Patent application title: TRICHOPLUSIA NI CELL LINE AND METHODS OF USE
Inventors:
Suzanne M. Thiem (Okemos, MI, US)
IPC8 Class: AC12N510FI
USPC Class:
435 6
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving nucleic acid
Publication date: 2011-04-21
Patent application number: 20110091890
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: TRICHOPLUSIA NI CELL LINE AND METHODS OF USE
Inventors:
Suzanne M. Thiem
Agents:
Assignees:
Origin: ,
IPC8 Class: AC12N510FI
USPC Class:
Publication date: 04/21/2011
Patent application number: 20110091890
Abstract:
An isolated cell from the cell line identified as TnT4. This cell may be
infected with a baculovirus expression vector which may carry a
heterologous nucleotide that encodes a polypeptide, such as a membrane
protein, e.g., human neurotensin receptor 1. Also included is a method
for using this cell line to produce a polypeptide, such as a membrane
protein; and a method for identifying a cell-of-interest which expresses
a protein-of-interest.Claims:
1. An isolated Trichoplusia ni cell wherein a sample of said cell has
been deposited as ATCC Accession No. PTA-9384.
2. The cell of claim 1 further including a baculovirus expression vector.
3. The cell of claim 2 wherein the vector carries a heterologous oligonucleotide that encodes a polypeptide.
4. The cell of claim 3 wherein the oligonucleotide is selected from the oligonucleotides having SEQ ID NOs. 1 and 16-23, or a substantially identical oligonucletide.
5. The cell of claim 3 wherein the polypeptide is a membrane protein.
6. The cell of claim 5 wherein the membrane protein is a G-protein coupled receptor.
7. The cell of claim 5 wherein the polypeptide is selected from the group consisting of human neurotensin receptor 1 (NTSR1), human cannabinoid receptor 2 (hCR2), cytokine receptor 2B (CCR2B), natriuretic peptide receptor C (NPR3), transient receptor potential vanilloid 4 (TRPV4), and conservative amino acid substitution variants thereof.
8. The cell of claim 7 wherein the polypeptide is NTSR1, or a conservative amino acid substitution variant thereof.
9. The cell of claim 3 wherein the nucleotide encodes a fusion protein.
10. The cell of claim 9 wherein the encoded fusion protein includes a protein operably linked with a marker protein.
11. The cell of claim 10 wherein the protein is NTSR1 and the marker protein is green fluorescent protein.
12. A method of producing a polypeptide comprising the steps of: a) providing the cell of claim 3; b) growing the cell such that the polypeptide is expressed; and c) isolating the expressed polypeptide from the cell.
13. The method of claim 12 wherein the polypeptide is a membrane protein.
14. The method of claim 13 wherein the membrane protein is a G-protein coupled receptor.
15. The method of claim 13 wherein the membrane protein is selected from the group consisting of NTSR1, hCR2, CCR2B, NPR3, TRPV4, and conservative amino acid substitution variants thereof.
16. The method of claim 15 wherein the membrane protein is NTSR1.
17. A method of identifying a cell that will express a protein-of-interest by a cell-of-interest comprising: operably linking (fusing) an oligonucleotide encoding a protein-of-interest to an oligonucleotide encoding a marker protein; introducing the fused oligonucleotide into a replicable vector; introducing the vector into a cell-of-interest; growing the cell-of-interest under conditions which bring about expression of a protein-of-interest; and measuring for expression of the marker protein.
18. The cell of claim 1 which is not infected with a nodavirus.
19. The cell of claim 3 wherein the polypeptide is expressed at high levels.
20. The method of claim 12 wherein the cell is not infected with a nodavirus.
21. The method of claim 12 wherein the polypeptide is expressed at high levels.
Description:
REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of an invention which was disclosed in U.S. Provisional Application 61/044,729 filed Apr. 14, 2008, entitled "Insect Cell Line and Methods of Use" and the aforementioned application is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] This invention is in the field of cell biology, medicine, and agriculture and, more specifically, relates to an isolated insect cell line and methods of using the cell line.
BACKGROUND OF THE INVENTION
[0003] The baculovirus expression vector system (BEVS) is one of the most widely used gene expression systems for eukaryotic proteins because the proteins are properly processed with protein modifications such as phosphorylation, acetylation, and glycosylation (Becker et al. 1994; Grunewald et al. 1996; Ng et al. 1993; Ng et al. 1994; Zavodzky and Cseh 1996; Zhao and Sane 1993). See also, Lucow, V. A. and Summers, M. D. "High level expression of non-fused foreign genes with Autographa californica nuclear polyhedrosis virus expression vectors, Virology, 170:311-39 (1988); and U.S. Pat. No. 4,745,051. The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is the basis of the BEVS owing to its ability to express high levels of protein from its polyhedrin gene (polh) promoter. To express proteins, cultured insect cells are infected by recombinant AcMNPV, which carries the gene encoding the protein of interest.
[0004] Although the interest, need, and development of more insect cell lines has grown exponentially since the first insect cell lines were created by Gao (Gaw) and by Grace (Gaw et al. 1959; Grace 1962), currently there are only a few cell lines commercially available for use with the BEVS. These include "Sf21" derived from Spodoptera frugiperda (Vaughn et al. 1977) and BTI-Tn-5B1-4 ("Hi-5") cells derived from Trichoplusia ni (Granados et al. 1994; McKenna et al. 1998), along with a clonal isolate of Sf21 called Sf9 cells (Smith et al. 1985). A genetically engineered Sf9 cell line called "Mimic" is also available from Invitrogen. Mimic cells are engineered to express five mammalian genes encoding glycosyltransferases enabling the cells to synthesize complex mono-sialylated N-glycans typical of mammalian but not most insect cells (Hollister et al. 2002).
[0005] Whereas many proteins are expressed efficiently using one of these currently available cell lines, many other proteins are expressed poorly, if at all. The reasons some proteins are poorly expressed in BEVS is not understood. In some cases, a change in the cell line used results in improved expression (Akermoun et al. 2005; Chai et al. 1996; Ogonah et al. 1996; Palomares et al. 2003). Thus a broader selection of cell lines available for BEVS is needed, and would be expected to increase the versatility of this expression system.
[0006] Membrane proteins are a major class of protein that is difficult to express to high levels in any heterologous expression system, but have been expressed with some success using BEVS (Akermoun et al. 2005; Grisshammer and Tate 1995; Massotte 2003; McCusker et al. 2007; Sarramegna et al. 2003). Sequencing the human genome revealed that membrane proteins make up approximately 30% of all of the encoded proteins, yet the structures for less than 3% have been solved. Membrane proteins are crucial for transport and signal transduction across membranes and play important roles in many medical conditions such as cancer, hypertension, and mental illness, thus they are major and important targets for drug development. Knowledge of membrane protein structure and function is critical for understanding their roles in these conditions and for drug development. Membrane proteins also are key targets for insecticides. Understanding how the structures of potential insecticide targets differ from their vertebrate counterparts also would be invaluable for developing new and safer chemicals for use in agriculture.
[0007] Most membrane proteins are not sufficiently abundant in nature to purify and crystallize and no gene expression system has been able to reliably express membrane proteins in sufficient quantities for these studies. The BEVS is efficient at expressing both cytoplasmic and secreted proteins and has been used to successfully express some membrane proteins at high levels (Grisshammer and Tate 1995; Massotte 2003). However, despite some success, many membrane proteins cannot be expressed at high enough levels for structural and functional studies.
SUMMARY OF THE INVENTION
[0008] A new cell line, MSU-TnT4 ("TnT4"), was established from Trichoplusia ni embryos. More specifically, the present invention includes the TnT4 Trichoplusia ni cell line deposited with the American Type Culture Collection, 10801 University Blvd., Manassas, Va. 20110-2209, a recognized public depository for strains of microorganisms, under the provisions of the Budapest Treaty, as Patent Deposit Designation PTA-9384, having been deposited on Jul. 24, 2008. The cell line will be irrevocably available from the ATCC for the life of the patent. This cell line can be used with baculovirus expression vectors and for protein production e.g., membrane protein production.
[0009] To evaluate protein synthesis (e.g., membrane protein synthesis) in TnT4 cells, recombinant baculoviruses were constructed to express various proteins as enhanced green fluorescent protein (GFP) fusion proteins. The proteins expressed were human neurotensin receptor 1 (NTSR1), human cannabinoid receptor 2 (hCR2), cytokine receptor 2B (CCR2B), natriuretic peptide receptor C (NPR3), transient receptor potential vanilloid 4 (TRPV4) and secreted alkaline phosphatase (SEAP).
[0010] The nucleotide sequence for NTSR1 is identified in the Sequence Listing submitted herewith as SEQ ID NO: 1 and the coding region for NTSR1 (beginning with the start codon and ending with the stop codon) is identified in the Sequence Listing submitted herewith as SEQ ID NO: 16. The nucleotide sequence for hCR2 is identified in the Sequence Listing submitted herewith as SEQ ID NO: 17 and the coding region for hCR2 (beginning with the start codon and ending with the stop codon) is identified in the Sequence Listing submitted herewith as SEQ ID NO: 18, and has a Genbank Accession no. BC069722. The nucleotide sequence for CCR2B is identified in the Sequence Listing submitted herewith as SEQ ID NO: 19 and the coding region for CCR2B (beginning with the start codon and ending with the stop codon) is identified in the Sequence Listing submitted herewith as SEQ ID NO: 20, and has a Genbank Accession no. NM-000648. The nucleotide sequence for NPR3 is identified in the Sequence Listing submitted herewith as SEQ ID NO: 21 and the coding region for NPR3 (beginning with the start codon and ending with the stop codon) is identified in the Sequence Listing submitted herewith as SEQ ID NO: 22, and has a Genbank Accession no. BCO55897. The nucleotide sequence for the coding region of TRPV4 (beginning with the start codon and ending with the stop codon) is identified in the Sequence Listing submitted herewith as SEQ ID NO: 23, and has a GenBank Accession no. AF258465.
[0011] The present invention includes an isolated Trichoplusia ni cell wherein a sample of said cell has been deposited as ATCC Accession No. PTA-9384 ("TnT4"). The cell may be infected by a BEVS vector and this vector may carry a heterologous oligonucleotide that encodes a polypeptide. The oligonucleotide may be selected from the oligonucleotides having SEQ ID NOs. 1, and 16-23 or a substantially identical oligonucletide; or the polypeptide may be a protein, such as a G-protein coupled receptor, or a fusion protein (e.g., the fusion protein may be a protein and a marker protein). The protein may be human neurotensin receptor 1 (NTSR1), human cannabinoid receptor 2 (hCR2), cytokine receptor 2B (CCR2B), natriuretic peptide receptor C (NPR3), transient receptor potential vanilloid 4 (TRPV4) and secreted alkaline phosphatase (SEAP), and conservative amino acid substitution variants thereof; and in the case of the fusion protein, the marker protein may be green fluorescent protein (GFP).
[0012] Also included is a method of producing a polypeptide including: providing an isolated cell from the TnT4 cell line which includes a heterologous oligonucleotide that encodes a polypeptide; growing the cell such that the polypeptide is expressed; and isolating the expressed polypeptide from the cell. The expressed polypeptide may be a protein, for example, a G-protein coupled receptor. The expressed polypeptide may be NTSR1, hCR2, CCR2B, NPR3, TRPV4, SEAP, and conservative amino acid substitution variants thereof.
[0013] The present invention also includes a method of identifying a cell that will express a protein-of-interest by a cell-of-interest including: operably linking (fusing) an oligonucleotide encoding a protein-of-interest to an oligonucleotide encoding a marker protein; introducing the fused oligonucleotide into a replicable vector; introducing the vector into a cell-of-interest; growing the cell-of-interest under conditions which bring about expression of a protein-of-interest; and measuring for expression of the marker protein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, certain embodiment(s) are shown in the drawings. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown. Drawings are not necessary to scale. Certain features of the invention may be exaggerated in scale or shown in schematic form in the interest of clarity and conciseness.
