Asn Tyr
20 25 30Gly Asn Gly Val Ser Cys
Ser Lys Thr Lys Cys Ser Val Asn Trp Gly 35 40
45Gln44290DNALeucocin A gene; 4aatttttgcc catgctgcat
gatattttga ctaccaaaaa atatgcgtgt tgcgtacttc 60aatgttgata atttttttaa
agataattcc tctgacaaag ctagttatat taatttcttt 120caagagttaa atatttctca
actgccttct ttaattttta ctaatggaaa catggactat 180aaacgattat caatttatac
aattaaaaca ccaataaatg catggattac tgctattaat 240gacgaattaa tttcaaaaca
ttccaagcaa tcatcaacaa attaaaaatg gttaaggtca 300aaatgtttca aaaaagaata
aattatatcg cacaagtaga tgaacgtgat tgtggtgttg 360ctgcactcgc tatggtttta
actcattaca aaacacgcct gtccttagcc aaactacggg 420acctggccaa aactgacatg
gaaggaacga ctgctttagg cattgttaaa gctgcgaatg 480cgctagactt tgaaaccatg
ccgatccagg ctgatttgag tttattcgat aaaaaggatt 540taccctatcc ttttatcgcc
catgtcatta aagacggtaa atacccgcat tattatgtag 600tttatgggat caaaggtgat
cagctattaa tcgctgatcc agataatacc gttggtaaaa 660ataaaatgac aaaagcgcat
tttaatgagg agtggaccgg tgtgtccatt tttattgcgc 720ccaatccaac ctacaagcca
acaaaggata aaaagcgttc cttgacttct tttattccag 780tgattacgcg tcaaaaatta
ttagttatca atattgtcat tgctgccttg ttggttaccc 840tagtgagtat tttaggatca
tattatttgc aaggtatcat tgatacctat atccccgata 900acatgaaaaa caccctaggg
attgtgtcac tagggcttat ttttgcgtat gttatccaac 960aactgctctc ttatgccaga
gattatttat taattgtcat ggggcaacgc ctctcaattg 1020atattatttt gtcttatatc
aaacacattt ttgaactgcc aatgtctttt ttcgcgacgc 1080gtcgtaccgg tgaaattgtg
agccgtttta cggacgctaa tgccattatt gaagccctgg 1140caagcacgat gttatctgta
tttttagact taggaatttt ggtcattgtt ggcacagtgc 1200tagtggttca aaattcaacc
ttgtttctga tttctctgat tgccattccg gcttatgccc 1260tagtggtctg gctctttatg
cgtccttttt caaagatgaa taatgaccaa atgcaagcag 1320gttcgatgtt aagttcttcc
attattgaag atattaatgg cgttgagacg attaaagcgc 1380tgaatagtga agaaaccgcc
tatcataaaa ttgatcatga atttgtcact tatttagaaa 1440aatcatttgt ttacgctaaa
acagaagcca ctcaaaatgc gattaaaagc ctcttacagc 1500tctctttaaa tgtcgtgatc
ttatgggttg gcgcacaact ggtcatgacc aataaaatta 1560gtgttggtca actgatcact
tacaatgctt tattaggatt ttttacagat cccttgcaaa 1620atattattaa tttacaaact
aagctccaac aggcctcagt cgctaataat cgtttgaacg 1680aagtttattt ggttgattca
gaatttaaag ctagtcatca aatgacagaa agcattatgc 1740ccaatagctc attagtagcc
gatcatatca cctataaata cggttttggt gcgccagcaa 1800ttgatgatgt ttcactaacg
attacagccg gtgaaaaaat cgctttggtt gggattagtg 1860gatcaggtaa atcaacttta
gttaaattgc tggttaattt ctttcaacca gagtcaggga 1920caatttcact aggacaaaca
ccactcgcca atcttgataa acatgagcta agagcacaca 1980ttaattattt accacaagaa
ccctttatat tttccggttc aattatggac aacctgttat 2040tgggggctaa gccagggaca
acccaagaag atattatcag ggcggtagaa attgctgaaa 2100ttaaagatga tattgaaaaa
atgtcgcaag gatttggcac tgaactcgca gaaagtggca 2160atatttcggg tggtcaaaaa
caacgcattg ctttagctag agccatttta gtcgattctc 2220cggtgctgat tttagatgag
tcaaccagta atcttgatgt tttaacagaa aaaaagatta 2280ttgataatct catgcagtta
accgaaaaaa ccattatctt tgtagcgcac cgcttaacca 2340tttcacagcg agtagatcgt
attctaacca tgcaaaacgg caaaattatc gaagatggca 2400cgcataatac tctgcttaat
gccggtggtt tctacgcgtc attgtttaat cattaaggag 2460acctgatgtt tgatccaaaa
tacttagaaa gtggcgaatt ttatcaacgt cgttaccgca 2520attttccaac tctgattatt
gtgcctattt ttttgttagt cgtgtttatc attctattta 2580gcctatttgc taagcgtgaa
attgttgtca aagcaagtgg cgaaattatt ccagccaaag 2640tgctatcaga tatccaatca
accagtaaca atgccatcga tagtaaccaa ttaactgaaa 2700ataaagtggt taaaaaaggc
gataccttag tgacctttac cagtggtaat gaaaaaatat 2760cgtctcaatt actgacgcaa
caacttaata atcttaacga ccgtctaaaa agtcttgata 2820cctataagca gagtattgtt
aacggacgta gcgaatttgg tggcacagat caatttggtt 2880atgatagtct attcaacggc
tatatggcgc aagttgatac gttgacgagt gaatttaatc 2940aacaaagtag tgataaacaa
acagctgatc aacaagctaa tcatcaaatt gacgttttaa 3000aacaaggtca atctaaaaac
aatcaacaat tagctaatta tcaagctatt ctaaccagta 3060ttaatagcaa cactaaaccg
actaataatc cctatcaagc catttatgat aattattcag 3120cccagttaaa atcagcacaa
acaactgatg ataaagatca agtcaagcaa actgccttaa 3180gtaatgtaca acaacaaatt
gatcaattac aaacaacgag tagttcgtat gatagtcaaa 3240ttgctggtat tacaaagagt
ggtcctttat ctcaaagcag taccttagat aaaatcgctg 3300acttgaagca acaacaacta
gcgagtgctc aaaaagaaat caatgatcag caacaatcct 3360tagatgagtt aaaagccaag
caatcctctg ctaatgagga ttatcaagat acggttatta 3420aagcaccaga agatggcatt
ttacatttag ccactgacaa aactaaaatc aagtatttcc 3480ctaaaggcac aaccattgcg
caaatttatc ctaaactgac gcaaaaaaca gctttgaatg 3540ttgagtacta tgtgcctgcc
agtaatatta tcggcttaaa gcaaagacaa gccatccgtt 3600ttgtagcaaa tcaaaatgtc
acgaaaccgc tcaccttaaa cggaacaatc aaaagcatta 3660gttctgcacc aatagccagt
aaagagggat ccttttataa attagtcgcg acgattcagg 3720ctagcaaaat agaccgtgaa
cagattaaat atggtcttaa tggtcgaatc acaaccataa 3780aagggactaa aacatggttt
aattattata aagacattgt tttaggtgag aataattagc 3840taggaagata aacacaattt
ttaaacgtgt ttatcttttt tagtctcaat gaaattgtcg 3900ccgaaggttt ttctagccaa
gtggcaggac acagaaaaat gatagttgct actgaaggga 3960agttcaactg ccaccaaaaa
tagtaaccgc gcgacagcca accgccacca caacagttat 4020gctcgcccgt ggttattatt
atcattaaca ctcttacgtc tttctatgat acttttgagc 4080cacattctta taatgctgca
atcgaccttt tagaaaattg atctcatcag aaatttcttt 4140taagtggtta tcatcagcat
gtttactagc aatatttaat tctttaatcc tacgtttaat 4200caacttagta gttttagtat
ctttcatgta ttgattatct caaaaaaaca cccaacaagg 4260gcaatcagtt tgatttgagc
agaggaagcc 42905717PRTlcaC; 5Met Phe
Gln Lys Arg Ile Asn Tyr Ile Ala Gln Val Asp Glu Arg Asp1 5
10 15Cys Gly Val Ala Ala Leu Ala Met
Val Leu Thr His Tyr Lys Thr Arg 20 25