[0015] FIG. 1 is a schematic drawing showing the construction of the NTSR1-GFP reporter virus. NTSR-1, GFP, and baculovirus promoters were amplified by PCR, introducing suitable restriction sites for cloning. The promoter-fusion protein construct was assembled sequentially in pBluescriptSK+, in the order indicated in the schematic drawing. PCR and sequencing primers sequences are shown in Table 2 (below). The entire cassette was then cleaved from pBluescript with XbaI and BglII and ligated into the XbaI and BglII sites of the AcMNPV transfer vector pAcUW2B (Weyer et al. 1990) for generation of recombinant virus by homologous recombination. Protein-GFP reporter viruses were similarly constructed in which the membrane protein was one of: cannabinoid receptor 2 (hCR2), cytokine receptor 2B (CCR2B)), natriuretic peptide receptor C (NPR3), transient receptor potential vanilloid 4 (TRPV4), and secreted alkaline phosphatase (SEAP), (constructs not shown in FIG. 1).
[0016] FIGS. 2A and 2B are images of TnT4 cells. FIG. 2A shows phase contrast images of TnT4 cells with cellular pleiomorphy. The bar represents 100 μm. FIG. 2B shows an enlarged portion of FIG. 2A with several cells in more detail. The bar represents 25 μm.
[0017] FIG. 3 is an image of an agarose gel showing DNA fingerprints of TnT4 and
[0018] Sf21 cells. Cell lines are indicated at the top of each lane; primer sets 1-3 (McIntosh et al. 1996) are indicated at the top of the panel; Lane "M" contains molecular size markers: and lanes labeled "N. C." have no DNA controls for each primer set.
[0019] FIGS. 4A and 4B are graphs showing cell growth rates and virus production. Referring to FIG. 4A, cells were plated in 60 mm culture dishes in TC100 medium supplemented with 10% fetal bovine serum. Cells were scraped from the plates and counted using a hemocytometer. Cell counts were normalized based on the volume of medium per plate at the time of counting. Bars indicate standard deviation from two independent experiments. Referring to FIG. 4B, cells were infected with AcMNPV expressing β-galactosidase at an multiplicity of infection rate (moi) of 10 and supernatants were collected at the times indicated. Virus titers were determined by plaque assay. Sf21 cells are indicated by open bars and TnT4 cells by shaded bars. Bars indicating standard deviation are from two independent experiments.
[0020] FIGS. 5A-5E. Flow cytometry and confocal microscopy showed fluorescence from the expression of NTSR1-GFP in Sf21. Cells were mock infected (FIG. 5A) or infected by Pie-1-NTSR1-GFP (FIGS. 5B and 5C) or P10-NTSR1-GFP (FIGS. 5D and 5E) for 1 hr and replaced with fresh media. 24 hours (FIGS. 5B and 5D) or 48 hours (FIGS. 5C and 5E) post infection, cells were subjected to flow cytometry and confocal microscope analysis (magnification, 60×). Graphic plots of cell numbers and fluorescent intensity of GFP positive cells are shown for flow cytometry analysis in the first column. Confocal images of fluorescence, bright field (BF) images, and overlays of fluorescent and BF images are shown in the next three columns.
[0021] FIGS. 6A-6E. Flow cytometry and confocal microscopy showed fluorescence from the expression of NTSR1-GFP in TnT4 cells. Cells were mock infected (FIG. 6A) or infected by Pie-1-NTSR1-GFP (FIGS. 6B and 6C) or P10-NTSR1-GFP (FIGS. 6D and 6E) for 1 hr and replaced with fresh media. 24 hours (FIGS. 6B and 6D) or 48 hours (FIGS. 6C and 6E) post infection, cells were subjected to flow cytometry and confocal microscope analysis (magnification, 60×). Graphic plots of cell numbers and fluorescent intensity of GFP positive cells are shown for flow cytometry analysis in the first column. Confocal images of fluorescence, bright field (BF) images, and overlays of fluorescent and BF images are shown in the next three columns.
[0022] FIGS. 7A and 7B show secreted alkaline phosphatase (SEAP) levels from the supernatants and cells of Sf21 and TnT4 cell lines infected with AcMNPV-SEAP virus. Supernatants (FIG. 7A) and cells (FIG. 7B) were collected separately 24 hours-144 hours after infection. SEAP and protein levels were measured as described in Example 1 below. SEAP is expressed as IU/mg protein. Bars indicate the standard deviation from three independent experiments done in triplicate and *indicates there is significant difference between the Sf21 and TnT4 cells (P=0.01, t-test).
[0023] FIG. 8 shows PCR analysis of TnT4 cells for the presence of the latent nodavirus. RNA was isolated from Hi5, TnT4, and SF21 cells and used as template for cDNA synthesis and the cDNA was analyzed for the presence of nodavirus by PCR using the forward primer: 5'ACATCCAGATCCGATCAAGT3' (SEQ ID NO. 14) and the reverse primer: 5'GCCAGGAATGTTGCTTGCAA3 (SEQ ID NO. 15), as described by Li et al. The PCR products were resolved on an agarose gel. The 690 bp PCR product is diagnostic for the nodavirus.
[0024] FIGS. 9A-9D show the relative fluorescence of baculovirus expressed GFP fusion proteins in Sf21, TnT4, and Hi5 cells over time (24, 48, and 72 hpi). FIG. 9A shows the relative fluorescence of human cannabinoid receptor 2; FIG. 9B shows the relative fluorescence of cytokine receptor 2B; FIG. 9C shows the relative fluorescence of natriuretic peptide receptor C; and FIG. 9D shows the relative fluorescence of transient receptor potential vanilloid 4 ion channel.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0025] Before the subject invention is described further, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims.
[0026] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0027] All references, patents, patent publications, articles, and databases, referred to in this application are incorporated herein by reference in their entirety, as if each were specifically and individually incorporated herein by reference. Such patents, patent publications, articles, and databases are incorporated for the purpose of describing and disclosing the subject components of the invention that are described in those patents, patent publications, articles, and databases, which components might be used in connection with the presently described invention.
[0028] The information provided below is not admitted to be prior art to the present invention, but is provided solely to assist the understanding of the reader.
[0029] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, embodiments, and advantages of the invention will be apparent from the description and drawings, and from the claims. The preferred embodiments of the present invention may be understood more readily by reference to the following detailed description of the specific embodiments and the Examples and Sequence Listing included hereafter.
[0030] The text file filed concurrently with this application, titled "MIC037 FP340AWO Sequence Listing.txt" contains material identified as SEQ ID NOS: 1-23, which material is incorporated herein by reference. This text file was created on Apr. 14, 2009, and is 63,973 bytes.
[0031] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry and nucleic acid chemistry and hybridization described below are those well known and commonly employed in the art. Standard techniques are used for nucleic acid and peptide synthesis. Generally, enzymatic reactions and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., which is incorporated herein by reference), which are provided throughout this document.
[0032] In this specification and the appended claims, the singular forms "a," "an" and "the" include plural reference unless the context clearly dictates otherwise.
[0033] The term "cell" is used in its usual biological sense, and does not refer to an entire multicellular organism. The cell can, for example, be in vitro, e.g., in cell culture. The term "cell" as used herein, refers to an isolated cell, as well as any individual cell, harvested cell, and culture containing a cell, so long as they are derived from a cell line. For example, TnT4 cells are cells derived from the TnT4 cell line.
[0034] An "expression vector" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.
[0035] The phrase "fusion protein" refers to a protein comprising amino acid sequences that are in addition to, in place of, less than, and/or different from the amino acid sequences encoding the original or native full-length protein or subsequences thereof. Moreover, a nucleic acid sequence or amino acid sequence of a first protein can be modified to include sequences that are substantially identical to the nucleic acid sequence or amino acid sequence, respectively, of a second protein and, thereby, a "fusion protein" is constructed.
[0036] The term "heterologous" when used with reference to portions of a nucleic acid or protein indicates that the molecule comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, a heterologous nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
[0037] The term "host cell" includes an individual cell or cell culture which can be or has been a recipient of any recombinant vector(s). Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells tranfected or infected in vitro with a recombinant vector. A host cell which comprises a recombinant vector or construct of the invention is a "recombinant host cell."
[0038] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. This definition also refers to the complement of a test sequence. Preferably, the percent identity exists over a region of the sequence that is at least about 25 amino acids in length, more preferably over a region that is 50 or 100 amino acids in length.
[0039] For sequence comparison, one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0040] A "comparison window," as used herein, includes reference to a segment of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homolog aliment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection.
[0041] One example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351 360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151 153 (1989). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. Using PILEUP, a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nucleic Acids Res. 12:387 395 (1984)).
[0042] Another example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403 410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., sugar). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0043] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873 5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
[0044] The phrase "substantially identical," in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 60%-70%, preferably 80-85%, more preferably 90-95%, or most preferably 96%, 97%, 98%, or 99% nucleotide or amino acid identity, when compared and aligned for maximum correspondence, as measured using one of the above-identified sequence comparison algorithms or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 nucleotides or residues in length, more preferably over a region of at least about 100 nucleotides or residues, and most preferably the sequences are substantially identical over at least about 150 nucleotides or residues. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding regions. An indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, or can be amplified by the same primer set. Another indication that two nucleic acid sequences are "substantially identical" is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid.
[0045] As used herein the term "isolated," in the context of a subject isolated cell, refers to a cell that is in an environment different from that in which the cell naturally occurs. As used herein, the term "clonal cell line" refers to a cloned cell line that is typically immortalized, e.g., under suitable in vitro culture conditions, the cell line divides virtually indefinitely. Isolated cells may also include "host cells."
[0046] "Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogues or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs). Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses variants thereof (e.g., degenerate codon substitutions that encode the same amino acids) and complementary sequences, as well as the sequence explicitly indicated. The term "nucleic acid" is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
[0047] The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
[0048] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms also include amino acid polymers in which one or more amino acid residue is an analogue or mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. For a detailed description of protein chemistry and structure, see Schulz, GE et al., Principles of Protein Structure, Springer-Verlag, New York, 1978, and Creighton, T. E., Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, 1983, which are hereby incorporated by reference.
[0049] The term "recombinant" when used with reference, e.g., to a cell, nucleic acid, vector, or protein indicates that the cell, nucleic acid, or vector has been modified by the introduction of a heterologous nucleic acid or the alteration of a native nucleic acid, or that the cell is derived from a cell so modified, or that the protein is encoded or expressed by such a nucleic acid or cell. Thus, for example, recombinant cells express genes and proteins that are not found within the native (non-recombinant) form of the cell or express native genes and proteins that are otherwise abnormally expressed, under expressed or not expressed at all.
[0050] The term "stringent conditions" refers to conditions under which a probe will hybridize to its target subsequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 15° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. (As the target sequences are generally present in excess, at Tm, 50% of the probes are occupied at equilibrium). Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or, 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 65. degree. C.
[0051] Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 1×SSC at 45° C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous reference, e.g., and Current Protocols in Molecular Biology, ed. Ausubel, et al.
[0052] A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3<1>direction) coding sequence For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgamo sequences in addition to the -10 and -35 consensus sequences
[0053] An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
[0054] A "signal sequence" can be included before the coding sequence This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes
[0055] The present invention includes a new cell line established from Lepidopteran embryos. In particular, the present invention includes a cell line for use in BEVS, identified as "MSU-TnT4" (or "TnT4"), derived from Trichoplusia ni embryos. This cell line has good growth characteristics and expresses various human proteins to high levels (e.g., membrane proteins). Such proteins include, but are not limited to: human neurotensin receptor 1 (NTSR1), a model G-protein coupled receptor; G-protein coupled receptors human cannabinoid receptor 2 (hCR2) and cytokine receptor 2B (CCR2B); a highly glycosylated single membrane spanning protein known as natriuretic peptide receptor C (NPR3); an ion channel known as transient receptor potential vanilloid 4 (TRPV4), and secreted alkaline phosphatase (SEAP). It is expected that the TnT4 cell line also will show good growth characteristics in BEVS with other proteins (e.g., membrane proteins).
[0056] TnT4 cells grow rapidly and can be grown in suspension culture. TnT4 cells are susceptible to infection by AcMNPV and support its complete lifecycle, producing both BV and polyhedra (FIGS. 6D and 6E). However, in contrast to Hi-5 cells (Granados et al. 1994), a commercially available T ni cell line, TnT4 cells produce less BV than Sf21 cells (FIG. 4B).
[0057] Analysis of fluorescence by flow cytometry and confocal microscopy showed that TnT4 cells supported significantly higher levels of NTSR1-GFP production than Sf21 cells at 48 hours post-injection from the P10 promoter and at 24 hours post-injection from the ie-1 promoter (FIGS. 5 and 6, Table 1). Table 1 shows the percentage and average intensity of GFP.sup.+ positive cells from Sf21, TnT4 and Hi-5 cells from flow cytometry analysis:
TABLE-US-00001 TABLE 1 Sf21 TnT4 Hi-5 GFP.sup.+ GFP.sup.+ GFP.sup.+ cells Median cells Median cells Median percentage Intensity of percentage Intensity of percentage Intensity of (%) GFP (%) GFP (%) GFP Mock 0.28 18.7 ± 4.5 0.24 17.9 ± 4.3 0.3 18.6 ± 8.1 Pie1-NTSR1- 21.69 43.4 ± 5.1 77.04 71.6 ± 13.0* 94.42 71.3 ± 16.2 GFP 24 h Pie1-NTSR1- 91.38 125.2 ± 30.1 96.91 87.2 ± 18.7 96.93 88.8 ± 27.8 GFP 48 h P10-NTSR1- 97.36 2027.9 ± 538.4 93.51 1120.1 ± 854.5 97.29 2961.0 ± 244.5 GFP 24 h P10-NTSR1- 97.49 3450.2 ± 450.5 98.08 6343.3 ± 641.4.sup.§1 97.31 6219.5 ± 984.8.sup.§2 GFP 48 h *Significant difference compared to Sf21 cells, P = 0.028 t-test; .sup.§Significant difference compared to Sf21 cells, .sup.§1P = 0.004 t-test; .sup.§2P = 0.03 t-test
[0058] Analysis of expression in Hi-5 cells by flow cytometry showed similar expression levels as TnT4 cells. Interestingly, the fluorescent intensity increased dramatically in both TnT4 and Hi-5 cells relative to Sf21 cells between 24 and 48 h when NTSR1-GFP was expressed from the p10 promoter, suggesting a possible species difference in either the response to protein expression directly or indirectly due to species specific cellular responses to baculovirus infection (Chen and Thiem 1997; Clem et al. 1991; Lu and Miller 1996). Although higher protein expression was achieved with the p10 promoter in both cell lines, NTSR1-GFP was observed throughout the interior of the cell by confocal imaging, suggesting it was retained in intracellular membranes (FIGS. 5 and 6). Expression from the ie-1 promoter was lower but NTSR1-GFP appeared to localize to the cytoplasmic membrane in both Sf21 and TnT4 cells (FIGS. 5 and 6). This observation remains to be confirmed by more definitive techniques such as co-localization with cytoplasmic membrane markers, but suggests that reduced protein synthesis from the weaker and earlier ie-1 promoter facilitates protein trafficking These observations support the idea that although strong, late baculovirus promoters, such as the P10 and polyhedrin promoters, can drive high levels of protein synthesis, this level of expression may overwhelm protein folding and modification in the RER and Golgi.
[0059] The inventors also have shown the expression of additional proteins using BEVS in the TnT4 cell line and compared such expression to comparative expression data to BEVS in Sf21 and Hi5 cells. These proteins were expressed using a p10 promoter and the expression compared using fluorescent intensity for GFP. These additional proteins include two more G-protein coupled receptors (human cannabinoid receptor 2 (hCR2) and cytokine receptor (CCR2B)), a highly glycosylated single membrane spanning protein (natriuretic peptide receptor C (NPR3), and an ion channel (the transient receptor potential vanilloid 4 (TRPV4). The methods of analysis for these membrane proteins are described in Example 6 below. Further, Table 1 shows the numerical data for the 72 h time point. (Three time points of the same data are shown graphically in FIGS. 9A-9D.) Table 1 shows the relative fluorescence of these four membrane protein GFP fusions expressed from baculovirus in Sf21, TnT4, and Hi5 cells at 72 hpi from captured images analyzed by Metamorph software.
TABLE-US-00002 TABLE 1 Sf21 TnT4 Hi5 hCR2 1950 ± 106 1471 ± 147 2091 ± 16 CCR2B 664 ± 21 572 ± 1 607 ± 15 NPR3 1857 ± 204 1522 ± 33 2088 ± 104 TRPV4 1511 ± 59 1274 ± 64 1073 ± 97
Based on this data, the inventors believe TnT4 is capable of being used with BEVS to express human G-protein coupled receptors, and various other proteins (e.g., membrane proteins).
[0060] Further, it appears that the Hi5 cell line (BTI-TN-5B1-4), which is derived from Trichoplusia ni embryos, harbors a latent nodavirus (Li T-C et al., 2007, Latent Infection of a New Alphanodavirus in an Insect Cell Line, J. Virol. 81:10890-10896). A nodavirus is a bipartite positive sense RNA virus, many of which infect insects and a few infect mammals. Also, a nodavirus is a small icosahedral virus that does not have an envelope. The particular nodavirus (reported by Li, et al.) in the Hi5 cell line is related to the Flockhouse virus, a nodavirus that was originally isolated from grass grubs in New Zealand but which can replicate in other organisms such as plants, nematodes, and mammals. The inventors used the PCR primers (SEQ ID NO. 14-15) and cycling parameters described in this Li et al paper to analyze TnT4 cells for the nodavirus. The results show that the TnT4 cell line is not infected with the nodavirus (see, FIG. 8). In view of the absence of infection by the nodavirus, the TnT4 cell line has further value as a host cell for use in connection with BEVS in the production of proteins that have not been exposed to the nodavirus.
[0061] Also, the present invention includes a method of identifying a cell that will express a protein-of-interest, or highly express a protein-of-interest, by a cell-of-interest including the following steps: operably linking (fusing) an oligonucleotide encoding a protein-of-interest to an oligonucleotide encoding a marker protein; introducing the fused oligonucleotide into a replicable vector (e.g., BEVS), introducing the vector into a cell-of-interest, growing the cell-of-interest under conditions which bring about expression of a polypeptide encoded by the oligonucleotide, and measuring for the presence of the marker protein. For example, expression of the G-protein coupled receptor, NTSR1 as a C-terminally tagged GFP fusion protein in a recombinant baculovirus can be used as a tool for analyzing protein synthesis in insect cells. Previous studies indicate that yields of baculovirus-expressed G-protein coupled receptors, and other membrane proteins, vary considerably (Akermoun et al. 2005; Grisshammer and Tate 1995; Massotte 2003; Sarramegna et al. 2003). The general approach of using fluorescent protein fusions is relatively rapid and will be useful for testing the expression of other proteins in other cell lines. Thus, using this approach, other lepidopteran insect cell lines (that have been developed for studies of insect pathogens and insect physiological processes) can be screened for their utility for expressing proteins. In addition, this approach can be used to evaluate other parameters needed for optimal protein production, such as promoters, signal sequences, the addition of chaperones, virus modifications, media composition, and growth conditions.
[0062] The importance of analyzing different insect cell lines for their ability to express a particular protein is well established (Davis et al. 1993; Hink 1991; McKenna et al. 1998; Wickham et al. 1992). No presently commercially available cell line appears to be superior for all proteins. TnT4 cells are a good addition to the selection of available cell lines for recombinant protein production, in particular, for protein production.
[0063] The invention also provides a method of producing polypeptides by introducing an oligonucleotide into a replicable vector (e.g., BEVS), introducing the vector into a TnT4 host cell, and growing the host cell under conditions which bring about expression of a polypeptide encoded by the oligonucleotide. The polypeptide then may be recovered from the host cell. Methods for producing polypeptides from a cell are generally known and these methods can be applied to the production of proteins using BEVS in the present TnT4 cell line. For specific examples of such protein production methods see: O'Reilly D R, Miller L K, Luckow V. 1992. Baculovirus Expression Vectors: A Laboratory Manual. New York, W. H. Freeman and Company. ISBN 0-19-509131-0; and Murhammer D W (ed). 2007. Baculovirus and insect cell expression protocols, 2nd ed, Methods in Molecular Biology (Clifton N.J.) vol. 388, Totowa, N.J., Humana. ISBN 1588295370, 9781588295378.
[0064] More specifically, vectors may be introduced into the TnT4 host cell to provide for expression of any polypeptide (e.g. NTSR1, hCR2, CCR2B, NPR3 and TRPV4) or a conservative amino acid substitution variant thereof. For example, a conservative amino acid substitution variant may differ from the original sequence such that it has 90%, 95%, 96%, 97%, 98% or 99% identity with the original amino acid sequence of the polypeptide. It is well known in the art that the amino acids within the same conservative group can typically substitute for one another without substantially affecting the function of a protein. Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, one exemplary guideline to select conservative substitutions includes (original residue followed by exemplary substitution): ala/gly or ser; arg/lys; asn/gln or his; asp/glu; cys/ser; gln/asn; gly/asp; gly/ala or pro; his/asn or gln; ile/leu or val; leu/ile or val; lys/arg or gln or glu; met/leu or tyr or ile; phe/met or leu or tyr; ser/thr; thr/ser; trp/tyr; tyr/trp or phe; val/ile or leu.
[0065] The introduction of vectors into a host cell may be followed by causing or allowing expression from the nucleic acid, e.g. by culturing host cells (which may include cells actually transformed although, more likely, the cells will be descendants of the transformed cells) under conditions for expression of the gene, so that the encoded polypeptide is produced. If the polypeptide is expressed coupled to an appropriate signal leader peptide it may be secreted from the cell into the culture medium. Following production by expression, a polypeptide may be isolated and/or purified from the host cell and/or culture medium, as the case may be, and subsequently used as desired, e.g. in the formulation of a composition which may include one or more additional components, such as a pharmaceutical composition which includes one or more pharmaceutically acceptable excipients, vehicles or carriers.
[0066] In another embodiment, the oligonucleotide in the vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. In a further embodiment, the oligonucleotide in the vector is operably linked to a marker protein, such as GFP, to measure expression of the protein encoded by the oligonucleotide. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Promoters and other expression regulation signals may be selected to be compatible with the TnT4 host cell. Such promoters are readily available in the art.
[0067] When using a vector (e.g., BEVS) in a host cell to produce a protein, the protein may be either expressed alone or with some type of tag that can be later removed by proteolytic cleavage. For example, such a tag could be used to facilitate downstream purification of the protein. If a protein is to be expressed with a tag at the C-terminus, then a stop codon is included at the end of the coding sequence for the tag (rather than at the end of the coding sequence for the protein).
[0068] The vectors may be provided with an origin of replication, optionally a promoter for the expression of the oligonucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector. Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell. Systems for cloning and expression of a polypeptide in a variety of different host cells are well known.
[0069] Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.