30Leu Ser Leu Ala Lys Leu Arg Asp Leu Ala Lys Thr Asp Met Glu
Gly 35 40 45Thr Thr Ala Leu Gly
Ile Val Lys Ala Ala Asn Ala Leu Asp Phe Glu 50 55
60Thr Met Pro Ile Gln Ala Asp Leu Ser Leu Phe Asp Lys Lys
Asp Leu65 70 75 80Pro
Tyr Pro Phe Ile Ala His Val Ile Lys Asp Gly Lys Tyr Pro His
85 90 95Tyr Tyr Val Val Tyr Gly Ile
Lys Gly Asp Gln Leu Leu Ile Ala Asp 100 105
110Pro Asp Asn Thr Val Gly Lys Asn Lys Met Thr Lys Ala His
Phe Asn 115 120 125Glu Glu Trp Thr
Gly Val Ser Ile Phe Ile Ala Pro Asn Pro Thr Tyr 130
135 140Lys Pro Thr Lys Asp Lys Lys Arg Ser Leu Thr Ser
Phe Ile Pro Val145 150 155
160Ile Thr Arg Gln Lys Leu Leu Val Ile Asn Ile Val Ile Ala Ala Leu
165 170 175Leu Val Thr Leu Val
Ser Ile Leu Gly Ser Tyr Tyr Leu Gln Gly Ile 180
185 190Ile Asp Thr Tyr Ile Pro Asp Asn Met Lys Asn Thr
Leu Gly Ile Val 195 200 205Ser Leu
Gly Leu Ile Phe Ala Tyr Val Ile Gln Gln Leu Leu Ser Tyr 210
215 220Ala Arg Asp Tyr Leu Leu Ile Val Met Gly Gln
Arg Leu Ser Ile Asp225 230 235
240Ile Ile Leu Ser Tyr Ile Lys His Ile Phe Glu Leu Pro Met Ser Phe
245 250 255Phe Ala Thr Arg
Arg Thr Gly Glu Ile Val Ser Arg Phe Thr Asp Ala 260
265 270Asn Ala Ile Ile Glu Ala Leu Ala Ser Thr Met
Leu Ser Val Phe Leu 275 280 285Asp
Leu Gly Ile Leu Val Ile Val Gly Thr Val Leu Val Val Gln Asn 290
295 300Ser Thr Leu Phe Leu Ile Ser Leu Ile Ala
Ile Pro Ala Tyr Ala Leu305 310 315
320Val Val Trp Leu Phe Met Arg Pro Phe Ser Lys Met Asn Asn Asp
Gln 325 330 335Met Gln Ala
Gly Ser Met Leu Ser Ser Ser Ile Ile Glu Asp Ile Asn 340
345 350Gly Val Glu Thr Ile Lys Ala Leu Asn Ser
Glu Glu Thr Ala Tyr His 355 360
365Lys Ile Asp His Glu Phe Val Thr Tyr Leu Glu Lys Ser Phe Val Tyr 370
375 380Ala Lys Thr Glu Ala Thr Gln Asn
Ala Ile Lys Ser Leu Leu Gln Leu385 390
395 400Ser Leu Asn Val Val Ile Leu Trp Val Gly Ala Gln
Leu Val Met Thr 405 410
415Asn Lys Ile Ser Val Gly Gln Leu Ile Thr Tyr Asn Ala Leu Leu Gly
420 425 430Phe Phe Thr Asp Pro Leu
Gln Asn Ile Ile Asn Leu Gln Thr Lys Leu 435 440
445Gln Gln Ala Ser Val Ala Asn Asn Arg Leu Asn Glu Val Tyr
Leu Val 450 455 460Asp Ser Glu Phe Lys
Ala Ser His Gln Met Thr Glu Ser Ile Met Pro465 470
475 480Asn Ser Ser Leu Val Ala Asp His Ile Thr
Tyr Lys Tyr Gly Phe Gly 485 490
495Ala Pro Ala Ile Asp Asp Val Ser Leu Thr Ile Thr Ala Gly Glu Lys
500 505 510Ile Ala Leu Val Gly
Ile Ser Gly Ser Gly Lys Ser Thr Leu Val Lys 515
520 525Leu Leu Val Asn Phe Phe Gln Pro Glu Ser Gly Thr
Ile Ser Leu Gly 530 535 540Gln Thr Pro
Leu Ala Asn Leu Asp Lys His Glu Leu Arg Ala His Ile545
550 555 560Asn Tyr Leu Pro Gln Glu Pro
Phe Ile Phe Ser Gly Ser Ile Met Asp 565
570 575Asn Leu Leu Leu Gly Ala Lys Pro Gly Thr Thr Gln
Glu Asp Ile Ile 580 585 590Arg
Ala Val Glu Ile Ala Glu Ile Lys Asp Asp Ile Glu Lys Met Ser 595
600 605Gln Gly Phe Gly Thr Glu Leu Ala Glu
Ser Gly Asn Ile Ser Gly Gly 610 615
620Gln Lys Gln Arg Ile Ala Leu Ala Arg Ala Ile Leu Val Asp Ser Pro625
630 635 640Val Leu Ile Leu
Asp Glu Ser Thr Ser Asn Leu Asp Val Leu Thr Glu 645
650 655Lys Lys Ile Ile Asp Asn Leu Met Gln Leu
Thr Glu Lys Thr Ile Ile 660 665
670Phe Val Ala His Arg Leu Thr Ile Ser Gln Arg Val Asp Arg Ile Leu
675 680 685Thr Met Gln Asn Gly Lys Ile
Ile Glu Asp Gly Thr His Asn Thr Leu 690 695
700Leu Asn Ala Gly Gly Phe Tyr Ala Ser Leu Phe Asn His705
710 7156457PRTlcaD; 6Met Phe Asp Pro Lys Tyr Leu Glu
Ser Gly Glu Phe Tyr Gln Arg Arg1 5 10
15Tyr Arg Asn Phe Pro Thr Leu Ile Ile Val Pro Ile Phe Leu
Leu Val 20 25 30Val Phe Ile
Ile Leu Phe Ser Leu Phe Ala Lys Arg Glu Ile Val Val 35
40 45Lys Ala Ser Gly Glu Ile Ile Pro Ala Lys Val
Leu Ser Asp Ile Gln 50 55 60Ser Thr
Ser Asn Asn Ala Ile Asp Ser Asn Gln Leu Thr Glu Asn Lys65
70 75 80Val Val Lys Lys Gly Asp Thr
Leu Val Thr Phe Thr Ser Gly Asn Glu 85 90
95Lys Ile Ser Ser Gln Leu Leu Thr Gln Gln Leu Asn Asn
Leu Asn Asp 100 105 110Arg Leu
Lys Ser Leu Asp Thr Tyr Lys Gln Ser Ile Val Asn Gly Arg 115
120 125Ser Glu Phe Gly Gly Thr Asp Gln Phe Gly
Tyr Asp Ser Leu Phe Asn 130 135 140Gly
Tyr Met Ala Gln Val Asp Thr Leu Thr Ser Glu Phe Asn Gln Gln145
150 155 160Ser Ser Asp Lys Gln Thr
Ala Asp Gln Gln Ala Asn His Gln Ile Asp 165
170 175Val Leu Lys Gln Gly Gln Ser Lys Asn Asn Gln Gln
Leu Ala Asn Tyr 180 185 190Gln
Ala Ile Leu Thr Ser Ile Asn Ser Asn Thr Lys Pro Thr Asn Asn 195
200 205Pro Tyr Gln Ala Ile Tyr Asp Asn Tyr
Ser Ala Gln Leu Lys Ser Ala 210 215
220Gln Thr Thr Asp Asp Lys Asp Gln Val Lys Gln Thr Ala Leu Ser Asn225
230 235 240Val Gln Gln Gln
Ile Asp Gln Leu Gln Thr Thr Ser Ser Ser Tyr Asp 245
250 255Ser Gln Ile Ala Gly Ile Thr Lys Ser Gly
Pro Leu Ser Gln Ser Ser 260 265
270Thr Leu Asp Lys Ile Ala Asp Leu Lys Gln Gln Gln Leu Ala Ser Ala
275 280 285Gln Lys Glu Ile Asn Asp Gln
Gln Gln Ser Leu Asp Glu Leu Lys Ala 290 295
300Lys Gln Ser Ser Ala Asn Glu Asp Tyr Gln Asp Thr Val Ile Lys
Ala305 310 315 320Pro Glu
Asp Gly Ile Leu His Leu Ala Thr Asp Lys Thr Lys Ile Lys
325 330 335Tyr Phe Pro Lys Gly Thr Thr
Ile Ala Gln Ile Tyr Pro Lys Leu Thr 340 345
350Gln Lys Thr Ala Leu Asn Val Glu Tyr Tyr Val Pro Ala Ser
Asn Ile 355 360 365Ile Gly Leu Lys
Gln Arg Gln Ala Ile Arg Phe Val Ala Asn Gln Asn 370
375 380Val Thr Lys Pro Leu Thr Leu Asn Gly Thr Ile Lys
Ser Ile Ser Ser385 390 395
400Ala Pro Ile Ala Ser Lys Glu Gly Ser Phe Tyr Lys Leu Val Ala Thr
405 410 415Ile Gln Ala Ser Lys
Ile Asp Arg Glu Gln Ile Lys Tyr Gly Leu Asn 420
425 430Gly Arg Ile Thr Thr Ile Lys Gly Thr Lys Thr Trp