EXAMPLES
Example 1
Materials and Methods for Examples 2-5
Establishment of Cell Lines
[0070] T. ni eggs were obtained from Lloyd Browne, Entopath Inc., Easton, Pa. Embryonic tissues were prepared essentially as previously described (Lynn 1996, 2001). Briefly, eggs were surface sterilized with 0.05% sodium hypochlorite for five minutes, followed in succession by one five minute wash each in 70% ethanol, sterile distilled water, phosphate buffered saline (O'Reilly et al. 1992), and tissue culture medium. The embryos were then dissociated from the eggs into TC 100 (JRH Bioscience, Lenexa, Kans.) tissue culture medium, supplemented with 10% fetal bovine serum (Hyclone Laboratories), 100 U/ml penicillin, 100 μg/ml streptomycin, and 0.25 μg/ml amphotericin B. Pools of approximately 20 embryos were minced with a scalpel and transferred to disposable T12.5 flasks in 2 ml of medium supplemented as above. Cells were incubated at 27° C. Cells were monitored and fed every 7 days replacing half the media until cells proliferated and became confluent. Cells were then split 1:1 when they became confluent, until they were being split once a week, and as growth rates accelerated the split ratio was gradually increased to 1:8 per week and subsequently the cells were split twice a week. The growth rate continued to increase such that those cells were eventually maintained at a split ratio of 1:14 twice a week.
[0071] DNA fingerprinting. DNA was extracted from Sf21 and TnT4 cells respectively using Qiagen DNeasy Tissue Kit. For each PCR reaction, 150 ng DNA was used as template for a total volume of 25 ul reaction mix. Three sets of primers were used for the fingerprint as previously described (McIntosh et al. 1996). Each set of amplifications consisted of a negative control including distilled water instead of DNA sample as the template. Amplification was conducted under following conditions: 3 min of initial denaturation at 95° C., followed by forty cycles of denaturation at 95° C. for 30 s, annealing at 40° C. for 30 s and extension at 72° C. for 45 s. A final 72° C. extension was conducted for 10 min to stop the reaction. 10 ul of PCR products were loaded on a 2% agarose gel for electrophoresis.
[0072] Cell growth and virus production. Cells were laid down in 60 mm plates at 1.25×105 cells/plate, in duplicate, for each time point. Every 24 h the cells were scraped from two plates and counted using a hemocytometer and an inverted microscope. The number of cells per plate was calculated by multiplying by the volume of medium in the plate, as determined by weight, at the time of the counts. Counts were stopped when the cells reached confluence. Doubling times were calculated using standard methods (Kuchler 1977). Virus production was determined by infecting 1.5×106 cells per plate with recombinant AcMNPV, expressing β-galactosidase from the polh promoter, at an moi of 10. Supernatants were harvested at 6, 12, 24, 48, and 72 h pi and virus titers determined by plaque assay. The chromogenic indicator X-gal was included in the overlays at 120 μg/ml to facilitate plaque counts.
[0073] Recombinant baculovirus construction. Recombinant reporter viruses expressing a model membrane protein the G-protein coupled receptor, NTSR1, (Genbank accession number NM--002531) fused to enhanced green fluorescent protein (GFP) (Clontech, Mountain View, Calif.) was constructed to select and evaluate cell lines for enhanced protein production. The fusion proteins were expressed from either the AcMNPV p10 or ie-1 promoter, P10-NTSR1-GFP and Pie 1-NTSR1-GFP, respectively. NTSR1 was PCR amplified from a cDNA clone using NTSR1 F and NTSR1R (Table 2). Table 2 shows the oligonucleotides used in this study* (SEQ ID NOs: 3-14).
TABLE-US-00003 TABLE 2 Primer SEQ ID name Primer sequence (5'-3') NOS: NTRS1F ATGCACTAGTAAAGAATTCACC 2 ATGCGCCTCAACAGCTCCGCGC NTRS1R GGTAAAGCTTAAACCGGTAG 3 CGTCTCGCGGGTGGCATTG GFPF TCCACCGGTCGCCACCA 4 TGGTGAGCAAGGGCGAG GFPR GATAAAGCTTATAAGATCTAT 5 ATTACTTGTACAGCT Acp10F GTTGGAGTCTAGAGTGCTATTTTACAAAG 6 Acp10R GATTGGAATTCAAATGTAATTTACAGTATAG 7 Acie-1F AAGCTTCTAGAATCCGCTCACCAAACG 8 Acie-1R TTTGCGTCATAGTGAATTCGTTGTTC 9 GFP seq CCGTCCTCCTTGAAGTCGATGCC 10 NTRS11 seq ACGGTGCATTACCACCTGGGCAGCC 11 NTRS12 seq ACCATCATCGCCAACAAGCTGACCGTCATG 12 NTRS13 seq CAGGAGGAAGAGGCCAGCCTTCTCG 13 *introduced restriction sites and restriction site sticky-ends are underlined.
[0074] The forward primer introduced restriction sites for SpeI and EcoRI and the reverse primer introduced HindIII and Age1 sites. The PCR product was gel isolated using a QiaQuick gel extraction kit (Qiagen Inc., Valencia, Calif.), cleaved with HindIII and SpeI and cloned into BluescriptSK+ (Stratagene, La Jolla, Calif.) (FIG. 1). GFP was amplified from pEGFP-1 (Clontech, Mountain View, Calif.) using primers GFPF and GFPR (Table 2), isolated as described for NTSR1, cleaved with AgeI and HindIII, and cloned in frame with NTSR1 in Bluescript SK+. The resulting plasmid was sequenced to verify the sequences and confirm that the coding sequences were in frame. Primers used for sequencing were T3 and T7 (Stratagene, La Jolla, Calif.) and gene specific primers GFPseq, NTSR11, NTRS12, and NTSR13 (Table 2). AcMNPV p10 and ie-1 promoters were PCR amplified using primers Acp10F. and Acp10R, and with primers Acie-1F and Acie-1R, respectively (Table 2). Following gel purification each promoter PCR product was cleaved with XbaI and EcoRI and cloned in front of the NTSR1/GFP fusion in pBluescript SK+. Then each promoter fusion-protein construct was cleaved from Bluescript SK+with XbaI and BglII and ligated into pAcUW2B (Weyer et al. 1990). The resulting transfer vectors along with Bsu36I cleaved Baculogold DNA (Pharmingen, BD Biosciences, San Jose, Calif.) were co-transfected into Sf21 cells using Cellfectin (Invitrogen, Carlsbad, Calif.) to generate recombinant viruses by homologous recombination (O'Reilly et al. 1992). Recombinant viruses, Pie1-NTSR1-GFP or P10-NTSR1-GFP, were selected as white polyhedrin (polh) positive plaques against a background of blue, polh-non-recombinant viruses in the presence of 120 μg/ml X-gal.
[0075] Flow Cytometry and Confocal Fluorescent Microscope Examination. Sf21, TnT4, and Hi-5 cells, 5×105 cells/well were placed in 6-well plates and mock-infected or infected with Pie1-NTSR1-GFP or P10-NTSR1-GFP (MOI=10) for 1 hour the following day. Then the virus was aspirated and replaced with fresh media. Cells were conducted to Flow Cytometry (BD Bioscience Vantage SE) to examine the percentage of GFP positive cells and the average intensity of GFP fluorescent at 24 h and 48 h after infection. Data were collected and analyzed using BD CellQuest. Sf21 and TnT4 cells were infected as described and analyzed by Confocal Fluorescent Microscope (Olympus Fluoview 100) at 24 h and 48 h after infection. Data were collected and analyzed using Olympus Fluoview 100 software.
[0076] Secreted alkaline phosphatase (SEAP) assay. Sf21 or TnT4 cells were seeded at 5×105 cells per 35 mm dish and used for infection the following day. Cells were mock infected or infected at MOI=10 for 1 h by rAcMNPV-SEAP virus (Davis et al. 1992) (kindly provided by P. Wang, Cornell U.), which contains a SEAP gene expressed from the polh promoter. Cells and media were collected at 24, 48, 72, 96, 120, or 144 h after infection. For each time point, three replicates of cells were infected and collected. Then cells were spun down and half of the supernatant was removed to a new tube. Cells were then resuspended in the remaining media and sonicated for 10 sec to disrupt the cells. Both the cell lysates and supernatant media were heated to 65° C. for 5 min and stored at -20° C. until assayed. SEAP activity was determined by a colorimetric assay using p-nitrophenol phosphate (Sigma P-4744) as substrate using a previous described protocol (Cullen and Malim 1992), modified to measure a single time point. Prewarmed cell lysates or medium samples in lx SEAP buffer were incubated with substrate for 10 minutes and the reactions were stopped by the addition of 4 volumes of 1M NaOH and the absorbance read at 405 nm. Total cell proteins were determined using Bradford method with a kit from Biorad (Richmond, Calif.) and the expression of SEAP was calculated as international units (IU)/mg cell protein.
Example 2
Cell Line Production
[0077] Cell lines were established from minced whole T. ni embryos in TC100 medium. TnT4 cells were obtained from one of eight flasks initiated in early 2005. These cells grew well and were split two months after initial seeding. Cells were split twice more at two-month intervals and subsequently at one-month intervals. One year after initiation, at passage number 15, cells were split once a week, at a split ratio of 1:4. Two years after initiation cells were subcultured twice a week at a split ratio of 1:14. TnT4 was selected for further characterization and development because it expressed the NTSR1-GFP-fusion protein, grew rapidly, and adapted readily to spinner culture. In plates, the TnT4 cells displayed variable morphologies including a small number of round cells and many cells with extended filipodia exhibiting diverse morphology (FIG. 2), but formed a contiguous sheet-like monolayer when confluent. When transferred to spinner culture the cells occasionally formed aggregates but if stirred at sufficient speed in suspension they were maintained as single cells. For verification purposes DNA was extracted from the cells and DAF analysis performed as previously described (McIntosh et al. 1996). The DAF profile of TnT4 cells was distinct from that of Sf21 (FIG. 3).
Example 3
Cell Growth and Virus Production
[0078] Cell growth rate was determined by counting cells, grown in tissue culture plates, at 24 h intervals (FIG. 4A). Calculated average cell doubling time was 21 hours. Production of AcMNPV budded virus in TnT4 cells was compared with that of Sf21 cells over time (FIG. 4B). TnT4 cells produced less BV than Sf21 cells over a 72 h period. There was also a delay in initial BV production in TnT4 cells compared to Sf21 cells (FIG. 4B, compare 12 and 24 h time points).
Example 4
Protein Expression
[0079] TnT4 protein expression was compared to that of Sf21 and Hi-5 cells by infecting cells with P10-NTSR1-GFP or Pie1-NTSR1-GFP, recombinant AcMNPV each expressing a G-protein coupled receptor EGFP-fusion protein. Expression levels at various times post-infection (pi) were compared by flow cytometry analysis of fluorescence (Table 1). Cellular localization and relative GFP expression within Sf21 and TnT4 cell populations were analyzed by confocal microscopy (FIGS. 5 and 6). All of the cells had low autofluorescence, see mock-infected cells (mock, Table 1, FIGS. 5A and 6A). Flow cytometry analysis indicated differences in promoter strength and utilization among Sf21, Tn4, and Hi-5 cells at 24 h pi. At 24 h pi the percentage of cells expressing NTSR1-GFP from the ie-1 promoter was considerably higher in TnT4 than in Sf21 cells (Compare FIGS. 5B and 6B, Table 1). In addition the fluorescent intensity of the TnT4 GFP+ cells was significantly greater than the Sf21 cells (p=0.028). Hi-5 cells had a higher percentage of fluorescing cells than either Sf21 or TnT4, and similar fluorescent intensity as TnT4 cells. At 24 h pi, while the percentage of cells expressing NTSR1-GFP from the P10 promoter was slightly higher in Sf21 than in TnT4 cells, the fluorescence intensity was approximately two-fold more (Compare FIGS. 5C and 6C, Table 1). At 24 h pi, Hi-5 cells expressing NTSR1-GFP from the P10 promoter was higher than either Sf21 or TnT4 cells.
[0080] At 48 h pi most cells (greater than 90%) of all cell lines were infected and expressing NTSR1-GFP from both promoters (Table 1; FIGS. 5C, 5E, 6C and 6E). Fluorescent intensity was slightly lower in both TnT4 and Hi-5 cells than in Sf21 cells when NTSR1-GFP was expressed from the ie-1 promoter, but twice that of Sf21 cells when expressed from the P10 promoter (Table 1). Fluorescent intensity of GFP+ cells expressed from the p10 promoter was significantly higher than Sf21 cells for both TnT4 (p=0.004) and Hi-5 (p=0.03).
Example 5
Secreted Glycoprotein Production
[0081] Infection with a recombinant AcMNPV expressing human placental secreted alkaline phosphatase (SEAP) (Davis et al. 1992) has been used to assess the ability of insect cells to express and glycosylate secretory proteins (Davis et al. 1992; Palomares et al. 2003). To further characterize protein expression in TnT4 cells the inventors compared SEAP production between Sf21 and TnT4 cells infected with rAcSEAP, which expresses SEAP from the AcMNPV polh promoter. SEAP activity in cell-free culture supernatants and cell lysates was analyzed (FIG. 7). At 24 h pi, significantly more SEAP activity was detected in both supernatants and cell lysates from infected Sf21 than from TnT4 cells (p=0.01). At all other times there were no statistical differences in SEAP activity between the two cell lines. However there were trends towards higher levels of SEAP activity in cell lysates from TnT4 and in supernatants from Sf21 cells at later times pi.
Example 6
Methods for hCR2, CCR2B, NPR3 and TRPV4 Membrane Proteins
[0082] Expression levels of hCR2, CCR2B, NPR3 and TRPV4 membrane proteins were compared by fluorescent intensity of the membrane protein/green fluorescent fusion-protein captured using a Coolsnaps camera mounted on a Nikon Eclipse inverted fluorescent microscope. Briefly, 2.5×105 cells were laid down to each well of the 12-well plate and cells were infected with the virus at MOI of 5. For each well, eight different views of the cells were selected randomly and pictures were taken under the same exposure time (250 ms) 24 h, 48 h and 72 h post infection. The same threshold was set up to get rid of the background and the average intensity of the GFP/area was measured by Metamorph V7.1 software (Molecular Devices). Data are shown from three independent experiments for each virus infected cell line (see, Table 3 and FIGS. 9A-9D). All constructs were made by inserting the Green Fluorescent Protein (GFP) coding sequence in frame with the C-terminus of the membrane protein coding sequence at the Autographa californica nucleopolyhedrovirus (AcMNPV) polyhedron gene locus, under control of the p10 promoter. The DNA sequences beginning with the start codon and ending with the stop codon for each of the hCR2, CCR2B, NPR3 and TRPV4 membrane proteins are identified as SEQ ID NOs. 18, 20, 22, and 23, respectively. All constructs included the membrane protein start codon and had the GFP coding sequence immediately following the last codon before the stop codon of the membrane protein. The recombinant viruses were used to infect insect cells and fluoresent intensity was measured as described above.
[0083] While the foregoing specification has been described with regard to certain preferred embodiments, and many details have been set forth for the purpose of illustration, it will be apparent to those skilled in the art that the invention may be subject to various modifications and additional embodiments, and that certain of the details described herein can be varied considerably without departing from the spirit and scope of the invention. Such modifications, equivalent variations and additional embodiments are also intended to fall within the scope of the appended claims.
REFERENCES
[0084] Akermoun, M.; Koglin, M.; Zvalova-Iooss, D.; Folschweiller, N.; Dowell, S. J. Gearing, K. L. Characterization of 16 human G protein-coupled receptors expressed in baculovirus-infected insect cells. Protein Expr. Purif., 44: 65-74; 2005. [0085] Becker, G. W.; Miller, J. R.; Kovacevic, S.; Ellis, R. M.; Louis, A. I.; Small, J. S.; Stark, D. H.; Roberts, E. F.; Wyrick, T. K.; Hoskins, J.; Chiou, X. G.; Sharp, J. D.; McClure, D. B.; Riggin, R. M. Kramer, R. M. Characterization by Electrospray Mass-Spectrometry of Human Ca2+-Sensitive Cytosolic Phospholipase-a(2) Produced in Baculovirus-Infected Insect Cells. Bio-Technology, 12: 69-74; 1994. [0086] Chai, H.; AlRubeai, M.; Chua, K. L.; Oh, S. K. W. Yap, M. G. S. Insect cell line dependent gene expression of recombinant human tumor necrosis factor-beta. Enzyme Microb. Technol., 18: 126-132; 1996. [0087] Chen, C. J. Thiem, S. M. Differential infectivity of two Autographa californica nucleopolyhedrovirus mutants on three permissive cell lines is the result of lef-7 deletion. Virology, 227: 88-95; 1997. [0088] Clem, R. J.; Fechheimer, M. Miller, L. K. Prevention of Apoptosis by a Baculovirus Gene During Infection of Insect Cells. Science, 254: 1388-1390; 1991. [0089] Cullen, B. R. Malim, M. H. Secreted Placental Alkaline-Phosphatase as a Eukaryotic Reporter Gene. Methods in Enzymology, 216: 362-368; 1992. [0090] Davis, T. R.; Trotter, K. M.; Granados, R. R. Wood, H. A. Baculovirus Expression of Alkaline-Phosphatase as a Reporter Gene for Evaluation of Production, Glycosylation and Secretion. Bio-Technology, 10: 1148-1150; 1992. [0091] Davis, T. R.; Wickham, T. J.; McKenna, K. A.; Granados, R. R.; Shuler, M. L. [0092] Wood, H. A. Comparative Recombinant Protein-Production of 8 Insect-Cell Lines. In Vitro Cell. Dev. Biol.-Anim., 29A: 388-390; 1993. [0093] Gaw, Z.-Y.; Liu, N. T. Zia, T. U. Tissue culture methods for cultivation of virus grasserie. Acta Virol., 3 (Suppl.): 55-60; 1959. [0094] Grace, T. Establishment of four strains of cells from insect tissues grown in vitro. Nature (London), 195: 788-789; 1962. [0095] Granados, R. R.; Li, G. X.; Derksen, A. C. G. McKenna, K. A. A New Insect-Cell Line from Trichoplusia Ni (Bti-Tn-5b1-4) Susceptible to Trichoplusia Ni Single Enveloped Nuclear Polyhedrosis-Virus. J. Invertebr. Pathol., 64: 260-266; 1994. [0096] Grisshammer, R. Tate, C. G. Overexpression of Integral Membrane-Proteins for Structural Studies. Quarterly Reviews of Biophysics, 28: 315-422; 1995. [0097] Grunewald, S.; Haase, W.; Reilander, H. Michel, H. Glycosylation, palmitoylation, and localization of the human D-2S receptor in Baculovirus-infected insect cells. [0098] Biochemistry, 35: 15149-15161; 1996. [0099] Hink, W. F. A Serum-Free Medium for the Culture of Insect Cells and Production of Recombinant Proteins. In Vitro Cellular & Developmental Biology, 27: 397-401; 1991. [0100] Hollister, J.; Grabenhorst, E.; Nimtz, M.; Conradt, H. Jarvis, D. L. Engineering the Protein N-Glycosylation Pathway in Insect Cells for Production of Biantennary, Complex N-Glycans. Biochemistry, 41: 15093-15104; 2002. [0101] Kuchler, R. J. Biochemical Methods in Cell Culture and Virology. Stroudsburg: Dowden, Hutchinson & Ross, Inc. 1977. [0102] Lu, A. Miller, L. K. Species-specific effects of the hcf-1 gene on baculovirus virulence. J. Virol., 70: 5123-5130; 1996. [0103] Lynn, D. E. Development and characterization of insect cell lines. Cytotechnology, 20: 3-11; 1996. [0104] Lynn, D. E. Novel techniques to establish new insect cell lines. In Vitro Cellular & Developmental Biology-Animal, 37: 319-321; 2001. [0105] Massotte, D. G protein-coupled receptor overexpression with the baculovirus-insect cell system: a tool for structural and functional studies. Biochim. Biophys. Acta-Biomembr., 1610: 77-89; 2003. [0106] McCusker, E. C.; Bane, S. E.; O'Malley, M. A. Robinson, A. S. Heterologous GPCR expression: A bottleneck to obtaining crystal structures. Biotechnol. Prog., 23: 540-547; 2007. [0107] McIntosh, A. H.; Grasela, J. J. Matteri, R. L. Identification of insect cell lines by DNA amplification fingerprinting (DAF). Insect Mol. Biol., 5: 187-195; 1996. [0108] McKenna, K. A.; Hong, H. Z.; vanNunen, E. Granados, R. R. Establishment of new Trichoplusia ni cell lines in serum-free medium for Baculovirus and recombinant protein production. J. Invertebr. Pathol., 71: 82-90; 1998. [0109] Ng, G. Y. K.; George, S. R.; Zastawny, R. L.; Caron, M.; Bouvier, M.; Dennis, M. Odowd, B. F. Human Serotonin(1b) Receptor Expression in Sf9 Cells--Phosphorylation, Palmitoylation, and Adenylyl-Cyclase Inhibition. Biochemistry, 32: 11727-11733; 1993. [0110] Ng, G. Y. K.; Odowd, B. F.; Caron, M.; Dennis, M.; Brann, M. R. George, S. R. Phosphorylation and Palmitoylation of the Human D2 (L) Dopamine-Receptor in Sf9 Cells. J. Neurochem., 63: 1589-1595; 1994. [0111] O'Reilly, D. R.; Miller, L. K. Luckow, V. Baculovirus Expression Vectors: A Laboratory Manual. New York: W. H. Freeman and Company. 1992. [0112] Ogonah, 0. W.; Freedman, R. B.; Jenkins, N.; Patel, K. Rooney, B. C. Isolation and characterization of an insect cell line able to perform complex N-linked glycosylation on recombinant proteins. Bio-Technology, 14: 197-202; 1996. [0113] Palomares, L. A.; Joosten, C. E.; Hughes, P. R.; Granados, R. R. Shuler, M. L. Novel insect cell line capable of complex N-glycosylation and sialylation of recombinant proteins. Biotechnol. Prog., 19: 185-192; 2003. [0114] Sarramegna, V.; Talmont, R.; Demange, P. Milon, A. Heterologous expression of G-protein-coupled receptors: comparison of expression systems from the standpoint of large-scale production and purification. Cellular and Molecular Life Sciences, 60: 1529-1546; 2003. [0115] Smith, G. E.; Ju, G.; Ericson, B. L.; Moschera, J.; Lahm, H. W.; Chizzonite, R. [0116] Summers, M. D. Modification and Secretion of Human Interleukin-2 Produced in Insect Cells by a Baculovirus Expression Vector. Proceedings of the National Academy of Sciences of the United States of America, 82: 8404-8408; 1985. [0117] Vaughn, J. L.; Goodwin, R. H.; Tompkins, G. J. McCawley, P. Establishment of 2 Cell Lines from Insect Spodoptera-Frugiperda (Lepidoptera-Noctuidae). In Vitro-Journal of the Tissue Culture Association, 13: 213-217; 1977. [0118] Weyer, U.; Knight, S. Possee, R. D. Analysis of Very Late Gene-Expression by Autographa-Californica Nuclear Polyhedrosis-Virus and the Further Development of Multiple Expression Vectors. J. Gen. Virol., 71: 1525-1534; 1990. [0119] Wickham, T. J.; Davis, T.; Granados, R. R.; Shuler, M. L. Wood, H. A. Screening of Insect Cell-Lines for the Production of Recombinant Proteins and Infectious Virus in the Baculovirus Expression System. Biotechnol. Prog., 8: 391-396; 1992. [0120] Zavodzky, P. Cseh, S. Production of multidomain complement glycoproteins in insect cells. Cytotechnology, 20: 279-288; 1996. [0121] Zhao, Y. Sane, D. C. Expression of a Recombinant Baculovirus for Vitronectin in Insect Cells--Purification, Characterization of Posttranslational Modifications and Functional-Studies of the Recombinant Protein. Arch. Biochem. Biophys., 304: 434-442; 1993.