Phe Asn Tyr Tyr 435 440 445Lys Asp
Ile Val Leu Gly Glu Asn Asn 450 455735PRTDivergicin
N-terminal;Cleavage_site(29)..(30) 7Met Lys Lys Gln Ile Leu Lys Gly Leu
Val Ile Val Val Cys Leu Ser1 5 10
15Gly Ala Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala Ala Ala
Pro 20 25 30Lys Ile Thr
35829PRTDivergicin N-terminal; 8Met Lys Lys Gln Ile Leu Lys Gly Leu Val
Ile Val Val Cys Leu Ser1 5 10
15Gly Ala Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala 20
25930PRTLeucocin N-terminal;cleavage_site(24)..(25) 9Met
Met Asn Met Lys Pro Thr Glu Ser Tyr Glu Gln Leu Asp Asn Ser1
5 10 15Ala Leu Glu Gln Val Val Gly
Gly Lys Tyr Tyr Gly Asn Gly 20 25
301024PRTLeucocin N-terminal; 10Met Met Asn Met Lys Pro Thr Glu Ser
Tyr Glu Gln Leu Asp Asn Ser1 5 10
15Ala Leu Glu Gln Val Val Gly Gly
201127PRTLactococcin A N-terminal;cleavage_site(21)..(22) 11Met Lys Asn
Gln Leu Asn Phe Asn Ile Val Ser Asp Glu Glu Leu Ser1 5
10 15Glu Ala Asn Gly Gly Lys Leu Thr Phe
Ile Gln 20 251221PRTLactococcin A; 12Met Lys
Asn Gln Leu Asn Phe Asn Ile Val Ser Asp Glu Glu Leu Ser1 5
10 15Glu Ala Asn Gly Gly
201321PRTcolicin V N-terminal;cleavage_site(15)..(16) 13Met Arg Thr Leu
Thr Leu Asn Glu Leu Asp Ser Val Ser Gly Gly Ala1 5
10 15Ser Gly Arg Asp Ile
201415PRTcolicin V; 14Met Arg Thr Leu Thr Leu Asn Glu Leu Asp Ser Val Ser
Gly Gly1 5 10
15153475DNAplasmid; 15gatatcttgg tattacaaac taattggagg ttggtatata
tgaaaaaaca aattttaaaa 60gggttggtta tagttgtttg tttatctggg gcaacatttt
tctcaacacc acaacaagct 120tctgctgctg caccgaaaat tactcaaaaa caaaaaaatt
gtgttaatgg acaattaggt 180ggaatgcttg ctggagcttt gggtggacct ggcggagttg
tgttaggtgg tataggtggt 240gcaatagcag gaggttgttt taattaaatg aaaataaaat
ggtactggga atctctgatt 300gaaaccttaa tatttataat tgttcttctt gtattttttt
atagaagttc tggtttttct 360ttaaaaaatt tagttttagg aagtttattt tatttgatag
caattggtct ttttaattat 420aaaaagataa acaaataggc actattttta aatttacaac
ttttgcattt taagtatatt 480gttgttatta ttaaggtgcg agatgagata aggtctacat
ggacagcaca aaacccaccc 540ctaatgcgaa taggggtggg tttttttcgt tcgttgcgaa
tacgaacgtg tgggttagag 600acaacttgcg agattatcgt ctaatcatct aaccaatgat
ccactagtat taatactagt 660cccacaaaaa gtggagcaat aaccaatgag ataaggtttt
ccataaacag cacccccttt 720caggggcaag ttgccactta ctaatatagc acagctcctt
tattgttctt agtctaaatc 780tgataaatct tttcttgttc aaaaatatag accacttaaa
agcttataac ggtactagat 840ttttcagata ccccaattac ctacttaaaa cgtctctctt
tttcgtttta agatgtttaa 900aattattttc tatgaattat acacaaatgt gcttaaatcg
tcttaaatcg tcttaaaatg 960tggtctgtgt tgagaataca acgactttgt ttggtcgtac
ctctaaatct gtttgctgtg 1020aacgagggta gcgaagtgaa ctttttgttg ctaacgctct
tggttttgtc ttttgatttt 1080ataaaatgtg gatgtaatcc actccttact aggggtttaa
tctttataaa ataaaggagc 1140ttgcgaatgc aaggtgccct tttttctttg tctgactact
agggacaaat tatctgagta 1200tgaacaagat tttgtctgtt cttgcgcgta tttattaata
tatattttaa gagatatttt 1260aagagatatt ttaaaacctt tttaggggtg agctcagcct
tagagagagt aagcattgaa 1320gcatagtact agggacaaat tatctgacta ctagggataa
attatctgac tactagggac 1380aaattatctg actactaggg ataaattatc tgactactag
ggacgcactt tactttgtgt 1440atcgtatcgt ttataatctt tatatgtgag gggaggtcga
aaggattgga aaagaaaacg 1500aatttaaaaa ttgcatatca aaatgaattg aatctggttc
cacttaaaaa tttcaatgct 1560aaacaaatgg atttattctt tgctttgtgt gcccgaatga
aaaataaagg gcttagaaag 1620gtatctttta cgtttgaaga actaagagaa ctaagtgatt
acaagataac tgctatcgaa 1680ccgttcacga atgatttaga acaattatac aaaaaaatgt
taaacctaac atacagaacg 1740gagacagaaa caaaaatcag ttatttcgtt ttatttactg
ggtttgtgat tgataaatca 1800gagcaaattg ttgaagttag tgtaaaccca gacttagaac
atatcattaa cggtatctct 1860agtgagttca ataaatttga gttactagca ttcacaagta
tccagtcgaa atatacgaaa 1920acactcttta gattgcttat gcagtttcaa tcaactgggt
tttatgtggt taaaattgaa 1980gatttcagag cacttttaga cattccaaaa tcttatcaaa
tgactgacat aacccaacgg 2040atattgaaac ctagtttaat tgagttaagt cagtacttta
atgatttaaa agttaataaa 2100attaaagctc gaaagggtaa taaaatagac cgtttagaat
tcactttctc cggtctaaag 2160actgatttac ctaaagttcc attgcacgac tggacgaaat
aaaaaaagga cctccccctc 2220acatttaagc aagtaggaac gtccctcgca atccacgaag
actgctgatt cattttagca 2280tatattgtgc gggacttcta aataaattat atttggaggt
catttttatg tcgaataagt 2340acttgaaaaa aagaaagcgt caagctaagc aggtagctga
tttgtacgat ttaattattg 2400gggttgaaca tgctggcagc tcgttaattg cgttgtatga
gggaattaaa ccctctcaat 2460atcgaatttt tattcttttg tcttattcta gttttgaaaa
taaattaaac ttatacaaca 2520aagcgatttt aagaactgaa gtttattctt tagaaaaaaa
attaaacgaa aaaataaatg 2580ctcaaatcag aattgcgcaa aaaaataaaa aagaaattgc
ggtaattgat ttcacaaaac 2640aaaaagaaaa actcaaaaga gaattactta gttttgaaaa
tgataaagaa atgaaactta 2700tggattcgca attaaaacaa tttcatgaaa ataaaacgtt
agctgatatt aatgatcagt 2760tttttatgac ggtacaaaat agtttaattt tgctgcataa
aaaagcacct ttaacattaa 2820aattaatttg tttgaaaaat tatattcgcc tttgcaaaaa
ttattttcta aagaatatat 2880tttaatgttt tttgaaaaaa atagtaacat gggaacatgt
tgctctgctc gcaaaaggaa 2940aaatatttaa actaataaaa aaccgtcgga gaccagccaa
ccaataggtt ggctttaagt 3000ttaagcctac gttgacaact gtcaatgtat aagtgcgccc
tttgggtgtt ttattttttg 3060tttaactatt attttctgca taggtttttt atttttatta
atttgatttt caagaaaggg 3120atgaacctaa aatgatttat aaacaaaaaa agaaagaaga
tgtttttgga tttcctaaag 3180ttttaacaat tgctgatttg agtacgagat ggaaaatgtc
acgtcaagct atccataaaa 3240aaattcaaga agatttatta tttcctatgc ctgttcaaat
tgtctcaaat ggaaaaatta 3300aattgttttt atttgttgat attgaaaaat acgaaaaaaa
tcgtccgtgg ttattagaca 3360ttaattatcg aaatgaacga caactttgga tttacaaaaa