Sequence CWU
1
2314158DNAHomo sapiens 1caagctcgcc ccgcgcagcc cgagccgggc tgggcgctgt
cctcgggggc ctggggaacc 60gcgcggtttg gagatcggag gcacctggaa cccgtggcaa
gcgccgagcc gggagacagc 120ccgaggaacc acgggttctg gagctaggag ccggaagctg
ggagtccgga ggagagcgga 180gcccggagcc cggagcccgg ggcggcgcgt ctgggtctgg
cgcttcccga ctggacggcg 240cgcccgctgg tcttcgccac gcgccctccc ctgggctccc
gttcatcggt ccccgcctga 300gacgcgccca ctcctgcccg gacttccagc cccggaggcg
ccggacagag ccgcggactc 360cagcgcccac catgcgcctc aacagctccg cgccgggaac
cccgggcacg ccggccgccg 420accccttcca gcgggcgcag gccggactgg aggaggcgct
gctggccccg ggcttcggca 480acgcttcggg caacgcgtcg gagcgcgtcc tggcggcacc
cagcagcgag ctggacgtga 540acaccgacat ctactccaag gtgctggtga ccgccgtgta
cctggcgctc ttcgtggtgg 600gcacggtggg caacacggtg acggcgttca cgctggcgcg
gaagaagtcg ctgcagagcc 660tgcagagcac ggtgcattac cacctgggca gcctggcgct
gtccgacctg ctcaccctgc 720tgctggccat gcccgtggag ctgtacaact tcatctgggt
gcaccacccc tgggccttcg 780gcgacgccgg ctgccgcggc tactacttcc tgcgcgacgc
ctgcacctac gccacggccc 840tcaacgtggc cagcctgagt gtggagcgct acctggccat
ctgccacccc ttcaaggcca 900agaccctcat gtcccgaagc cgcaccaaga agttcatcag
cgccatctgg ctcgcctcgg 960ccctgctggc ggtgcctatg ctgttcacca tgggcgagca
gaaccgcagc gccgacggcc 1020agcacgccgg cggcctggtg tgcaccccca ccatccacac
tgccaccgtc aaggtcgtca 1080tacaggtcaa caccttcatg tccttcatat tccccatggt
ggtcatctcg gtcctgaaca 1140ccatcatcgc caacaagctg accgtcatgg tacgccaggc
ggccgagcag ggccaagtgt 1200gcacggtcgg gggcgagcac agcacattca gcatggccat
cgagcctggc agggtccagg 1260ccctgcggca cggcgtgcgc gtcctacgtg cagtggtcat
cgcctttgtg gtctgctggc 1320tgccctacca cgtgcggcgc ctcatgttct gctacatctc
ggatgagcag tggactccgt 1380tcctctatga cttctaccac tacttctaca tggtgaccaa
cgcactcttc tacgtcagct 1440ccaccatcaa ccccatcctg tacaacctcg tctctgccaa
cttccgccac atcttcctgg 1500ccacactggc ctgcctctgc ccggtgtggc ggcgcaggag
gaagaggcca gccttctcga 1560ggaaggccga cagcgtgtcc agcaaccaca ccctctccag
caatgccacc cgcgagacgc 1620tgtactaggc tgtgcgcccc ggaacgtgtc caggaggagc
ctggccatgg gtccttgccc 1680ccgacagaca gagcagcccc cacccgggag ccttgatggg
ggtcaggcag aggccagcct 1740gcactggagt ctgaggcctg ggaccccccc ctcccacccc
ctaacccatg tttctcatta 1800gtgtctcccg ggcctgtccc caactcctcc ccacccctcc
cccatctcct ctttgaaagc 1860cagaacaaga gagcgctcct ctcccagata ggaaaagggc
ctctaacaag gagaaattag 1920tgtgcggcaa aaggcagttt tctttgttct cagactaatg
gatggttcca gagaaggaaa 1980tgaaaggtgc tgggtggggc cgggcctccg gcggcccggc
tgctgttccc atgtccacat 2040ctctgaggcc tgcaccccct ctgtctagct cggggagtcc
agccccagtc ccgcaggctc 2100cgtggctttg ggcctcacgt gcagaccctg ccatgcagac
ccatgccccc ctcccccagg 2160cagctccaag aaagctccct gactcgcccc ttcaggcctg
gcaagctggg ggcccatcgc 2220cgtggggagt ccctcccacc accctcgccg caggcagctg
cagcccccag aggggaccac 2280aagcccaaaa aggacaaaaa tgggctggcc tggaatggcc
cagaccccag cctcccctcc 2340tccctcccat cctcacccag gccaaggccc aggggctctg
ccaggacacc acatgggagg 2400gggctcaggc ctcagcctca agatcttcag ctgtggcctc
tcgggctcgg cagaagggac 2460gccggatcag gggcctggtc tccagcacct gcccgagtgg
ccgtggccag gatggggtgc 2520gcattccgtg tgctttgctt gtggctgtgc aggctgaggt
ctggagccag gcccagagct 2580ggcttcaggg tggggccttg agaaggggaa tgtgggacag
gggcgatggt gcctggtctc 2640tgagtaagat gccaggtccc aggaactcag gcttcaggtg
agaaggagcg gtgtgtccag 2700gcaccgctgg ccggcagccc tgggctgagg cacagactca
tttgtcacct tctggcggcg 2760gcagccctgg ccccggcctc caagcagttg aaaaagctgg
cgcctccttg gtctctagga 2820tccaggctcc acagagcaca tgactagcca ggcccctggc
ttaagaaggt cgcctaagcc 2880taagagaaga cagtcccagg agaagctggc cgggaccagc
caggagctgg gagccacagg 2940aagcaaaagt cagccttttc ttcaagggat ttccctgtct
cagagcagcc tttgccccag 3000ggaaatgggc tctgggctgg ctgcctgcac cggccatgtc
gacccaggac ccggacacct 3060ggtcttgggc tgtgttcagc cactttgcct tctctggact
cagtttcccc gtctgagaaa 3120tgagagtcga atgctacagt atctgcagtc gcttggatct
ggctgttgag ttgacgggtt 3180ccttgaaccc cacaaaatcc ctctccaacc acaggaccct
tcggctcacc aagaacaggg 3240cccaggggag tcaggcctat tcgctgcact tcctgccaaa
ctttgccccc acaagcctgg 3300tcatcagcca ggcagccctc ccagtgccca agggccacca
accccaggga aacagggcca 3360gcacagaggg gccttcctcc cccacagagc ccccatgaca
tagtctgctc tgggcggaag 3420agctttgctg ccagccaggg atgtccagag gtcagtgcag
cccctacccc tgctcaggag 3480tgggctcaga gtctagcaaa tgctaaggcc cctcaggctg
ggctctgaac gaggacctgg 3540actcagagcc agacagggca gcctcagacc cttctctggg
gctcctggac cttgggccat 3600aatttctgag cctcggtttc cccatctaag gaacagatgt
ggtcgttccg ccctctcagc 3660tggatgagac tgtcctggag gatccacccc ggaacagaca
gaatggtgtc tctcaggatg 3720gtgctctgag agagggcaga gtggatgccc cactgcccta
gaccctcggt agacgtgggg 3780tctctggggc ggggtctgtg gctgtgactg aagtcggctt
ttcccgttga tgtcttgatg 3840ctcctatctg tgcacttacc gtaggtaggg acacgtgtcc
acgcaccaca gacacaccca 3900cgacacctga tctcgtatca ctagcttgcg gccaggtcat
gatgtggccc cggaagctgg 3960ccctgcgtgc catgagtgcg tcggtcatgg agtccggagc
ccctgagccg gcccctggtg 4020acggcacagc cctcacagct caaacgccca cccccactcc
caccatctgc aggtggtgaa 4080aacaaacccc gtgtatctct caataaaggt ggccgaaggg
cctcgatgtg gaaaaaaaaa 4140aaaaaaaaaa aaaaaaaa
4158244DNAArtificial SequencePrimer 2atgcactagt
aaagaattca ccatgcgcct caacagctcc gcgc
44339DNAArtificial SequencePrimer 3ggtaaagctt aaaccggtag cgtctcgcgg
gtggcattg 39434DNAArtificial SequencePrimer
4tccaccggtc gccaccatgg tgagcaaggg cgag
34536DNAArtificial SequencePrimer 5gataaagctt ataagatcta tattacttgt
acagct 36629DNAArtificial SequencePrimer
6gttggagtct agagtgctat tttacaaag
29731DNAArtificial SequencePrimer 7gattggaatt caaatgtaat ttacagtata g
31827DNAArtificial SequencePrimer
8aagcttctag aatccgctca ccaaacg
27926DNAArtificial SequencePrimer 9tttgcgtcat agtgaattcg ttgttc
261023DNAArtificial SequencePrimer
10ccgtcctcct tgaagtcgat gcc
231125DNAArtificial SequencePrimer 11acggtgcatt accacctggg cagcc
251230DNAArtificial SequencePrimer
12accatcatcg ccaacaagct gaccgtcatg
301325DNAArtificial SequencePrimer 13caggaggaag aggccagcct tctcg
251420DNAArtificial SequencePrimer
14acatccagat ccgatcaagt
201520DNAArtificial SequencePrimer 15gccaggaatg ttgcttgcaa
20161257DNAHomo sapiens 16atgcgcctca
acagctccgc gccgggaacc ccgggcacgc cggccgccga ccccttccag 60cgggcgcagg
ccggactgga ggaggcgctg ctggccccgg gcttcggcaa cgcttcgggc 120aacgcgtcgg
agcgcgtcct ggcggcaccc agcagcgagc tggacgtgaa caccgacatc 180tactccaagg
tgctggtgac cgccgtgtac ctggcgctct tcgtggtggg cacggtgggc 240aacacggtga
cggcgttcac gctggcgcgg aagaagtcgc tgcagagcct gcagagcacg 300gtgcattacc
acctgggcag cctggcgctg tccgacctgc tcaccctgct gctggccatg 360cccgtggagc
tgtacaactt catctgggtg caccacccct gggccttcgg cgacgccggc 420tgccgcggct
actacttcct gcgcgacgcc tgcacctacg ccacggccct caacgtggcc 480agcctgagtg
tggagcgcta cctggccatc tgccacccct tcaaggccaa gaccctcatg 540tcccgaagcc
gcaccaagaa gttcatcagc gccatctggc tcgcctcggc cctgctggcg 600gtgcctatgc
tgttcaccat gggcgagcag aaccgcagcg ccgacggcca gcacgccggc 660ggcctggtgt
gcacccccac catccacact gccaccgtca aggtcgtcat acaggtcaac 720accttcatgt
ccttcatatt ccccatggtg gtcatctcgg tcctgaacac catcatcgcc 780aacaagctga
ccgtcatggt acgccaggcg gccgagcagg gccaagtgtg cacggtcggg 840ggcgagcaca
gcacattcag catggccatc gagcctggca gggtccaggc cctgcggcac 900ggcgtgcgcg
tcctacgtgc agtggtcatc gcctttgtgg tctgctggct gccctaccac 960gtgcggcgcc
tcatgttctg ctacatctcg gatgagcagt ggactccgtt cctctatgac 1020ttctaccact
acttctacat ggtgaccaac gcactcttct acgtcagctc caccatcaac 1080cccatcctgt
acaacctcgt ctctgccaac ttccgccaca tcttcctggc cacactggcc 1140tgcctctgcc
cggtgtggcg gcgcaggagg aagaggccag ccttctcgag gaaggccgac 1200agcgtgtcca
gcaaccacac cctctccagc aatgccaccc gcgagacgct gtactag
1257171789DNAHomo sapiens 17caggtcctgg gagaggacag aaaacaactg ggactcctca
gcccccggca gctcccagtg 60cccagccacc cacaacacaa cccaaagcct tctagacaag
ctcagtggaa tctgaagggc 120ccaccccatg gaggaatgct gggtgacaga gatagccaat
ggctccaagg atggcttgga 180ttccaaccct atgaaggatt acatgatcct gagtggtccc
cagaagacag ctgttgctgt 240gttgtgcact cttctgggcc tgctaagtgc cctggagaac
gtggctgtgc tctatctgat 300cctgtcctcc caccaactcc gccggaagcc ctcatacctg
ttcattggca gcttggctgg 360ggctgacttc ctggccagtg tggtctttgc atgcagcttt
gtgaatttcc atgttttcca 420tggtgtggat tccaaggctg tcttcctgct gaagattggc
agcgtgacta tgaccttcac 480agcctctgtg ggtagcctcc tgctgaccgc cattgaccga
tacctctgcc tgcgctatcc 540accttcctac aaagctctgc tcacccgtgg aagggcactg
gtgaccctgg gcatcatgtg 600ggtcctctca gcactagtct cctacctgcc cctcatggga
tggacttgct gtcccaggcc 660ctgctctgag cttttcccac tgatccccaa tgactacctg
ctgagctggc tcctgttcat 720cgccttcctc ttttccggaa tcatctacac ctatgggcat
gttctctgga aggcccatca 780gcatgtggcc agcttgtctg gccaccagga caggcaggtg
ccaggaatgg cccgaatgag 840gctggatgtg aggttggcca agaccctagg gctagtgttg
gctgtgctcc tcatctgttg 900gttcccagtg ctggccctca tggcccacag cctggccact
acgctcagtg accaggtcaa 960gaaggccttt gctttctgct ccatgctgtg cctcatcaac
tccatggtca accctgtcat 1020ctatgctcta cggagtggag agatccgctc ctctgcccat
cactgcctgg ctcactggaa 1080gaagtgtgtg aggggccttg ggtcagaggc aaaagaagaa
gccccgagat cctcagtcac 1140cgagacagag gctgatggga aaatcactcc gtggccagat
tccagagatc tagacctctc 1200tgattgctga tgaggcctct tcccaattta aacaactcaa
gtcagaaatc agttcactcc 1260ctggaagaga gagaggggtc ttggcactct cttcttactt
aaaccagtcc cagacaccta 1320gacacggacc cctttttgct gatgagtgtt gggactgact
cctggaagac agcctggcct 1380tgcccacctg cacacagtct gttggatagg tagggccacg
aggagtagcc aggtaggcga 1440gacacaaaag gcctgggaca gggtcagtac aagtcaggtc
aggcttcatg cctgcatcct 1500ccagagacca caggagccaa agcgagcctc caggcccagc
aatgagggac ttgggagaaa 1560tctgagaaga atgggttgtt ctcttgggaa gtcagggtat
cagatgggat ggacatccag 1620gtcttctctc tgcctaattg tcaaggcctc cttggctctg
gagctatgaa aggccccact 1680ttcaagtcac ccttgccact gaggaccgag gactatgcta
tgatgaggat taaggtgttg 1740acttgcctct ttcagagata aatgacaagc cttcaaaaaa
aaaaaaaaa 1789181083DNAHomo sapiens 18atggaggaat gctgggtgac
agagatagcc aatggctcca aggatggctt ggattccaac 60cctatgaagg attacatgat
cctgagtggt ccccagaaga cagctgttgc tgtgttgtgc 120actcttctgg gcctgctaag
tgccctggag aacgtggctg tgctctatct gatcctgtcc 180tcccaccaac tccgccggaa
gccctcatac ctgttcattg gcagcttggc tggggctgac 240ttcctggcca gtgtggtctt
tgcatgcagc tttgtgaatt tccatgtttt ccatggtgtg 300gattccaagg ctgtcttcct
gctgaagatt ggcagcgtga ctatgacctt cacagcctct 360gtgggtagcc tcctgctgac
cgccattgac cgatacctct gcctgcgcta tccaccttcc 420tacaaagctc tgctcacccg
tggaagggca ctggtgaccc tgggcatcat gtgggtcctc 480tcagcactag tctcctacct
gcccctcatg ggatggactt gctgtcccag gccctgctct 540gagcttttcc cactgatccc
caatgactac ctgctgagct ggctcctgtt catcgccttc 600ctcttttccg gaatcatcta
cacctatggg catgttctct ggaaggccca tcagcatgtg 660gccagcttgt ctggccacca
ggacaggcag gtgccaggaa tggcccgaat gaggctggat 720gtgaggttgg ccaagaccct
agggctagtg ttggctgtgc tcctcatctg ttggttccca 780gtgctggccc tcatggccca
cagcctggcc actacgctca gtgaccaggt caagaaggcc 840tttgctttct gctccatgct
gtgcctcatc aactccatgg tcaaccctgt catctatgct 900ctacggagtg gagagatccg
ctcctctgcc catcactgcc tggctcactg gaagaagtgt 960gtgaggggcc ttgggtcaga
ggcaaaagaa gaagccccga gatcctcagt caccgagaca 1020gaggctgatg ggaaaatcac
tccgtggcca gattccagag atctagacct ctctgattgc 1080tga
1083192492DNAHomo sapiens
19agaaacagga gcagatgtac agggtttgcc tgactcacac tcaaggttgc ataagcaaga
60tttcaaaatt aatcctattc tggagacctc aacccaatgt acaatgttcc tgactggaaa
120agaagaacta tatttttctg attttttttt tcaaatcttt accattagtt gccctgtatc
180tccgccttca ctttctgcag gaaactttat ttcctacttc tgcatgccaa gtttctacct
240ctagatctgt ttggttcagt tgctgagaag cctgacatac caggactgcc tgagacaagc
300cacaagctga acagagaaag tggattgaac aaggacgcat ttccccagta catccacaac
360atgctgtcca catctcgttc tcggtttatc agaaatacca acgagagcgg tgaagaagtc
420accacctttt ttgattatga ttacggtgct ccctgtcata aatttgacgt gaagcaaatt
480ggggcccaac tcctgcctcc gctctactcg ctggtgttca tctttggttt tgtgggcaac
540atgctggtcg tcctcatctt aataaactgc aaaaagctga agtgcttgac tgacatttac
600ctgctcaacc tggccatctc tgatctgctt tttcttatta ctctcccatt gtgggctcac
660tctgctgcaa atgagtgggt ctttgggaat gcaatgtgca aattattcac agggctgtat
720cacatcggtt attttggcgg aatcttcttc atcatcctcc tgacaatcga tagatacctg
780gctattgtcc atgctgtgtt tgctttaaaa gccaggacgg tcacctttgg ggtggtgaca
840agtgtgatca cctggttggt ggctgtgttt gcttctgtcc caggaatcat ctttactaaa
900tgccagaaag aagattctgt ttatgtctgt ggcccttatt ttccacgagg atggaataat
960ttccacacaa taatgaggaa cattttgggg ctggtcctgc cgctgctcat catggtcatc
1020tgctactcgg gaatcctgaa aaccctgctt cggtgtcgaa acgagaagaa gaggcatagg
1080gcagtgagag tcatcttcac catcatgatt gtttactttc tcttctggac tccctataat
1140attgtcattc tcctgaacac cttccaggaa ttcttcggcc tgagtaactg tgaaagcacc
1200agtcaactgg accaagccac gcaggtgaca gagactcttg ggatgactca ctgctgcatc
1260aatcccatca tctatgcctt cgttggggag aagttcagaa ggtatctctc ggtgttcttc
1320cgaaagcaca tcaccaagcg cttctgcaaa caatgtccag ttttctacag ggagacagtg
1380gatggagtga cttcaacaaa cacgccttcc actggggagc aggaagtctc ggctggttta
1440taaaacgagg agcagtttga ttgttgttta taaagggaga taacaatctg tatataacaa
1500caaacttcaa gggtttgttg aacaatagaa acctgtaaag caggtgccca ggaacctcag
1560ggctgtgtgt actaatacag actatgtcac ccaatgcata tccaacatgt gctcagggaa
1620taatccagaa aaactgtggg tagagacttt gactctccag aaagctcatc tcagctcctg
1680aaaaatgcct cattaccttg tgctaatcct ctttttctag tcttcataat ttcttcactc
1740aatctctgat tctgtcaatg tcttgaaatc aagggccagc tggaggtgaa gaagagaatg
1800tgacaggcac agatgaatgg gagtgaggga tagtggggtc agggctgaga ggagaaggag
1860ggagacatga gcatggctga gcctggacaa agacaaaggt gagcaaaggg ctcacgcatt
1920cagccaggag atgatactgg tccttagccc catctgccac gtgtatttaa ccttgaaggg
1980ttcaccaggt cagggagagt ttgggaactg caataacctg ggagttttgg tggagtccga
2040tgattctctt ttgcataagt gcatgacata tttttgcttt attacagttt atctatggca
2100cccatgcacc ttacatttga aatctatgaa atatcatgct ccattgttca gatgcttctt
2160aggccacatc cccctgtcta aaaattcaga aaatttttgt ttataaaaga tgcattatct
2220atgatatgct aatatatgta tatgcaatat atataggctc ttgcttgatc tctccaggag
2280gtagtgatta tgagaagggg gtggagaatg atgagttcct tcaccaggag caaaggacgg
2340ggatcgtgtg gaaccactgc agaactattt ccgaaatcaa ctaagtggag agagccagga
2400aggctgcatc agaacccagt aaagcttctt gtctggatct gagctggttt gttttgtgct
2460tgcttttccc tgccttgcca ctcccctcac tc
2492201083DNAHomo sapiens 20atgctgtcca catctcgttc tcggtttatc agaaatacca
acgagagcgg tgaagaagtc 60accacctttt ttgattatga ttacggtgct ccctgtcata
aatttgacgt gaagcaaatt 120ggggcccaac tcctgcctcc gctctactcg ctggtgttca
tctttggttt tgtgggcaac 180atgctggtcg tcctcatctt aataaactgc aaaaagctga
agtgcttgac tgacatttac 240ctgctcaacc tggccatctc tgatctgctt tttcttatta
ctctcccatt gtgggctcac 300tctgctgcaa atgagtgggt ctttgggaat gcaatgtgca
aattattcac agggctgtat 360cacatcggtt attttggcgg aatcttcttc atcatcctcc
tgacaatcga tagatacctg 420gctattgtcc atgctgtgtt tgctttaaaa gccaggacgg
tcacctttgg ggtggtgaca 480agtgtgatca cctggttggt ggctgtgttt gcttctgtcc
caggaatcat ctttactaaa 540tgccagaaag aagattctgt ttatgtctgt ggcccttatt
ttccacgagg atggaataat 600ttccacacaa taatgaggaa cattttgggg ctggtcctgc
cgctgctcat catggtcatc 660tgctactcgg gaatcctgaa aaccctgctt cggtgtcgaa
acgagaagaa gaggcatagg 720gcagtgagag tcatcttcac catcatgatt gtttactttc
tcttctggac tccctataat 780attgtcattc tcctgaacac cttccaggaa ttcttcggcc
tgagtaactg tgaaagcacc 840agtcaactgg accaagccac gcaggtgaca gagactcttg
ggatgactca ctgctgcatc 900aatcccatca tctatgcctt cgttggggag aagttcagaa
ggtatctctc ggtgttcttc 960cgaaagcaca tcaccaagcg cttctgcaaa caatgtccag
ttttctacag ggagacagtg 1020gatggagtga cttcaacaaa cacgccttcc actggggagc
aggaagtctc ggctggttta 1080taa
1083212452DNAMus musculus 21gccggcggcc agggcgagcg
cttactggca acacgatgcg gtccttgctg ctgttcactt 60tctcggcgtg cgtgctgctg
gcccgggtgc tgctggctgg cggcgcgagc agcggcgccg 120gggacacccg gccaggcagc
aggcgccggg cgagagaggc gctggcggct caaaagatcg 180aggtgcttgt tctattgccc
cgggacgatt cgtacttgtt ctcgctggcc cgggtgaggc 240cggccatcga gtacgcgctg