tggttttttt aaatagcaag 3420ttagtcaatt accttatacc ttgttggata tctttggata
aaaaaatagt tgtat 347516227DNADivergicin structural
gene;CDS(1)..(225) 16atg aaa aaa caa att tta aaa ggg ttg gtt ata gtt gtt
tgt tta tct 48Met Lys Lys Gln Ile Leu Lys Gly Leu Val Ile Val Val
Cys Leu Ser1 5 10 15ggg
gca aca ttt ttc tca aca cca caa caa gct tct gct gct gca ccg 96Gly
Ala Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala Ala Ala Pro 20
25 30aaa att act caa aaa caa aaa aat
tgt gtt aat gga caa tta ggt gga 144Lys Ile Thr Gln Lys Gln Lys Asn
Cys Val Asn Gly Gln Leu Gly Gly 35 40
45atg ctt gct gga gct ttg ggt gga cct ggc gga gtt gtg tta ggt ggt
192Met Leu Ala Gly Ala Leu Gly Gly Pro Gly Gly Val Val Leu Gly Gly
50 55 60ata ggt ggt gca ata gca gga ggt
tgt ttt aat ta 227Ile Gly Gly Ala Ile Ala Gly Gly
Cys Phe Asn65 70 751775PRTDivergicin
structural gene; 17Met Lys Lys Gln Ile Leu Lys Gly Leu Val Ile Val Val
Cys Leu Ser1 5 10 15Gly
Ala Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala Ala Ala Pro 20
25 30Lys Ile Thr Gln Lys Gln Lys Asn
Cys Val Asn Gly Gln Leu Gly Gly 35 40
45Met Leu Ala Gly Ala Leu Gly Gly Pro Gly Gly Val Val Leu Gly Gly
50 55 60Ile Gly Gly Ala Ile Ala Gly Gly
Cys Phe Asn65 70 751875PRTDivergicin
structural gene 18Met Lys Lys Gln Ile Leu Lys Gly Leu Val Ile Val Val Cys
Leu Ser1 5 10 15Gly Ala
Thr Phe Phe Ser Thr Pro Gln Gln Ala Ser Ala Ala Ala Pro 20
25 30Lys Ile Thr Gln Lys Gln Lys Asn Cys
Val Asn Gly Gln Leu Gly Gly 35 40
45Met Leu Ala Gly Ala Leu Gly Gly Pro Gly Gly Val Val Leu Gly Gly 50
55 60Ile Gly Gly Ala Ile Ala Gly Gly Cys
Phe Asn65 70 7519170DNAdivergicin
immunity gene;CDS(1)..(168) 19atg aaa ata aaa tgg tac tgg gaa tct ctg att
gaa acc tta ata ttt 48Met Lys Ile Lys Trp Tyr Trp Glu Ser Leu Ile
Glu Thr Leu Ile Phe1 5 10
15ata att gtt ctt ctt gta ttt ttt tat aga agt tct ggt ttt tct tta
96Ile Ile Val Leu Leu Val Phe Phe Tyr Arg Ser Ser Gly Phe Ser Leu
20 25 30aaa aat tta gtt tta gga agt
tta ttt tat ttg ata gca att ggt ctt 144Lys Asn Leu Val Leu Gly Ser
Leu Phe Tyr Leu Ile Ala Ile Gly Leu 35 40
45ttt aat tat aaa aag ata aac aaa ta
170Phe Asn Tyr Lys Lys Ile Asn Lys 50
552056PRTdivergicin immunity gene; 20Met Lys Ile Lys Trp Tyr Trp Glu Ser
Leu Ile Glu Thr Leu Ile Phe1 5 10
15Ile Ile Val Leu Leu Val Phe Phe Tyr Arg Ser Ser Gly Phe Ser
Leu 20 25 30Lys Asn Leu Val
Leu Gly Ser Leu Phe Tyr Leu Ile Ala Ile Gly Leu 35
40 45Phe Asn Tyr Lys Lys Ile Asn Lys 50
552156PRTDivergicin immunity gene 21Met Lys Ile Lys Trp Tyr Trp Glu
Ser Leu Ile Glu Thr Leu Ile Phe1 5 10
15Ile Ile Val Leu Leu Val Phe Phe Tyr Arg Ser Ser Gly Phe
Ser Leu 20 25 30Lys Asn Leu
Val Leu Gly Ser Leu Phe Tyr Leu Ile Ala Ile Gly Leu 35
40 45Phe Asn Tyr Lys Lys Ile Asn Lys 50
5522124DNADivergicin signal peptide;sig_peptide(1)..(123) 22atc
ttg gta tca caa act aat ttg gag gtt ggt ata tat gaa aaa aca 48Ile
Leu Val Ser Gln Thr Asn Leu Glu Val Gly Ile Tyr Glu Lys Thr1
5 10 15aat ttt aaa agg gtt ggt tat
agt tgt ttg ttt atc tgg ggc aac att 96Asn Phe Lys Arg Val Gly Tyr
Ser Cys Leu Phe Ile Trp Gly Asn Ile 20 25
30ttt ctc aac acc aca aca agc ttc tgc t
124Phe Leu Asn Thr Thr Thr Ser Phe Cys 35
402341PRTDivergicin signal peptide; 23Ile Leu Val Ser Gln Thr Asn Leu
Glu Val Gly Ile Tyr Glu Lys Thr1 5 10
15Asn Phe Lys Arg Val Gly Tyr Ser Cys Leu Phe Ile Trp Gly
Asn Ile 20 25 30Phe Leu Asn
Thr Thr Thr Ser Phe Cys 35 402441PRTdivergicin
signal peptide 24Ile Leu Val Ser Gln Thr Asn Leu Glu Val Gly Ile Tyr Glu
Lys Thr1 5 10 15Asn Phe
Lys Arg Val Gly Tyr Ser Cys Leu Phe Ile Trp Gly Asn Ile 20
25 30Phe Leu Asn Thr Thr Thr Ser Phe Cys
35 4025675DNABrochocin-C; 25gctattttga gaaatattaa
ccaatagtaa aaattatcat gctatctttt gtatgtaata 60aaaattattt aaaggagggt
gtttcatcat gcacaaggta aaaaaattaa acaatcaaga 120gttacaacag atcgtgggag
gttacagttc aaaagattgt ctaaaagata ttggtaaagg 180aattggtgct ggtacagtag
ctggggcagc cggcggtggc ctagctgcag gattaggtgc 240tatcccagga gcattcgttg
gagcacattt tggagtaatc ggcggatctg ccgcatgcat 300tggtggatta ttaggtaact
aggaggttat atttatgaaa aaagaactat tgaataaaaa 360tgaaatgagt agaattatcg
gcggcaaaat aaattgggga aatgttggcg gttcttgtgt 420tggaggtgca gtaattggag
gcgccctcgg tggactaggt ggagctggcg gaggttgcat 480tacaggagct atcggaagta
tttgggatca atggtaaaaa ctatactatt ttcggttgta 540atttcattcg ttgcattatg
taacttttta ataaaaaaag atgtgtcttc aaaaaaaaaa 600ttatttttaa caggttctat
tgctgtcttt ctaattatct atgattttct atggattata 660ttctctaact agtac
67526233DNABrochocin-C
peptide A;CDS(1)..(231) 26atg cac aag gta aaa aaa tta aac aat caa gag tta
caa cag atc gtg 48Met His Lys Val Lys Lys Leu Asn Asn Gln Glu Leu
Gln Gln Ile Val1 5 10
15gga ggt tac agt tca aaa gat tgt cta aaa gat att ggt aaa gga att
96Gly Gly Tyr Ser Ser Lys Asp Cys Leu Lys Asp Ile Gly Lys Gly Ile
20 25 30ggt gct ggt aca gta gct ggg
gca gcc ggc ggt ggc cta gct gca gga 144Gly Ala Gly Thr Val Ala Gly
Ala Ala Gly Gly Gly Leu Ala Ala Gly 35 40
45tta ggt gct atc cca gga gca ttc gtt gga gca cat ttt gga gta
atc 192Leu Gly Ala Ile Pro Gly Ala Phe Val Gly Ala His Phe Gly Val
Ile 50 55 60ggc gga tct gcc gca tgc
att ggt gga tta tta ggt aac ta 233Gly Gly Ser Ala Ala Cys
Ile Gly Gly Leu Leu Gly Asn65 70
752777PRTBrochocin-C peptide A; 27Met His Lys Val Lys Lys Leu Asn Asn Gln
Glu Leu Gln Gln Ile Val1 5 10
15Gly Gly Tyr Ser Ser Lys Asp Cys Leu Lys Asp Ile Gly Lys Gly Ile
20 25 30Gly Ala Gly Thr Val Ala
Gly Ala Ala Gly Gly Gly Leu Ala Ala Gly 35 40
45Leu Gly Ala Ile Pro Gly Ala Phe Val Gly Ala His Phe Gly
Val Ile 50 55 60Gly Gly Ser Ala Ala
Cys Ile Gly Gly Leu Leu Gly Asn65 70
752877PRTbrochocin C, peptide A 28Met His Lys Val Lys Lys Leu Asn Asn Gln
Glu Leu Gln Gln Ile Val1 5 10
15Gly Gly Tyr Ser Ser Lys Asp Cys Leu Lys Asp Ile Gly Lys Gly Ile
20 25 30Gly Ala Gly Thr Val Ala
Gly Ala Ala Gly Gly Gly Leu Ala Ala Gly 35 40
45Leu Gly Ala Ile Pro Gly Ala Phe Val Gly Ala His Phe Gly
Val Ile 50 55 60Gly Gly Ser Ala Ala
Cys Ile Gly Gly Leu Leu Gly Asn65 70
7529182DNABrochocin-C peptide B;CDS(1)..(177) 29atg aaa aaa gaa cta ttg
aat aaa aat gaa atg agt aga att atc ggc 48Met Lys Lys Glu Leu Leu
Asn Lys Asn Glu Met Ser Arg Ile Ile Gly1 5
10 15ggc aaa ata aat tgg gga aat gtt ggc ggt tct tgt
gtt gga ggt gca 96Gly Lys Ile Asn Trp Gly Asn Val Gly Gly Ser Cys
Val Gly Gly Ala 20 25 30gta
att gga ggc gcc ctc ggt gga cta ggt gga gct ggc gga ggt tgc 144Val
Ile Gly Gly Ala Leu Gly Gly Leu Gly Gly Ala Gly Gly Gly Cys 35
40 45att aca gga gct atc gga agt att tgg
gat caa tggta 182Ile Thr Gly Ala Ile Gly Ser Ile Trp
Asp Gln 50 553059PRTBrochocin-C peptide B; 30Met Lys
Lys Glu Leu Leu Asn Lys Asn Glu Met Ser Arg Ile Ile Gly1 5
10 15Gly Lys Ile Asn Trp Gly Asn Val
Gly Gly Ser Cys Val Gly Gly Ala 20 25
30Val Ile Gly Gly Ala Leu Gly Gly Leu Gly Gly Ala Gly Gly Gly
Cys 35 40 45Ile Thr Gly Ala Ile
Gly Ser Ile Trp Asp Gln 50 553160PRTBrochocin-C,
peptide B 31Met Lys Lys Glu Leu Leu Asn Lys Asn Glu Met Ser Arg Ile Ile
Gly1 5 10 15Gly Lys Ile
Asn Trp Gly Asn Val Gly Gly Ser Cys Val Gly Gly Ala 20
25 30Val Ile Gly Gly Ala Leu Gly Gly Leu Gly
Gly Ala Gly Gly Gly Cys 35 40
45Ile Thr Gly Ala Ile Gly Ser Ile Trp Asp Gln Trp 50
55 6032161DNABrochocin-C immunity peptide;CDS(1)..(159)
32atg gta aaa act ata cta ttt tcg gtt gta att tca ttc gtt gca tta
48Met Val Lys Thr Ile Leu Phe Ser Val Val Ile Ser Phe Val Ala Leu1
5 10 15tgt aac ttt tta ata aaa
aaa gat gtg tct tca aaa aaa aaa tta ttt 96Cys Asn Phe Leu Ile Lys
Lys Asp Val Ser Ser Lys Lys Lys Leu Phe 20 25
30tta aca ggt tct att gct gtc ttt cta att atc tat gat
ttt cta tgg 144Leu Thr Gly Ser Ile Ala Val Phe Leu Ile Ile Tyr Asp
Phe Leu Trp 35 40 45att ata ttc
tct aac ta 161Ile Ile Phe
Ser Asn 503353PRTBrochocin-C immunity peptide; 33Met Val Lys Thr Ile
Leu Phe Ser Val Val Ile Ser Phe Val Ala Leu1 5
10 15Cys Asn Phe Leu Ile Lys Lys Asp Val Ser Ser
Lys Lys Lys Leu Phe 20 25
30Leu Thr Gly Ser Ile Ala Val Phe Leu Ile Ile Tyr Asp Phe Leu Trp
35 40 45Ile Ile Phe Ser Asn
503453PRTBrochocin-C immunity peptide 34Met Val Lys Thr Ile Leu Phe Ser
Val Val Ile Ser Phe Val Ala Leu1 5 10
15Cys Asn Phe Leu Ile Lys Lys Asp Val Ser Ser Lys Lys Lys
Leu Phe 20 25 30Leu Thr Gly
Ser Ile Ala Val Phe Leu Ile Ile Tyr Asp Phe Leu Trp 35
40 45Ile Ile Phe Ser Asn 50352226DNAEnterocin
900 operon; 35aagctttact tgatattagt tctgagttct gcctgattta tcagtaacat
aactctagag 60ataactgcgt cgctatctca agttcttttt tcttttctta caaaataaat
atactttatt 120tcattttata agtcaacgtt ttcattgctt ataaattagt ttttttaatc
atctcagtaa 180taatttgcta tgtcagttcg atcaatacca tttgcatgaa agtacagcta
taagccaatc 240acacctaacc tactcttaat cgtataatga ttccagttag caaggtcttt
aatactcatg 300atccccatct ggttgagttt ttttcattcg aaaccctatg ccccaaaaga
ccgtcatttt 360aggaatattc catactttct caggaacatt ttgatacgtc cattcagcaa
taaacccttc 420attgtgcttc gcttcattgt ctaaggcgag tttggccaaa ggggattatc
tccgcgacac 480ctaccgtagc aatcaatcct aattcttctt taatacgttc cttggatcat
ttgaacgaat 540tttttccttc tctgacttct tgttccttca gtcgtaaaaa tattcagtga
tctggtcact 600tttaaaatgg gttcatcgat tggatacatc agtagatctt cgtcagccac
atatcttttg 660aaaatattat ttacccgcat atttcgcttg atatataggt tcatacgtgg
tggaacaacg 720tatgatgttt taggaaatag ttgtgataaa tcacgtggtc tactcacatt
tgtaatatca 780taccgctttt ttgcttcagg agaagaagct ctaatatcaa tcctaaacca
gtattgtcag 840cgcgactcat aacaacaagt tctgttgtta atggatcaaa atttctttct
atacactcga 900tactcgcata aaaaggcttc atgtcgatta gaaaataatc atttactgat
tctttcgaat 960aatccagcat gaataacacc cattcttttt cacattacac aaacgtaagt
taggaaatat 1020aaagaagaaa actaaatagc actaaacaaa caagacaact catgcttatt
ccgtataaga 1080aactacatat tatgttaact agttattaaa ataacatatt taataaaatt
aaattgtgat 1140tttataggtt tcaggaatga aaaagcctta tttcaggaag tttttaactg
tttgctatag 1200atgtatgtca tgatagcatc gtaataaaaa tactctaaaa ggagcgagtt
taaatatgca 1260aaatgtaaaa gaattaagta cgaaagagat gaaacaaatt atcggtggag
aaaatgatca 1320cagaatgcct aatgagttaa atagacctaa caacttatct aaaggtggag
caaaatgtgg 1380tgctgcaatt gctgggggat tatttggaat cccaaaagga ccactagcat
gggctgctgg 1440gttagcaaat gtatactcta aatgcaacta aaaaagaaga gaaaaaactc
attacgagtt 1500ttttctcttc tttttttgca tgaaattagg aataactaat aaaacaatag
caatcaatag 1560taaaatctta cttaatatag tttcggaaaa aataaataat cctaaattta
taattactgc 1620taaaaaaatg cataaattat actctaaatt attttttttt aaattcataa
tataaacatc 1680ctctctttaa ttagtctacc attccgaaat atttcatccc cagctctttt
tttactaata 1740taccaactac atttaataac aaaataacta gtaaacttaa tatttttagt
ggcatagaat 1800attcaaaaat aaataaaggc accatacatg tagctatcaa tataaataca
gaacttacgt 1860attttattat tttacggaac attataacct attacaactc cgcaaatagc
catagcccat 1920accatagata agatttttac cagcaccacc accacatgtt tgttttatct
ctttcatact 1980taattttttt acattttgca tgtctctaca tgctcctttt aaagtttttt
tagaacctca 2040cgactataac atggataatt taatcgtggt caaaaacttc ctgaaatagg
gtgtttcata 2100tcctgaacac gaatttttag tcaattttcg aaaaatgaaa ctttaaaatt
tctttgacca 2160gaactctatt tattcttgtg ttgttccttc gaataggttc ccgtatatct
tttttatttg 2220aagctt
222636215DNAEnterocin 900 peptide;CDS(1)..(213) 36atg caa aat
gta aaa gaa tta agt acg aaa gag atg aaa caa att atc 48Met Gln Asn
Val Lys Glu Leu Ser Thr Lys Glu Met Lys Gln Ile Ile1 5
10 15ggt gga gaa aat gat cac aga atg cct
aat gag tta aat aga cct aac 96Gly Gly Glu Asn Asp His Arg Met Pro
Asn Glu Leu Asn Arg Pro Asn 20 25
30aac tta tct aaa ggt gga gca aaa tgt ggt gct gca att gct ggg gga
144Asn Leu Ser Lys Gly Gly Ala Lys Cys Gly Ala Ala Ile Ala Gly Gly
35 40 45tta ttt gga atc cca aaa gga
cca cta gca tgg gct gct ggg tta gca 192Leu Phe Gly Ile Pro Lys Gly
Pro Leu Ala Trp Ala Ala Gly Leu Ala 50 55
60aat gta tac tct aaa tgc aac ta
215Asn Val Tyr Ser Lys Cys Asn65 703771PRTEnterocin
900 peptide; 37Met Gln Asn Val Lys Glu Leu Ser Thr Lys Glu Met Lys Gln
Ile Ile1 5 10 15Gly Gly
Glu Asn Asp His Arg Met Pro Asn Glu Leu Asn Arg Pro Asn 20
25 30Asn Leu Ser Lys Gly Gly Ala Lys Cys
Gly Ala Ala Ile Ala Gly Gly 35 40
45Leu Phe Gly Ile Pro Lys Gly Pro Leu Ala Trp Ala Ala Gly Leu Ala 50
55 60Asn Val Tyr Ser Lys Cys Asn65
703871PRTEnterocin 900 peptide 38Met Gln Asn Val Lys Glu Leu
Ser Thr Lys Glu Met Lys Gln Ile Ile1 5 10
15Gly Gly Glu Asn Asp His Arg Met Pro Asn Glu Leu Asn
Arg Pro Asn 20 25 30Asn Leu
Ser Lys Gly Gly Ala Lys Cys Gly Ala Ala Ile Ala Gly Gly 35
40 45Leu Phe Gly Ile Pro Lys Gly Pro Leu Ala
Trp Ala Ala Gly Leu Ala 50 55 60Asn
Val Tyr Ser Lys Cys Asn65 7039103PRTColicin V
pre-peptide;DISULFID(91)..(102) 39Met Arg Thr Leu Thr Leu Asn Glu Leu Asp
Ser Val Ser Gly Gly Ala1 5 10
15Ser Gly Arg Asp Ile Ala Met Ala Ile Gly Thr Leu Ser Gly Gln Phe
20 25 30Val Ala Gly Gly Ile Gly
Ala Ala Ala Gly Gly Val Ala Gly Gly Ala 35 40
45Ile Tyr Asp Tyr Ala Ser Thr His Lys Pro Asn Pro Ala Met
Ser Pro 50 55 60Ser Gly Leu Gly Gly
Thr Ile Lys Gln Lys Pro Glu Gly Ile Pro Ser65 70
75 80Glu Ala Trp Asn Tyr Ala Ala Gly Arg Leu
Cys Asn Trp Ser Pro Asn 85 90
95Asn Leu Ser Asp Val Cys Leu 1004088PRTColicin
V;DISULFID(76)..(87) 40Ala Ser Gly Arg Asp Ile Ala Met Ala Ile Gly Thr
Leu Ser Gly Gln1 5 10
15Phe Val Ala Gly Gly Ile Gly Ala Ala Ala Gly Gly Val Ala Gly Gly
20 25 30Ala Ile Tyr Asp Tyr Ala Ser
Thr His Lys Pro Asn Pro Ala Met Ser 35 40
45Pro Ser Gly Leu Gly Gly Thr Ile Lys Gln Lys Pro Glu Gly Ile
Pro 50 55 60Ser Glu Ala Trp Asn Tyr
Ala Ala Gly Arg Leu Cys Asn Trp Ser Pro65 70
75 80Asn Asn Leu Ser Asp Val Cys Leu
8541675DNAcarnobacteriocin BM1;RBS(89)..(93) 41tcgagatacg tttatccatg
gttcaggatg attttatcaa cgagttaatt atttatgcta 60cagtaaactt gttactaaat
actttataag gagtgtatgt ac atg aaa agc gtt 114
Met Lys Ser Val
1aaa gaa cta aat aaa aaa gaa atg caa caa att aat ggt gga gct
atc 162Lys Glu Leu Asn Lys Lys Glu Met Gln Gln Ile Asn Gly Gly Ala
Ile5 10 15 20tct tat
ggc aat ggt gtt tat tgt aac aaa gag aaa tgt tgg gta aac 210Ser Tyr
Gly Asn Gly Val Tyr Cys Asn Lys Glu Lys Cys Trp Val Asn 25
30 35aag gca gaa aac aaa caa gct att
act gga ata gtt atc ggt gga tgg 258Lys Ala Glu Asn Lys Gln Ala Ile
Thr Gly Ile Val Ile Gly Gly Trp 40 45
50gct tct agt tta gca gga atg gga cat taaagaggta tctagtt atg ata
308Ala Ser Ser Leu Ala Gly Met Gly His Met Ile
55 60aaa gat gaa aaa ata aat aaa atc tat gct tta
gtt aag agc gca ctt 356Lys Asp Glu Lys Ile Asn Lys Ile Tyr Ala Leu
Val Lys Ser Ala Leu 65 70 75gat aat
acg gat gtt aag aat gat aaa aaa ctt tct tta ctt ctt atg 404Asp Asn
Thr Asp Val Lys Asn Asp Lys Lys Leu Ser Leu Leu Leu Met80
85 90 95aga ata caa gaa aca tca att
aat gga gaa cta ttt tac gat tat aaa 452Arg Ile Gln Glu Thr Ser Ile
Asn Gly Glu Leu Phe Tyr Asp Tyr Lys 100
105 110aaa gaa tta cag cca gct att agt atg tac tct att
caa cat aac ttt 500Lys Glu Leu Gln Pro Ala Ile Ser Met Tyr Ser Ile
Gln His Asn Phe 115 120 125cgg
gtt cct gac gat cta gta aaa ctg tta gca tta gtt caa aca cct 548Arg
Val Pro Asp Asp Leu Val Lys Leu Leu Ala Leu Val Gln Thr Pro 130
135 140aaa gct tgg tca ggg ttt taactttagt
tccagatgag ttaaaatcct 596Lys Ala Trp Ser Gly Phe
145taaaaataag gaataatggt aaatcagcat tccttatttt tatagtcatc acactataac
656tttacttaaa gatgttcga
6754261PRTcarnobacteriocin BM1; 42Met Lys Ser Val Lys Glu Leu Asn Lys Lys
Glu Met Gln Gln Ile Asn1 5 10
15Gly Gly Ala Ile Ser Tyr Gly Asn Gly Val Tyr Cys Asn Lys Glu Lys
20 25 30Cys Trp Val Asn Lys Ala
Glu Asn Lys Gln Ala Ile Thr Gly Ile Val 35 40
45Ile Gly Gly Trp Ala Ser Ser Leu Ala Gly Met Gly His 50
55 604388PRTcarnobacteriocin BM1; 43Met
Ile Lys Asp Glu Lys Ile Asn Lys Ile Tyr Ala Leu Val Lys Ser1
5 10 15Ala Leu Asp Asn Thr Asp Val
Lys Asn Asp Lys Lys Leu Ser Leu Leu 20 25
30Leu Met Arg Ile Gln Glu Thr Ser Ile Asn Gly Glu Leu Phe
Tyr Asp 35 40 45Tyr Lys Lys Glu
Leu Gln Pro Ala Ile Ser Met Tyr Ser Ile Gln His 50 55
60Asn Phe Arg Val Pro Asp Asp Leu Val Lys Leu Leu Ala
Leu Val Gln65 70 75
80Thr Pro Lys Ala Trp Ser Gly Phe 854461PRTCarnobacterium
B2 44Met Lys Ser Val Lys Glu Leu Asn Lys Lys Glu Met Gln Gln Ile Asn1
5 10 15Gly Gly Ala Ile Ser
Tyr Gly Asn Gly Val Tyr Cys Asn Lys Glu Lys 20
25 30Cys Trp Val Asn Lys Ala Glu Asn Lys Gln Ala Ile
Thr Gly Ile Val 35 40 45Ile Gly
Gly Trp Ala Ser Ser Leu Ala Gly Met Gly His 50 55
604588PRTCarnobacterium B2 45Met Ile Lys Asp Glu Lys Ile Asn
Lys Ile Tyr Ala Leu Val Lys Ser1 5 10
15Ala Leu Asp Asn Thr Asp Val Lys Asn Asp Lys Lys Leu Ser
Leu Leu 20 25 30Leu Met Arg
Ile Gln Glu Thr Ser Ile Asn Gly Glu Leu Phe Tyr Asp 35
40 45Tyr Lys Lys Glu Leu Gln Pro Ala Ile Ser Met
Tyr Ser Ile Gln His 50 55 60Asn Phe
Arg Val Pro Asp Asp Leu Val Lys Leu Leu Ala Leu Val Gln65
70 75 80Thr Pro Lys Ala Trp Ser Gly
Phe 85461907DNAcarnobacterium B2
operon;-35_signal(165)..(170) 46aagcttttat agtacaatta tttatgcgtg
ctatgcaata gctattgtat atactatttt 60tactatgaga aaagattctt atgaaaataa
caaaaataat cgtaaaaaag ttatatagca 120tttatttcat ttatgaattc aaataccctg
gttcaagatg tattttccaa aaaaatgttc 180agatatgata tagttttttt gaaatacaaa
tataaaataa aggagtttga tttag atg 238
Met
1aat agc gta aaa gaa tta aac gtg aaa gaa atg aaa caa tta
cac ggt 286Asn Ser Val Lys Glu Leu Asn Val Lys Glu Met Lys Gln Leu
His Gly 5 10 15gga gta aat
tat ggt aat ggt gtt tct tgc agt aaa aca aaa tgt tca 334Gly Val Asn
Tyr Gly Asn Gly Val Ser Cys Ser Lys Thr Lys Cys Ser 20
25 30gtt aac tgg gga caa gcc ttt caa gaa aga tac
aca gct gga att aac 382Val Asn Trp Gly Gln Ala Phe Gln Glu Arg Tyr
Thr Ala Gly Ile Asn 35 40 45tca ttt
gta agt gga gtc gct tct ggg gca gga tcc att ggt agg aga 430Ser Phe
Val Ser Gly Val Ala Ser Gly Ala Gly Ser Ile Gly Arg Arg50
55 60 65ccg taaatatata aatacaatat
agagcaaggt ggtgataca atg gat ata aag 484Pro
Met Asp Ile Lys
70tct caa aca tta tat ttg aat cta agc gag gca tat aaa
gac cct gaa 532Ser Gln Thr Leu Tyr Leu Asn Leu Ser Glu Ala Tyr Lys
Asp Pro Glu 75 80 85gta
aaa gct aat gaa ttc tta tca aaa tta gtt gta caa tgt gct ggg 580Val
Lys Ala Asn Glu Phe Leu Ser Lys Leu Val Val Gln Cys Ala Gly 90
95 100aaa tta aca gct tca aac agt gag
aac agt tat att gaa gta ata tca 628Lys Leu Thr Ala Ser Asn Ser Glu
Asn Ser Tyr Ile Glu Val Ile Ser 105 110
115ttg cta tct agg ggt att tct agt tat tat tta tcc cat aaa cgt ata
676Leu Leu Ser Arg Gly Ile Ser Ser Tyr Tyr Leu Ser His Lys Arg Ile
120 125 130att cct tca agt atg tta act
ata tat act caa ata caa aag gat ata 724Ile Pro Ser Ser Met Leu Thr
Ile Tyr Thr Gln Ile Gln Lys Asp Ile135 140
145 150aaa aac ggg aat att gac acc gaa aaa tta agg aaa
tat gag ata gca 772Lys Asn Gly Asn Ile Asp Thr Glu Lys Leu Arg Lys
Tyr Glu Ile Ala 155 160
165aaa gga tta atg tcc gtt cct tat ata tat ttc taattttttc aatgatgtta
825Lys Gly Leu Met Ser Val Pro Tyr Ile Tyr Phe 170
175gttgacttca aaaagatgtg aaatcgatta gcattttcaa aattagatta aaaatactat
885ctatataaaa tagaactact gatttaaagt atttataaga atataaagta gcaaataaca
945tgatagacac aattaaggag cgacatttta tggaaaattt gaaatggtat tcgggcggga
1005acgatagaaa aaaaaagca atg gct act att act gat ttg tta aac gat tta
1057 Met Ala Thr Ile Thr Asp Leu Leu Asn Asp Leu
180 185aaa ata gac tta ggt aac gaa
tct cta caa aat gtc tta gaa aat tat 1105Lys Ile Asp Leu Gly Asn Glu
Ser Leu Gln Asn Val Leu Glu Asn Tyr 190 195
200ctt gaa gaa ttg gaa caa gca aat gct gct gtt cca att ata tta ggc
1153Leu Glu Glu Leu Glu Gln Ala Asn Ala Ala Val Pro Ile Ile Leu Gly205
210 215 220cgt atg aac ata
gat atc tct aca gca atc aga aaa gat ggt gtt act 1201Arg Met Asn Ile
Asp Ile Ser Thr Ala Ile Arg Lys Asp Gly Val Thr 225
230 235tta tca gaa att cag tct aaa aaa tta aaa
gag ctg att tca ata tcc 1249Leu Ser Glu Ile Gln Ser Lys Lys Leu Lys
Glu Leu Ile Ser Ile Ser 240 245
250tat att aaa tat ggc tat taatttagta ttaataacag tgtaggattg
1297Tyr Ile Lys Tyr Gly Tyr 255attcaaatta tttgaatcaa aatttatata
caaattttat ttattttggg tctttaaata 1357attttgtgta agttcaaatt atttaaagat
gagttaaaac tctatcttcg aaaaacatca 1417caaaatgtga tgaaatttgt ccccaatttt
ggaccttcat ggtccatttt ttcgttacat 1477ccatcgtcac taaacaaagc atttttagta
aggattcatc agatgggaat actaccttag 1537attttgttgg ctttcacagc tgacaatgga
ggccttcaat cacattggcg gtataaataa 1597tccggcgcaa atctgctgaa tacttgaaaa
atgtcgctaa ttctgcccag ttatctatca 1657attcttcaat taatttgtct gcgtttatat
ccattttcat tccccttttt taatttttca 1717ttttttagtt actttaaacg gtttaaagcc
ttaagcactt aggctttaat cttttttcac 1777ttgatctaat tatttgaact tcagcattta
tcttttgatt tattctttta gggaattgac 1837cgaataggga gatttcctgt gagtaggcgc
caacggtggt ggcggtcgga gtcagccgac 1897tcacaagctt
19074766PRTcarnobacterium B2 operon;
47Met Asn Ser Val Lys Glu Leu Asn Val Lys Glu Met Lys Gln Leu His1
5 10 15Gly Gly Val Asn Tyr Gly
Asn Gly Val Ser Cys Ser Lys Thr Lys Cys 20 25
30Ser Val Asn Trp Gly Gln Ala Phe Gln Glu Arg Tyr Thr
Ala Gly Ile 35 40 45Asn Ser Phe
Val Ser Gly Val Ala Ser Gly Ala Gly Ser Ile Gly Arg 50
55 60Arg Pro6548111PRTcarnobacterium B2 operon; 48Met
Asp Ile Lys Ser Gln Thr Leu Tyr Leu Asn Leu Ser Glu Ala Tyr1
5 10 15Lys Asp Pro Glu Val Lys Ala
Asn Glu Phe Leu Ser Lys Leu Val Val 20 25
30Gln Cys Ala Gly Lys Leu Thr Ala Ser Asn Ser Glu Asn Ser
Tyr Ile 35 40 45Glu Val Ile Ser
Leu Leu Ser Arg Gly Ile Ser Ser Tyr Tyr Leu Ser 50 55
60His Lys Arg Ile Ile Pro Ser Ser Met Leu Thr Ile Tyr
Thr Gln Ile65 70 75
80Gln Lys Asp Ile Lys Asn Gly Asn Ile Asp Thr Glu Lys Leu Arg Lys
85 90 95Tyr Glu Ile Ala Lys Gly
Leu Met Ser Val Pro Tyr Ile Tyr Phe 100 105
1104981PRTcarnobacterium B2 operon; 49Met Ala Thr Ile Thr
Asp Leu Leu Asn Asp Leu Lys Ile Asp Leu Gly1 5
10 15Asn Glu Ser Leu Gln Asn Val Leu Glu Asn Tyr
Leu Glu Glu Leu Glu 20 25
30Gln Ala Asn Ala Ala Val Pro Ile Ile Leu Gly Arg Met Asn Ile Asp
35 40 45Ile Ser Thr Ala Ile Arg Lys Asp
Gly Val Thr Leu Ser Glu Ile Gln 50 55
60Ser Lys Lys Leu Lys Glu Leu Ile Ser Ile Ser Tyr Ile Lys Tyr Gly65
70 75
80Tyr5066PRTCarnobacterium B2 operon 50Met Asn Ser Val Lys Glu Leu Asn
Val Lys Glu Met Lys Gln Leu His1 5 10
15Gly Gly Val Asn Tyr Gly Asn Gly Val Ser Cys Ser Lys Thr
Lys Cys 20 25 30Ser Val Asn
Trp Gly Gln Ala Phe Gln Glu Arg Tyr Thr Ala Gly Ile 35
40 45Asn Ser Phe Val Ser Gly Val Ala Ser Gly Ala
Gly Ser Ile Gly Arg 50 55 60Arg
Pro6551111PRTCarnobacterium B2 operon 51Met Asp Ile Lys Ser Gln Thr Leu
Tyr Leu Asn Leu Ser Glu Ala Tyr1 5 10
15Lys Asp Pro Glu Val Lys Ala Asn Glu Phe Leu Ser Lys Leu
Val Val 20 25 30Gln Cys Ala
Gly Lys Leu Thr Ala Ser Asn Ser Glu Asn Ser Tyr Ile 35
40 45Glu Val Ile Ser Leu Leu Ser Arg Gly Ile Ser
Ser Tyr Tyr Leu Ser 50 55 60His Lys
Arg Ile Ile Pro Ser Ser Met Leu Thr Ile Tyr Thr Gln Ile65
70 75 80Gln Lys Asp Ile Lys Asn Gly
Asn Ile Asp Thr Glu Lys Leu Arg Lys 85 90
95Tyr Glu Ile Ala Lys Gly Leu Met Ser Val Pro Tyr Ile
Tyr Phe 100 105
1105281PRTCarnobacterium B2 operon 52Met Ala Thr Ile Thr Asp Leu Leu Asn
Asp Leu Lys Ile Asp Leu Gly1 5 10
15Asn Glu Ser Leu Gln Asn Val Leu Glu Asn Tyr Leu Glu Glu Leu
Glu 20 25 30Gln Ala Asn Ala
Ala Val Pro Ile Ile Leu Gly Arg Met Asn Ile Asp 35
40 45Ile Ser Thr Ala Ile Arg Lys Asp Gly Val Thr Leu
Ser Glu Ile Gln 50 55 60Ser Lys Lys
Leu Lys Glu Leu Ile Ser Ile Ser Tyr Ile Lys Tyr Gly65 70
75 80Tyr5335DNAJMc7; 53cccaagcttc
tgctgtaaat tatggtaatg gtgtt
355436DNAKLR179; 54gcgcaagctt ctgctcggac accagaaatg cctgtt
365530DNAKLR180; 55ggccaagctt gccattaagt ctggttgcta
305620DNAMB32; 56aattcgagct cgcccaaatc
205740DNAMB37; 57tgagtaattt
tcggtgcagc acctcctacg acttgttcga 405823DNARW58;
58tacgcgcaag aacagacaaa atc
235940DNAMB38; 59tgagtaattt tcggtgcagc tcctccgtta gcttctgaaa
406019DNAMB39; 60tacgaattcg agctcgccc
196176DNAMB42; 61attttcggtg cagcacctcc
agaaacagaa tctaattcat ttagagtcag agttctcata 60ataactttcc tctttt
766240DNAMB41; 62tgagtaattt
tcggtgcagc cataataact ttcctctttt 406337DNAMB43;
63atatcacgcc ctgaagcacc tcctacgact tgttcga
376436DNAMB44;misc_difference(11)..(12)standard_name= "any base"
64aattaagctt ggatccttct gtgtggattg tccaat
366521DNAAPO-1misc_difference(11)..(12)standard_name="(any base)"
65aaagatattg gaaaggattg g
21667PRTCarnobacterium sp. 66Val Asn Tyr Gly Asn Gly Val1
56732PRTCF01 probeMISC_FEATURE(13)..(13)C or A 67Gly Ala Ala Ala Ala Thr
Gly Ala Thr Cys Ala Thr Xaa Gly Xaa Ala1 5
10 15Thr Gly Cys Cys Xaa Ala Ala Thr Gly Ala Ala Cys
Thr Xaa Ala Ala 20 25
306861PRTLeucocin A 68Met Met Asn Met Lys Pro Thr Glu Ser Tyr Glu Gln Leu
Asp Asn Ser1 5 10 15Ala
Leu Glu Gln Val Val Gly Gly Lys Tyr Tyr Gly Asn Gly Val His 20
25 30Cys Thr Lys Ser Gly Cys Ser Val
Asn Trp Gly Glu Ala Glu Ser Ala 35 40
45Gly Val His Arg Leu Ala Asn Gly Gly Asn Gly Phe Trp 50
55 606936PRTMesenteriocin Y105 69Lys Tyr Tyr Gly
Asn Gly Val His Cys Thr Lys Ser Gly Cys Ser Val1 5
10 15Asn Trp Gly Glu Ala Ala Ser Ala Gly Ile
His Arg Leu Ala Asn Gly 20 25
30Gly Asn Gly Phe 357041PRTSakacin PMISC_FEATURE(33)..(33)any
amino acid 70Lys Tyr Tyr Gly Asn Gly Val His Cys Gly Lys His Ser Cys Thr
Val1 5 10 15Asp Trp Gly
Thr Ala Ile Gly Asn Ile Gly Asn Asn Ala Ala Ala Asn 20
25 30Xaa Ala Thr Gly Xaa Asn Ala Xaa Xaa
35 407162PRTPediocin PA1 71Met Lys Lys Ile Glu Lys Leu
Thr Glu Lys Glu Met Ala Asn Ile Ile1 5 10
15Gly Gly Lys Tyr Tyr Gly Asn Gly Val Thr Cys Gly Lys
His Ser Cys 20 25 30Ser Val
Asp Trp Gly Lys Ala Thr Thr Cys Ile Ile Asn Asn Gly Ala 35
40 45Met Ala Trp Ala Thr Gly Gly His Gln Gly
Asn His Lys Cys 50 55
607266PRTCarnobacteriocin B2 72Met Asn Ser Val Lys Glu Leu Asn Val Lys
Glu Met Lys Gln Leu His1 5 10
15Gly Gly Val Asn Tyr Gly Asn Gly Val Ser Cys Ser Lys Thr Lys Cys
20 25 30Ser Val Asn Trp Gly Gln
Ala Phe Gln Glu Arg Tyr Thr Ala Gly Ile 35 40
45Asn Ser Phe Val Ser Gly Val Ala Ser Gly Ala Gly Ser Ile
Gly Arg 50 55 60Arg
Pro657361PRTCarnobacteriocin BM1 73Met Lys Ser Val Lys Glu Leu Asn Lys
Lys Glu Met Gln Gln Ile Ile1 5 10
15Gly Gly Ala Ile Ser Tyr Gly Asn Gly Val Tyr Cys Asn Lys Glu
Lys 20 25 30Cys Trp Val Asn
Lys Ala Glu Asn Lys Gln Ala Ile Thr Gly Ile Val 35
40 45Ile Gly Gly Trp Ala Ser Ser Leu Ala Gly Met Gly
His 50 55 607459PRTSakacin A 74Met
Asn Asn Val Lys Glu Leu Ser Met Thr Glu Leu Gln Thr Ile Thr1
5 10 15Gly Gly Ala Arg Ser Tyr Gly
Asn Gly Val Tyr Cys Asn Asn Lys Lys 20 25
30Cys Trp Val Asn Arg Gly Glu Ala Thr Gln Ser Ile Ile Gly
Gly Met 35 40 45Ile Ser Gly Trp
Ala Ser Gly Leu Ala Gly Met 50 557531PRTCurvacin
AMISC_FEATURE(25)..(25)any amino acid 75Ala Cys Ser Tyr Gly Asn Gly Val
Tyr Cys Asn Asn Lys Lys Ser Trp1 5 10
15Val Asn Gly Gly Glu Ala Thr Gln Xaa Xaa Ile Xaa Xaa Gly
Xaa 20 25
307618PRTCarnobacteriocin A 76Met Asn Asn Val Lys Glu Leu Ser Ile Lys Glu
Met Gln Gln Val Thr1 5 10
15Gly Gly7718PRTLactacin F 77Met Lys Gln Phe Asn Tyr Leu Ser His Lys Asp
Leu Ala Val Val Val1 5 10
15Gly Gly7821PRTLactococcin B 78Met Lys Asn Gln Leu Asn Phe Asn Ile Leu
Ser Glu Glu Asp Leu Ala1 5 10
15Glu Ala Asn Gly Gly 207921PRTLactococcin A 79Met Lys
Asn Gln Leu Asn Phe Asn Ile Leu Ser Glu Glu Asp Leu Ser1 5
10 15Glu Ala Asn Gly Gly
208021PRTLactococcin M 80Met Lys Asn Gln Leu Asn Phe Glu Ile Leu Ser Glu
Glu Asp Leu Gln1 5 10
15Gly Ile Asn Gly Gly 20
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20130111968 | SAMPLE ANALYSIS DEVICE FOR DETERMINING SAMPLES IN A SAMPLE MATRIX AND METHOD FOR DETERMINING SAMPLES IN ONE OR SEVERAL MATRICES |
20130111967 | PUNCH AND DIE SET |
20130111966 | METHOD FOR FORMING STEEL SHEET BY HOT PRESSING |
20130111965 | MOLD FOR HOT STAMPING |
20130111964 | PRODUCTION METHOD FOR A SEMI-FINISHED PRODUCT |