cgtagcgtgg agggcaatgg caccgggagg aagctgctgc 300cgccgggcac tcgcttccag
gtggcctacg aagactcgga ctgcggcaac cgcgcgctct 360tcagtcttgt ggaccgcgtg
gcggcggcgc gcggcgccaa gccggatctc atcctggggc 420ccgtgtgcga gtacgcggcg
gcgccggtgg ctcggctggc gtctcactgg gacctgccga 480tgctgtccgc aggagcgctg
gccgccggtt tccagcacaa ggacacggaa tactcgcacc 540tcacgcgcgt ggcgcctgcc
tacgccaaga tgggagagat gatgctcgct ctgtttcgcc 600accaccactg gagccgtgca
gccctggtct acagcgacga caaactcgag aggaactgtt 660atttcaccct cgagggggtc
cacgaggttt ttcaggagga ggggttgcac acgtctgcct 720acaatttcga cgaaaccaaa
gacttggacc tggacgacat agtgcgctac atccaaggca 780gcgagcgagt ggtgatcatg
tgtgccagtg gtgacaccat tcggagaatc atgttggcgg 840tgcacagaca cggcatgacc
agtggagact acgctttctt caacattgaa ctcttcaaca 900gttcttccta cggagatggc
tcgtggagga gaggagacaa acacgactct gaagctaaac 960aagcatactc gtccctccaa
acagtcactc tactgaggac cgtgaaacct gagtttgaga 1020agttttccat ggaggtgaaa
agttctgttg agaaacaagg gctcaatgag gaggattacg 1080tgaacatgtt tgttgaaggg
ttccatgacg ccatcctcct ctacgttctg gctttacacg 1140aagtgctcag agctggctac
agcaagaagg atggggggaa aatcatccag cagacttgga 1200acaggacatt tgaaggtatc
gctgggcagg tgtccataga tgccaacggg gaccggtatg 1260gggacttctc tgtggttgcc
atgactgaca ctgaagcagg cacccaagag gtcattggtg 1320attactttgg gaaagaaggc
cggttccaaa tgcgatcgaa tgtcaaatat ccttggggcc 1380ctttgaaact gagactagat
gagaccagaa tcgtggagca taccaacagc tctccttgca 1440aatcatgtgg cctagaagaa
tctgcagtga caggaatcgt tgtgggggcc ctactaggtg 1500ctggcttgct aatggccttc
tactttttca ggaagaaata cagaataacc attgagaggc 1560gaaatcagca agaggaaagc
aacatcggga agcatcgaga gctgcgggaa gattccatca 1620gatcacattt ttcggtggct
taaaagagat gcccctctcg cttcgtctac ttgagattcc 1680ttaaagagat agatggaagg
acagacatca acggagcaga aagggcgttc tcggagaagt 1740cattctttta agcagtagtc
atttcatttt acattttctt tagaagctca ggaatgattg 1800ttaatcacta tctgccttct
ggcctctcat ctcatggcaa actaatataa tgaaacaacg 1860caatgctgtt aagtgttctg
gctgctggag gggcatcaga ggagatttat gtcttgaaag 1920tctgctgcat ccatatcttg
attgctttgg gggcagttca cacgaggata gaaaaatgtg 1980gcttttctga aatgaaatgt
tttgtagcta ggataaaaca atttttacaa ggagaatatt 2040cttggaaaga atttaacacc
caataagagg acaatggaat gaaagaaatc tccaggctgg 2100gaatgcagtg cccctctctc
tggaactggg ggacaggttt gtggttgatg aaggctgcgt 2160ccaacgtcca cattcaggtc
tgaattcata tctcaagaaa ggatcctccc tgtctctttt 2220agtgtctcat cagagctact
ctggaaaact gtaaatatta gtgagcaagg aggatttata 2280taagaaaatt gagtctaaaa
tgcttcttat acgatgtaaa aaaagtccta cttcacacta 2340acattttatt tttaagtatt
ttaatcttat attttggtat tagaaatgtg tctatttttt 2400cattttgaag attaaatttc
acttatattt taagagcaaa aaaaaaaaaa aa 2452221608DNAMus musculus
22atgcggtcct tgctgctgtt cactttctcg gcgtgcgtgc tgctggcccg ggtgctgctg
60gctggcggcg cgagcagcgg cgccggggac acccggccag gcagcaggcg ccgggcgaga
120gaggcgctgg cggctcaaaa gatcgaggtg cttgttctat tgccccggga cgattcgtac
180ttgttctcgc tggcccgggt gaggccggcc atcgagtacg cgctgcgtag cgtggagggc
240aatggcaccg ggaggaagct gctgccgccg ggcactcgct tccaggtggc ctacgaagac
300tcggactgcg gcaaccgcgc gctcttcagt cttgtggacc gcgtggcggc ggcgcgcggc
360gccaagccgg atctcatcct ggggcccgtg tgcgagtacg cggcggcgcc ggtggctcgg
420ctggcgtctc actgggacct gccgatgctg tccgcaggag cgctggccgc cggtttccag
480cacaaggaca cggaatactc gcacctcacg cgcgtggcgc ctgcctacgc caagatggga
540gagatgatgc tcgctctgtt tcgccaccac cactggagcc gtgcagccct ggtctacagc
600gacgacaaac tcgagaggaa ctgttatttc accctcgagg gggtccacga ggtttttcag
660gaggaggggt tgcacacgtc tgcctacaat ttcgacgaaa ccaaagactt ggacctggac
720gacatagtgc gctacatcca aggcagcgag cgagtggtga tcatgtgtgc cagtggtgac
780accattcgga gaatcatgtt ggcggtgcac agacacggca tgaccagtgg agactacgct
840ttcttcaaca ttgaactctt caacagttct tcctacggag atggctcgtg gaggagagga
900gacaaacacg actctgaagc taaacaagca tactcgtccc tccaaacagt cactctactg
960aggaccgtga aacctgagtt tgagaagttt tccatggagg tgaaaagttc tgttgagaaa
1020caagggctca atgaggagga ttacgtgaac atgtttgttg aagggttcca tgacgccatc
1080ctcctctacg ttctggcttt acacgaagtg ctcagagctg gctacagcaa gaaggatggg
1140gggaaaatca tccagcagac ttggaacagg acatttgaag gtatcgctgg gcaggtgtcc
1200atagatgcca acggggaccg gtatggggac ttctctgtgg ttgccatgac tgacactgaa
1260gcaggcaccc aagaggtcat tggtgattac tttgggaaag aaggccggtt ccaaatgcga
1320tcgaatgtca aatatccttg gggccctttg aaactgagac tagatgagac cagaatcgtg
1380gagcatacca acagctctcc ttgcaaatca tgtggcctag aagaatctgc agtgacagga
1440atcgttgtgg gggccctact aggtgctggc ttgctaatgg ccttctactt tttcaggaag
1500aaatacagaa taaccattga gaggcgaaat cagcaagagg aaagcaacat cgggaagcat
1560cgagagctgc gggaagattc catcagatca catttttcgg tggcttaa
1608232616DNAHomo sapiens 23atggcggatt ccagcgaagg cccccgcgcg gggcccgggg
aggtggctga gctccccggg 60gatgagagtg gcaccccagg tggggaggct tttcctctct
cctccctggc caatctgttt 120gagggggagg atggctccct ttcgccctca ccggctgatg
ccagtcgccc tgctggccca 180ggcgatgggc gaccaaatct gcgcatgaag ttccagggcg
ccttccgcaa gggggtgccc 240aaccccatcg atctgctgga gtccacccta tatgagtcct
cggtggtgcc tgggcccaag 300aaagcaccca tggactcact gtttgactac ggcacctatc
gtcaccactc cagtgacaac 360aagaggtgga ggaagaagat catagagaag cagccgcaga
gccccaaagc ccctgcccct 420cagccgcccc ccatcctcaa agtcttcaac cggcctatcc
tctttgacat cgtgtcccgg 480ggctccactg ctgacctgga cgggctgctc ccattcttgc
tgacccacaa gaaacgccta 540actgatgagg agtttcgaga gccatctacg gggaagacct
gcctgcccaa ggccttgctg 600aacctgagca atggccgcaa cgacaccatc cctgtgctgc
tggacatcgc ggagcgcacc 660ggcaacatgc gggagttcat taactcgccc ttccgtgaca
tctactatcg aggtcagaca 720gccctgcaca tcgccattga gcgtcgctgc aaacactacg
tggaacttct cgtggcccag 780ggagctgatg tccacgccca ggcccgtggg cgcttcttcc
agcccaagga tgaggggggc 840tacttctact ttggggagct gcccctgtcg ctggctgcct
gcaccaacca gccccacatt 900gtcaactacc tgacggagaa cccccacaag aaggcggaca
tgcggcgcca ggactcgcga 960ggcaacacag tgctgcatgc gctggtggcc attgctgaca
acacccgtga gaacaccaag 1020tttgttacca agatgtacga cctgctgctg ctcaagtgtg
cccgcctctt ccccgacagc 1080aacctggagg ccgtgctcaa caacgacggc ctctcgcccc
tcatgatggc tgccaagacg 1140ggcaagattg ggatctttca gcacatcatc cggcgggagg
tgacggatga ggacacacgg 1200cacctgtccc gcaagttcaa ggactgggcc tatgggccag
tgtattcctc gctttatgac 1260ctctcctccc tggacacgtg tggggaagag gcctccgtgc
tggagatcct ggtgtacaac 1320agcaagattg agaaccgcca cgagatgctg gctgtggagc
ccatcaatga actgctgcgg 1380gacaagtggc gcaagttcgg ggccgtctcc ttctacatca
acgtggtctc ctacctgtgt 1440gccatggtca tcttcactct caccgcctac taccagccgc
tggagggcac accgccgtac 1500ccttaccgca ccacggtgga ctacctgcgg ctggctggcg
aggtcattac gctcttcact 1560ggggtcctgt tcttcttcac caacatcaaa gacttgttca
tgaagaaatg ccctggagtg 1620aattctctct tcattgatgg ctccttccag ctgctctact
tcatctactc tgtcctggtg 1680atcgtctcag cagccctcta cctggcaggg atcgaggcct
acctggccgt gatggtcttt 1740gccctggtcc tgggctggat gaatgccctt tacttcaccc
gtgggctgaa gctgacgggg 1800acctatagca tcatgatcca gaagattctc ttcaaggacc
ttttccgatt cctgctcgtc 1860tacttgctct tcatgatcgg ctacgcttca gccctggtct
ccctcctgaa cccgtgtgcc 1920aacatgaagg tgtgcaatga ggaccagacc aactgcacag
tgcccactta cccctcgtgc 1980cgtgacagcg agaccttcag caccttcctc ctggacctgt
ttaagctgac catcggcatg 2040ggcgacctgg agatgctgag cagcaccaag taccccgtgg
tcttcatcat cctgctggtg 2100acctacatca tcctcacctt tgtgctgctc ctcaacatgc
tcattgccct catgggcgag 2160acagtgggcc aggtctccaa ggagagcaag cacatctgga
agctgcagtg ggccaccacc 2220atcctggaca ttgagcgctc cttccccgta ttcctgagga
aggccttccg ctctggggag 2280atggtcaccg tgggcaagag ctcggacggc actcctgacc
gcaggtggtg cttcagggtg 2340gatgaggtga actggtctca ctggaaccag aacttgggca
tcatcaacga ggacccgggc 2400aagaatgaga cctaccagta ttatggcttc tcgcataccg
tgggccgcct ccgcagggat 2460cgctggtcct cggtggtacc ccgcgtggtg gaactgaaca
agaactcgaa cccggacgag 2520gtggtggtgc ctctggacag catggggaac ccccgctgcg
atggccacca gcagggttac 2580ccccgcaagt ggaggactga ggacgccccg ctctag
2616
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: