Patent application title: NPC1L1 (NPC3) AND METHODS OF USE THEREOF
Inventors:
Scott W. Altmann (Fanwood, NJ, US)
Nicholas J. Murgolo (Millington, NJ, US)
Luquan Wang (East Brunswick, NJ, US)
Michael P. Graziano (Scotch Plains, NJ, US)
Assignees:
Schering Corporation
IPC8 Class: AA01K67027FI
USPC Class:
800 18
Class name: Transgenic nonhuman animal (e.g., mollusks, etc.) mammal mouse
Publication date: 2012-03-29
Patent application number: 20120079616
Abstract:
The present invention provides human, rat and mouse NPC1L1 polypeptides
and polynucleotides encoding the polypeptides. Also provided are methods
for detecting agonists and antagonists of NPC1L1. Inhibitors of NPC1L1
can be used for inhibiting intestinal cholesterol absorption in a
subject.Claims:
1. An isolated polypeptide comprising 42 or more contiguous amino acids
from an amino acid sequence selected from SEQ ID NOs: 2 and 12.
2. An isolated polypeptide comprising an amino acid sequence selected from SEQ ID NOs: 2, 4 and 12.
3. An isolated polynucleotide encoding a polypeptide of claim 1.
4. An isolated polynucleotide comprising a nucleotide sequence selected from SEQ ID NOs: 1, 3 and 11.
5. A recombinant vector comprising the polynucleotide of claim 3.
6. A host cell comprising the vector of claim 5.
7. An isolated antibody which specifically binds to a polypeptide comprising 42 or more contiguous amino acids from an amino acid sequence selected from SEQ ID NOs: 2 and 12 or to an isolated polypeptide comprising an amino acid of SEQ ID NO: 4.
8. An isolated antibody which specifically binds to a polypeptide comprising an amino acid sequence selected from SEQ ID NOs: 39-42.
9. A method for making a polypeptide comprising culturing a host cell of claim 6 under conditions in which the polynucleotide is expressed.
10. The method of claim 9 wherein the polypeptide is isolated from the culture.
11. A method for identifying an antagonist of NPC1L1 comprising: (a) contacting a host cell expressing a polypeptide comprising an amino acid sequence selected from SEQ ID NOs: 2, 4 and 12 or a functional fragment thereof on a cell surface, in the presence of a known amount of detectably labeled ezetimibe, with a sample to be tested for the presence of the antagonist; and (b) measuring the amount of detectably labeled ezetimibe specifically bound, directly or indirectly, to the polypeptide; wherein an NPC1L1 antagonist in the sample is identified by measuring substantially reduced direct or indirect binding of the detectably labeled ezetimibe to the polypeptide, compared to what would be measured in the absence of such an antagonist.
12. A method for identifying an antagonist of NPC1L1 comprising: (a) placing, in an aqueous suspension, a plurality of support particles, impregnated with a fluorescer, to which a host cell expressing a polypeptide comprising an amino acid sequence selected from SEQ ID NOs: 2, 4 and 12 or a functional fragment thereof on a cell surface are attached; (b) adding, to the suspension, radiolabeled ezetimibe and a sample to be tested for the presence of the antagonist, wherein the radiolabel emits radiation energy capable of activating the fluorescer upon direct or indirect binding of the ezetimibe to the polypeptide to produce light energy, whereas radiolabeled ezetimibe that does not directly or indirectly bind to the polypeptide is, generally, too far removed from the support particles to enable the radioactive energy to activate the fluorescer; and (c) measuring the light energy emitted by the fluorescer in the suspension; wherein an NPC1L1 antagonist in the sample is identified by measuring substantially reduced light energy emission, compared to what would be measured in the absence of such an antagonist.
13. A method for identifying an antagonist of NPC1L1 comprising: (a) contacting a host cell expressing a polypeptide comprising an amino acid sequence selected from SEQ ID NOs: 2, 4 and 12 or a functional fragment thereof on a cell surface with a detectably labeled sterol or 5.alpha.-stanol and with a sample to be tested for the presence of the antagonist; and (b) measuring the amount of detectably labeled sterol or 5.alpha.-stanol in the cell; wherein an NPC1L1 antagonist in the sample is identified by measuring substantially reduced detectably labeled sterol or 5.alpha.-stanol within the host cell, compared to what would be measured in the absence of such an antagonist.
14. A mutant transgenic mouse comprising a homozygous mutation of endogenous, chromosomal NPC1L1 wherein the mouse does not produce any functional NPC1L1 protein.
15. An offspring or progeny of the mouse of claim 14 wherein the offspring or progeny has inherited a mutated NPC1L1 allele of said mouse.
16. A method for screening a sample for an intestinal sterol or 5.alpha.-stanol absorption antagonist comprising: (a) feeding a sterol or 5.alpha.-stanol-containing substance to a first and second mouse comprising a functional NPC1L1 gene and to a third, mutant mouse of claim 21; (b) administering the sample to the first mouse but not the second mouse; (c) measuring the amount of sterol or 5.alpha.-stanol absorption in the intestine of said first, second and third mouse; and (d) comparing the levels of intestinal sterol or 5.alpha.-stanol absorption in said first, second and third mouse; wherein the sample is determined to contain the intestinal sterol or 5.alpha.-stanol absorption antagonist when the level of intestinal sterol or 5.alpha.-stanol absorption in the first mouse and third mouse are less than the amount of intestinal sterol or 5.alpha.-stanol absorption in the second mouse.
17. A method for inhibiting NPC1L1 mediated sterol or 5.alpha.-stanol uptake, in a subject, by administering, to the subject, a substance identified by the method of claim 11.
18. A method for inhibiting NPC1L1 mediated sterol or 5.alpha.-stanol uptake, in a subject, by administering, to the subject, a substance identified by the method of claim 12.
19. A method for inhibiting NPC1L1 mediated sterol or 5.alpha.-stanol uptake, in a subject, by administering, to the subject, a substance identified by the method of claim 13.
20. A method for inhibiting NPC1L1 mediated sterol or 5.alpha.-stanol uptake, in a subject, by administering, to the subject, a substance identified by the method of claim 16.
21. A kit comprising: (a) ezetimibe in a pharmaceutical dosage form; and (b) information indicating that NPC1L1 is a target of ezetimibe.
22. A method for decreasing the level of intestinal sterol or 5.alpha.-stanol absorption in a subject comprising reducing the level of expression of NPC1L1 in the subject.
23. A method for identifying an antagonist of NPC1L1 comprising: (a) contacting a host cell expressing a polypeptide comprising an amino acid sequence selected from SEQ ID NOs: 2, 4 and 12 or a functional fragment thereof on a cell surface, in the presence of a known amount of a detectably labeled substituted azetidinone, with a sample to be tested for the presence of the antagonist; and (b) measuring the amount of detectably labeled substituted azetidinone specifically bound, directly or indirectly, to the polypeptide; wherein an NPC1L1 antagonist in the sample is identified by measuring substantially reduced direct or indirect binding of the detectably labeled substituted azetidinone to the polypeptide, compared to what would be measured in the absence of such an antagonist.
24. A kit comprising: (a) a substituted azetidinone in a pharmaceutical dosage form; and (b) information indicating that NPC1L1 is a target of the substituted azetidinone.
25. An isolated mammalian cell which lacks a gene which encodes a functional NPC1L1 protein.
26. A method for inhibiting intestinal cholesterol absorption, in a mammalian subject, comprising administering an isolated oligonucleotide consisting of between 30 and 100 nucleotides, which is RNA or DNA, and is capable of hybridizing to the sense strand of a polynucleotide that encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2, 4 or 12; to the subject.
Description:
[0001] This application is a divisional of U.S. patent application Ser.
No. 11/523,512; filed Sep. 19, 2006, which is a divisional of U.S. patent
application Ser. No. 10/736,769; filed Dec. 16, 2003 which is a
continuation-in-part of U.S. patent application Ser. No. 10/663,208;
filed Sep. 16, 2003 which is a continuation-in-part of U.S. patent
application Ser. No. 10/646,301; filed Aug. 22, 2003 which is a
continuation-in-part of U.S. patent application Ser. No. 10/621,758;
filed Jul. 17, 2003 which claims the benefit of U.S. Provisional Patent
Application No. 60/397,442; filed Jul. 19, 2002 each of which is herein
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention includes NPC1L1 polypeptides and polynucleotides which encode the polypeptides along with methods of use thereof.
BACKGROUND OF THE INVENTION
[0003] A factor leading to development of vascular disease, a leading cause of death in industrialized nations, is elevated serum cholesterol. It is estimated that 19% of Americans between the ages of 20 and 74 years of age have high serum cholesterol. The most prevalent form of vascular disease is arteriosclerosis, a condition associated with the thickening and hardening of the arterial wall. Arteriosclerosis of the large vessels is referred to as atherosclerosis. Atherosclerosis is the predominant underlying factor in vascular disorders such as coronary artery disease, aortic aneurysm, arterial disease of the lower extremities and cerebrovascular disease.
[0004] Cholesteryl esters are a major component of atherosclerotic lesions and the major storage form of cholesterol in arterial wall cells. Formation of cholesteryl esters is also a step in the intestinal absorption of dietary cholesterol. Thus, inhibition of cholesteryl ester formation and reduction of serum cholesterol can inhibit the progression of atherosclerotic lesion formation, decrease the accumulation of cholesteryl esters in the arterial wall, and block the intestinal absorption of dietary cholesterol.
[0005] The regulation of whole-body cholesterol homeostasis in mammals and animals involves the regulation of intestinal cholesterol absorption, cellular cholesterol trafficking, dietary cholesterol and modulation of cholesterol biosynthesis, bile acid biosynthesis, steroid biosynthesis and the catabolism of the cholesterol-containing plasma lipoproteins. Regulation of intestinal cholesterol absorption has proven to be an effective means by which to regulate serum cholesterol levels. For example, a cholesterol absorption inhibitor,
##STR00001##
has been shown to be effective in this regard. A pharmaceutical composition containing ezetimibe is commercially available from Merck/Schering-Plough Pharmaceuticals, Inc. under the tradename Zetia®. Identification of a gene target through which ezetimibe acts is important to understanding the process of cholesterol absorption and to the development of other, novel absorption inhibitors. The present invention addresses this need by providing a rat and a mouse homologue of human NPC1L1 (also known as NPC3; Genbank Accession No. AF192522; Davies, et al., (2000) Genomics 65(2):137-45 and Ioannou, (2000) Mol. Genet. Metab. 71(1-2):175-81), an ezetimibe target.
[0006] NPC1L1 is an N-glycosylated protein comprising a YQRL (SEQ ID NO: 38) motif (i.e., a trans-golgi network to plasma membrane transport signal; see Bos, et al., (1993) EMBO J. 12:2219-2228; Humphrey, et al., (1993) J. Cell. Biol. 120:1123-1135; Ponnambalam, et al., (1994) J. Cell. Biol. 125:253-268 and Rothman, et al., (1996) Science 272:227-234) which exhibits limited tissue distribution and gastrointestinal abundance. Also, the human NPC1L1 promoter includes a Sterol Regulated Element Binding Protein 1 (SREBP1) binding consensus sequence (Athanikar, et al., (1998) Proc. Natl. Acad. Sci. USA 95:4935-4940; Ericsson, et al., (1996) Proc. Natl. Acad. Sci. USA 93:945-950; Metherall, et al., (1989) J. Biol. Chem. 264:15634-15641; Smith, et al., (1990) J. Biol. Chem. 265:2306-2310; Bennett, et al., (1999) J. Biol. Chem. 274:13025-13032 and Brown, et al., (1997) Cell 89:331-340). NPC1L1 has 42% amino acid sequence homology to human NPC1 (Genbank Accession No. AF002020), a receptor responsible for Niemann-Pick C1 disease (Carstea, et al., (1997) Science 277:228-231). Niemann-Pick C1 disease is a rare genetic disorder in humans which results in accumulation of low density lipoprotein (LDL)-derived unesterified cholesterol in lysosomes (Pentchev, et al., (1994) Biochim. Biophys. Acta. 1225: 235-243 and Vanier, et al., (1991) Biochim. Biophys. Acta. 1096:328-337). In addition, cholesterol accumulates in the trans-golgi network of npc1.sup.- cells, and relocation of cholesterol, to and from the plasma membrane, is delayed. NPC1 and NPC1L1 each possess 13 transmembrane spanning segments as well as a sterol-sensing domain (SSD). Several other proteins, including HMG-CoA Reductase (HMG-R), Patched (PTC) and Sterol Regulatory Element Binding Protein Cleavage-Activation Protein (SCAP), include an SSD which is involved in sensing cholesterol levels possibly by a mechanism which involves direct cholesterol binding (Gil, et al., (1985) Cell 41:249-258; Kumagai, et al., (1995) J. Biol. Chem. 270:19107-19113 and Hua, et al., (1996) Cell 87:415-426).
SUMMARY OF THE INVENTION
[0007] The present invention includes an isolated polypeptide comprising 42 or more contiguous amino acids from an amino acid sequence selected from SEQ ID NOs: 2 and 12, preferably comprising the amino acid sequence selected from SEQ ID NOs: 2 and 12. The present invention also comprises an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 4. The invention also includes an isolated polynucleotide encoding a polypeptide of SEQ ID NO: 2, 4 or 12, preferably comprising a nucleotide sequence selected from SEQ ID NOs: 1, 3, 5-10, 11 and 13. A recombinant vector comprising a polynucleotide of the invention is also provided along with a host cell comprising the vector.
[0008] The present invention also provides an isolated antibody which specifically binds to or was raised against NPC (e.g., rat NPC1L1, mouse NPC or human NPC1L1) or any antigenic fragment thereof, preferably rat NPC1L1, more preferably a polypeptide comprising an amino acid sequence selected from SEQ ID NO: 39-42. Preferably, the antibody is an isolated polyclonal or monoclonal antibody. In one embodiment, the antibody is obtained from a rabbit.
[0009] The present invention also includes a method for making an NPC1L1 polypeptide of the invention comprising culturing a host cell of the invention under conditions in which the nucleic acid in the cell which encodes the NPC1L1 polypeptide is expressed. Preferably, the method includes the step of isolating the polypeptide from the culture.
[0010] The present invention includes methods for identifying an agonist or antagonist of NPC1L1 comprising (a) contacting a host cell (e.g., chinese hamster ovary (CHO) cell, a J774 cell, a macrophage cell or a Caco2 cell) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 12 or a functional fragment thereof on a cell surface, in the presence of a known amount of a detectably labeled (e.g., with 3H, 14C or 125I) substituted azetidinone (e.g., ezetimibe), with a sample to be tested for the presence of an NPC agonist or antagonist; and (b) measuring the amount of detectably labeled substituted azetidinone (e.g., ezetimibe) specifically bound to the polypeptide; wherein an NPC1L1 agonist or antagonist in the sample is identified by measuring substantially reduced binding of the detectably labeled substituted azetidinone (e.g., ezetimibe) to the polypeptide, compared to what would be measured in the absence of such an agonist or antagonist.
[0011] Another method for identifying an agonist or antagonist of NPC1L1 is also provided. The method comprises (a) placing, in an aqueous suspension, a plurality of support particles, impregnated with a fluorescer (e.g., yttrium silicate, yttrium oxide, diphenyloxazole and polyvinyltoluene), to which a host cell (e.g., chinese hamster ovary (CHO) cell, a J774 cell, a macrophage cell or a Caco2 cell) expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 12 or a functional fragment thereof on a cell surface are attached; (b) adding, to the suspension, a radiolabeled (e.g., with 3H, 14C or 125I) substituted azetidinone (e.g., ezetimibe) and a sample to be tested for the presence of an antagonist or agonist, wherein the radiolabel emits radiation energy capable of activating the fluorescer upon the binding of the substituted azetidinone (e.g., ezetimibe) to the polypeptide to produce light energy, whereas radiolabeled substituted azetidinone (e.g., ezetimibe) that does not bind to the polypeptide is, generally, too far removed from the support particles to enable the radioactive energy to activate the fluorescer; and (c) measuring the light energy emitted by the fluorescer in the suspension; wherein an NPC1L1 agonist or antagonist in the sample is identified by measuring substantially reduced light energy emission, compared to what would be measured in the absence of such an agonist or antagonist.
[0012] Also provided is a method for identifying an agonist or antagonist of NPC1L1 comprising (a) contacting a host cell (e.g., chinese hamster ovary (CHO) cell, a J774 cell, a macrophage cell or a Caco2 cell) expressing an polypeptide comprising an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 12 or a functional fragment thereof on a cell surface with detectably labeled (e.g., with 3H, 14C or 125I) sterol (e.g., cholesterol) or 5α-stanol and with a sample to be tested for the presence of an antagonist or agonist; and (b) measuring the amount of detectably labeled sterol (e.g., cholesterol) or 5α-stanol in the cell; wherein an NPC1L1 antagonist in the sample is identified by measuring substantially reduced detectably labeled sterol (e.g., cholesterol) or 5α-stanol within the host cell, compared to what would be measured in the absence of such an antagonist and wherein an NPC1L1 agonist in the sample is identified by measuring substantially increased detectably labeled sterol (e.g., cholesterol) or 5α-stanol within the host cell, compared to what would be measured in the absence of such an agonist.
[0013] The present invention includes methods for inhibiting NPC1L1-mediated intestinal sterol (e.g., cholesterol) or 5α-stanol uptake, in a subject, by administering a substance identified by the screening methods described herein to the subject. Such substances include compounds such as small molecule antagonists of NPC1L1 other than ezetimibe. Also contemplated are methods for antagonizing NPC1L1-mediated sterol (e.g., cholesterol) or 5α-stanol absorption by administering anti-NPC1L1 antibodies. NPC1L1-mediated absorption of sterol (e.g., cholesterol) or 5α-stanol can also be antagonized by any method which reduces expression of NPC1L1 in an organism. For example, NPC1L1 expression can be reduced by introduction of anti-sense NPC1L1 mRNA into a cell of an organism or by genetic mutation of the NPC1L1 gene in an organism (e.g., by complete knockout, disruption, truncation or by introduction of one or more point mutations).
[0014] Also included in the present invention is a mutant transgenic mammal (e.g., mouse, rat, dog, rabbit, pig, guinea pig, cat, horse), preferably a mouse comprising a homozygous or heterozygous mutation (e.g., disruption, truncation, one or more point mutations, knock out) of endogenous, chromosomal NPC1L1 wherein, preferably, the mouse does not produce any functional NPC1L1 protein. Preferably, the mutant mouse, lacking functional NPC1L1, exhibits a reduced level of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption and/or a reduced level of serum sterol (e.g., cholesterol) or 5α-stanol and/or a reduced level of liver sterol (e.g., cholesterol) or 5α-stanol as compared to that of a non-mutant mouse comprising functional NPC1L1. Preferably, in the mutant mouse chromosome, the region of NPC1L1 (SEQ ID NO: 45) deleted is from nucleotide 790 to nucleotide 998. In one embodiment, NPC1L1 (SEQ ID NO: 11) is deleted from nucleotide 767 to nucleotide 975. Any offspring or progeny of a parent NPC1L1 mutant mouse (i.e., npc1l1) of the invention which has inherited an npc1l1 mutant allele is also part of the present invention.
[0015] The scope of the present invention also includes a method for screening a sample for an intestinal sterol (e.g., cholesterol) or 5α-stanol absorption antagonist comprising (a) feeding a sterol (e.g., cholesterol) or 5α-stanol-containing substance (e.g., comprising radiolabeled cholesterol, such as 14C-cholesterol or 3H-cholesterol) to a first and second mouse comprising a functional NPC1L1 gene and to a third, mutant mouse lacking a functional NPC1L1; (b) administering the sample to the first mouse comprising a functional NPC1L1 but not to the second mouse; (c) measuring the amount of sterol (e.g., cholesterol) or 5α-stanol absorption in the intestine of said first, second and third mouse (e.g., by measuring serum cholesterol); and (d) comparing the levels of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption in each mouse; wherein the sample is determined to contain the intestinal sterol (e.g., cholesterol) or 5α-stanol absorption antagonist when the level of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption in the first mouse and third mouse are less than the amount of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption in the second mouse.
[0016] The present invention also encompasses a kit comprising (a) a substituted azetidinone (e.g., ezetimibe) in a pharmaceutical dosage form (e.g., a pill or tablet comprising 10 mg substituted azetidinone (e.g., ezetimibe)); and (b) information, for example in the form of an insert, indicating that NPC1L1 is a target of ezetimibe. The kit may also include simvastatin in a pharmaceutical dosage form (e.g., a pill or tablet comprising 5 mg, 10 mg, 20 mg, 40 mg or 80 mg simvastatin). The simvastatin in pharmaceutical dosage form and the ezetimibe in pharmaceutical dosage form can be associated in a single pill or tablet or in separate pills or tablets.
[0017] The present invention also provides any isolated mammalian cell (e.g., isolated mouse cell, isolated rat cell or isolated human cell) which lacks a gene which encodes or can produce a functional NPC1L1 polypeptide. The isolated cell can be isolated from a mutant mouse comprising a homozygous mutation of endogenous, chromosomal NPC1L1 wherein the mouse does not produce any functional NPC1L1 protein. Further, the mutation can be in a gene which when un-mutated encodes an amino acid sequence of SEQ ID NO: 12 (e.g., comprising a nucleotide sequence of SEQ ID NO: 11). The cell can be isolated or derived from duodenum, gall bladder, liver, small intestine or stomach tissue. The cell can be an enterocyte.
DETAILED DESCRIPTION OF THE INVENTION
[0018] The present invention includes an NPC1L1 polypeptide from rat, human and from mouse along with polynucleotides encoding the respective polypeptides. Preferably, the rat NPC1L1 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 2, the human NPC1L1 comprises the amino acid sequence set forth in SEQ ID NO: 4 and the mouse NPC1L1 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:12. The rat NPC1L1 polynucleotide of SEQ ID NO:1 or 10 encodes the rat NPC1L1 polypeptide. The human NPC1L1 polynucleotide of SEQ ID NO: 3 encodes the human NPC1L1 polypeptide. The mouse NPC1L1 polynucleotide of SEQ ID NO:11 or 13 encodes the mouse NPC1L1 polypeptide.
[0019] The present invention includes any isolated polynucleotide or isolated polypeptide comprising a nucleotide or amino acid sequence referred to, below, in Table 1.
TABLE-US-00001 TABLE 1 Polynucleotides and Polypeptides of the Invention. Polynucleotide or Polypeptide Sequence Identifier Rat NPC1L1 polynucleotide SEQ ID NO: 1 Rat NPC1L1 polypeptide SEQ ID NO: 2 Human NPC1L1 polynucleotide SEQ ID NO: 3 Human NPC1L1 polypeptide SEQ ID NO: 4 Rat NPC1L1 expressed sequence tag SEQ ID NO: 5 603662080F1 (partial sequence) Rat NPC1L1 expressed sequence tag SEQ ID NO: 6 603665037F1 (partial sequence) Rat NPC1L1 expressed sequence tag SEQ ID NO: 7 604034587F1 (partial sequence) EST 603662080F1 with downstream SEQ ID NO: 8 sequences added EST 603662080F1 with upstream and SEQ ID NO: 9 downstream sequences added Back-translated polynucleotide sequence of SEQ ID NO: 10 rat NPC1L1 Mouse NPC1L1 polynucleotide SEQ ID NO: 11 Mouse NPC1L1 polypeptide SEQ ID NO: 12 Back-translated polynucleotide sequence of SEQ ID NO: 13 mouse NPC1L1 Back-translated polynucleotide sequence of SEQ ID NO: 51 human NPC1L1
[0020] A human NPC1L1 is also disclosed under Genbank Accession Number AF192522. As discussed below, the nucleotide sequence of the rat NPC1L1 set forth in SEQ ID NO: 1 was obtained from an expressed sequence tag (EST) from a rat jejunum enterocyte cDNA library. SEQ ID NOs: 5-7 include partial nucleotide sequences of three independent cDNA clones. The downstream sequence of the SEQ ID NO: 5 EST (603662080F1) were determined; the sequencing data from these experiments are set forth in SEQ ID NO: 8. The upstream sequences were also determined; these data are set forth in SEQ ID NO: 9.
[0021] SEQ ID NOs: 43 and 44 are the nucleotide and amino acid sequence, respectively, of human NPC1L1 which is disclosed under Genbank Accession No.: AF192522 (see Davies, et al., (2000) Genomics 65(2):137-45).
[0022] SEQ ID NO: 45 is the nucleotide sequence of a mouse NPC1L1 which is disclosed under Genbank Accession No. AK078947.
[0023] NPC1L1 mediates intestinal sterol (e.g., cholesterol) or 5α-stanol absorption. Inhibition of NPC1L1 in a patient is a useful method for reducing intestinal sterol (e.g., cholesterol) or 5α-stanol absorption and serum sterol (e.g., cholesterol) or 5α-stanol in the patient. Reducing the level of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption and serum sterol (e.g., cholesterol) or 5α-stanol in a patient is a useful way in which to treat or prevent the occurrence of atherosclerosis, particularly diet-induced atherosclerosis.
[0024] As used herein, the term "sterol" includes, but is not limited to, cholesterol and phytosterols (including, but not limited to, sitosterol, campesterol, stigmasterol and avenosterol)).
[0025] As used herein, the term "5α-stanol" includes, but is not limited to, cholestanol, 5α-campestanol and 5α-sitostanol.
Molecular Biology
[0026] In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (herein "Sambrook, et al., 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. (1985)); Transcription And Translation (B. D. Hames & S. J. Higgins, eds. (1984)); Animal Cell Culture (R. I. Freshney, ed. (1986)); Immobilized Cells And Enzymes (IRL Press, (1986)); B. Perbal, A Practical Guide To Molecular Cloning (1984); F. M. Ausubel, et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
[0027] The back-translated sequences of SEQ ID NO: 10 and of SEQ ID NO: 13 uses the single-letter code shown in Table 1 of Annex C, Appendix 2 of the PCT Administrative Instruction in the Manual of Patent Examination Procedure.
[0028] A "polynucleotide", "nucleic acid" or "nucleic acid molecule" may refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in single stranded form, double-stranded form or otherwise.
[0029] A "polynucleotide sequence", "nucleic acid sequence" or "nucleotide sequence" is a series of nucleotide bases (also called "nucleotides") in a nucleic acid, such as DNA or RNA, and means any chain of two or more nucleotides.
[0030] A "coding sequence" or a sequence "encoding" an expression product, such as a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when expressed, results in production of the product.
[0031] The term "gene" means a DNA sequence that codes for or corresponds to a particular sequence of ribonucleotides or amino acids which comprise all or part of one or more RNA molecules, proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine, for example, the conditions under which the gene is expressed. Genes may be transcribed from DNA to RNA which may or may not be translated into an amino acid sequence.
[0032] The present invention includes nucleic acid fragments of any of SEQ ID NOs: 1, 5-11 or 13. A nucleic acid "fragment" includes at least about 30 (e.g., 31, 32, 33, 34), preferably at least about 35 (e.g, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34), more preferably at least about 45 (e.g., 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44), and most preferably at least about 126 or more contiguous nucleotides (e.g., 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 1000 or 1200) from any of SEQ ID NOs: 1, 5-11 or 13.
[0033] The present invention also includes nucleic acid fragments consisting of at least about 7 (e.g., 9, 12, 17, 19), preferably at least about 20 (e.g., 30, 40, 50, 60), more preferably about 70 (e.g., 80, 90, 95), yet more preferably at least about 100 (e.g., 105, 110, 114) and even more preferably at least about 115 (e.g., 117, 119, 120, 122, 124, 125, 126) contiguous nucleotides from any of SEQ ID NOs: 1, 5-11 or 13.
[0034] As used herein, the term "oligonucleotide" refers to a nucleic acid, generally of no more than about 100 nucleotides (e.g., 30, 40, 50, 60, 70, 80, or 90), that may be hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a gene, mRNA, cDNA, or other nucleic acid of interest. Oligonucleotides can be labeled, e.g., by incorporation of 32P-nucleotides, 3H-nucleotides, 14C-nucleotides, 35S-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. In one embodiment, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid. In another embodiment, oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of the gene, or to detect the presence of nucleic acids. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer.
[0035] A "protein sequence", "peptide sequence" or "polypeptide sequence" or "amino acid sequence" may refer to a series of two or more amino acids in a protein, peptide or polypeptide.
[0036] "Protein", "peptide" or "polypeptide" includes a contiguous string of two or more amino acids. Preferred peptides of the invention include those set forth in any of SEQ ID NOs: 2 or 12 as well as variants and fragments thereof. Such fragments preferably comprise at least about 10 (e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19), more preferably at least about 20 (e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40), and yet more preferably at least about 42 (e.g., 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 110, 120 or 130) or more contiguous amino acid residues from any of SEQ ID NOs: 2 or 12.
[0037] The present invention also includes polypeptides, preferably antigenic polypeptides, consisting of at least about 7 (e.g., 9, 10, 13, 15, 17, 19), preferably at least about 20 (e.g., 22, 24, 26, 28), yet more preferably at least about 30 (e.g., 32, 34, 36, 38) and even more preferably at least about 40 (e.g., 41, 42) contiguous amino acids from any of SEQ ID NOs: 2 or 12.
[0038] The polypeptides of the invention can be produced by proteolytic cleavage of an intact peptide, by chemical synthesis or by the application of recombinant DNA technology and are not limited to polypeptides delineated by proteolytic cleavage sites. The polypeptides, either alone or cross-linked or conjugated to a carrier molecule to render them more immunogenic, are useful as antigens to elicit the production of antibodies and fragments thereof. The antibodies can be used, e.g., in immunoassays for immunoaffinity purification or for inhibition of NPC1L1, etc.
[0039] The terms "isolated polynucleotide" or "isolated polypeptide" include a polynucleotide (e.g., RNA or DNA molecule, or a mixed polymer) or a polypeptide, respectively, which are partially or fully separated from other components that are normally found in cells or in recombinant DNA expression systems. These components include, but are not limited to, cell membranes, cell walls, ribosomes, polymerases, serum components and extraneous genomic sequences.
[0040] An isolated polynucleotide or polypeptide will, preferably, be an essentially homogeneous composition of molecules but may contain some heterogeneity.
[0041] "Amplification" of DNA as used herein may denote the use of polymerase chain reaction (PCR) to increase the concentration of a particular DNA sequence within a mixture of DNA sequences. For a description of PCR see Saiki, et al., Science (1988) 239:487.
[0042] The term "host cell" includes any cell of any organism that is selected, modified, transfected, transformed, grown, or used or manipulated in any way, for the production of a substance by the cell, for example the expression or replication, by the cell, of a gene, a DNA or RNA sequence or a protein. Preferred host cells include chinese hamster ovary (CHO) cells, murine macrophage J774 cells or any other macrophage cell line and human intestinal epithelial Caco2 cells.
[0043] The nucleotide sequence of a nucleic acid may be determined by any method known in the art (e.g., chemical sequencing or enzymatic sequencing). "Chemical sequencing" of DNA includes methods such as that of Maxam and Gilbert (1977) (Proc. Natl. Acad. Sci. USA 74:560), in which DNA is randomly cleaved using individual base-specific reactions. "Enzymatic sequencing" of DNA includes methods such as that of Sanger (Sanger, et al., (1977) Proc. Natl. Acad. Sci. USA 74:5463).
[0044] The nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5'- and 3'-non-coding regions, and the like.
[0045] In general, a "promoter" or "promoter sequence" is a DNA regulatory region capable of binding an RNA polymerase in a cell (e.g., directly or through other promoter-bound proteins or substances) and initiating transcription of a coding sequence. A promoter sequence is, in general, bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at any level. Within the promoter sequence may be found a transcription initiation site (conveniently defined, for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. The promoter may be operably associated with other expression control sequences, including enhancer and repressor sequences or with a nucleic acid of the invention. Promoters which may be used to control gene expression include, but are not limited to, cytomegalovirus (CMV) promoter (U.S. Pat. Nos. 5,385,839 and 5,168,062), the SV40 early promoter region (Benoist, et al., (1981) Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al., (1980) Cell 22:787-797), the herpes thymidine kinase promoter (Wagner, et al., (1981) Proc. Natl. Acad. Sci. USA 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster, et al., (1982) Nature 296:39-42); prokaryotic expression vectors such as the β-lactamase promoter (VIIIa-Komaroff, et al., (1978) Proc. Natl. Acad. Sci. USA 75:3727-3731), or the tac promoter (DeBoer, et al., (1983) Proc. Natl. Acad. Sci. USA 80:21-25); see also "Useful proteins from recombinant bacteria" in Scientific American (1980) 242:74-94; and promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter or the alkaline phosphatase promoter.
[0046] A coding sequence is "under the control of", "functionally associated with" or "operably associated with" transcriptional and translational control sequences in a cell when the sequences direct RNA polymerase mediated transcription of the coding sequence into RNA, preferably mRNA, which then may be RNA spliced (if it contains introns) and, optionally, translated into a protein encoded by the coding sequence.
[0047] The terms "express" and "expression" mean allowing or causing the information in a gene, RNA or DNA sequence to become manifest; for example, producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene. A DNA sequence is expressed in or by a cell to form an "expression product" such as an RNA (e.g., mRNA) or a protein. The expression product itself may also be said to be "expressed" by the cell.
[0048] The term "transformation" means the introduction of a nucleic acid into a cell. The introduced gene or sequence may be called a "clone". A host cell that receives the introduced DNA or RNA has been "transformed" and is a "transformant" or a "clone." The DNA or RNA introduced to a host cell can come from any source, including cells of the same genus or species as the host cell, or from cells of a different genus or species.
[0049] The term "vector" includes a vehicle (e.g., a plasmid) by which a DNA or RNA sequence can be introduced into a host cell, so as to transform the host and, optionally, promote expression and/or replication of the introduced sequence.
[0050] Vectors that can be used in this invention include plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles that may facilitate introduction of the nucleic acids into the genome of the host. Plasmids are the most commonly used form of vector but all other forms of vectors which serve a similar function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels, et al., Cloning Vectors: A Laboratory Manual, 1985 and Supplements, Elsevier, N.Y., and Rodriguez et al. (eds.), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, Mass.
[0051] The term "expression system" means a host cell and compatible vector which, under suitable conditions, can express a protein or nucleic acid which is carried by the vector and introduced to the host cell. Common expression systems include E. coli host cells and plasmid vectors, insect host cells and Baculovirus vectors, and mammalian host cells and vectors.
[0052] Expression of nucleic acids encoding the NPC1L1 polypeptides of this invention can be carried out by conventional methods in either prokaryotic or eukaryotic cells. Although E. coli host cells are employed most frequently in prokaryotic systems, many other bacteria, such as various strains of Pseudomonas and Bacillus, are known in the art and can be used as well. Suitable host cells for expressing nucleic acids encoding the NPC1L1 polypeptides include prokaryotes and higher eukaryotes. Prokaryotes include both gram-negative and gram-positive organisms, e.g., E. coli and B. subtilis. Higher eukaryotes include established tissue culture cell lines from animal cells, both of non-mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
[0053] Prokaryotic host-vector systems include a wide variety of vectors for many different species. A representative vector for amplifying DNA is pBR322 or many of its derivatives (e.g., pUC18 or 19). Vectors that can be used to express the NPC1L1 polypeptides include, but are not limited to, those containing the lac promoter (pUC-series); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or hybrid promoters such as ptac (pDR540). See Brosius et al., "Expression Vectors Employing Lambda-, trp-, lac-, and Ipp-derived Promoters", in Rodriguez and Denhardt (eds.) Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, pp. 205-236. Many polypeptides can be expressed, at high levels, in an E. coli/T7 expression system as disclosed in U.S. Pat. Nos. 4,952,496, 5,693,489 and 5,869,320 and in Davanloo, P., et al., (1984) Proc. Natl. Acad. Sci. USA 81: 2035-2039; Studier, F. W., et al., (1986) J. Mol. Biol. 189: 113-130; Rosenberg, A. H., et al., (1987) Gene 56: 125-135; and Dunn, J. J., et al., (1988) Gene 68: 259.
[0054] Higher eukaryotic tissue culture cells may also be used for the recombinant production of the NPC1L1 polypeptides of the invention. Although any higher eukaryotic tissue culture cell line might be used, including insect baculovirus expression systems, mammalian cells are preferred. Transformation or transfection and propagation of such cells have become a routine procedure. Examples of useful cell lines include HeLa cells, chinese hamster ovary (CHO) cell lines, J774 cells, Caco2 cells, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines. Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site. These vectors also, usually, contain a selection gene or amplification gene. Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus. Examples of expression vectors include pCR®3.1, pcDNA1, pCD (Okayama, et al., (1985) Mol. Cell Biol. 5:1136), pMC1neo Poly-A (Thomas, et al., (1987) Cell 51:503), pREP8, pSVSPORT and derivatives thereof, and baculovirus vectors such as pAC373 or pAC610. One embodiment of the invention includes membrane bound NPC1L1. In this embodiment, NPC1L1 can be expressed in the cell membrane of a eukaryotic cell and the membrane bound protein can be isolated from the cell by conventional methods which are known in the art.
[0055] The present invention also includes fusions which include the NPC1L1 polypeptides and NPC1L1 polynucleotides of the present invention and a second polypeptide or polynucleotide moiety, which may be referred to as a "tag". The fusions of the present invention may comprise any of the polynucleotides or polypeptides set forth in Table 1 or any subsequence or fragment thereof (discussed above). The fused polypeptides of the invention may be conveniently constructed, for example, by insertion of a polynucleotide of the invention or fragment thereof into an expression vector. The fusions of the invention may include tags which facilitate purification or detection. Such tags include glutathione-S-transferase (GST), hexahistidine (His6) tags, maltose binding protein (MBP) tags, haemagglutinin (HA) tags, cellulose binding protein (CBP) tags and myc tags. Detectable tags such as 32P, 35S, 3H, 99mTc, 123I, 111In, 68Ga, 8F, 125I, 131I, 113mIn, 76Br, 67Ga, 99mTc, 123I, 111In and 68Ga may also be used to label the polypeptides and polynucleotides of the invention. Methods for constructing and using such fusions are very conventional and well known in the art.
[0056] Modifications (e.g., post-translational modifications) that occur in a polypeptide often will be a function of how it is made. For polypeptides made by expressing a cloned gene in a host, for instance, the nature and extent of the modifications, in large part, will be determined by the host cell's post-translational modification capacity and the modification signals present in the polypeptide amino acid sequence. For instance, as is well known, glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide can be expressed in a glycosylating host, generally a eukaryotic cell. Insect cells often carry out post-translational glycosylations which are similar to those of mammalian cells. For this reason, insect cell expression systems have been developed to express, efficiently, mammalian proteins having native patterns of glycosylation. An insect cell which may be used in this invention is any cell derived from an organism of the class Insecta. Preferably, the insect is Spodoptera fruigiperda (Sf9 or Sf21) or Trichoplusia ni (High 5). Examples of insect expression systems that can be used with the present invention, for example to produce NPC1L1 polypeptide, include Bac-To-Bac (Invitrogen Corporation, Carlsbad, Calif.) or Gateway (Invitrogen Corporation, Carlsbad, Calif.). If desired, deglycosylation enzymes can be used to remove carbohydrates attached during production in eukaryotic expression systems.
[0057] Other modifications may also include addition of aliphatic esters or amides to the polypeptide carboxyl terminus. The present invention also includes analogs of the NPC1L1 polypeptides which contain modifications, such as incorporation of unnatural amino acid residues, or phosphorylated amino acid residues such as phosphotyrosine, phosphoserine or phosphothreonine residues. Other potential modifications include sulfonation, biotinylation, or the addition of other moieties. For example, the NPC1L1 polypeptides of the invention may be appended with a polymer which increases the half-life of the peptide in the body of a subject. Preferred polymers include polyethylene glycol (PEG) (e.g., PEG with a molecular weight of 2 kDa, 5 kDa, 10 kDa, 12 kDa, 20 kDa, 30 kDa and 40 kDa), dextran and monomethoxypolyethylene glycol (mPEG).
[0058] The peptides of the invention may also be cyclized. Specifically, the amino- and carboxy-terminal residues of an NPC1L1 polypeptide or two internal residues of an NPC1L1 polypeptide of the invention can be fused to create a cyclized peptide. Methods for cyclizing peptides are conventional and very well known in the art; for example see Gurrath, et al., (1992) Eur. J. Biochem. 210:911-921.
[0059] The present invention contemplates any superficial or slight modification to the amino acid or nucleotide sequences which correspond to the polypeptides of the invention. In particular, the present invention contemplates sequence conservative variants of the nucleic acids which encode the polypeptides of the invention. "Sequence-conservative variants" of a polynucleotide sequence are those in which a change of one or more nucleotides in a given codon results in no alteration in the amino acid encoded at that position. Function-conservative variants of the polypeptides of the invention are also contemplated by the present invention. "Function-conservative variants" are those in which one or more amino acid residues in a protein or enzyme have been changed without altering the overall conformation and function of the polypeptide, including, but, by no means, limited to, replacement of an amino acid with one having similar properties. Amino acids with similar properties are well known in the art. For example, polar/hydrophilic amino acids which may be interchangeable include asparagine, glutamine, serine, cysteine, threonine, lysine, arginine, histidine, aspartic acid and glutamic acid; nonpolar/hydrophobic amino acids which may be interchangeable include glycine, alanine, valine, leucine, isoleucine, proline, tyrosine, phenylalanine, tryptophan and methionine; acidic amino acids which may be interchangeable include aspartic acid and glutamic acid and basic amino acids which may be interchangeable include histidine, lysine and arginine.
[0060] The present invention includes polynucleotides encoding rat, human or mouse NPC1L1 and fragments thereof as well as nucleic acids which hybridize to the polynucleotides. Preferably, the nucleic acids hybridize under low stringency conditions, more preferably under moderate stringency conditions and most preferably under high stringency conditions. A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook, et al., supra). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. Typical low stringency hybridization conditions are 55° C., 5×SSC, 0.1% SDS, 0.25% milk, and no formamide at 42° C.; or 30% formamide, 5×SSC, 0.5% SDS at 42° C. Typical, moderate stringency hybridization conditions are similar to the low stringency conditions except the hybridization is carried out in 40% formamide, with 5× or 6×SSC at 42° C. High stringency hybridization conditions are similar to low stringency conditions except the hybridization conditions are carried out in 50% formamide, 5× or 6×SSC and, optionally, at a higher temperature (e.g., higher than 42° C.: 57° C., 59° C., 60° C., 62° C., 63° C., 65° C. or 68° C.). In general, SSC is 0.15M NaCl and 0.015M Na-citrate. Hybridization requires that the two nucleic acids contain complementary sequences, although, depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the higher the stringency under which the nucleic acids may hybridize. For hybrids of greater than 100 nucleotides in length, equations for calculating the melting temperature have been derived (see Sambrook, et al., supra, 9.50-9.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook, et al., supra).
[0061] Also included in the present invention are polynucleotides comprising nucleotide sequences and polypeptides comprising amino acid sequences which are at least about 70% identical, preferably at least about 80% identical, more preferably at least about 90% identical and most preferably at least about 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, 100%) to the reference rat NPC1L1 nucleotide (e.g., any of SEQ ID NOs: 1 or 5-10) and amino acid sequences (e.g., SEQ ID NO: 2), reference human NPC1L1 nucleotide (e.g., SEQ ID NO: 3) and amino acid sequences (e.g., SEQ ID NO: 4) or the reference mouse NPC1L1 nucleotide (e.g., any of SEQ ID NOs: 11 or 13) and amino acids sequences (e.g., SEQ ID NO: 12), when the comparison is performed by a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences. Polypeptides comprising amino acid sequences which are at least about 70% similar, preferably at least about 80% similar, more preferably at least about 90% similar and most preferably at least about 95% similar (e.g., 95%, 96%, 97%, 98%, 99%, 100%) to the reference rat NPC1L1 amino acid sequence of SEQ ID NO: 2, reference human NPC1L1 amino acid sequence of SEQ ID NO: 4 or the reference mouse NPC1L1 amino acid sequence of SEQ ID NO: 12, when the comparison is performed with a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences, are also included in the present invention.
[0062] Sequence identity refers to exact matches between the nucleotides or amino acids of two sequences which are being compared. Sequence similarity refers to both exact matches between the amino acids of two polypeptides which are being compared in addition to matches between nonidentical, biochemically related amino acids. Biochemically related amino acids which share similar properties and may be interchangeable are discussed above.
[0063] The following references regarding the BLAST algorithm are herein incorporated by reference: BLAST ALGORITHMS: Altschul, S. F., et al., (1990) J. Mol. Biol. 215:403-410; Gish, W., et al., (1993) Nature Genet. 3:266-272; Madden, T. L., et al., (1996) Meth. Enzymol. 266:131-141; Altschul, S. F., et al., (1997) Nucleic Acids Res. 25:3389-3402; Zhang, J., et al., (1997) Genome Res. 7:649-656; Wootton, J. C., et al., (1993) Comput. Chem. 17:149-163; Hancock, J. M., et al., (1994) Comput. Appl. Biosci. 10:67-70; ALIGNMENT SCORING SYSTEMS: Dayhoff, M. O., et al., "A model of evolutionary change in proteins." in Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3. M. O. Dayhoff (ed.), pp. 345-352, Natl. Biomed. Res. Found., Washington, D.C.; Schwartz, R. M., et al., "Matrices for detecting distant relationships." in Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3." M. O. Dayhoff (ed.), pp. 353-358, Natl. Biomed. Res. Found., Washington, D.C.; Altschul, S. F., (1991) J. Mol. Biol. 219:555-565; States, D. J., et al., (1991) Methods 3:66-70; Henikoff, S., et al., (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919; Altschul, S. F., et al., (1993) J. Mol. Evol. 36:290-300; ALIGNMENT STATISTICS: Karlin, S., et al., (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268; Karlin, S., et al., (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877; Dembo, A., et al., (1994) Ann. Prob. 22:2022-2039; and Altschul, S. F. "Evaluating the statistical significance of multiple distinct local alignments." in Theoretical and Computational Methods in Genome Research (S. Suhai, ed.), (1997) pp. 1-14, Plenum, N.Y.
Protein Purification
[0064] The proteins, polypeptides and antigenic fragments of this invention can be purified by standard methods, including, but not limited to, salt or alcohol precipitation, affinity chromatography (e.g., used in conjunction with a purification tagged NPC1L1 polypeptide as discussed above), preparative disc-gel electrophoresis, isoelectric focusing, high pressure liquid chromatography (HPLC), reversed-phase HPLC, gel filtration, cation and anion exchange and partition chromatography, and countercurrent distribution. Such purification methods are well known in the art and are disclosed, e.g., in "Guide to Protein Purification", Methods in Enzymology, Vol. 182, M. Deutscher, Ed., 1990, Academic Press, New York, N.Y.
[0065] Purification steps can be followed by performance of assays for receptor binding activity as described below. Particularly where an NPC1L1 polypeptide is being isolated from a cellular or tissue source, it is preferable to include one or more inhibitors of proteolytic enzymes in the assay system, such as phenylmethanesulfonyl fluoride (PMSF), Pefabloc SC, pepstatin, leupeptin, chymostatin and EDTA.
Antibody Molecules
[0066] Antigenic (including immunogenic) fragments of the NPC1L1 polypeptides of the invention are within the scope of the present invention (e.g., 42 or more contiguous amino acids from SEQ ID NO: 2, 4 or 12). The antigenic peptides may be useful, inter alia, for preparing isolated antibody molecules which recognize NPC1L1. Isolated anti-NPC1L1 antibody molecules are useful NPC1L1 antagonists.
[0067] An antigen is any molecule that can bind specifically to an antibody. Some antigens cannot, by themselves, elicit antibody production. Those that can induce antibody production are immunogens.
[0068] Preferably, isolated anti-NPC1L1 antibodies recognize an antigenic peptide comprising an amino acid sequence selected from SEQ ID NOs: 39-42 (e.g., an antigen derived from rat NPC1L1). More preferably, the antibody is A0715, A0716, A0717, A0718, A0867, A0868, A1801 or A1802.
[0069] The term "antibody molecule" includes, but is not limited to, antibodies and fragments (preferably antigen-binding fragments) thereof. The term includes monoclonal antibodies, polyclonal antibodies, bispecific antibodies, Fab antibody fragments, F(ab)2 antibody fragments, Fv antibody fragments (e.g., VH or VL), single chain Fv antibody fragments and dsFv antibody fragments. Furthermore, the antibody molecules of the invention may be fully human antibodies, mouse antibodies, rat antibodies, rabbit antibodies, goat antibodies, chicken antibodies, humanized antibodies or chimeric antibodies.
[0070] Although it is not always necessary, when NPC1L1 polypeptides are used as antigens to elicit antibody production in an immunologically competent host, smaller antigenic fragments are, preferably, first rendered more immunogenic by cross-linking or concatenation, or by coupling to an immunogenic carrier molecule (i.e., a macromolecule having the property of independently eliciting an immunological response in a host animal, such as diptheria toxin or tetanus). Cross-linking or conjugation to a carrier molecule may be required because small polypeptide fragments sometimes act as haptens (molecules which are capable of specifically binding to an antibody but incapable of eliciting antibody production, i.e., they are not immunogenic). Conjugation of such fragments to an immunogenic carrier molecule renders them more immunogenic through what is commonly known as the "carrier effect".
[0071] Carrier molecules include, e.g., proteins and natural or synthetic polymeric compounds such as polypeptides, polysaccharides, lipopolysaccharides etc. Protein carrier molecules are especially preferred, including, but not limited to, keyhole limpet hemocyanin and mammalian serum proteins such as human or bovine gammaglobulin, human, bovine or rabbit serum albumin, or methylated or other derivatives of such proteins. Other protein carriers will be apparent to those skilled in the art. Preferably, the protein carrier will be foreign to the host animal in which antibodies against the fragments are to be elicited.
[0072] Covalent coupling to the carrier molecule can be achieved using methods well known in the art, the exact choice of which will be dictated by the nature of the carrier molecule used. When the immunogenic carrier molecule is a protein, the fragments of the invention can be coupled, e.g., using water-soluble carbodiimides such as dicyclohexylcarbodiimide or glutaraldehyde.
[0073] Coupling agents, such as these, can also be used to cross-link the fragments to themselves without the use of a separate carrier molecule. Such cross-linking into aggregates can also increase immunogenicity. Immunogenicity can also be increased by the use of known adjuvants, alone or in combination with coupling or aggregation.
[0074] Adjuvants for the vaccination of animals include, but are not limited to, Adjuvant 65 (containing peanut oil, mannide monooleate and aluminum monostearate); Freund's complete or incomplete adjuvant; mineral gels such as aluminum hydroxide, aluminum phosphate and alum; surfactants such as hexadecylamine, octadecylamine, lysolecithin, dimethyldioctadecylammonium bromide, N,N-dioctadecyl-N',N'-bis(2-hydroxymethyl) propanediamine, methoxyhexadecylglycerol and pluronic polyols; polyanions such as pyran, dextran sulfate, poly IC, polyacrylic acid and carbopol; peptides such as muramyl dipeptide, dimethylglycine and tuftsin; and oil emulsions. The polypeptides could also be administered following incorporation into liposomes or other microcarriers.
[0075] Information concerning adjuvants and various aspects of immunoassays are disclosed, e.g., in the series by P. Tijssen, Practice and Theory of Enzyme Immunoassays, 3rd Edition, 1987, Elsevier, N.Y. Other useful references covering methods for preparing polyclonal antisera include Microbiology, 1969, Hoeber Medical Division, Harper and Row; Landsteiner, Specificity of Serological Reactions, 1962, Dover Publications, New York, and Williams, et al., Methods in Immunology and Immunochemistry, Vol. 1, 1967, Academic Press, New York.
[0076] The anti-NPC1L1 antibody molecules of the invention preferably recognize human, mouse or rat NPC1L1; however, the present invention includes antibody molecules which recognize NPC1L1 from any species, preferably mammals (e.g., cat, sheep or horse). The present invention also includes complexes comprising an NPC1L1 polypeptide of the invention and an anti-NPC1L1 antibody molecule. Such complexes can be made by simply contacting the antibody molecule with its cognate polypeptide.
[0077] Various methods may be used to make the antibody molecules of the invention. Human antibodies can be made, for example, by methods which are similar to those disclosed in U.S. Pat. Nos. 5,625,126; 5,877,397; 6,255,458; 6,023,010 and 5,874,299.
[0078] Hybridoma cells which produce the monoclonal anti-NPC1L1 antibodies may be produced by methods which are commonly known in the art. These methods include, but are not limited to, the hybridoma technique originally developed by Kohler, et al., (1975) (Nature 256:495-497), as well as the trioma technique (Hering, et al., (1988) Biomed. Biochim. Acta. 47:211-216 and Hagiwara, et al., (1993) Hum. Antibod. Hybridomas 4:15), the human B-cell hybridoma technique (Kozbor, et al., (1983) Immunology Today 4:72 and Cote, et al., (1983) Proc. Natl. Acad. Sci. U.S.A 80:2026-2030), and the EBV-hybridoma technique (Cole, et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, 1985). ELISA may be used to determine if hybridoma cells are expressing anti-NPC1L1 antibodies.
[0079] The anti-NPC1L1 antibody molecules of the present invention may also be produced recombinantly (e.g., in an E. coli/T7 expression system as discussed above). In this embodiment, nucleic acids encoding the antibody molecules of the invention (e.g., VH or VL) may be inserted into a pet-based plasmid and expressed in the E. coli/T7 system. There are several methods by which to produce recombinant antibodies which are known in the art. An example of a method for recombinant production of antibodies is disclosed in U.S. Pat. No. 4,816,567. See also Skerra, A., et al., (1988) Science 240:1038-1041; Better, M., et al., (1988) Science 240:1041-1043 and Bird, R. E., et al., (1988) Science 242:423-426.
[0080] The term "monoclonal antibody," includes an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible, naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Monoclonal antibodies are advantageous in that they may be synthesized by a hybridoma culture, essentially uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. The monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method as described by Kohler, et al., (1975) Nature 256:495.
[0081] The term "polyclonal antibody" includes an antibody which was produced among or in the presence of one or more other, non-identical antibodies. In general, polyclonal antibodies are produced from a B-lymphocyte in the presence of several other B-lymphocytes which produced non-identical antibodies. Typically, polyclonal antibodies are obtained directly from an immunized animal (e.g., a rabbit).
[0082] A "bispecific antibody" comprises two different antigen binding regions which bind to distinct antigens. Bispecific antibodies, as well as methods of making and using the antibodies, are conventional and very well known in the art.
[0083] Anti-idiotypic antibodies or anti-idiotypes are antibodies directed against the antigen-combining region or variable region (called the idiotype) of another antibody molecule. As disclosed by Jerne (Jerne, N. K., (1974) Ann. Immunol. (Paris) 125c:373 and Jerne, N. K., et al., (1982) EMBO 1:234), immunization with an antibody molecule expressing a paratope (antigen-combining site) for a given antigen (e.g., NPC1L1) will produce a group of anti-antibodies, some of which share, with the antigen, a complementary structure to the paratope. Immunization with a subpopulation of the anti-idiotypic antibodies will, in turn, produce a subpopulation of antibodies or immune cell subsets that are reactive to the initial antigen.
[0084] The term "fully human antibody" refers to an antibody which comprises human immunoglobulin sequences only. Similarly, "mouse antibody" refers to an antibody which comprises mouse immunoglobulin sequences only.
[0085] "Human/mouse chimeric antibody" refers to an antibody which comprises a mouse variable region (VH and VL) fused to a human constant region.
[0086] "Humanized" anti-NPC1L1 antibodies are also within the scope of the present invention. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region of the recipient are replaced by residues from a complementary determining region of a nonhuman species (donor antibody), such as mouse, rat or rabbit, having a desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are also replaced by corresponding non-human residues.
[0087] "Single-chain Fv" or "sFv" antibody fragments include the VH and/or VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Generally, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding. Techniques described for the production of single chain antibodies (U.S. Pat. Nos. 5,476,786; 5,132,405 and 4,946,778) can be adapted to produce anti-NPC1L1 specific, single chain antibodies. For a review of sFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, N.Y., pp. 269-315 (1994).
[0088] "Disulfide stabilized Fv fragments" and "dsFv" include molecules having a variable heavy chain (VH) and/or a variable light chain (VL) which are linked by a disulfide bridge.
[0089] Antibody fragments within the scope of the present invention also include F(ab)2 fragments which may be produced by enzymatic cleavage of an IgG by, for example, pepsin. Fab fragments may be produced by, for example, reduction of F(ab)2 with dithiothreitol or mercaptoethylamine.
[0090] An Fv fragment is a VL or VH region.
[0091] Depending on the amino acid sequences of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are at least five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG-1, IgG-2, IgG-3 and IgG-4; IgA-1 and IgA-2.
[0092] The anti-NPC1L1 antibody molecules of the invention may also be conjugated to a chemical moiety. The chemical moiety may be, inter alia, a polymer, a radionuclide or a cytotoxic factor. Preferably, the chemical moiety is a polymer which increases the half-life of the antibody molecule in the body of a subject. Suitable polymers include, but are by no means limited to, polyethylene glycol (PEG) (e.g., PEG with a molecular weight of 2 kDa, 5 kDa, 10 kDa, 12 kDa, 20 kDa, 30 kDa or 40 kDa), dextran and monomethoxypolyethylene glycol (mPEG). Methods for producing PEGylated anti-IL8 antibodies which are described in U.S. Pat. No. 6,133,426 can be applied to the production of PEGylated anti-NPC1L1 antibodies of the invention. Lee, et al., (1999) (Bioconj. Chem. 10:973-981) discloses PEG conjugated single-chain antibodies. Wen, et al., (2001) (Bioconj. Chem. 12:545-553) discloses conjugating antibodies with PEG which is attached to a radiometal chelator (diethylenetriaminpentaacetic acid (DTPA)).
[0093] The antibody molecules of the invention may also be conjugated with labels such as 99Tc, 90Y, 111In, 32P, 14C, 125I, 3H, 131I, 11C, 15O, 13N, 18F, 35S, 51Sr, 57To, 226Ra, 60Co, 59Fe, 57Se, 152Eu, 67CU, 217Ci, 211At, 212Pb, 47Sc, 109Pd, 234Th, 40K, 157Gd, 55Mn, 52Tr or 56Fe.
[0094] The antibody molecules of the invention may also be conjugated with fluorescent or chemilluminescent labels, including fluorophores such as rare earth chelates, fluorescein and its derivatives, rhodamine and its derivatives, isothiocyanate, phycoerythrin, phycocyanin, allophycocyanin, o-phthaladehyde, fluorescamine, 152Eu, dansyl, umbelliferone, luciferin, luminal label, isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridimium salt label, an oxalate ester label, an aequorin label, 2,3-dihydrophthalazinediones, biotin/avidin, spin labels and stable free radicals.
[0095] The antibody molecules may also be conjugated to a cytotoxic factor such as diptheria toxin, Pseudomonas aeruginosa exotoxin A chain, ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins and compounds (e.g., fatty acids), dianthin proteins, Phytoiacca americana proteins PAPI, PAPII, and PAP-S, momordica charantia inhibitor, curcin, crotin, saponaria officinalis inhibitor, mitogellin, restrictocin, phenomycin, and enomycin.
[0096] Any method known in the art for conjugating the antibody molecules of the invention to the various moieties may be employed, including those methods described by Hunter, et al., (1962) Nature 144:945; David, et al., (1974) Biochemistry 13:1014; Pain, et al., (1981) J. Immunol. Meth. 40:219; and Nygren, J., (1982) Histochem. and Cytochem. 30:407.
[0097] Methods for conjugating antibodies are conventional and very well known in the art.
Screening Assays
[0098] The invention allows the discovery of selective agonists and antagonists of NPC1L1 (e.g., SEQ ID NO: 2, 4 or 12) that may be useful in treatment and management of a variety of medical conditions including elevated serum sterol (e.g., cholesterol) or 5α-stanol. Thus, NPC1L1 of this invention can be employed in screening systems to identify agonists or antagonists. Essentially, these systems provide methods for bringing together NPC1L1, an appropriate, known ligand or agonist or antagonist, including a sterol (e.g., cholesterol, phytosterols (including, but not limited to, sitosterol, campesterol, stigmasterol and avenosterol)), a cholesterol oxidation product, a 5α-stanol (including but not limited to cholestanol, 5α-campestanol and 5α-sitostanol), a substituted azetidinone (e.g., ezetimibe), BODIPY-ezetimibe (Altmann, et al., (2002) Biochim. Biophys. Acta 1580(1):77-93) or 4'',6''-bis[(2-fluorophenyl)carbamoyl]-beta-D-cellobiosyl derivative of 11-ketotigogenin as described in DeNinno, et al., (1997) (J. Med. Chem. 40(16):2547-54) (Merck; L-166,143) or any substituted azetidinone, and a sample to be tested for the presence of an NPC1L1 agonist or antagonist.
[0099] The term "specific" when used to describe binding of, for example, a ligand or antagonist of NPC1L1 in a screening assay is a term of art which refers to the extent by which the ligand or antagonist (e.g., detectably labeled substituted azetidinone, detectably labeled ezetimibe, detectably labeled sterol (e.g., cholesterol) or detectably labeled 5α-stanol) binds preferentially to NPC1L1 over that of other proteins in the assay system. For example, an antagonist or ligand of NPC binds specifically to NPC when the signal generated in the assay to indicate such binding exceeds, to any extent, a background signal in a negative control experiment wherein, for example, NPC1L1 or the antagonist or ligand is absent. Furthermore, "specific binding" includes binding of an antagonist or ligand either directly to NPC1L1 or indirectly, for example via another moiety, in a complex of which NPC1L1 is a part. The moiety to which an NPC1L1 ligand or antagonist binds can be another protein or a post-translational modification of NPC1L1 (e.g., a lipid chain or a carbohydrate chain).
[0100] Non-limiting examples of suitable azetidinones include those disclosed in U.S. Pat. Nos. RE37,721; 5,631,365; 5,767,115; 5,846,966; 5,688,990; 5,656,624; 5,624,920; 5,698,548 and 5,756,470 and U.S. Patent Application Publication No 2003/0105028-each of which is herein incorporated by reference in its entirety.
[0101] A convenient method by which to evaluate whether a sample contains an NPC1L1 agonist or antagonist is to determine whether the sample contains a substance which competes for binding between the known agonist or antagonist (e.g., ezetimibe) and NPC1L1.
[0102] Ezetimibe can be prepared by a variety of methods well know to those skilled in the art, for example such as are disclosed in U.S. Pat. Nos. 5,631,365, 5,767,115, 5,846,966, 6,207,822, U.S. Patent Application Publication No. 2002/0193607 and PCT Patent Application WO 93/02048, each of which is incorporated herein by reference in its entirety.
[0103] "Sample", "candidate compound" or "candidate substance" refers to a composition which is evaluated in a test or assay, for example, for the ability to agonize or antagonize NPC1L1 (e.g., SEQ ID NO: 2, 4 or 12) or a functional fragment thereof. The composition may small molecules, peptides, nucleotides, polynucleotides, subatomic particles (e.g., α particles, β particles) or antibodies.
[0104] Two basic types of screening systems that can be used include, a labeled-ligand binding assay (e.g., direct binding assay or scintillation proximity assay (SPA)) and a "sterol (e.g., cholesterol) or 5α-stanol uptake" assay. A labeled ligand, for use in the binding assay, can be obtained by labeling a sterol (e.g., cholesterol) or a 5α-stanol or a known NPC1L1 agonist or antagonist with a measurable group (e.g., 125I or 3H). Various labeled forms of sterols (e.g., cholesterol) or 5α-stanols are available commercially or can be generated using standard techniques (e.g., Cholesterol-[1,2-3H(N)], Cholesterol[1,2,6,7-3H(N)] or Cholesterol-[7-3H(N)]; American Radiolabeled Chemicals, Inc; St. Louis, Mo.). In a preferred embodiment, ezetimibe is fluorescently labeled with a BODIPY group (Altmann, et al., (2002) Biochim. Biophys. Acta 1580(0:77-93) or labeled with a detectable group such as 125I or 3H.
[0105] Direct Binding Assay. Typically, a given amount of NPC1L1 of the invention (e.g., SEQ ID NO: 2, 4 or 12) or a complex including NPC1L1 is contacted with increasing amounts of labeled ligand or known antagonist or agonist (discussed above) and the amount of the bound, labeled ligand or known antagonist or agonist is measured after removing unbound, labeled ligand or known antagonist or agonist by washing. As the amount of the labeled ligand or known agonist or antagonist is increased, a point is eventually reached at which all receptor binding sites are occupied or saturated. Specific receptor binding of the labeled ligand or known agonist or antagonist is abolished by a large excess of unlabeled ligand or known agonist or antagonist.
[0106] Preferably, an assay system is used in which non-specific binding of the labeled ligand or known antagonist or agonist to the receptor is minimal. Non-specific binding is typically less than 50%, preferably less than 15%, and more preferably less than 10% of the total binding of the labeled ligand or known antagonist or agonist.
[0107] A nucleic acid encoding an NPC1L1 polypeptide of the invention (e.g., SEQ ID NO: 2, 4 or 12) can be transfected into an appropriate host cell, whereby the receptor will become incorporated into the membrane of the cell. A membrane fraction can then be isolated from the cell and used as a source of the receptor for assay. Alternatively, the whole cell expressing the receptor in the cell surface can be used in an assay. Preferably, specific binding of the labeled ligand or known antagonist or agonist to an untransfected/untransformed host cell or to a membrane fraction from an untransfected/untransformed host cell will be negligible.
[0108] In principle, a binding assay of the invention could be carried out using a soluble NPC1L1 polypeptide of the invention, e.g., following production and refolding by standard methods from an E. coli expression system, and the resulting receptor-labeled ligand complex could be precipitated, e.g., using an antibody against the receptor. The precipitate could then be washed and the amount of the bound, labeled ligand or antagonist or agonist could be measured.
[0109] In the basic binding assay, the method for identifying an NPC1L1 agonist or antagonist includes: [0110] (a) contacting NPC1L1 (e.g., SEQ ID NO: 2 or 4 or 12), a subsequence thereof or a complex including NPC1L1, in the presence of a known amount of labeled sterol (e.g., cholesterol) or 5α-stanol or known antagonist or agonist (e.g., labeled ezetimibe or labeled L-166,143) with a sample to be tested for the presence of an NPC1L1 agonist or antagonist; and [0111] (b) measuring the amount of labeled sterol (e.g., cholesterol) or 5α-stanol or known antagonist or agonist directly or indirectly bound to NPC1L1.
[0112] An NPC1L1 antagonist or agonist in the sample is identified by measuring substantially reduced direct or indirect binding of the labeled sterol (e.g., cholesterol) or 5α-stanol or known antagonist or agonist to NPC1L1, compared to what would be measured in the absence of such an antagonist or agonist. For example, reduced direct or indirect binding between [3H]-cholesterol and NPC1L1 in the presence of a sample might suggest that the sample contains a substance which is competing against [3H]-cholesterol for NPC1L1 binding.
[0113] This assay can include a control experiment lacking any NPC1L1-dependent ligand (e.g., sterol such as cholesterol or 5α-stanol) binding. In this assay, for example, a whole cell or cell membrane lacking any functional NPC1L1, for example, a cell or membrane isolated or derived from a transgenic mutant npc1l1.sup.- mouse of the invention, is assayed for ligand binding. When screening a sample for the presence of an NPC1L1 antagonist, it is useful to compare the level of binding observed in the presence of a sample being tested with that of a control experiment, as described herein, which completely lacks NPC1L1-dependent binding. Ideally, though by no means necessarily, the level of binding seen in the presence of a sample containing an antagonist will be similar to that of the control experiment.
[0114] Alternatively, a sample can be tested directly for binding to NPC1L1 (e.g., SEQ ID NO: 2, 4 or 12). A basic assay of this type may include the following steps:
[0115] (a) contacting NPC1L1 (e.g., SEQ ID NO: 2 or 4 or 12), a subsequence thereof or a complex including NPC1L1 with a labeled candidate compound (e.g., [3H]-ezetimibe); and
[0116] (b) detecting direct or indirect binding between the labeled candidate compound and NPC1L1.
[0117] Again, these experiment can be performed along with a control experiment wherein NPC1L1-dependent binding is completely lacking. For example, the assay can be performed using a whole cell or cell membrane lacking any functional NPC1L1 (e.g., cell or cell membrane derived from a transgenic, mutant npc1l1.sup.- mouse as described herein).
[0118] A candidate compound which is found to bind to NPC1L1 may function as an agonist or antagonist of NPC1L1 (e.g., by inhibition of sterol (e.g., cholesterol) or 5α-stanol uptake).
[0119] SPA Assay. NPC1L1 antagonists or agonists may also be measured using scintillation proximity assays (SPA). SPA assays are conventional and very well known in the art; see, for example, U.S. Pat. No. 4,568,649. In SPA, the target of interest is immobilised to a small microsphere approximately 5 microns in diameter. The microsphere, typically, includes a solid scintillant core which has been coated with a polyhydroxy film, which in turn contains coupling molecules, which allow generic links for assay design. When a radioisotopically labeled molecule binds to the microsphere, the radioisotope is brought into close proximity to the scintillant and effective energy transfer from electrons emitted by the isotope will take place resulting in the emission of light. While the radioisotope remains in free solution, it is too distant from the scintillant and the electron will dissipate the energy into the aqueous medium and therefore remain undetected. Scintillation may be detected with a scintillation counter. In general, 3H and 125I labels are well suited to SPA.
[0120] For the assay of receptor-mediated binding events, the lectin wheat germ agglutinin (WGA) may be used as the SPA bead coupling molecule (Amersham Biosciences; Piscataway, N.J.). The WGA coupled bead captures glycosylated, cellular membranes and glycoproteins and has been used for a wide variety of receptor sources and cultured cell membranes. The receptor is immobilized onto the WGA-SPA bead and a signal is generated on binding of an isotopically labeled ligand. Other coupling molecules which may be useful for receptor binding SPA assays include poly-L-lysine and WGA/polyethyleneimine (Amersham Biosciences; Piscataway, N.J.). See, for example, Berry, J. A., et al., (1991) Cardiovascular Pharmacol. 17 (Supp1.7): S143-S145; Hoffman, R., et al., (1992) Anal. Biochem. 203: 70-75; Kienhus, et al., (1992) J. Receptor Research 12: 389-399; Jing, S., et al., (1992) Neuron 9: 1067-1079.
[0121] The scintillant contained in SPA beads may include, for example, yttrium silicate (YSi), yttrium oxide (YOx), diphenyloxazole or polyvinyltoluene (PVT) which acts as a solid solvent for diphenylanthracine (DPA).
[0122] SPA assays may be used to analyze whether a sample contains an NPC1L1 antagonist or agonist. In these assays, a host cell which expresses NPC1L1 (e.g., SEQ ID NO: 2 or 4 or 12) on the cell surface or a membrane fraction thereof is incubated with and captured by SPA beads (e.g., WGA coated YOx beads or WGA coated YSi beads). The beads bearing the NPC1L1 are incubated with labeled, known ligand or agonist or antagonist (e.g., 3H-cholesterol, 3H-ezetimibe or 125I-ezetimibe). The assay mixture further includes either the sample to be tested or a blank (e.g., water). After an optional incubation, scintillation is measured using a scintillation counter. An NPC1L1 agonist or antagonist may be identified in the sample by measuring substantially reduced fluorescence, compared to what would be measured in the absence of such agonist or antagonist (blank). Measuring substantially reduced fluorescence may suggest that the sample contains a substance which competes for direct or indirect NPC1L1 binding with the known ligand, agonist or antagonist.
[0123] Alternatively, a sample may be identified as an antagonist or agonist of NPC1L1 by directly detecting binding in a SPA assay. In this assay, a labeled version of a candidate compound to be tested may be put in contact with the host cell expressing NPC1L1 or a membrane fraction thereof which is bound to the SPA bead. Fluorescence may then be assayed to detect the presence of a complex between the labeled candidate compound and the host cell or membrane fraction expressing NPC1L1 or a complex including NPC1L1. A candidate compound which binds directly or indirectly to NPC1L1 may possess NPC1L1 agonistic or antagonistic activity.
[0124] SPA Assays can also be performed along with a control experiment lacking any NPC1L1-dependent binding. The control experiment can be performed, for example, with a cell or cell membrane lacking any functional NPC1L1 (e.g., cell or cell membrane derived from a transgenic, mutant npc1l1.sup.- mouse as described herein). When the control experiment is performed, the level of binding observed in the presence of sample being tested for the presence of an antagonist can be compared with that observed in the control experiment.
[0125] Host cells expressing NPC1L1 may be prepared by transforming or transfecting a nucleic acid encoding an NPC1L1 of the invention into an appropriate host cell, whereby the receptor becomes incorporated into the membrane of the cell. A membrane fraction can then be isolated from the cell and used as a source of the receptor for assay. Alternatively, the whole cell expressing the receptor on the cell surface can be used in an assay. Preferably, specific binding of the labeled ligand or known antagonist or agonist to an untransfected/untransformed host cell or membrane fraction from an untransfected/untransformed host cell will be negligible. Preferred host cells include Chinese Hamster Ovary (CHO) cells, murine macrophage J774 cells or any other macrophage cell line and human intestinal epithelial Caco2 cells.
[0126] Sterol/5α-stanol Uptake Assay. Assays may also be performed to determine if a sample can agonize or antagonize NPC1L1 mediated sterol (e.g., cholesterol) or 5α-stanol uptake. In these assays, a host cell expressing NPC1L1 (e.g., SEQ ID NO: 2 or 4 or 12) on the cell surface (discussed above) can be contacted with detectably labeled sterol (e.g., 3H-cholesterol or 125I-cholesterol)) or 5α-stanol along with either a sample or a blank. After an optional incubation, the cells can be washed to remove unabsorbed sterol or 5α-stanol. Sterol or 5α-stanol uptake can be determined by detecting the presence of labeled sterol or 5α-stanol in the host cells. For example, assayed cells or lysates or fractions thereof (e.g., fractions resolved by thin-layer chromatography) can be contacted with a liquid scintillant and scintillation can be measured using a scintillation counter.
[0127] In these assays, an NPC1L1 antagonist in the sample may be identified by measuring substantially reduced uptake of labeled sterol (e.g., 3H-cholesterol) or 5α-stanol, compared to what would be measured in the absence of such an antagonist and an agonist may be identified by measuring substantially increased uptake of labeled sterol (e.g., 3H-cholesterol) or 5α-stanol, compared to what would be measured in the absence of such an agonist.
[0128] Uptake assays can also be performed along with a control experiment lacking any NPC1L1-dependent uptake. The control experiment can be performed, for example, with a cell lacking any functional NPC1L1 (e.g., cell derived from a transgenic, mutant npc1l1.sup.- mouse as described herein). When the control experiment is performed, the level of uptake observed in the presence of sample being tested for the presence of an antagonist can be compared with that observed in the control experiment.
[0129] Mouse Assay. The present invention comprises a mutant, transgenic mouse which lacks any functional NPC1L1. This mouse may serve as a convenient control experiment in screening assays for identifying inhibitors of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption, preferably inhibitors of NPC1L1. Preferably, a mouse assay of the present invention would comprise the following steps: [0130] (a) feeding a sterol (e.g., cholesterol) or 5α-stanol-containing substance (e.g., comprising radiolabeled cholesterol, such as 14C-cholesterol or 3H-cholesterol) to a first and second mouse comprising a functional NPC1L1 gene and to a third, mutant mouse lacking a functional NPC1L1;
[0131] The sterol (e.g., cholesterol) or 5α-stanol containing substance preferably contains labeled cholesterol, such as a radiolabeled cholesterol, for example, 3H or 14C labeled cholesterol. The sterol (e.g., cholesterol) or 5α-stanol containing substance may also include cold, unlabeled sterol (e.g., cholesterol) or 5α-stanol such as in corn oil.
[0132] In these assays, the third npc1l1 mutant mouse serves as a (+)-control experiment which exhibits low levels of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption and the second mouse serves as a (-)-control experiment which exhibits normal, uninhibited levels of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption. The second mouse is not administered the sample to be tested for an NPC1L1 antagonist. The first mouse is the experiment. [0133] (b) administering the sample to the first mouse comprising a functional NPC1L1 but not to the second mouse; [0134] (c) measuring the amount of sterol (e.g., cholesterol) or 5α-stanol absorption in the intestine of said first, second and third mouse;
[0135] Intestinal sterol (e.g., cholesterol) or 5α-stanol absorption may be measured by any method known in the art. For example, the level intestinal absorption can be assayed by measuring the level of serum sterol (e.g., cholesterol) or 5α-stanol. [0136] (d) comparing the levels of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption in each mouse;
[0137] wherein the sample is determined to contain the intestinal sterol (e.g., cholesterol) or 5α-stanol absorption antagonist when the level of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption in the first mouse and in the third mouse are less than the amount of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption in the second mouse.
[0138] Preferably, if the sample contains an intestinal sterol (e.g., cholesterol) or 5α-stanol absorption inhibitor (e.g., an NPC1L1 inhibitor), the level of sterol (e.g., cholesterol) or 5α-stanol absorption in the first mouse will be similar to that of the third, npc1l1 mutant mouse.
[0139] An alternative, (+)-control experiment which may be used in these screening assays is a mouse comprising functional NPC1L1 which is administered a known antagonist of NPC1L1, such as ezetimibe.
Pharmaceutical Compositions
[0140] NPC1L1 agonists and antagonists discovered, for example, by the screening methods described above may be used therapeutically (e.g., in a pharmaceutical composition) to stimulate or block the activity of NPC1L1 and, thereby, to treat any medical condition caused or mediated by NPC1L1. In addition, the antibody molecules of the invention may also be used therapeutically (e.g., in a pharmaceutical composition) to bind NPC1L1 and, thereby, block the ability of NPC1L1 to bind a sterol (e.g., cholesterol) or 5α-stanol. Blocking the binding of a sterol (e.g., cholesterol) or 5α-stanol would prevent absorption of the molecule (e.g., by intestinal cells such as enterocytes). Blocking absorption of sterol (e.g., cholesterol) or 5α-stanol would be a useful way to lower serum sterol (e.g., cholesterol) or 5α-stanol levels in a subject and, thereby, reduce the incidence of, for example, hyperlipidemia, atherosclerosis, coronary heart disease, stroke or arteriosclerosis.
[0141] The term "subject" or "patient" includes any organism, preferably animals, more preferably mammals (e.g., mice, rats, rabbits, dogs, horses, primates, cats) and most preferably humans.
[0142] The term "pharmaceutical composition" refers to a composition including an active ingredient and a pharmaceutically acceptable carrier and/or adjuvant.
[0143] Although the compositions of this invention could be administered in simple solution, they are more typically used in combination with other materials such as carriers, preferably pharmaceutically acceptable carriers. Useful, pharmaceutically acceptable carriers can be any compatible, non-toxic substances suitable for delivering the compositions of the invention to a subject. Sterile water, alcohol, fats, waxes, and inert solids may be included in a pharmaceutically acceptable carrier. Pharmaceutically acceptable adjuvants (buffering agents, dispersing agents) may also be incorporated into the pharmaceutical composition.
[0144] Preferably, the pharmaceutical compositions of the invention are in the form of a pill or capsule. Methods for formulating pills and capsules are very well known in the art. For example, for oral administration in the form of tablets or capsules, the active drug component may be combined with any oral, non-toxic pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid forms) and the like. Moreover, when desired or needed, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated in the mixture. Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethylcellulose, polyethylene glycol and waxes. Among the lubricants there may be mentioned for use in these dosage forms, boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include starch, methylcellulose, guar gum and the like. Sweetening and flavoring agents and preservatives may also be included where appropriate.
[0145] The pharmaceutical compositions of the invention may be administered in conjunction with a second pharmaceutical composition or substance. In preferred embodiments, the second composition includes a cholesterol-lowering drug. When a combination therapy is used, both compositions may be formulated into a single composition for simultaneous delivery or formulated separately into two or more compositions (e.g., a kit).
[0146] The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. See, e.g., Gilman et al. (eds.) (1990), The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Remington's Pharmaceutical Sciences, supra, Easton, Pa.; Avis et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications Dekker, New York; Lieberman et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets Dekker, New York; and Lieberman et al. (eds.) (1990), Pharmaceutical Dosage Forms: Disperse Systems Dekker, N.Y.
[0147] The dosage regimen involved in a therapeutic application may be determined by a physician, considering various factors which may modify the action of the therapeutic substance, e.g., the condition, body weight, sex and diet of the patient, the severity of any infection, time of administration, and other clinical factors. Often, treatment dosages are titrated upward from a low level to optimize safety and efficacy. Dosages may be adjusted to account for the smaller molecular sizes and possibly decreased half-lives (clearance times) following administration.
[0148] An "effective amount" of an antagonist of the invention may be an amount that will detectably reduce the level of intestinal sterol (e.g., cholesterol) or 5α-stanol absorption or detectably reduce the level of serum sterol (e.g., cholesterol) or 5α-stanol in a subject administered the composition.
[0149] Typical protocols for the therapeutic administration of such substances are well known in the art. Pharmaceutical composition of the invention may be administered, for example, by any parenteral or non-parenteral route.
[0150] Pills and capsules of the invention can be administered orally. Injectable compositions can be administered with medical devices known in the art; for example, by injection with a hypodermic needle.
[0151] Injectable pharmaceutical compositions of the invention may also be administered with a needleless hypodermic injection device; such as the devices disclosed in U.S. Pat. Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824 or 4,596,556.
Anti-Sense
[0152] The present invention also encompasses anti-sense oligonucleotides capable of specifically hybridizing to mRNA encoding NPC1L1 (e.g., any of SEQ ID NOs: 1, 3, 5-11 or 13) having an amino acid sequence defined by, for example, SEQ ID NO: 2 or 4 or 12 or a subsequence thereof so as to prevent translation of the mRNA. Additionally, this invention contemplates anti-sense oligonucleotides capable of specifically hybridizing to the genomic DNA molecule encoding NPC1L1, for example, having an amino acid sequence defined by SEQ ID NO: 2 or 4 or 12 or a subsequence thereof.
[0153] This invention further provides pharmaceutical compositions comprising (a) an amount of an oligonucleotide effective to reduce NPC1L1-mediated sterol (e.g., cholesterol) or 5α-stanol absorption by passing through a cell membrane and binding specifically with mRNA encoding NPC1L1 in the cell so as to prevent its translation and (b) a pharmaceutically acceptable carrier capable of passing through a cell membrane. In an embodiment, the oligonucleotide is coupled to a substance that inactivates mRNA. In another embodiment, the substance that inactivates mRNA is a ribozyme.
[0154] Reducing the level of NPC1L1 expression by introducing anti-sense NPC1L1 RNA into the cells of a patient is a useful method reducing intestinal sterol (e.g., cholesterol) or 5α-stanol absorption and serum cholesterol in the patient.
Kits
[0155] Kits of the present invention include ezetimibe, preferably combined with a pharmaceutically acceptable carrier, in a pharmaceutical formulation, more preferably in a pharmaceutical dosage form such as a pill, a powder, an injectable liquid, a tablet, dispersible granules, a capsule, a cachet or a suppository. See for example, Gilman et al. (eds.) (1990), The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Remington's Pharmaceutical Sciences, supra, Easton, Pa.; Avis et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications Dekker, New York; Lieberman et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets Dekker, New York; and Lieberman et al. (eds.) (1990), Pharmaceutical Dosage Forms: Disperse, Systems Dekker, New York. Preferably, the dosage form is a Zetia® tablet (Merck/Schering-Plough Corp.). Ezetimibe may be supplied in any convenient form. For example, tablets including ezetimibe may be supplied in bottles of 30, 90 or 500.
[0156] The kits of the present invention also include information, for example in the form of a package insert, indicating that the target of ezetimibe is NPC1L1 (NPC3). The term "target of ezetimibe" indicates that ezetimibe reduces intestinal sterol (e.g., cholesterol) or 5α-stanol absorption, either directly or indirectly, by antagonizing NPC1L1. The form of the insert may take any form, such as paper or on electronic media such as a magnetically recorded medium (e.g., floppy disk) or a CD-ROM.
[0157] The package insert may also include other information concerning the pharmaceutical compositions and dosage forms in the kit. Generally, such information aids patients and physicians in using the enclosed pharmaceutical compositions and dosage forms effectively and safely. For example, the following information regarding ezetimibe (e.g., Zetia®) and/or simvastatin (e.g., Zocor®) may be supplied in the insert: pharmacokinetics, pharmacodynamics, clinical studies, efficacy parameters, indications and usage, contraindications, warnings, precautions, adverse reactions, overdosage, proper dosage and administration, how supplied, proper storage conditions, references and patent information.
[0158] The kits of the invention may also include simvastatin
##STR00002##
preferably combined with a pharmaceutically acceptable carrier, in a pharmaceutical formulation, more preferably in a pharmaceutical dosage form such as a pill, a powder, an injectable liquid, a tablet, dispersible granules, a capsule, a cachet or a suppository. Preferably, the dosage form of simvastatin is a Zocor® tablet (Merck & Co.; Whitehouse Station, N.J.).
[0159] Tablets or pills comprising simvastatin may be supplied in any convenient form. For example, pills or tablets comprising 5 mg simvastatin can be supplied as follows: bottles of 30, 60, 90, 100 or 1000. Pills or tablets comprising 10 mg simvastatin may be supplied as follows: bottles of 30, 60, 90, 100, 1000 or 10,000. Pills or tablets comprising 20 mg simvastatin may be supplied as follows: bottles of 30, 60, 90, 100, 1000 or 10,000. Pills or tablets comprising 40 mg simvastatin may be supplied as follows: bottles of 30, 60, 90, 100 or 1000. Pills or tablets comprising 80 mg simvastatin may be supplied as follows: bottles of 30, 60, 90, 100, 1000 or 10,000.
[0160] Ezetimibe and simvastatin may be supplied, in the kit, as separate compositions or combined into a single composition. For example, ezetimibe and simvastatin may be supplied within a single, common pharmaceutical dosage form (e.g., pill or tablet) as in separate pharmaceutical dosage forms (e.g., two separate pills or tablets).
npc1l1.sup.- Cells
[0161] The present invention provides any isolated mammalian cell, (e.g., an isolated mouse cell, an isolated rat cell or an isolated human cell) which lacks an NPC1L1 gene which encodes or can produce a functional NPC1L1 protein. Included within this embodiment are mutant npc1l1 genes comprising a point mutation, truncation or deletion of the genetic coding region or of any regulatory element (e.g., a promoter).
[0162] For example, the cell can be isolated from a mutant mouse comprising a homozygous mutation of endogenous, chromosomal NPC1L1 wherein the mouse does not produce any functional NPC1L1 protein (e.g., the mouse described below in Example 22). Moreover, the present invention comprises any cell, tissue, organ, fluid, nucleic acid, peptide or other biological substance derived or isolated from such a mutant mouse, particularly a mutant, transgenic mouse which does not produce any functional NPC1L1, wherein the region of endogenous, chromosomal NPC1L1 deleted, in the mouse, corresponds to nucleotides 790-998 of the nucleotide sequence set forth in SEQ ID NO: 45.
[0163] The isolated cell can be isolated or derived, for example, from the duodenum, gall bladder, liver, small intestine or stomach of the mutant mouse. Further, the cell can be an enterocyte.
[0164] The npc1l1.sup.- mutant cells are useful, for example, for use in control experiments in screening assays (see e.g., supra) since they lack any NPC1L1-dependent uptake or binding of sterol, 5α-stanol or ezetimibe. The level of inhibition caused by a particular sample, in a screening assay, can be compared to that of an assay performed with the mutant cell. Ideally, though by no means necessarily, in a screening assay, for example, as described herein, the same amount of binding will be observed by a non-mutant cell or cell membrane, in the presence of an antagonist, as is observed in connection with a mutant npc1l1.sup.- cell or cell membrane alone.
EXAMPLES
[0165] The following examples are provided to more clearly describe the present invention and should not be construed to limit the scope of the invention in any way.
Example 1
Cloning and Expression of Rat, Mouse and Human NPC1L1
[0166] Rat NPC, mouse NPC1L1 or human NPC1L1 can all conveniently be amplified using polymerase chain reaction (PCR). In this approach, DNA from a rat, mouse or human cDNA library can be amplified using appropriate primers and standard PCR conditions. Design of primers and optimal amplification conditions constitute standard techniques which are commonly known in the art.
[0167] An amplified NPC1L1 gene may conveniently be expressed, again, using methods which are commonly known in the art. For example, NPC1L1 may be inserted into a pET-based plasmid vector (Stratagene; La Joola, Calif.), downstream of the T7 RNA polymerase promoter. The plasmid may then be transformed into a T7 expression system (e.g., BL21DE3 E. coli cells), grown in a liquid culture and induced (e.g., by adding IPTG to the bacterial culture).
Example 2
Direct Binding Assay
[0168] Membrane preparation: Caco2 cells transfected with an expression vector containing a polynucleotide encoding NPC1L1 (e.g., SEQ ID NO: 2, 4 or 12) are harvested by incubating in 5 mM EDTA/phosphate-buffered saline followed by repeated pipeting. The cells are centrifuged 5 min at 1000×g. The EDTA/PBS is decanted and an equal volume of ice-cold 50 mM Tris-HCl, pH 7.5 is added and cells are broken up with a Polytron (PT10 tip, setting 5, 30 sec). Nuclei and unbroken cells are sedimented at 1000×g for 10 min and then the supernatant is centrifuged at 50,000×g for 10 min. The supernatant is decanted, the pellet is resuspended by Polytron, a sample is taken for protein assay (bicinchoninic acid, Pierce), and the tissue is again centrifuged at 50,000×g. Pellets are stored frozen at -20° C.
[0169] Binding assay: For saturation binding, four concentrations of [3H]-ezetimibe (15 Ci/mmol) are incubated without and with 10-5M ezetimibe in triplicate with 50 μg of membrane protein in a total volume of 200 μl of 50 mM Tris-HCl, pH 7.5, for 30 min at 30° C. Samples are filtered on GF/B filters and washed three times with 2 ml of cold Tris buffer. Filters are dried in a microwave oven, impregnated with Meltilex wax scintillant, and counted at 45% efficiency. For competition binding assays, five concentrations of a sample are incubated in triplicate with 18 nM [3H]-ezetimibe and 70 μg of membrane protein under the conditions described above. Curves are fit to the data with Prism (GraphPad Software) nonlinear least-squares curve-fitting program and Ki values are derived from IC50 values according to Cheng and Prusoff (Cheng, Y. C., et al., (1973) Biochem. Pharmacol. 22:3099-3108).
Example 3
SPA Assay
[0170] For each well of a 96 well plate, a reaction mixture of 10 μg human, mouse or rat NPC1L1-CHO overexpressing membranes (Biosignal) and 200 μg/well YSi--WGA-SPA beads (Amersham) in 100 μl is prepared in NPC1L1 assay buffer (25 mM HEPES, pH 7.8, 2 mM CaCl2, 1 mM MgCl2, 125 mM NaCl, 0.1% BSA). A 0.4 nM stock of ligand-[125I]-ezetimibe--is prepared in the NPC1L1 assay buffer. The above solutions are added to a 96-well assay plate as follows: 50 μl NPC1L1 assay buffer, 100 μl of reaction mixture, 50 μl of ligand stock (final ligand concentration is 0.1 nM). The assay plates are shaken for 5 minutes on a plate shaker, then incubated for 8 hours before cpm/well are determined in Microbeta Trilux counter (PerkinElmer).
[0171] These assays will indicate that [125I]-ezetimibe binds to the cell membranes expressing human, mouse or rat NPC1L1. Similar results will be obtained if the same experiment is performed with radiolabeled cholesterol (e.g., 125I-cholesterol).
Example 4
Cholesterol Uptake Assay
[0172] CHO cells expressing either SR-B1 or three different clones of rat NPC1L1 or one clone of mouse NPC1L1 were starved overnight in cholesterol free media then dosed with [3H]-cholesterol in a mixed synthetic micelle emulsion for 4 min, 8 min, 12 min or 24 min in the absence or presence of 10 μM ezetimibe. The cells were harvested and the lipids were organically extracted. The extracted lipids were spotted on thin-layer chromatography (TLC) plates and resolved within an organic vapor phase. The free cholesterol bands for each assay were isolated and counted in a scintillation counter.
[0173] The SR-B1 expressing cells exhibited an increase in [3H]-cholesterol uptake as early as 4 min which was also inhibited by ezetimibe. The three rat clones and the one mouse clone appeared to give background levels of [3H]-cholesterol uptake which was similar to that of the untransformed CHO cell.
[0174] These experiments will yield data demonstrating that CHO cells can perform mouse, rat and human NPC1L1-dependent uptake of [3H]-cholesterol when more optimal experimental conditions are developed.
Example 5
Expression of Rat NPC1L1 in Wistar Rat Tissue
[0175] In these experiments, the expression of rat NPC1L1 mRNA, in several rat tissues, was evaluated. The tissues evaluated were esophagus, stomach, duodenum, jejunum, ileum, proximal colon, distal colon, liver, pancreas, heart, aorta, spleen, lung, kidney, brain, muscle, testes, ovary, uterus, adrenal gland and thyroid gland. Total RNA samples were isolated from at least 3 male and 3 female animals and pooled. The samples were then subjected to real time quantitative PCR using Taqman analysis using standard dual-labeled fluorogenic oligonucleotide probes. Typical probe design incorporated a 5' reporter dye (e.g., 6FAM (6-carboxyfluorescein) or VIC) and a 3' quenching dye (e.g., TAMRA (6-carboxytetramethyl-rhodamine)).
TABLE-US-00002 rat NPC1L1: Forward: (SEQ ID NO: 14) TCTTCACCCTTGCTCTTTGC Reverse: (SEQ ID NO: 15) AATGATGGAGAGTAGGTTGAGGAT Probe: (SEQ ID NO: 16) [6FAM]TGCCCACCTTTGTTGTCTGCTACC[TAMRA] rat β-actin: Forward: (SEQ ID NO: 17) ATCGCTGACAGGATGCAGAAG Reverse: (SEQ ID NO: 18) TCAGGAGGAGCAATGATCTTGA Probe: (SEQ ID NO: 19) [VIC]AGATTACTGCCCTGGCTCCTAGCACCAT[TAMRA]
[0176] PCR reactions were run in 96-well format with 25 μl reaction mixture in each well containing: Platinum SuperMix (12.5 μl), ROX Reference Dye (0.5 ul), 50 mM magnesium chloride (2 μl), cDNA from RT reaction (0.2 μl). Multiplex reactions contained gene specific primers at 200 nM each and FAM labeled probe at 100 nM and gene specific primers at 100 nM each and VIC labeled probe at 50 nM. Reactions were run with a standard 2-step cycling program, 95° C. for 15 sec and 60° C. for 1 min, for 40 cycles.
[0177] The highest levels of expression were observed in the duodenum, jejunum and ileum tissue. These data indicate that NPC1L1 plays a role in cholesterol absorption in the intestine.
Example 6
Expression of Mouse NPC1L1 in Mouse Tissue
[0178] In these experiments, the expression of mouse NPC1L1 mRNA, in several tissues, was evaluated. The tissues evaluated were adrenal gland, BM, brain, heart, islets of langerhans, LI, small intestine, kidney, liver, lung, MLN, PLN, muscle, ovary, pituitary gland, placenta, Peyers Patch, skin, spleen, stomach, testes, thymus, thyroid gland, uterus and trachea. Total RNA samples were isolate from at least 3 male and 3 female animals and pooled. The samples were then subjected to real time quantitative PCR using Taqman analysis using the following primers and probes:
TABLE-US-00003 mouse NPC1L1: Forward: (SEQ ID NO: 20) ATCCTCATCCTGGGCTTTGC Reverse: (SEQ ID NO: 21) GCAAGGTGATCAGGAGGTTGA Probe: (SEQ ID NO: 22) [6FAM]CCCAGCTTATCCAGATTTTCTTCTTCCGC[TAMRA]
[0179] The highest levels of expression were observed in the Peyer's Patch, small intestine, gall bladder and stomach tissue. These data are consistent with a cholesterol absorption role for NPC1L1 which takes place in the digestive system.
Example 7
Expression of Human NPC1L1 in Human Tissue
[0180] In these experiments, the expression level of human NPC1L1 mRNA was evaluated in 2045 samples representing 46 normal tissues. Microarray-based gene expression analysis was performed on the Affymetrix HG-U95 GeneChip using a cRNA probe corresponding to base pairs 4192-5117 (SEQ ID NO: 43) in strict accordance to Affymetrix's established protocols. Gene Chips were scanned under low photo multiplier tube (PMT), and data were normalized using either Affymetrix MAS 4.0 or MAS 5.0 algorithms. In addition "spike ins" for most samples were used to construct a standard curve and obtain RNA concentration values according Gene Logic algorithms and procedures. A summary of these results are indicated, below, in Table 2.
TABLE-US-00004 TABLE 2 Expression level of NPC1L1 mRNA in various human tissues. ##STR00003##
[0181] Shaded data corresponds to tissues wherein the highest levels of NPC1L1 mRNA was detected. The "Present" column indicates the proportion of specified tissue samples evaluated wherein NPC1L1 mRNA was detected. The "Absent" column indicates the proportion of specified tissue samples evaluated wherein NPC1L1 RNA was not detected. The "lower 25%", "median" and "upper 75%" columns indicate statistical distribution of the relative NPC1L1 signal intensities observed for each set of tissue evaluated.
Example 8
Distribution of Rat NPC1L1, Rat IBAT or Rat SR-B1 mRNA in Rat Small Intestine
[0182] In these experiments, the distribution of rat NPC1L1 mRNA along the proximal-distal axis of rat small intestines was evaluated. Intestines were isolated from five independent animals and divided into 10 sections of approximately equal length. Total RNA was isolated and analyzed, by real time quantitative PCR using Taqman analysis, for localized expression levels of rat NPC1L1, rat IBAT (Heal bile acid transporter) or rat SR-B1 mRNA. The primers and probes used in the analysis were:
TABLE-US-00005 rat NPC1L1: Forward: (SEQ ID NO: 23) TCTTCACCCTTGCTCTTTGC Reverse: (SEQ ID NO: 24) AATGATGGAGAGTAGGTTGAGGAT Probe: (SEQ ID NO: 25) [6FAM]TGCCCACCTTTGTTGTCTGCTACC[TAMRA] rat Villin: Forward: (SEQ ID NO: 26) AGCACCTGTCCACTGAAGATTTC Reverse: (SEQ ID NO: 27) TGGACGCTGAGCTTCAGTTCT Probe: (SEQ ID NO: 28) [VIC]CTTCTCTGCGCTGCCTCGATGGAA[TAMRA] rat SR-B1: Forward: (SEQ ID NO: 29) AGTAAAAAGGGCTCGCAGGAT Reverse: (SEQ ID NO: 30) GGCAGCTGGTGACATCAGAGA Probe: (SEQ ID NO: 31) [6FAM]AGGAGGCCATGCAGGCCTACTCTGA[TAMRA] rat IBAT: Forward: (SEQ ID NO: 32) GAGTCCACGGTCAGTCCATGT Reverse: (SEQ ID NO: 33) TTATGAACAACAATGCCAAGCAA Probe: (SEQ ID NO: 34) [6FAM]AGTCCTTAGGTAGTGGCTTAGTCCCTGGAAGCTC[TAMRA]
[0183] The mRNA expression levels of each animal intestinal section were analyzed separately, then the observed expression level was normalized to the observed level of villin mRNA in that intestinal section. The observed, normalized mRNA expression levels for each section where then averaged.
[0184] The expression level of NPC1L1 and SR-B1 were highest in the jejunum (sections 2-5) as compared to that of the more distal ileum sections. Since the jejunum is believed to be the site of cholesterol absorption, these data suggest such a role for rat NPC1L1. IBAT distribution favoring the ileum is well document and served as a control for the experiment.
Example 9
In situ Analysis of Rat NPC1L1 mRNA in Rat Jejunum Tissue
[0185] The localization of rat NPC1L1 mRNA was characterized by in situ hybridization analysis of rat jejunum serial sections. The probes used in this analysis were:
TABLE-US-00006 T7-sense probe: (SEQ ID NO: 35) GTAATACGACTCACTATAGGGCCCTGACGGTCCTTCCTGAGGGAATCTT CAC T7-antisense probe: (SEQ ID NO: 36) GTAATACGACTCACTATAGGGCCTGGGAAGTTGGTCATGGCCACTCCAG C
[0186] The RNA probes were synthesized using T7 RNA polymerase amplification of a PCR amplified DNA fragment corresponding rat NPC1L1 nucleotides 3318 to 3672 (SEQ ID NO 1). Sense and anti-sense digoxigenin-UTP labeled cRNA probes were generated from the T7 promoter using the DIG RNA Labeling Kit following the manufacturer's instructions. Serial cryosections rat jejunum were hybridized with the sense and antiisense probes. Digoxigenin labeling was detected with the DIG Nucleic Acid Detection Kit based on previous methods. A positive signal is characterized by the deposition of a red reaction product at the site of hybridization.
[0187] The anti-sense probe showed strong staining of epithelium along the crypt-villus axis under low magnification (40×). The observed rat NPC1L1 mRNA expression levels may have been somewhat greater in the crypts than in the villus tips. Under high magnification (200×), staining was observed in the enterocytes but not in the goblet cells. A lack of staining observed with the sense probe (control) confirmed the high specificity of the NPC1L1 anti-sense signal. These data provided further evidence of the role of rat NPC1 L1 in intestinal cholesterol absorption.
Example 10
FACS Analysis of Fluorescently Labeled Ezetimibe Binding to Transiently Transfected CHO Cells
[0188] In these experiments, the ability of BODIPY-labeled ezetimibe (Altmann, et al., (2002) Biochim. Biophys. Acta 1580(1):77-93) to bind to NPC1L1 and SR-B1 was evaluated. "BODIPY" is a fluorescent group which was used to detect the BODIPY-ezetimibe. Chinese hamster ovary (CHO) cells were transiently transfected with rat NPC1L1 DNA (rNPC1L1/CHO), mouse NPC1L1 DNA (mNPC1L1/CHO), mouse SR-B1 DNA (mSRBI/CHO) or EGFP DNA (EGFP/CHO). EGFP is enhanced green fluorescent protein which was used as a positive control. The transfected CHO cells or untransfected CHO cells were then stained with 100 nM BODIPY-labeled ezetimibe and analyzed by FACS. Control experiments were also performed wherein the cells were not labeled with the BODIPY-ezetimibe and wherein untransfected CHO cells were labeled with the BODIPY-ezetimibe.
[0189] No staining was observed in the untransfected CHO, rNPC1L1/CHO or mNPC1L1/CHO cells. Fluorescence was detected in the positive-control EGFP/CHO cells. Staining was also detected in the mouse SR-B1/CHO cells. These data show that, under the conditions tested, BODIPY-ezetimibe is capable of binding to SR-B1 and that such binding is not ablated by the presence of the fluorescent BODIPY group. When more optimal conditions are determined, BODIPY-ezetimibe will be shown to label the rNPC1L1/CHO and mNPC1L1/CHO cells.
Example 11
FACS Analysis of Transiently Transfected CHO Cells Labeled with Anti-FLAG Antibody M2
[0190] In these experiments, the expression of FLAG-tagged NPC1L1 on CHO cells was evaluated. CHO cells were transiently transfected with mouse NPC1L1 DNA, rat NPC1L1 DNA, FLAG-rat NPC1L1 DNA or FLAG-mouse NPC1L1 DNA. The 8 amino acid FLAG tag used was DYKDDDDK (SEQ ID NO: 37) which was inserted on the amino-terminal extracellular loop just past the secretion signal sequence. The cells were incubated with commercially available anti-FLAG monoclonal mouse antibody M2 followed by a BODIPY-tagged anti-mouse secondary antibody. The treated cells were then analyzed by FACS.
[0191] The M2 antibody stained the CHO cells transfected with FLAG-rat NPC1L1 DNA and with FLAG-mouse NPC1L1. No staining was observed in the CHO cells transfected with mouse NPC1L1 DNA and with rat NPC1L1 DNA. These data showed that rat NPC1L1 and mouse NPC1L1 possess no significant, inherent fluorescence and are not bound by the anti-FLAG antibody. The observed, FLAG-dependent labeling of the cells indicated that the FLAG-mouse NPC1L1 and FLAG-rat NPC1L1 proteins are localized at the cell membrane of the CHO cells.
Example 12
FACS Analysis of FLAG-Rat NPC1L1-EGFP Chimera in Transiently Transfected CHO Cells
[0192] In these experiments, the surface and cytoplasmic localization of rat NPC1L1 in CHO cells was evaluated. CHO cells were transiently transfected with FLAG-rat NPC1L1 DNA or with FLAG-rat NPC1L1-EGFP DNA. In these fusions, the FLAG tag is at amino-terminus of rat NPC and EGFP fusion is at the carboxy-terminus of rat NPC1L1. The cells were then stained with the M2 anti-FLAG mouse (primary) antibody followed by secondary staining with a BODIPY-labeled anti-mouse antibody. In control experiments, cells were stained with only the secondary antibody and not with the primary antibody (M2). The stained cells were then analyzed by FACS.
[0193] In a control experiment, FLAG-rat NPC1L1 transfected cells were stained with BODIPY anti-mouse secondary antibody but not with the primary antibody. The data demonstrated that the secondary, anti-mouse antibody possessed no significant specificity for FLAG-rat NPC1L1 and that the FLAG-rat NPC1L1, itself, possesses no significant fluorescence.
[0194] In another control experiment, unlabeled FLAG-rat NPC1 L1-EGFP cells were FACS analyzed. In these experiments, autofluorescence of the enhanced green fluorescent protein (EGFP) was detected.
[0195] FLAG-rat NPC1L1 cells were stained with anti-FLAG mouse antibody M2 and with the BODIPY-labeled anti-mouse secondary antibody and FACS analyzed. The data from this analysis showed that the cells were labeled with the secondary, BODIPY-labeled antibody which indicated expression of the FLAG-rat NPC1L1 protein on the surface of the CHO cells.
[0196] FLAG-rat NPC1 L1-EGFP cells were stained with anti-FLAG mouse antibody M2 and with the BODIPY-labeled anti-mouse secondary antibody and FACS analyzed. The data from this analysis showed that both markers (BODIPY and EGFP) were present indicating surface expression of the chimeric protein. The data also indicated that a portion of the protein was located within the cells and may be associated with transport vesicles. These data supported a role for rat NPC1L1 in vesicular transport of cholesterol or protein expressed in subcellular organelles such as the rough endoplasmic reticulum.
Example 13
FACS Analysis and Fluorescent Microscopy of FLAG-Rat NPC1L1-EGFP Chimera in a Cloned CHO Cell Line
[0197] In these experiments, the cellular localization of rat NPC1L1 was evaluated by FACS analysis and by immunohistochemistry. CHO cells were transfected with FLAG-rat NPC1L1-EGFP DNA and stained with anti-FLAG mouse antibody M2 and then with a BODIPY-labeled anti-mouse secondary antibody. In the fusion, the FLAG tag is at the amino-terminus of rat NPC1L1 and the enhanced green fluorescent protein (EGFP) tag is located at the carboxy-terminus of the rat NPC1L1. The stained cells were then analyzed by FACS and by fluorescence microscopy.
[0198] Cells transfected with FLAG-rat NPC1L 1-EGFP DNA were stained with the anti-FLAG mouse antibody M2 and then with the BODIPY-labeled anti-mouse secondary antibody. FACS analysis of the cells detected both markers indicating surface expression of the chimeric protein.
[0199] FLAG-rat NPC1L1-EGFP transfected cells were analyzed by fluorescent microscopy at 63× magnification. Fluorescent microscopic analysis of the cells indicated non-nuclear staining with significant perinuclear organelle staining. Resolution of the image could not confirm the presence of vesicular associated protein. These data indicated that the fusion protein was expressed on the cell membrane of CHO cells.
Example 14
Generation of Polyclonal Anti-Rat NPC1L1 Rabbit Antibodies
[0200] Synthetic peptides (SEQ ID NO: 39-42) containing an amino- or carboxy-terminal cysteine residue were coupled to keyhole limpet hemocyanin (KLH) carrier protein through a disulfide linkage and used as antigen to raise polyclonal antiserum in New Zealand white rabbits (range 3-9 months in age). The KLH-peptide was emulsified by mixing with an equal volume of Freund's Adjuvant, and injected into three subcutaneous dorsal sites. Prior to the 16 week immunization schedule a pre-immune sera sample was collected which was followed by a primary injection of 0.25 mg KLH-peptide and 3 scheduled booster injections of 0.1 mg KLH-peptide. Animals were bled from the auricular artery and the blood was allowed to clot and the serum was then collected by centrifugation
[0201] The anti-peptide antibody titer was determined with an enzyme linked immunosorbent assay (ELISA) with free peptide bound in solid phase (1 μg/well). Results are expressed as the reciprocal of the serum dilution that resulted in an OD450 of 0.2. Detection was obtained using the biotinylated anti-rabbit IgG, horse radish peroxidase-streptavidin (HRP-SA) conjugate, and ABTS.
Example 15
FACS Analysis of Rat NPC1L1 Expression in CHO Cells Transiently Transfected with Rat NPC1L1 DNA Using Rabbit Anti-Rat NPC1L1 Antisera
[0202] In these experiments, the expression of rat NPC on the surface of CHO cells was evaluated. CHO cells were transfected with rat NPC1L1 DNA, then incubated with either rabbit preimmune serum or with 10 week anti-rat NPC1L1 serum described, above, in Example 14 (i.e., A0715, A0716, A0867 or A0868). Cells labeled with primary antisera were then stained with a BODIPY-modified anti-rabbit secondary antibody followed by FACS analysis.
[0203] No antibody surface labeling was observed for any of the pre-immune sera samples. Specific cell surface labeling of rat NPC1L1 transfected cells was observed for both A0715 and A0868. Antisera A0716 and A0867 did not recognize rat NPC1L1 surface expression in this assay format. This indicates that the native, unfused rat NPC1L1 protein is expressed in the CHO cells and localized to the CHO cell membranes. Cell surface expression of NPC1L1 is consistent with a role in intestinal cholesterol absorption.
Example 16
FACS Analysis of CHO Cells Transiently Transfected with FLAG-Mouse NPC1L1 DNA or FLAG-Rat NPC1L1 DNA or Untransfected CHO Cells Using Rabbit Anti-Rat NPC1L1 Antisera
[0204] In these experiments, the expression of FLAG-mouse NPC1L1 and FLAG-rat NPC1L1 in CHO cells was evaluated. CHO cells were transiently transfected with FLAG-mouse NPC1L1 DNA or with FLAG-rat NPC1L1 DNA. The FLAG-mouse NPC1L1 and FLAG-rat NPC1L1 transfected cells were labeled with either A0801, A0802, A0715 or A0868 sera (see Example 14) or with anti-FLAG antibody, M2. The labeled cells were then stained with BODIPY-labeled anti-rabbit secondary antibody and FACS analyzed. The untransfected CHO cells were analyzed in the same manner as the transfected cell lines.
[0205] Positive staining of the untransfected CHO cells was not observed for any of the antisera tested. Serum A0801-dependent labeling of FLAG-rat NPC1L1 transfected cells was observed but such labeling of FLAG-mouse NPC1L1 transfected cells was not observed. Serum A0802-dependent labeling of FLAG-mouse NPC1L1 or FLAG-rat NPC1L1 transfected cells was not observed. Strong serum A0715-dependent labeling of FLAG-rat NPC1L1 transfected cells was observed and weak serum A0715-dependent labeling of FLAG-mouse NPC1L1 transfected cells was observed. Weak serum A0868-dependent labeling of rat NPC1L1 and mouse NPC1L1 transfected cells was observed. Strong Anti-FLAG M2 antibody-dependent labeling of FLAG-rat NPC1L1 and FLAG-mouse NPC1L1 transfected cells was observed. The strong M2 staining is likely to be due to the fact that M2 is an affinity-purified, monoclonal antibody of known concentration. In contrast, the respective antisera are polyclonal, unpurified and contain an uncertain concentration of anti-rat NPC1L1 antibody. These date provide further evidence that the FLAG-mouse NPC1L1 and FLAG-rat NPC1L1 proteins are expressed in CHO cells and localized to the CHO cell membranes. Cell surface expression of NPC1L1 is consistent with a role in intestinal cholesterol absorption.
Example 17
Immunohistochemical Analysis of Rat Jejunum Tissue with Rabbit Anti-Rat NPC1L1 Antisera A0715
[0206] In these experiments, the localization of rat NPC1L1 in rat jejunum was analyzed by immunohistochemistry. Rat jejunum was removed, immediately embedded in O.C.T. compound and frozen in liquid nitrogen. Sections (6 μm) were cut with a cryostat microtome and mounted on glass slides. Sections were air dried at room temperature and then fixed in Bouin's fixative. Streptavidin-biotin-peroxidase immunostaining was carried out using Histostain-SP kit. Endogenous tissue peroxidase activity was blocked with a 10 minute incubation in 3% H2O2 in methanol, and nonspecific antibody binding was minimized by a 45 minute incubation in 10% nonimmune rabbit serum. Sections were incubated with a rabbit anti-rat NPC1L1 antisera A0715 or A0868 at a 1:500 dilution at 4° C., followed by incubation with biotinylated goat anti-rabbit IgG and with streptavidin-peroxidase. Subsequently, the sections were developed in an aminoethyl carbazole (AEC)--H2O2 staining system and counterstained with hematoxylin and examined by microscopy. A positive reaction using this protocol is characterized by the deposition of a red reaction product at the site of the antigen-antibody reaction. Nuclei appeared blue from the hematoxylin counterstain. Controls were performed simultaneously on the neighboring sections from the same tissue block. Control procedures consisted of the following: (1) substitute the primary antibody with the pre-immune serum, (2) substitute the primary antibody with the non-immune rabbit serum, (3) substitute the primary antibody with PBS, (4) substitute the second antibody with PBS.
[0207] The example shows tissue stained with anti-rat NPC1L1 sera A0715 or with the preimmune sera analyzed at low magnification (40×) and at high magnification (200×). The A0715-stained tissue, at low magnification, showed positive, strong staining of the villi epithelial layer (enterocytes). The A0715-stained tissue at high magnification showed positive, strong staining of the enterocyte apical membranes. No staining was observed in tissue treated only with preimmune sera. Similar results were obtained with sera A0868. These data indicate that rat NPC1L1 is expressed in rat jejunum which is consistent with a role in intestinal cholesterol absorption.
Example 18
Labeled Cholesterol Uptake Assay
[0208] In this example, the ability of CHO cells stably transfected with rat NPC1L1 to take up labeled cholesterol was evaluated. In these assays, cholesterol uptake, at a single concentration, was evaluated in a pulse-chase experiment. The data generated in these experiments are set forth, below, in Table 3.
Cells:
[0209] A. CHO cells stably transfected with rat NPC1L1 cDNA B. CHO background (no transfection)
[0210] Cells were seeded at 500,000 cells/well (mL) in 12-well plates.
Procedure:
[0211] All reagents and culture plates were maintained at 37° C. unless otherwise noted.
[0212] Starve. The maintenance media (F12 HAMS, 1% Pen/Strep, 10% FCS) was removed and the cells were rinsed with serum-free HAMS media. The serum-free media was then replaced with 1 mL "starve" media (F12 HAMS, Pen/Strep, 5% lipoprotein deficient serum (LPDS).
[0213] One plate of each cell line was starved overnight. The remaining 2 plates were designated "No Starve" (see below).
[0214] Pre-Incubation. Media was removed from all plates, rinsed with serum-free HAMS and replaced with starve media for 30 minutes.
[0215] 3H-Cholesterol Pulse. The following was added directly to each well. [0216] 0.5 μCi 3H-cholesterol (˜1.1×106 dpm/well) in 50 μl of a mixed bile salt micelle. [0217] 4.8 mM sodium taurocholate (2.581 mg/mL) [0218] 0.6 mM sodium oleate (0.183 mg/mL) [0219] 0.25 mM cholesterol (0.1 mg/mL) [0220] Dispersed in "starve" media by ultrasonic vibration [0221] Final media cholesterol concentration=5 μg/mL
[0222] Labeled cholesterol pulse time points were 0, 4, 12 and 24 minutes. Triplicate wells for each treatment were prepared.
[0223] Wash. At the designated times, media was aspirated and the cells were washed once with Hobbs Buffer A (50 mM Tris, 0.9% NaCl, 0.2% BSA, pH 7.4) and once with Hobbs Buffer B (50 mM Tris, 0.9% NaCl, pH 7.4 (no BSA)) at 37° C.
[0224] Processing/Analysis. Cells were digested overnight with 0.2N NaOH, 2 mL/well at room temperature. One 1.5 mL aliquot was removed from each well, neutralized & counted for radioactivity by scintillation counting. Two additional 50 μl aliquots from all wells are assayed for total protein by the Pierce micro BCA method. The quantity of labeled cholesterol observed in the cells was normalized by the quantity of protein in the cells.
TABLE-US-00007 TABLE 3 Uptake of 3H-cholesterol by CHO cells transfected with rat NPC1L1 or mouse SR-B1 or untransfected CHO cells. Time, min Total Cholesterol, dpm protein ± sem Total Cholesterol, dpm/mg protein ± sem After3H-Cholesterol NPC1L1 CHO NPC1L1 CHO No Starve 0 2067 ± 46 4568 ± 1937 10754 ± 166 22881 ± 9230 4 2619 ± 130 2868 ± 193 15366 ± 938 15636 ± 1471 12 2868 ± 193 4459 ± 170 15636 ± 1471 24622 ± 966 24 7010 ± 89 7204 ± 173 41129 ± 685 39361 ± 1207 Starve 0 1937 ± 273 2440 ± 299 10909 ± 1847 12429 ± 1673 4 3023 ± 308 2759 ± 105 17278 ± 1650 14307 ± 781 12 2759 ± 105 4857 ± 186 14307 ± 781 26270 ± 1473 24 6966 ± 72 7344 ± 65 39196 ± 174 38381 ± 161 dpm = disintegrations per minute sem = standard error of the mean
Example 19
Effect of Ezetimibe on Cholesterol Uptake
[0225] The effect of ezetimibe on the ability of CHO cells stably transfected with mouse or rat NPC1L1 or mouse SR-B1 to take up 3H-labeled cholesterol was evaluated in pulse-chase experiments. One cDNA clone of mouse NPC1L1 (C7) and three clones of rat NPC1L1 (C7, C17 and C21) were evaluated. The ability of CHO cells stably transfected with mouse SR-B1, mouse NPC1L1 and rat NPC1L1 to take up labeled cholesterol, in the absence of ezetimibe, was also evaluated in the pulse-chase experiments. Data generated in these experiments are set forth, below, in Tables 4 and 5. Additionally, the quantity of total cholesterol taken up by transfected and untransfected CHO cells in the presence of four different unlabeled cholesterol concentrations was also evaluated. The data from these experiments is set forth, below, in Table 6.
Cells:
[0226] A. CHO cells stably transfected with rat or mouse NPC1L1 cDNA B. CHO background (no transfection) C. SR-B1 transfected CHO cells
[0227] Cells seeded at 500,000 cells/well (mL) in 12-well plates.
Procedure:
[0228] All reagents and culture plates were maintained at 37° C. unless otherwise noted.
[0229] Starve. The maintenance media (F12 HAMS, 1% Pen/Strep, 10% FCS) was removed and the cells were rinsed with serum-free HAMS media. The serum-free media was then replaced with 1 mL "starve" media (F12 HAMS, Pen/Strep, 5% lipoprotein deficient serum (LPDS). The cells were then starved overnight.
[0230] Pre-Incubation/pre-dose. Media was removed from all plates and replaced with fresh starve media and preincubated for 30 minutes. Half of the wells received media containing ezetimibe (stock soln in EtOH; final conc.=10 μM).
[0231] 3H-Cholesterol Pulse. The following was added directly to each well: [0232] 0.5 μCi 3H-cholesterol (˜1.1×106 dpm/well) in 50 μl of a mixed bile salt micelle [0233] 4.8 mM sodium taurocholate (2.581 mg/mL) [0234] 0.6 mM sodium oleate (0.183 mg/mL) [0235] 0.25 mM cholesterol (0.1 mg/mL) [0236] Dispersed in "starve" media by ultrasonic vibration [0237] Final media cholesterol concentration=5 μg/mL
[0238] Labeled cholesterol pulse time points were 4, 12, 24 minutes and 4 hours. Triplicate wells were prepared for each treatment.
[0239] Wash. At designated times, media was aspirated and cells were washed once with Hobbs Buffer A (50 mM Tris, 0.9% NaCl, 0.2% bovine serum albumin (BSA), pH 7.4) and once with Hobbs Buffer B (50 mM Tris, 0.9% NaCl, pH 7.4 (no BSA)) at 37° C.
[0240] Processing/Analysis.
A. 4, 12, 24 minute time points: Cells were digested overnight with 0.2N NaOH, 2 mL/well, room temperature. One 1.5 mL aliquot was removed from each well, neutralized & counted for radioactivity by scintillation counting. B. 4 hour time point: The digested cells were analyzed by thin-layer chromatography to determine the content of cholesterol ester in the cells.
[0241] Extracts were spotted onto TLC plates and run for 30 minutes in 2 ml hexane:isopropanol (3:2) mobile phase for 30 minutes, followed by a second run in 1 ml hexane:isopropanol (3:2) mobile phase for 15 minutes.
C. Protein determination of cell extracts. Plates containing a sample of the cell extracts were placed on orbital shaker at 120 rpm for indicated times and then extracts are pooled into 12×75 tubes. Plates were dried and NaOH (2 ml/well) added. The protein content of the samples were then determined. Two additional 50 μl aliquots from all wells were assayed for total protein by the Pierce micro BCA method. The quantity of labeled cholesterol observed in the cells was normalized to the quantity of protein in the cells.
TABLE-US-00008 TABLE 4 Total Cholesterol in Transfected CHO Cells in the Presence and Absence of Ezetimibe. Total Cholesterol, dpm ± sem Total Cholesterol, dpm/mg protein ± sem Clones: Vehicle EZ (10 μM) Vehicle EZ (10 μM) 4 Min Pulse CHO Control 3413 ± 417 3222 ± 26 33443 ± 4070 31881 ± 483 SR-BI 14207 ± 51 10968 ± 821 118242 ± 1261 92474 ± 2902 mNPC1L1(C7) 4043 ± 419 4569 ± 222 30169 ± 3242 30916 ± 1137 rNPC1L1(C21) 3283 ± 288 3769 ± 147 23728 ± 2111 27098 ± 689 rNPC1L1(C17) 3188 ± 232 3676 ± 134 24000 ± 832 28675 ± 527 rNPC1L1(C7) 1825 ± 806 3268 ± 121 15069 ± 6794 27285 ± 968 12 Min Pulse CHO Control 4710 ± 246 4532 ± 165 44208 ± 2702 43391 ± 1197 SR-BI 16970 ± 763 12349 ± 298 140105 ± 6523 98956 ± 4447 mNPC1L1(C7) 6316 ± 85 6120 ± 755 45133 ± 342 41712 ± 4054 rNPC1L1(C21) 5340 ± 12 4703 ± 231 40018 ± 1181 33985 ± 1928 rNPC1L1(C17) 4831 ± 431 4579 ± 257 37378 ± 3461 34063 ± 1619 rNPC1L1(C7) 4726 ± 272 4664 ± 63 39100 ± 2350 38581 ± 784 24 Min Pulse CHO Control 7367 ± 232 6678 ± 215 65843 ± 1281 61764 ± 2131 SR-BI 39166 ± 2152 23558 ± 1310 324126 ± 11848 198725 ± 11713 mNPC1L1(C7) 10616 ± 121 9749 ± 482 77222 ± 1040 74041 ± 3670 rNPC1L1(C21) 9940 ± 587 8760 ± 293 76356 ± 9618 66165 ± 2181 rNPC1L1(C17) 8728 ± 721 8192 ± 237 70509 ± 5189 62279 ± 4352 rNPC1L1(C7) 8537 ± 148 7829 ± 204 72134 ± 1305 63482 ± 368 EZ = ezetimibe
TABLE-US-00009 TABLE 5 Cholesterol Ester in CHO cells in the Presence or Absence of Ezetimibe. Cholesteryl Ester, dpm ± sem Cholesteryl Ester, dpm/mg protein ± sem Vehicle EZ (10 μM) Vehicle EZ (10 μM) Clones: 4 Hour Pulse CHO Control 652 ± 13 208 ± 9 5647 ± 55 1902 ± 87 SR-BI 47608 ± 1292 9305 ± 401 391067 ± 14391 72782 ± 3181 mNPC1L1(C7) 732 ± 127 453 ± 118 4994 ± 827 3057 ± 776 rNPC1L1(C21) 2667 ± 90 454 ± 33 18655 ± 1032 3193 ± 265 rNPC1L1(C17) 751 ± 74 202 ± 10 5379 ± 481 1510 ± 62 rNPC1L1(C7) 462 ± 25 191 ± 54 3597 ± 193 1496 ± 403 Free Cholesterol, dpm ± sem Free Cholesterol, dpm/mg protein ± sem Vehicle EZ (10 μM) Vehicle EZ (10 μM) 4 Hour Pulse CHO Control 61612 ± 1227 56792 ± 568 533876 ± 17770 519607 ± 16203 SR-BI 214678 ± 4241 194519 ± 474 1762873 ± 46607 1521341 ± 4185 mNPC1L1(C7) 79628 ± 793 77516 ± 1910 544661 ± 1269 523803 ± 10386 rNPC1L1(C21) 71352 ± 1343 69106 ± 711 498016 ± 8171 485460 ± 4410 rNPC1L1(C17) 78956 ± 3782 71646 ± 446 566456 ± 29204 536651 ± 7146 rNPC1L1(C7) 75348 ± 2093 70628 ± 212 586127 ± 13932 556855 ± 7481 EZ = ezetimibe
TABLE-US-00010 TABLE 6 Uptake of labeled cholesterol in the presence of increasing amounts of unlabeled cholesterol. Total Cholesterol, dpm ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) Cold Cholesterol 24 Min Pulse 3 μg/mL 12271 ± 430 49603 ± 2428 14250 ± 1628 10656 ± 1233 10 μg/mL 16282 ± 2438 79967 ± 8151 25465 ± 3037 13225 ± 4556 30 μg/mL 14758 ± 1607 71925 ± 3863 19001 ± 1530 13218 ± 1149 100 μg/mL 16458 ± 1614 58185 ± 4548 15973 ± 1665 11560 ± 1132 Cholesteryl Ester, dpm ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 4 Hour Pulse 3 μg/mL 2737 ± 114 39596 ± 1241 1561 ± 1 4015 ± 47 10 μg/mL 1646 ± 76 17292 ± 362 998 ± 36 1866 ± 33 30 μg/mL 970 ± 46 6642 ± 153 537 ± 82 970 ± 9 100 μg/mL 895 ± 156 4777 ± 27 405 ± 7 777 ± 16 Free Cholesterol, dpm ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 4 Hour Pulse 3 μg/mL 89013 ± 3724 211783 ± 3268 104343 ± 2112 92244 ± 987 10 μg/mL 136396 ± 8566 278216 ± 10901 196173 ± 4721 125144 ± 877 30 μg/mL 131745 ± 2922 224429 ± 2556 149172 ± 19689 117143 ± 4976 100 μg/mL 79336 ± 4011 231470 ± 4221 114599 ± 2803 93538 ± 1588 Cholesteryl Ester, dpm ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 24 Hour Pulse 3 μg/mL 57373 ± 2704 162296 ± 1644 22986 ± 940 59377 ± 953 10 μg/mL 33730 ± 1296 112815 ± 373 14836 ± 552 31797 ± 525 30 μg/mL 19193 ± 100 58668 ± 1413 8878 ± 355 18963 ± 380 100 μg/mL 16761 ± 398 31280 ± 1270 8784 ± 946 14933 ± 311 Free Cholesterol, dpm ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 24 Hour Pulse 3 μg/mL 248985 ± 4207 357819 ± 4519 285610 ± 5187 227244 ± 1016 10 μg/mL 231208 ± 8927 269822 ± 5872 311777 ± 8227 231666 ± 6198 30 μg/mL 203566 ± 6008 225273 ± 5932 279604 ± 6612 209372 ± 3386 100 μg/mL 178424 ± 2379 167082 ± 2211 229832 ± 4199 182678 ± 7709 Total Cholesterol, dpm/mg protein ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) Cold Cholesterol 24 Min Pulse 3 μg/mL 108936 ± 5413 541562 ± 13785 140764 ± 14433 94945 ± 12916 10 μg/mL 151283 ± 23345 880224 ± 82254 250985 ± 27481 123433 ± 34092 30 μg/mL 135109 ± 12106 796236 ± 18952 180436 ± 12112 111522 ± 6941 100 μg/mL 149559 ± 17977 630143 ± 3718 147717 ± 8261 101328 ± 7191 Cholesteryl Ester, dpm/mg protein ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 4 Hour Pulse 3 μg/mL 22050 ± 978 382641 ± 5955 13684 ± 217 32020 ± 641 10 μg/mL 13323 ± 606 157914 ± 3400 8917 ± 467 14849 ± 127 30 μg/mL 7627 ± 325 63547 ± 1760 4885 ± 748 7741 ± 100 100 μg/mL 7135 ± 1230 45088 ± 1526 3663 ± 68 6005 ± 198 Free Cholesterol, dpm/mg protein ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 4 Hour Pulse 3 μg/mL 717308 ± 34130 2047695 ± 16213 914107 ± 5869 735498 ± 11209 10 μg/mL 1105118 ± 76074 2540130 ± 92471 1753072 ± 86578 996824 ± 27850 30 μg/mL 1036195 ± 21142 2149315 ± 78068 1357136 ± 180264 934772 ± 43202 100 μg/mL 632965 ± 29756 2182022 ± 36793 1035979 ± 30329 723225 ± 21694 Cholesteryl Ester, dpm/mg protein ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 24 Hour Pulse 3 μg/mL 357629 ± 14639 1248900 ± 18565 160328 ± 6565 401315 ± 5557 10 μg/mL 215004 ± 5942 830231 ± 12764 98594 ± 4205 200451 ± 5239 30 μg/mL 122071 ± 1271 446581 ± 3472 59091 ± 2697 119728 ± 2131 100 μg/mL 103235 ± 1739 272796 ± 13392 60670 ± 4597 96215 ± 1023 Free Cholesterol, dpm/mg protein ± sem CHO Control SR-BI mNPC1L1(C7) rNPC1L1(C21) 24 Hour Pulse 3 μg/mL 1552637 ± 18954 2752957 ± 24984 1993256 ± 56968 1536023 ± 10304 10 μg/mL 1477414 ± 85954 1984473 ± 18420 2069980 ± 25517 1461157 ± 58517 30 μg/mL 1294878 ± 41819 1716066 ± 52581 1859476 ± 29507 1321730 ± 5452 100 μg/mL 1099648 ± 25160 1455799 ± 9885 1599244 ± 76938 1177546 ± 51191
Example 20
Labeled Cholesterol Uptake Assay
[0242] In this example, the ability of CHO cells transiently transfected with rat NPC1L1 or mouse SR-B1 to take up labeled cholesterol was evaluated. Also evaluated was the ability of rat NPC1L1 to potentiate the ability of CHO cells transfected with mouse SR-B1 to take up labeled cholesterol. In these assays, cholesterol uptake, at a single concentration, was evaluated in pulse-chase experiments. The data generated in these experiments are set forth, below, in Table 7.
Cells:
[0243] A. CHO background cells (mock transfection). B. CHO cells transiently transfected with mouse SR-B1. C. CHO transiently transfected with rat NPC1L1 cDNAs (n=8 clones). Transiently transfected cells were seeded at 300,000 cells/well (mL) in 12-well plates.
Procedure:
[0244] All reagents and culture plates were maintained at 37° C. unless otherwise noted.
[0245] Starve. The maintenance media (F12 HAMS, 1% Pen/Strep, 10% FCS) was removed from the cells and replaced with 1 mL "starve" media (F12 HAMS, Pen/Strep, 5% lipoprotein deficient serum (LPDS). Cells were starved for 1 hour.
[0246] 3H-Cholesterol Pulse. The following was added directly to each well. [0247] 0.5 μCi 3H-cholesterol (˜1.1×106 dpm/well) in 50 μl of a mixed bile salt micelle. [0248] 4.8 mM sodium taurocholate (2.581 mg/mL) [0249] 0.6 mM sodium oleate (0.183 mg/mL) [0250] 0.25 mM cholesterol (0.1 mg/mL) [0251] Dispersed in "starve" media by ultrasonic vibration [0252] Final media cholesterol concentration=5 μg/mL
[0253] Labeled cholesterol pulse time points were 24 Min and 4 hours. Triplicate wells for each treatment.
[0254] Wash. At the designated times, media was aspirated and cells were washed once with Hobbs Buffer A (50 mM Tris, 0.9% NaCl, 0.2% BSA, pH 7.4) and once with Hobbs Buffer B (50 mM Tris, 0.9% NaCl, pH 7.4 (no BSA)) at 37° C.
[0255] Processing/Analysis.
A. 24 minute time point: Cells were digested overnight with 0.2N NaOH, 2 mL/well at room temp. One, 1.5 mL aliquot was removed from each well, neutralized & counted for radioactivity by scintillation counting. B. 4 hour time point: The digested cells were analyzed by thin-layer chromatography to determine the content of cholesterol ester in the cells.
[0256] The extracts were spotted onto thin layer chromatography plates and run in 2 ml hexane:isopropanol (3:2) containing mobile phase for 30 minutes, followed by a second run in 1 ml hexane:isopropanol (3:2) containing mobile phase for 15 min.
C. Protein determination of cell extracts: Plates containing a sample of the cell extracts were placed on orbital shaker at 120 rpm for indicated times and then extracts are pooled into 12×75 tubes. Plates were dried and NaOH (2 ml/well) added. The protein content of the samples were then determined. Two additional 50 μl aliquots from all wells were assayed for total protein by the Pierce micro BCA method. The quantity of labeled cholesterol observed in the cells was normalized to the quantity of protein in the cells.
TABLE-US-00011 TABLE 7 Labeled cholesterol uptake in transiently transfected CHO cells. Total Cholesterol, ± sem dpm dpm/mg protein Transfection 24 Min Pulse CHO Control (mock) 4721 ± 436 49024 ± 4328 SR-BI(Transient) 5842 ± 82 59445 ± 1099 NPC1L1 (Transient) 4092 ± 377 47026 ± 2658 SR-BI/NPC1L1 (trans) 3833 ± 158 52132 ± 3071 Cholesteryl Ester, ± sem dpm dpm/mg protein 4 Hour Pulse CHO Control (mock) 2132 ± 40 20497 ± 640 SR-BI(Transient) 5918 ± 237 51812 ± 1417 NPC1L1 (Transient) 1944 ± 93 19788 ± 642 SR-BI/NPC1L1 (trans) 4747 ± 39 58603 ± 1156 Free Cholesterol, ± sem dpm dpm/mg protein 4 Hour Pulse CHO Control (mock) 45729 ± 328 439346 ± 5389 SR-BI(Transient) 50820 ± 2369 444551 ± 9785 NPC1L1 (Transient) 39913 ± 1211 406615 ± 6820 SR-BI/NPC1L1 (trans) 37269 ± 1225 459509 ± 6195
Example 21
Expression of Rat, Mouse and Human NPC1L1
[0257] In this example, NPC1L1 was introduced into cells and expressed. Species specific NPC1L1 expression constructs were cloned into the plasmid pcDNA3 using clone specific PCR primers to generate the ORF flanked by appropriate restriction sites compatible with the polylinker of the vector. For all three species of NPC1L1, small intestine total tissue RNA was used as a template for reverse transcriptase-polymerase chain reaction (RT-PCR) using oligo dT as the template primer. The rat NPC1L1 was cloned as an EcoRI fragment, human NPC1L1 was cloned as a XbaI/NotI fragment and mouse NPC1L1 was cloned as an EcoRI fragment. Forward and reverse strand sequencing of each clone was performed to confirm sequence integrity. Standard transient transfection procedures were used with CHO cells. In a 6-well plate CHO cells were plated 1 day before transfection at a plating density of 2×105 cells/well. The following day, cells were incubated with 2 μg plasmid DNA and 6 μL Lipofectamine for 5 hours followed a fresh media change. Forty-eight hours later, cells were analyzed for NPC1L1 expression using anti-NPC1L1 antisera by either FACS or western blot. To establish stable long term cell lines expressing NPC1L1, transfected CHO cells were selected in the presence of geneticin (G418, 0.8 mg/ml) as recommended by the manufacturer (Life Technologies). Following one month of selection in culture, the cell population was stained with anti-NPC1L1 antisera and sorted by FACS. Individual positive staining cells were cloned after isolation by limiting dilution and then maintained in selective media containing geneticin (0.5 mg/ml).
[0258] Other cell types less susceptible to transfection procedures have been generated using adenoviral vector systems. This system used to express NPC1L1 is dervied from Ad 5, a type C adenovirus. This recombinant replication-defective adenoviral vector is made defective through modifications of the E1, E2 and E4 regions. The vector also has additional modifications to the E3 region generally affecting the E3b region genes RIDa and RIDb. NPC1L1 expression was driven using the CMV promoter as an expression cassette substituted in the E3 region of the adenovirus. Rat and mouse NPC1L1 were amplified using clone specific primers flanked by restriction sites compatible with the adenovirus vector Adenovirus infective particles were produced from 293-D22 cells in titers of 5×1010 P/mL. Viral lysates were used to infect cells resistant to standard transfection methodologies. In Caco2 cells, which are highly resistant to heterologous protein expression, adenovirus mediated expression of NPC1L1 has been shown by western blot analysis to persist at least 21 days post-infection.
Example 22
NPC1L1 Knock-Out Transgenic Mouse
[0259] NPC1L1 knockout mice were constructed via targeted mutagenesis. This methodology utilized a targeting construct designed to delete a specific region of the mouse NPC1L1 gene. During the targeting process the E. coli lacZ reporter gene was inserted under the control of the endogenous NPC1L1 promoter. The region in NPC1L1 (SEQ ID NO: 45) being deleted is from nucleotide 790 to nucleotide 998. The targeting vector contains the LacZ-Neo cassette flanked by 1.9 kb 5' arm ending with nucleotide 789 and a 3.2 kb 3' arm starting with nucleotide 999. Genomic DNA from the recombinant embryonic stem cell line was assayed for homologous recombination using PCR. Amplified DNA fragments were visualized by agarose gel electrophoresis. The test PCRs employed a gene specific primer, which lies outside of and adjacent to the targeting vector arm, paired with one of three primers specific to the LacZ-Neo cassette sequence. For 5' PCR reconfirmation, the NPC1L1 specific oligonucleotide ATGTTAGGTGAGTCTGAACCTACCC (SEQ ID NO: 46) and for 3'PCR reconfirmation the NPC1L1 specific oligonucleotide GGATTGCATTTCCTTCAA GAAAGCC (SEQ ID NO: 47) were used. Genotyping of the F2 mice was performed by multiplex PCR using the NPC1L1 specific forward primer TATGGCTCTGCCC TCTGCAATGCTC (SEQ ID NO: 48) the LacZ-Neo cassette specific forward primer TCAGCAGCCTCTGTTCCACATACACTTC (SEQ ID NO: 49) in combination with the NPC1L1 gene specific reverse primer GTTCCACAGGGTCTGTGGTGAGTTC (SEQ ID NO: 50) allowed for determination of both the targeted and endogenous alleles. Analysis of the PCR products by agarose gel electrophoresis distinguished the wild-type, heterozygote and homozygote null mouse from each other.
Example 23
Acute Cholesterol Absorption in NPC1L1-Deficient Mice
[0260] To determine whether NPC1L1 plays a role in cholesterol absorption, NPC1L1 deficient mice were studied.
[0261] Mice deficient in NPC1L1 (-/-) were generated by breeding heterozygote mice (+/) to obtain wild-type (+/+) and NPC1L1 deficient mice (-/-). Non-fasted mice (6.5-9 weeks old, mixed 129 and C57BL/6 background) were weighed and grouped (n=2-/- and n=4+/+). All animals were gavaged (Feeding needles, 24G×1 inch, Popper and Sons, NY) with 0.1 ml corn oil (Sigma; St. Louis, Mo.) containing 1 μCi 14C-cholesterol (New England Nuclear, [4-14C] Cholesterol, NEC-018) and 0.1 mg carrier cholesterol mass (Sigma; St. Louis, Mo.). Two hours later, blood was collected by heart puncture. The liver was removed, weighed, and three samples were placed into 20 ml counting vials. Tissues were digested in 1 ml of 1N NaOH at 60° C. overnight. The tissue digests were acidified by addition of 250 μl of 4N HCl prior to liquid scintillation counting (LSC). Plasma was isolated by centrifugation at 10,000 rpm for 5 minutes in a microfuge and duplicate 100 μl aliquots of plasma were taken for LSC.
[0262] Cholesterol absorption, evaluated by this acute technique and expressed as the total amount of radioactive cholesterol in the plasma and liver, demonstrated that the wild type mice (+/+) absorbed an average of 11,773 dpm and NPC1L1 deficient mice absorbed 992 dpm of the 14C-cholesterol. These results indicate that the NPC1L1 deficient mice have a 92% reduction in cholesterol absorption. These data confirm the role of NPC1L1 in intestinal cholesterol absorption. Inhibition of NPC1L1-mediated cholesterol absorption, in a subject, by administering NPC1L1 antagonists, such as ezetimibe, to the subject, are a useful way to reduce serum cholesterol levels and the occurrence of atherosclerosis in the subject.
Example 24
Cholesterol Absorption in NPC1L1 (NPC3) Knockout Mice (Fecal Ratio Method: Cholesterol/Sitostanol)
[0263] In this example, cholesterol absorption and the activity of ezetimibe was determined in the NPC1L1 knockout mice (-/-), heterozygous mice (+/-), and age matched wild-type mice (+/+).
[0264] Cholesterol absorption in the mice was determined by the dual fecal isotope ratio method as described by Altmann et al. (Biochim. Biophys. Acta. 1580(1):77-93 (2002)). Mice (n=4-6/group) were fed a standard rodent chow diet and in some groups treated daily with a maximally effective dose of ezetimibe (10 mg/kg). Mice were gavaged with 14C-cholesterol (1 μCi, 0.1 mg unlabeled cholesterol) and 3H-sitostanol (2 μCi) in 0.1 ml corn oil. Feces were collected for 2 days and fecal 14C-cholesterol and 3H-sitostanol levels were determined by combustion in a Packard Oxidizer. The fraction of cholesterol absorbed, as evaluated by the fecal dual isotope technique, was similar in wild type (+/+) and heterozygous mice (+/-) fed a chow diet (heterozygous mice absorbed 46±5% and age matched wild type mice absorbed 51±3% of the dose of 14C-cholesterol). The NPC1L1 knockout mice (-/-) absorbed 15.6±0.4% of the 14C-cholesterol, which was similar to the wild type mice treated with a maximally effective dose of ezetimibe (16.1±0.3%), and reduced by 69% compared to wild type mice (p<0.001). In NPC1L1 knockout treated with ezetimibe at 10 mg/kg/day, cholesterol absorption was similar to that seen in the untreated knockout mice (16.2±0.6% compared to 15.6%±0.4%, respectively). Thus, the majority of cholesterol absorption is dependent on the presence of NPC1L1 and the residual cholesterol absorption in mice lacking NPC1L1 is insensitive to ezetimibe treatment. These results indicate that NPC1L1 is involved in the small intestinal enterocyte uptake and absorption of cholesterol and is in the ezetimibe sensitive pathway.
Example 25
Mouse Screening Assay (Acute Cholesterol Absorption)
[0265] The following screening assay is used to identify the presence of an NPC1L1 antagonist in a sample.
[0266] Mice deficient in NPC1L1 (-/-) are generated by breeding heterozygote mice (+/) to obtain wild-type (+/+) and NPC1L1 deficient mice (-/-).
[0267] In a first set of experiments, non-fasted mice (6.5-9 weeks old, mixed 129 and C57BL/6 background) are weighed and grouped (n=˜1 to 4-/- and n=1 to 4+/+). All animals are gavaged (Feeding needles, 24G×1 inch, Popper and Sons, NY) with 0.1 ml corn oil (Sigma; St. Louis, Mo.) containing 1 μCi 14C-cholesterol (New England Nuclear, [4-14C] Cholesterol, NEC-018) and 0.1 mg carrier cholesterol mass (Sigma; St. Louis, Mo.).
[0268] In another set of experiments, 1 to 4 wild-type NPC1L1 mice (+/+) are treated identically to the mice in the first set of experiments, above, except that the mice are additionally fed a sample to be tested for the presence of an NPC1L1 antagonist.
[0269] Two hours later, blood is collected from each mouse by heart puncture. The liver is removed, weighed, and three samples are placed into 20 ml counting vials. Tissues are digested in 1 ml of 1N NaOH at 60° C. overnight. The tissue digests are acidified by addition of 250 μl of 4N HCl prior to liquid scintillation counting (LSC). Plasma is isolated by centrifugation at 10,000 rpm for 5 minutes in a microfuge and duplicate 100 μl aliquots of plasma are taken for LSC.
[0270] Cholesterol absorption, evaluated by this acute technique is expressed as the total amount of radioactive cholesterol in the plasma and liver. The sample tested is determined to contain an NPC1L1 antagonist when the level of cholesterol absorption (as measured by the above described methods) in the wild-type NPC1L1 mouse (+/+) which was fed the sample and in the NPC1L1 deficient mouse (-/-) are less than the amount of cholesterol absorption in the wild-type NPC1L1 mouse (+/+) which was not fed the sample.
Example 26
Mouse Screening Assay (Fecal Ratio Method: Cholesterol/Sitostanol)
[0271] The following screening assay is used to identify the presence of an NPC1L1 antagonist in a sample.
[0272] Cholesterol absorption in the mice is determined by the dual fecal isotope ratio method as described by Altmann et al. (Biochim. Biophys. Acta. 1580(1):77-93 (2002)).
[0273] Three groups of mice (n=1-6/group) are assembled. Two separate groups comprise wild-type NPC1L1 mice (+/+) and one group comprises NPC1L1 deficient mice (-/-).
[0274] Each group is fed a standard rodent chow diet and in some groups treated daily. Mice are gavaged with 14C-cholesterol (1 μCi, 0.1 mg unlabeled cholesterol) and 3H-sitostanol (2 μCi) in 0.1 ml corn oil. One group of mice, which comprise wild-type NPC1L1 mice (+/+) are further fed a sample to be tested for the presence of an NPC1L1 antagonist. Feces are collected for 2 days and fecal 14C-cholesterol and 3H-sitostanol levels are determined by combustion in a Packard Oxidizer.
[0275] The sample tested is determined to contain an NPC1L1 antagonist when the level of cholesterol and/or sitostanol absorption (as measured by the above described methods) in the wild-type NPC1L1 mouse (+/+) which was fed the sample and in the NPC1L1 deficient mouse (-/-) are less than the amount of cholesterol and/or sitostanol absorption in the wild-type NPC1L1 mouse (+/+) which was not fed the sample.
[0276] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
[0277] Patents, patent applications, publications, product descriptions, Genbank Accession Numbers and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.
Sequence CWU
1
5113996DNARattus sp.CDS(1)..(3996) 1atg gca gct gcc tgg ctg gga tgg ctg
ctc tgg gcc ctg ctc ctg agc 48Met Ala Ala Ala Trp Leu Gly Trp Leu
Leu Trp Ala Leu Leu Leu Ser1 5 10
15gcg gcc cag ggt gag cta tac aca ccc aaa cac gaa gct ggg gtc
tgc 96Ala Ala Gln Gly Glu Leu Tyr Thr Pro Lys His Glu Ala Gly Val
Cys 20 25 30acc ttt tac gaa
gag tgc ggg aaa aac cca gag ctc tct gga ggc ctc 144Thr Phe Tyr Glu
Glu Cys Gly Lys Asn Pro Glu Leu Ser Gly Gly Leu 35
40 45acg tca cta tcc aat gta tcc tgc ctg tct aac acc
ccg gcc cgc cac 192Thr Ser Leu Ser Asn Val Ser Cys Leu Ser Asn Thr
Pro Ala Arg His 50 55 60gtc acg ggt
gaa cac ctg gct ctt ctc cag cgc atc tgt ccc cgc ctg 240Val Thr Gly
Glu His Leu Ala Leu Leu Gln Arg Ile Cys Pro Arg Leu65 70
75 80tac aac ggc ccc aat acc act ttt
gcc tgt tgc tct acc aag cag ctg 288Tyr Asn Gly Pro Asn Thr Thr Phe
Ala Cys Cys Ser Thr Lys Gln Leu 85 90
95ctg tcc tta gaa agc agc atg tcc atc acc aag gcc ctt ctc
acg cgc 336Leu Ser Leu Glu Ser Ser Met Ser Ile Thr Lys Ala Leu Leu
Thr Arg 100 105 110tgc ccg gcc
tgc tct gac aat ttt gtg agc tta cac tgc cac aac act 384Cys Pro Ala
Cys Ser Asp Asn Phe Val Ser Leu His Cys His Asn Thr 115
120 125tgc agc cct gac cag agc ctc ttc atc aac gtc
acc cgg gtg gtt gag 432Cys Ser Pro Asp Gln Ser Leu Phe Ile Asn Val
Thr Arg Val Val Glu 130 135 140cgg ggc
gct gga gag cct cct gcc gtg gtg gcc tat gag gcc ttt tat 480Arg Gly
Ala Gly Glu Pro Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr145
150 155 160cag cgc agc ttt gct gag aag
gcc tat gag tcc tgc agc cag gtg cgc 528Gln Arg Ser Phe Ala Glu Lys
Ala Tyr Glu Ser Cys Ser Gln Val Arg 165
170 175atc cct gcg gcc gct tcc ttg gcc gtg ggc agc atg
tgt gga gtg tat 576Ile Pro Ala Ala Ala Ser Leu Ala Val Gly Ser Met
Cys Gly Val Tyr 180 185 190ggc
tcc gcc ctc tgc aat gct cag cgc tgg ctc aac ttc caa gga gac 624Gly
Ser Ala Leu Cys Asn Ala Gln Arg Trp Leu Asn Phe Gln Gly Asp 195
200 205aca ggg aat ggc ctg gct ccg ctg gat
atc acc ttc cac ctc ttg gag 672Thr Gly Asn Gly Leu Ala Pro Leu Asp
Ile Thr Phe His Leu Leu Glu 210 215
220cct ggc cag gcc cta ccg gat ggg atc cag cca ctg aat ggg aag atc
720Pro Gly Gln Ala Leu Pro Asp Gly Ile Gln Pro Leu Asn Gly Lys Ile225
230 235 240gca ccc tgc aac
gag tct cag ggt gat gac tca gca gtc tgc tcc tgc 768Ala Pro Cys Asn
Glu Ser Gln Gly Asp Asp Ser Ala Val Cys Ser Cys 245
250 255cag gac tgt gcg gcg tcc tgc cct gtc atc
cct ccg ccc gag gcc ttg 816Gln Asp Cys Ala Ala Ser Cys Pro Val Ile
Pro Pro Pro Glu Ala Leu 260 265
270cgc cct tcc ttc tac atg ggt cgc atg cca ggc tgg ctg gcc ctc atc
864Arg Pro Ser Phe Tyr Met Gly Arg Met Pro Gly Trp Leu Ala Leu Ile
275 280 285atc atc ttc act gct gtc ttt
gtg ttg ctc tct gca gtc ctt gtg cgt 912Ile Ile Phe Thr Ala Val Phe
Val Leu Leu Ser Ala Val Leu Val Arg 290 295
300ctc cga gtg gtt tcc aac agg aac aag aac aag gca gaa ggc ccc cag
960Leu Arg Val Val Ser Asn Arg Asn Lys Asn Lys Ala Glu Gly Pro Gln305
310 315 320gaa gcc ccc aaa
ctc cct cat aag cac aaa ctc tca ccc cat acc atc 1008Glu Ala Pro Lys
Leu Pro His Lys His Lys Leu Ser Pro His Thr Ile 325
330 335ctg ggc cgg ttc ttc cag aac tgg ggc aca
agg gtg gcc tcg tgg cca 1056Leu Gly Arg Phe Phe Gln Asn Trp Gly Thr
Arg Val Ala Ser Trp Pro 340 345
350ctc acc gtc tta gca ctg tcc ttc atc gtt gtg ata gcc tta gca gca
1104Leu Thr Val Leu Ala Leu Ser Phe Ile Val Val Ile Ala Leu Ala Ala
355 360 365ggc ctg acc ttt att gaa ctc
acc aca gac cct gtg gaa ctg tgg tcg 1152Gly Leu Thr Phe Ile Glu Leu
Thr Thr Asp Pro Val Glu Leu Trp Ser 370 375
380gcc ccc aag agc cag gcc cgg aaa gag aag tct ttc cat gat gag cat
1200Ala Pro Lys Ser Gln Ala Arg Lys Glu Lys Ser Phe His Asp Glu His385
390 395 400ttc ggc ccc ttc
ttt cga acc aac cag att ttc gtg aca gct cgg aac 1248Phe Gly Pro Phe
Phe Arg Thr Asn Gln Ile Phe Val Thr Ala Arg Asn 405
410 415agg tcc agc tac aag tac gac tcc cta ctg
cta ggg tcc aag aac ttc 1296Arg Ser Ser Tyr Lys Tyr Asp Ser Leu Leu
Leu Gly Ser Lys Asn Phe 420 425
430agt ggg atc ctg tcc ctg gac ttc ctg ctg gag ctg ctg gag ctt cag
1344Ser Gly Ile Leu Ser Leu Asp Phe Leu Leu Glu Leu Leu Glu Leu Gln
435 440 445gag agg ctt cga cac ctg caa
gtg tgg tcc cct gag gca gag cgc aac 1392Glu Arg Leu Arg His Leu Gln
Val Trp Ser Pro Glu Ala Glu Arg Asn 450 455
460atc tcc ctc cag gac atc tgc tat gcc ccc ctc aac cca tat aac acc
1440Ile Ser Leu Gln Asp Ile Cys Tyr Ala Pro Leu Asn Pro Tyr Asn Thr465
470 475 480agc ctc tcc gac
tgc tgt gtc aac agc ctc ctt cag tac ttc cag aac 1488Ser Leu Ser Asp
Cys Cys Val Asn Ser Leu Leu Gln Tyr Phe Gln Asn 485
490 495aac cgc acc ctc ctg atg ctc acg gcc aac
cag act ctg aat ggc cag 1536Asn Arg Thr Leu Leu Met Leu Thr Ala Asn
Gln Thr Leu Asn Gly Gln 500 505
510acc tcc ctg gtg gac tgg aag gac cat ttc ctc tac tgt gca aat gcc
1584Thr Ser Leu Val Asp Trp Lys Asp His Phe Leu Tyr Cys Ala Asn Ala
515 520 525cct ctc acg ttc aaa gat ggc
acg tct ctg gcc ctg agc tgc atg gct 1632Pro Leu Thr Phe Lys Asp Gly
Thr Ser Leu Ala Leu Ser Cys Met Ala 530 535
540gac tac ggg gct cct gtc ttc ccc ttc ctt gct gtt ggg gga tac caa
1680Asp Tyr Gly Ala Pro Val Phe Pro Phe Leu Ala Val Gly Gly Tyr Gln545
550 555 560ggc acg gac tat
tcc gag gca gaa gcg ctg atc ata acc ttc tct ctc 1728Gly Thr Asp Tyr
Ser Glu Ala Glu Ala Leu Ile Ile Thr Phe Ser Leu 565
570 575aat aac tac ccc gct gat gat ccc cgc atg
gcc cag gcc aag ctc tgg 1776Asn Asn Tyr Pro Ala Asp Asp Pro Arg Met
Ala Gln Ala Lys Leu Trp 580 585
590gag gag gct ttc ttg aag gaa atg gaa tcc ttc cag agg aac aca agt
1824Glu Glu Ala Phe Leu Lys Glu Met Glu Ser Phe Gln Arg Asn Thr Ser
595 600 605gac aag ttc cag gtt gcg ttc
tca gct gag cgc tct ctg gag gat gag 1872Asp Lys Phe Gln Val Ala Phe
Ser Ala Glu Arg Ser Leu Glu Asp Glu 610 615
620atc aac cgc acc acc atc cag gac ctg cct gtc ttt gcc gtc agc tac
1920Ile Asn Arg Thr Thr Ile Gln Asp Leu Pro Val Phe Ala Val Ser Tyr625
630 635 640att atc gtc ttc
ctg tac atc tcc ctg gcc ctg ggc agc tac tcc aga 1968Ile Ile Val Phe
Leu Tyr Ile Ser Leu Ala Leu Gly Ser Tyr Ser Arg 645
650 655tgc agc cga gta gcg gtg gag tcc aag gct
act ctg ggc cta ggt ggg 2016Cys Ser Arg Val Ala Val Glu Ser Lys Ala
Thr Leu Gly Leu Gly Gly 660 665
670gtg att gtt gtg ctg gga gca gtt ctg gct gcc atg ggc ttc tac tcc
2064Val Ile Val Val Leu Gly Ala Val Leu Ala Ala Met Gly Phe Tyr Ser
675 680 685tac ctg ggt gtc ccc tct tct
ctg gtt atc atc caa gtg gta cct ttc 2112Tyr Leu Gly Val Pro Ser Ser
Leu Val Ile Ile Gln Val Val Pro Phe 690 695
700ctg gtg cta gct gtg gga gct gac aac atc ttc atc ttt gtt ctt gag
2160Leu Val Leu Ala Val Gly Ala Asp Asn Ile Phe Ile Phe Val Leu Glu705
710 715 720tac cag agg cta
cct agg atg cct ggg gaa cag cga gag gct cac att 2208Tyr Gln Arg Leu
Pro Arg Met Pro Gly Glu Gln Arg Glu Ala His Ile 725
730 735ggc cgc acc ctg ggc agt gtg gcc ccc agc
atg ctg ctg tgc agc ctc 2256Gly Arg Thr Leu Gly Ser Val Ala Pro Ser
Met Leu Leu Cys Ser Leu 740 745
750tct gag gcc atc tgc ttc ttt cta ggg gcc ctg acc ccc atg cca gct
2304Ser Glu Ala Ile Cys Phe Phe Leu Gly Ala Leu Thr Pro Met Pro Ala
755 760 765gtg agg acc ttc gcc ttg acc
tct ggc tta gca att atc ctc gac ttc 2352Val Arg Thr Phe Ala Leu Thr
Ser Gly Leu Ala Ile Ile Leu Asp Phe 770 775
780ctg ctc cag atg act gcc ttt gtg gcc ctg ctc tcc ctg gat agc aag
2400Leu Leu Gln Met Thr Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys785
790 795 800agg cag gag gcc
tct cgc ccg gat gtc tta tgc tgc ttt tca acc cgg 2448Arg Gln Glu Ala
Ser Arg Pro Asp Val Leu Cys Cys Phe Ser Thr Arg 805
810 815aag ctg ccc cca cct aaa gaa aaa gaa ggc
ctc tta ctc cgc ttc ttc 2496Lys Leu Pro Pro Pro Lys Glu Lys Glu Gly
Leu Leu Leu Arg Phe Phe 820 825
830cgc aag ata tac gct cct ttc ctg ctg cac aga ttc atc cgc cct gtt
2544Arg Lys Ile Tyr Ala Pro Phe Leu Leu His Arg Phe Ile Arg Pro Val
835 840 845gtg atg ctg ctg ttt ctg acc
ctg ttt gga gca aat ctc tac tta atg 2592Val Met Leu Leu Phe Leu Thr
Leu Phe Gly Ala Asn Leu Tyr Leu Met 850 855
860tgc aac atc aac gtg ggg cta gac cag gag ctg gct ctg ccc aag gac
2640Cys Asn Ile Asn Val Gly Leu Asp Gln Glu Leu Ala Leu Pro Lys Asp865
870 875 880tcg tac ttg ata
gac tac ttc ctc ttt ctg aac cga tac ctt gaa gtg 2688Ser Tyr Leu Ile
Asp Tyr Phe Leu Phe Leu Asn Arg Tyr Leu Glu Val 885
890 895ggg cct cca gtg tac ttt gtc acc acc tcg
ggc ttc aac ttc tcc agc 2736Gly Pro Pro Val Tyr Phe Val Thr Thr Ser
Gly Phe Asn Phe Ser Ser 900 905
910gag gca ggc atg aac gcc act tgc tct agc gca ggc tgt aag agc ttc
2784Glu Ala Gly Met Asn Ala Thr Cys Ser Ser Ala Gly Cys Lys Ser Phe
915 920 925tcc cta acc cag aaa atc cag
tat gcc agt gaa ttc cct gac cag tct 2832Ser Leu Thr Gln Lys Ile Gln
Tyr Ala Ser Glu Phe Pro Asp Gln Ser 930 935
940tac gtg gct att gct gca tcc tcc tgg gta gat gac ttc atc gac tgg
2880Tyr Val Ala Ile Ala Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp945
950 955 960ctg acc ccg tcc
tcc tcc tgc tgt cgc ctt tat ata cgt ggc ccc cat 2928Leu Thr Pro Ser
Ser Ser Cys Cys Arg Leu Tyr Ile Arg Gly Pro His 965
970 975aag gat gag ttc tgt ccc tca acg gat act
tcc ttc aac tgc tta aaa 2976Lys Asp Glu Phe Cys Pro Ser Thr Asp Thr
Ser Phe Asn Cys Leu Lys 980 985
990aac tgc atg aac cgc act ctg ggt cct gtg agg ccc aca gcg gaa cag
3024Asn Cys Met Asn Arg Thr Leu Gly Pro Val Arg Pro Thr Ala Glu Gln
995 1000 1005ttt cat aag tac ctg ccc
tgg ttc ctg aat gat ccg ccc aat atc 3069Phe His Lys Tyr Leu Pro
Trp Phe Leu Asn Asp Pro Pro Asn Ile 1010 1015
1020aga tgt ccc aaa ggg ggt cta gca gcg tat aga acg tct gtg
aat 3114Arg Cys Pro Lys Gly Gly Leu Ala Ala Tyr Arg Thr Ser Val
Asn 1025 1030 1035ttg agc tca gat ggc
cag gtt ata gcc tcc cag ttc atg gcc tac 3159Leu Ser Ser Asp Gly
Gln Val Ile Ala Ser Gln Phe Met Ala Tyr 1040 1045
1050cac aag ccc tta agg aac tca cag gac ttc aca gaa gct
ctc cgg 3204His Lys Pro Leu Arg Asn Ser Gln Asp Phe Thr Glu Ala
Leu Arg 1055 1060 1065gcg tcc cgg ttg
cta gca gcc aac atc aca gct gac cta cgg aag 3249Ala Ser Arg Leu
Leu Ala Ala Asn Ile Thr Ala Asp Leu Arg Lys 1070
1075 1080gtg cct ggg aca gat cca aac ttt gag gtc ttc
cct tac acg atc 3294Val Pro Gly Thr Asp Pro Asn Phe Glu Val Phe
Pro Tyr Thr Ile 1085 1090 1095tcc aac
gtg ttc tac cag caa tac ctg acg gtc ctt cct gag gga 3339Ser Asn
Val Phe Tyr Gln Gln Tyr Leu Thr Val Leu Pro Glu Gly 1100
1105 1110atc ttc acc ctt gct ctt tgc ttt gtg ccc
acc ttt gtt gtc tgc 3384Ile Phe Thr Leu Ala Leu Cys Phe Val Pro
Thr Phe Val Val Cys 1115 1120 1125tac
ctc cta ctg ggc ctg gac atg tgc tca ggg atc ctc aac cta 3429Tyr
Leu Leu Leu Gly Leu Asp Met Cys Ser Gly Ile Leu Asn Leu 1130
1135 1140ctc tcc atc att atg att ctc gtg gac
acc att ggc ctc atg gct 3474Leu Ser Ile Ile Met Ile Leu Val Asp
Thr Ile Gly Leu Met Ala 1145 1150
1155gtg tgg ggt atc agc tat aat gcg gta tcc ctc atc aac ctt gtc
3519Val Trp Gly Ile Ser Tyr Asn Ala Val Ser Leu Ile Asn Leu Val
1160 1165 1170acg gca gtg ggc atg tct
gtg gag ttt gtg tcc cac atc act cgg 3564Thr Ala Val Gly Met Ser
Val Glu Phe Val Ser His Ile Thr Arg 1175 1180
1185tcc ttt gct gta agc acc aag cct acc cgg ctg gag agg gct
aaa 3609Ser Phe Ala Val Ser Thr Lys Pro Thr Arg Leu Glu Arg Ala
Lys 1190 1195 1200gat gct act gtc ttc
atg ggc agt gcg gtg ttt gct gga gtg gcc 3654Asp Ala Thr Val Phe
Met Gly Ser Ala Val Phe Ala Gly Val Ala 1205 1210
1215atg acc aac ttc cca ggc atc ctc atc ttg ggc ttt gcc
caa gcc 3699Met Thr Asn Phe Pro Gly Ile Leu Ile Leu Gly Phe Ala
Gln Ala 1220 1225 1230cag ctt att cag
atc ttc ttc ttc cgc ctc aac ctt ctg atc acc 3744Gln Leu Ile Gln
Ile Phe Phe Phe Arg Leu Asn Leu Leu Ile Thr 1235
1240 1245ttg ctg ggt ctg ctg cat ggc ctg gtc ttc ctg
ccg gtt gtc ctc 3789Leu Leu Gly Leu Leu His Gly Leu Val Phe Leu
Pro Val Val Leu 1250 1255 1260agc tat
ctg gga cca gat gtt aac caa gct ctg gta cag gag gag 3834Ser Tyr
Leu Gly Pro Asp Val Asn Gln Ala Leu Val Gln Glu Glu 1265
1270 1275aaa cta gcc agc gag gca gca gtg gcc cca
gag cct tct tgc cca 3879Lys Leu Ala Ser Glu Ala Ala Val Ala Pro
Glu Pro Ser Cys Pro 1280 1285 1290cag
tac ccc tcc cct gct gat gcg gat gcc aat gtt aac tac ggc 3924Gln
Tyr Pro Ser Pro Ala Asp Ala Asp Ala Asn Val Asn Tyr Gly 1295
1300 1305ttt gcc cca gaa ctt gcc cac gga gct
aat gct gct aga agc tct 3969Phe Ala Pro Glu Leu Ala His Gly Ala
Asn Ala Ala Arg Ser Ser 1310 1315
1320ttg ccc aaa agt gac caa aag ttc taa
3996Leu Pro Lys Ser Asp Gln Lys Phe 1325
133021331PRTRattus sp. 2Met Ala Ala Ala Trp Leu Gly Trp Leu Leu Trp Ala
Leu Leu Leu Ser1 5 10
15Ala Ala Gln Gly Glu Leu Tyr Thr Pro Lys His Glu Ala Gly Val Cys
20 25 30Thr Phe Tyr Glu Glu Cys Gly
Lys Asn Pro Glu Leu Ser Gly Gly Leu 35 40
45Thr Ser Leu Ser Asn Val Ser Cys Leu Ser Asn Thr Pro Ala Arg
His 50 55 60Val Thr Gly Glu His Leu
Ala Leu Leu Gln Arg Ile Cys Pro Arg Leu65 70
75 80Tyr Asn Gly Pro Asn Thr Thr Phe Ala Cys Cys
Ser Thr Lys Gln Leu 85 90
95Leu Ser Leu Glu Ser Ser Met Ser Ile Thr Lys Ala Leu Leu Thr Arg
100 105 110Cys Pro Ala Cys Ser Asp
Asn Phe Val Ser Leu His Cys His Asn Thr 115 120
125Cys Ser Pro Asp Gln Ser Leu Phe Ile Asn Val Thr Arg Val
Val Glu 130 135 140Arg Gly Ala Gly Glu
Pro Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr145 150
155 160Gln Arg Ser Phe Ala Glu Lys Ala Tyr Glu
Ser Cys Ser Gln Val Arg 165 170
175Ile Pro Ala Ala Ala Ser Leu Ala Val Gly Ser Met Cys Gly Val Tyr
180 185 190Gly Ser Ala Leu Cys
Asn Ala Gln Arg Trp Leu Asn Phe Gln Gly Asp 195
200 205Thr Gly Asn Gly Leu Ala Pro Leu Asp Ile Thr Phe
His Leu Leu Glu 210 215 220Pro Gly Gln
Ala Leu Pro Asp Gly Ile Gln Pro Leu Asn Gly Lys Ile225
230 235 240Ala Pro Cys Asn Glu Ser Gln
Gly Asp Asp Ser Ala Val Cys Ser Cys 245
250 255Gln Asp Cys Ala Ala Ser Cys Pro Val Ile Pro Pro
Pro Glu Ala Leu 260 265 270Arg
Pro Ser Phe Tyr Met Gly Arg Met Pro Gly Trp Leu Ala Leu Ile 275
280 285Ile Ile Phe Thr Ala Val Phe Val Leu
Leu Ser Ala Val Leu Val Arg 290 295
300Leu Arg Val Val Ser Asn Arg Asn Lys Asn Lys Ala Glu Gly Pro Gln305
310 315 320Glu Ala Pro Lys
Leu Pro His Lys His Lys Leu Ser Pro His Thr Ile 325
330 335Leu Gly Arg Phe Phe Gln Asn Trp Gly Thr
Arg Val Ala Ser Trp Pro 340 345
350Leu Thr Val Leu Ala Leu Ser Phe Ile Val Val Ile Ala Leu Ala Ala
355 360 365Gly Leu Thr Phe Ile Glu Leu
Thr Thr Asp Pro Val Glu Leu Trp Ser 370 375
380Ala Pro Lys Ser Gln Ala Arg Lys Glu Lys Ser Phe His Asp Glu
His385 390 395 400Phe Gly
Pro Phe Phe Arg Thr Asn Gln Ile Phe Val Thr Ala Arg Asn
405 410 415Arg Ser Ser Tyr Lys Tyr Asp
Ser Leu Leu Leu Gly Ser Lys Asn Phe 420 425
430Ser Gly Ile Leu Ser Leu Asp Phe Leu Leu Glu Leu Leu Glu
Leu Gln 435 440 445Glu Arg Leu Arg
His Leu Gln Val Trp Ser Pro Glu Ala Glu Arg Asn 450
455 460Ile Ser Leu Gln Asp Ile Cys Tyr Ala Pro Leu Asn
Pro Tyr Asn Thr465 470 475
480Ser Leu Ser Asp Cys Cys Val Asn Ser Leu Leu Gln Tyr Phe Gln Asn
485 490 495Asn Arg Thr Leu Leu
Met Leu Thr Ala Asn Gln Thr Leu Asn Gly Gln 500
505 510Thr Ser Leu Val Asp Trp Lys Asp His Phe Leu Tyr
Cys Ala Asn Ala 515 520 525Pro Leu
Thr Phe Lys Asp Gly Thr Ser Leu Ala Leu Ser Cys Met Ala 530
535 540Asp Tyr Gly Ala Pro Val Phe Pro Phe Leu Ala
Val Gly Gly Tyr Gln545 550 555
560Gly Thr Asp Tyr Ser Glu Ala Glu Ala Leu Ile Ile Thr Phe Ser Leu
565 570 575Asn Asn Tyr Pro
Ala Asp Asp Pro Arg Met Ala Gln Ala Lys Leu Trp 580
585 590Glu Glu Ala Phe Leu Lys Glu Met Glu Ser Phe
Gln Arg Asn Thr Ser 595 600 605Asp
Lys Phe Gln Val Ala Phe Ser Ala Glu Arg Ser Leu Glu Asp Glu 610
615 620Ile Asn Arg Thr Thr Ile Gln Asp Leu Pro
Val Phe Ala Val Ser Tyr625 630 635
640Ile Ile Val Phe Leu Tyr Ile Ser Leu Ala Leu Gly Ser Tyr Ser
Arg 645 650 655Cys Ser Arg
Val Ala Val Glu Ser Lys Ala Thr Leu Gly Leu Gly Gly 660
665 670Val Ile Val Val Leu Gly Ala Val Leu Ala
Ala Met Gly Phe Tyr Ser 675 680
685Tyr Leu Gly Val Pro Ser Ser Leu Val Ile Ile Gln Val Val Pro Phe 690
695 700Leu Val Leu Ala Val Gly Ala Asp
Asn Ile Phe Ile Phe Val Leu Glu705 710
715 720Tyr Gln Arg Leu Pro Arg Met Pro Gly Glu Gln Arg
Glu Ala His Ile 725 730
735Gly Arg Thr Leu Gly Ser Val Ala Pro Ser Met Leu Leu Cys Ser Leu
740 745 750Ser Glu Ala Ile Cys Phe
Phe Leu Gly Ala Leu Thr Pro Met Pro Ala 755 760
765Val Arg Thr Phe Ala Leu Thr Ser Gly Leu Ala Ile Ile Leu
Asp Phe 770 775 780Leu Leu Gln Met Thr
Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys785 790
795 800Arg Gln Glu Ala Ser Arg Pro Asp Val Leu
Cys Cys Phe Ser Thr Arg 805 810
815Lys Leu Pro Pro Pro Lys Glu Lys Glu Gly Leu Leu Leu Arg Phe Phe
820 825 830Arg Lys Ile Tyr Ala
Pro Phe Leu Leu His Arg Phe Ile Arg Pro Val 835
840 845Val Met Leu Leu Phe Leu Thr Leu Phe Gly Ala Asn
Leu Tyr Leu Met 850 855 860Cys Asn Ile
Asn Val Gly Leu Asp Gln Glu Leu Ala Leu Pro Lys Asp865
870 875 880Ser Tyr Leu Ile Asp Tyr Phe
Leu Phe Leu Asn Arg Tyr Leu Glu Val 885
890 895Gly Pro Pro Val Tyr Phe Val Thr Thr Ser Gly Phe
Asn Phe Ser Ser 900 905 910Glu
Ala Gly Met Asn Ala Thr Cys Ser Ser Ala Gly Cys Lys Ser Phe 915
920 925Ser Leu Thr Gln Lys Ile Gln Tyr Ala
Ser Glu Phe Pro Asp Gln Ser 930 935
940Tyr Val Ala Ile Ala Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp945
950 955 960Leu Thr Pro Ser
Ser Ser Cys Cys Arg Leu Tyr Ile Arg Gly Pro His 965
970 975Lys Asp Glu Phe Cys Pro Ser Thr Asp Thr
Ser Phe Asn Cys Leu Lys 980 985
990Asn Cys Met Asn Arg Thr Leu Gly Pro Val Arg Pro Thr Ala Glu Gln
995 1000 1005Phe His Lys Tyr Leu Pro
Trp Phe Leu Asn Asp Pro Pro Asn Ile 1010 1015
1020Arg Cys Pro Lys Gly Gly Leu Ala Ala Tyr Arg Thr Ser Val
Asn 1025 1030 1035Leu Ser Ser Asp Gly
Gln Val Ile Ala Ser Gln Phe Met Ala Tyr 1040 1045
1050His Lys Pro Leu Arg Asn Ser Gln Asp Phe Thr Glu Ala
Leu Arg 1055 1060 1065Ala Ser Arg Leu
Leu Ala Ala Asn Ile Thr Ala Asp Leu Arg Lys 1070
1075 1080Val Pro Gly Thr Asp Pro Asn Phe Glu Val Phe
Pro Tyr Thr Ile 1085 1090 1095Ser Asn
Val Phe Tyr Gln Gln Tyr Leu Thr Val Leu Pro Glu Gly 1100
1105 1110Ile Phe Thr Leu Ala Leu Cys Phe Val Pro
Thr Phe Val Val Cys 1115 1120 1125Tyr
Leu Leu Leu Gly Leu Asp Met Cys Ser Gly Ile Leu Asn Leu 1130
1135 1140Leu Ser Ile Ile Met Ile Leu Val Asp
Thr Ile Gly Leu Met Ala 1145 1150
1155Val Trp Gly Ile Ser Tyr Asn Ala Val Ser Leu Ile Asn Leu Val
1160 1165 1170Thr Ala Val Gly Met Ser
Val Glu Phe Val Ser His Ile Thr Arg 1175 1180
1185Ser Phe Ala Val Ser Thr Lys Pro Thr Arg Leu Glu Arg Ala
Lys 1190 1195 1200Asp Ala Thr Val Phe
Met Gly Ser Ala Val Phe Ala Gly Val Ala 1205 1210
1215Met Thr Asn Phe Pro Gly Ile Leu Ile Leu Gly Phe Ala
Gln Ala 1220 1225 1230Gln Leu Ile Gln
Ile Phe Phe Phe Arg Leu Asn Leu Leu Ile Thr 1235
1240 1245Leu Leu Gly Leu Leu His Gly Leu Val Phe Leu
Pro Val Val Leu 1250 1255 1260Ser Tyr
Leu Gly Pro Asp Val Asn Gln Ala Leu Val Gln Glu Glu 1265
1270 1275Lys Leu Ala Ser Glu Ala Ala Val Ala Pro
Glu Pro Ser Cys Pro 1280 1285 1290Gln
Tyr Pro Ser Pro Ala Asp Ala Asp Ala Asn Val Asn Tyr Gly 1295
1300 1305Phe Ala Pro Glu Leu Ala His Gly Ala
Asn Ala Ala Arg Ser Ser 1310 1315
1320Leu Pro Lys Ser Asp Gln Lys Phe 1325
133033999DNAHomo sapiensCDS(1)..(3999) 3atg gcg gag gcc ggc ctg agg ggc
tgg ctg ctg tgg gcc ctg ctc ctg 48Met Ala Glu Ala Gly Leu Arg Gly
Trp Leu Leu Trp Ala Leu Leu Leu1 5 10
15cgc ttg gcc cag agt gag cct tac aca acc atc cac cag cct
ggc tac 96Arg Leu Ala Gln Ser Glu Pro Tyr Thr Thr Ile His Gln Pro
Gly Tyr 20 25 30tgc gcc ttc
tat gac gaa tgt ggg aag aac cca gag ctg tct gga agc 144Cys Ala Phe
Tyr Asp Glu Cys Gly Lys Asn Pro Glu Leu Ser Gly Ser 35
40 45ctc atg aca ctc tcc aac gtg tcc tgc ctg tcc
aac acg ccg gcc cgc 192Leu Met Thr Leu Ser Asn Val Ser Cys Leu Ser
Asn Thr Pro Ala Arg 50 55 60aag atc
aca ggt gat cac ctg atc cta tta cag aag atc tgc ccc cgc 240Lys Ile
Thr Gly Asp His Leu Ile Leu Leu Gln Lys Ile Cys Pro Arg65
70 75 80ctc tac acc ggc ccc aac acc
caa gcc tgc tgc tcc gcc aag cag ctg 288Leu Tyr Thr Gly Pro Asn Thr
Gln Ala Cys Cys Ser Ala Lys Gln Leu 85 90
95gta tca ctg gaa gcg agt ctg tcg atc acc aag gcc ctc
ctc acc cgc 336Val Ser Leu Glu Ala Ser Leu Ser Ile Thr Lys Ala Leu
Leu Thr Arg 100 105 110tgc cca
gcc tgc tct gac aat ttt gtg aac ctg cac tgc cac aac acg 384Cys Pro
Ala Cys Ser Asp Asn Phe Val Asn Leu His Cys His Asn Thr 115
120 125tgc agc ccc aat cag agc ctc ttc atc aat
gtg acc cgc gtg gcc cag 432Cys Ser Pro Asn Gln Ser Leu Phe Ile Asn
Val Thr Arg Val Ala Gln 130 135 140cta
ggg gct gga caa ctc cca gct gtg gtg gcc tat gag gcc ttc tac 480Leu
Gly Ala Gly Gln Leu Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr145
150 155 160cag cat agc ttt gcc gag
cag agc tat gac tcc tgc agc cgt gtg cgc 528Gln His Ser Phe Ala Glu
Gln Ser Tyr Asp Ser Cys Ser Arg Val Arg 165
170 175gtc cct gca gct gcc acg ctg gct gtg ggc acc atg
tgt ggc gtg tat 576Val Pro Ala Ala Ala Thr Leu Ala Val Gly Thr Met
Cys Gly Val Tyr 180 185 190ggc
tct gcc ctt tgc aat gcc cag cgc tgg ctc aac ttc cag gga gac 624Gly
Ser Ala Leu Cys Asn Ala Gln Arg Trp Leu Asn Phe Gln Gly Asp 195
200 205aca ggc aat ggt ctg gcc cca ctg gac
atc acc ttc cac ctc ttg gag 672Thr Gly Asn Gly Leu Ala Pro Leu Asp
Ile Thr Phe His Leu Leu Glu 210 215
220cct ggc cag gcc gtg ggg agt ggg att cag cct ctg aat gag ggg gtt
720Pro Gly Gln Ala Val Gly Ser Gly Ile Gln Pro Leu Asn Glu Gly Val225
230 235 240gca cgt tgc aat
gag tcc caa ggt gac gac gtg gcg acc tgc tcc tgc 768Ala Arg Cys Asn
Glu Ser Gln Gly Asp Asp Val Ala Thr Cys Ser Cys 245
250 255caa gac tgt gct gca tcc tgt cct gcc ata
gcc cgc ccc cag gcc ctc 816Gln Asp Cys Ala Ala Ser Cys Pro Ala Ile
Ala Arg Pro Gln Ala Leu 260 265
270gac tcc acc ttc tac ctg ggc cag atg ccg ggc agt ctg gtc ctc atc
864Asp Ser Thr Phe Tyr Leu Gly Gln Met Pro Gly Ser Leu Val Leu Ile
275 280 285atc atc ctc tgc tct gtc ttc
gct gtg gtc acc atc ctg ctt gtg gga 912Ile Ile Leu Cys Ser Val Phe
Ala Val Val Thr Ile Leu Leu Val Gly 290 295
300ttc cgt gtg gcc ccc gcc agg gac aaa agc aag atg gtg gac ccc aag
960Phe Arg Val Ala Pro Ala Arg Asp Lys Ser Lys Met Val Asp Pro Lys305
310 315 320aag ggc acc agc
ctc tct gac aag ctc agc ttc tcc acc cac acc ctc 1008Lys Gly Thr Ser
Leu Ser Asp Lys Leu Ser Phe Ser Thr His Thr Leu 325
330 335ctt ggc cag ttc ttc cag ggc tgg ggc acg
tgg gtg gct tcg tgg cct 1056Leu Gly Gln Phe Phe Gln Gly Trp Gly Thr
Trp Val Ala Ser Trp Pro 340 345
350ctg acc atc ttg gtg cta tct gtc atc ccg gtg gtg gcc ttg gca gcg
1104Leu Thr Ile Leu Val Leu Ser Val Ile Pro Val Val Ala Leu Ala Ala
355 360 365ggc ctg gtc ttt aca gaa ctc
act acg gac ccc gtg gag ctg tgg tcg 1152Gly Leu Val Phe Thr Glu Leu
Thr Thr Asp Pro Val Glu Leu Trp Ser 370 375
380gcc ccc aac agc caa gcc cgg agt gag aaa gct ttc cat gac cag cat
1200Ala Pro Asn Ser Gln Ala Arg Ser Glu Lys Ala Phe His Asp Gln His385
390 395 400ttc ggc ccc ttc
ttc cga acc aac cag gtg atc ctg acg gct cct aac 1248Phe Gly Pro Phe
Phe Arg Thr Asn Gln Val Ile Leu Thr Ala Pro Asn 405
410 415cgg tcc agc tac agg tat gac tct ctg ctg
ctg ggg ccc aag aac ttc 1296Arg Ser Ser Tyr Arg Tyr Asp Ser Leu Leu
Leu Gly Pro Lys Asn Phe 420 425
430agc gga atc ctg gac ctg gac ttg ctg ctg gag ctg cta gag ctg cag
1344Ser Gly Ile Leu Asp Leu Asp Leu Leu Leu Glu Leu Leu Glu Leu Gln
435 440 445gag agg ctg cgg cac ctc cag
gta tgg tcg ccc gaa gca cag cgc aac 1392Glu Arg Leu Arg His Leu Gln
Val Trp Ser Pro Glu Ala Gln Arg Asn 450 455
460atc tcc ctg cag gac atc tgc tac gcc ccc ctc aat ccg gac aat acc
1440Ile Ser Leu Gln Asp Ile Cys Tyr Ala Pro Leu Asn Pro Asp Asn Thr465
470 475 480agt ctc tac gac
tgc tgc atc aac agc ctc ctg cag tat ttc cag aac 1488Ser Leu Tyr Asp
Cys Cys Ile Asn Ser Leu Leu Gln Tyr Phe Gln Asn 485
490 495aac cgc acg ctc ctg ctg ctc aca gcc aac
cag aca ctg atg ggg cag 1536Asn Arg Thr Leu Leu Leu Leu Thr Ala Asn
Gln Thr Leu Met Gly Gln 500 505
510acc tcc caa gtc gac tgg aag gac cat ttt ctg tac tgt gcc aat gcc
1584Thr Ser Gln Val Asp Trp Lys Asp His Phe Leu Tyr Cys Ala Asn Ala
515 520 525ccg ctc acc ttc aag gat ggc
aca gcc ctg gcc ctg agc tgc atg gct 1632Pro Leu Thr Phe Lys Asp Gly
Thr Ala Leu Ala Leu Ser Cys Met Ala 530 535
540gac tac ggg gcc cct gtc ttc ccc ttc ctt gcc att ggg ggg tac aaa
1680Asp Tyr Gly Ala Pro Val Phe Pro Phe Leu Ala Ile Gly Gly Tyr Lys545
550 555 560gga aag gac tat
tct gag gca gag gcc ctg atc atg acg ttc tcc ctc 1728Gly Lys Asp Tyr
Ser Glu Ala Glu Ala Leu Ile Met Thr Phe Ser Leu 565
570 575aac aat tac cct gcc ggg gac ccc cgt ctg
gcc cag gcc aag ctg tgg 1776Asn Asn Tyr Pro Ala Gly Asp Pro Arg Leu
Ala Gln Ala Lys Leu Trp 580 585
590gag gag gcc ttc tta gag gaa atg cga gcc ttc cag cgt cgg atg gct
1824Glu Glu Ala Phe Leu Glu Glu Met Arg Ala Phe Gln Arg Arg Met Ala
595 600 605ggc atg ttc cag gtc acg ttc
acg gct gag cgc tct ctg gaa gac gag 1872Gly Met Phe Gln Val Thr Phe
Thr Ala Glu Arg Ser Leu Glu Asp Glu 610 615
620atc aat cgc acc aca gct gaa gac ctg ccc atc ttt gcc acc agc tac
1920Ile Asn Arg Thr Thr Ala Glu Asp Leu Pro Ile Phe Ala Thr Ser Tyr625
630 635 640att gtc ata ttc
ctg tac atc tct ctg gcc ctg ggc agc tat tcc agc 1968Ile Val Ile Phe
Leu Tyr Ile Ser Leu Ala Leu Gly Ser Tyr Ser Ser 645
650 655tgg agc cga gtg atg gtg gac tcc aag gcc
acg ctg ggc ctc ggc ggg 2016Trp Ser Arg Val Met Val Asp Ser Lys Ala
Thr Leu Gly Leu Gly Gly 660 665
670gtg gcc gtg gtc ctg gga gca gtc atg gct gcc atg ggc ttc ttc tcc
2064Val Ala Val Val Leu Gly Ala Val Met Ala Ala Met Gly Phe Phe Ser
675 680 685tac ttg ggt atc cgc tcc tcc
ctg gtc atc ctg caa gtg gtt cct ttc 2112Tyr Leu Gly Ile Arg Ser Ser
Leu Val Ile Leu Gln Val Val Pro Phe 690 695
700ctg gtg ctg tcc gtg ggg gct gat aac atc ttc atc ttt gtt ctc gag
2160Leu Val Leu Ser Val Gly Ala Asp Asn Ile Phe Ile Phe Val Leu Glu705
710 715 720tac cag agg ctg
ccc cgg agg cct ggg gag cca cga gag gtc cac att 2208Tyr Gln Arg Leu
Pro Arg Arg Pro Gly Glu Pro Arg Glu Val His Ile 725
730 735ggg cga gcc cta ggc agg gtg gct ccc agc
atg ctg ttg tgc agc ctc 2256Gly Arg Ala Leu Gly Arg Val Ala Pro Ser
Met Leu Leu Cys Ser Leu 740 745
750tct gag gcc atc tgc ttc ttc cta ggg gcc ctg acc ccc atg cca gct
2304Ser Glu Ala Ile Cys Phe Phe Leu Gly Ala Leu Thr Pro Met Pro Ala
755 760 765gtg cgg acc ttt gcc ctg acc
tct ggc ctt gca gtg atc ctt gac ttc 2352Val Arg Thr Phe Ala Leu Thr
Ser Gly Leu Ala Val Ile Leu Asp Phe 770 775
780ctc ctg cag atg tca gcc ttt gtg gcc ctg ctc tcc ctg gac agc aag
2400Leu Leu Gln Met Ser Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys785
790 795 800agg cag gag gcc
tcc cgg ttg gac gtc tgc tgc tgt gtc aag ccc cag 2448Arg Gln Glu Ala
Ser Arg Leu Asp Val Cys Cys Cys Val Lys Pro Gln 805
810 815gag ctg ccc ccg cct ggc cag gga gag ggg
ctc ctg ctt ggc ttc ttc 2496Glu Leu Pro Pro Pro Gly Gln Gly Glu Gly
Leu Leu Leu Gly Phe Phe 820 825
830caa aag gct tat gcc ccc ttc ctg ctg cac tgg atc act cga ggt gtt
2544Gln Lys Ala Tyr Ala Pro Phe Leu Leu His Trp Ile Thr Arg Gly Val
835 840 845gtg ctg ctg ctg ttt ctc gcc
ctg ttc gga gtg agc ctc tac tcc atg 2592Val Leu Leu Leu Phe Leu Ala
Leu Phe Gly Val Ser Leu Tyr Ser Met 850 855
860tgc cac atc agc gtg gga ctg gac cag gag ctg gcc ctg ccc aag gac
2640Cys His Ile Ser Val Gly Leu Asp Gln Glu Leu Ala Leu Pro Lys Asp865
870 875 880tcg tac ctg ctt
gac tat ttc ctc ttt ctg aac cgc tac ttc gag gtg 2688Ser Tyr Leu Leu
Asp Tyr Phe Leu Phe Leu Asn Arg Tyr Phe Glu Val 885
890 895ggg gcc ccg gtg tac ttt gtt acc acc ttg
ggc tac aac ttc tcc agc 2736Gly Ala Pro Val Tyr Phe Val Thr Thr Leu
Gly Tyr Asn Phe Ser Ser 900 905
910gag gct ggg atg aat gcc atc tgc tcc agt gca ggc tgc aac aac ttc
2784Glu Ala Gly Met Asn Ala Ile Cys Ser Ser Ala Gly Cys Asn Asn Phe
915 920 925tcc ttc acc cag aag atc cag
tat gcc aca gag ttc cct gag cag tct 2832Ser Phe Thr Gln Lys Ile Gln
Tyr Ala Thr Glu Phe Pro Glu Gln Ser 930 935
940tac ctg gcc atc cct gcc tcc tcc tgg gtg gat gac ttc att gac tgg
2880Tyr Leu Ala Ile Pro Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp945
950 955 960ctg acc ccg tcc
tcc tgc tgc cgc ctt tat ata tct ggc ccc aat aag 2928Leu Thr Pro Ser
Ser Cys Cys Arg Leu Tyr Ile Ser Gly Pro Asn Lys 965
970 975gac aag ttc tgc ccc tcg acc gtc aac tct
ctg aac tgc cta aag aac 2976Asp Lys Phe Cys Pro Ser Thr Val Asn Ser
Leu Asn Cys Leu Lys Asn 980 985
990tgc atg agc atc acg atg ggc tct gtg agg ccc tcg gtg gag cag ttc
3024Cys Met Ser Ile Thr Met Gly Ser Val Arg Pro Ser Val Glu Gln Phe
995 1000 1005cat aag tat ctt ccc tgg
ttc ctg aac gac cgg ccc aac atc aaa 3069His Lys Tyr Leu Pro Trp
Phe Leu Asn Asp Arg Pro Asn Ile Lys 1010 1015
1020tgt ccc aaa ggc ggc ctg gca gca tac agc acc tct gtg aac
ttg 3114Cys Pro Lys Gly Gly Leu Ala Ala Tyr Ser Thr Ser Val Asn
Leu 1025 1030 1035act tca gat ggc cag
gtt tta gcc tcc agg ttc atg gcc tat cac 3159Thr Ser Asp Gly Gln
Val Leu Ala Ser Arg Phe Met Ala Tyr His 1040 1045
1050aag ccc ctg aaa aac tca cag gat tac aca gaa gct ctg
cgg gca 3204Lys Pro Leu Lys Asn Ser Gln Asp Tyr Thr Glu Ala Leu
Arg Ala 1055 1060 1065gct cga gag ctg
gca gcc aac atc act gct gac ctg cgg aaa gtg 3249Ala Arg Glu Leu
Ala Ala Asn Ile Thr Ala Asp Leu Arg Lys Val 1070
1075 1080cct gga aca gac ccg gct ttt gag gtc ttc ccc
tac acg atc acc 3294Pro Gly Thr Asp Pro Ala Phe Glu Val Phe Pro
Tyr Thr Ile Thr 1085 1090 1095aat gtg
ttt tat gag cag tac ctg acc atc ctc cct gag ggg ctc 3339Asn Val
Phe Tyr Glu Gln Tyr Leu Thr Ile Leu Pro Glu Gly Leu 1100
1105 1110ttc atg ctc agc ctc tgc ctt gtg ccc acc
ttc gct gtc tcc tgc 3384Phe Met Leu Ser Leu Cys Leu Val Pro Thr
Phe Ala Val Ser Cys 1115 1120 1125ctc
ctg ctg ggc ctg gac ctg cgc tcc ggc ctc ctc aac ctg ctc 3429Leu
Leu Leu Gly Leu Asp Leu Arg Ser Gly Leu Leu Asn Leu Leu 1130
1135 1140tcc att gtc atg atc ctc gtg gac act
gtc ggc ttc atg gcc ctg 3474Ser Ile Val Met Ile Leu Val Asp Thr
Val Gly Phe Met Ala Leu 1145 1150
1155tgg gac atc agt tac aat gct gtg tcc ctc atc aac ctg gtc tcg
3519Trp Asp Ile Ser Tyr Asn Ala Val Ser Leu Ile Asn Leu Val Ser
1160 1165 1170gcg gtg ggc atg tct gtg
gag ttt gtg tcc cac att acc cgc tcc 3564Ala Val Gly Met Ser Val
Glu Phe Val Ser His Ile Thr Arg Ser 1175 1180
1185ttt gcc atc agc acc aag ccc acc tgg ctg gag agg gcc aaa
gag 3609Phe Ala Ile Ser Thr Lys Pro Thr Trp Leu Glu Arg Ala Lys
Glu 1190 1195 1200gcc acc atc tct atg
gga agt gcg gtg ttt gca ggt gtg gcc atg 3654Ala Thr Ile Ser Met
Gly Ser Ala Val Phe Ala Gly Val Ala Met 1205 1210
1215acc aac ctg cct ggc atc ctt gtc ctg ggc ctc gcc aag
gcc cag 3699Thr Asn Leu Pro Gly Ile Leu Val Leu Gly Leu Ala Lys
Ala Gln 1220 1225 1230ctc att cag atc
ttc ttc ttc cgc ctc aac ctc ctg atc act ctg 3744Leu Ile Gln Ile
Phe Phe Phe Arg Leu Asn Leu Leu Ile Thr Leu 1235
1240 1245ctg ggc ctg ctg cat ggc ttg gtc ttc ctg ccc
gtc atc ctc agc 3789Leu Gly Leu Leu His Gly Leu Val Phe Leu Pro
Val Ile Leu Ser 1250 1255 1260tac gtg
ggg cct gac gtt aac ccg gct ctg gca ctg gag cag aag 3834Tyr Val
Gly Pro Asp Val Asn Pro Ala Leu Ala Leu Glu Gln Lys 1265
1270 1275cgg gct gag gag gcg gtg gca gca gtc atg
gtg gcc tct tgc cca 3879Arg Ala Glu Glu Ala Val Ala Ala Val Met
Val Ala Ser Cys Pro 1280 1285 1290aat
cac ccc tcc cga gtc tcc aca gct gac aac atc tat gtc aac 3924Asn
His Pro Ser Arg Val Ser Thr Ala Asp Asn Ile Tyr Val Asn 1295
1300 1305cac agc ttt gaa ggt tct atc aaa ggt
gct ggt gcc atc agc aac 3969His Ser Phe Glu Gly Ser Ile Lys Gly
Ala Gly Ala Ile Ser Asn 1310 1315
1320ttc ttg ccc aac aat ggg cgg cag ttc tga
3999Phe Leu Pro Asn Asn Gly Arg Gln Phe 1325
133041332PRTHomo sapiens 4Met Ala Glu Ala Gly Leu Arg Gly Trp Leu Leu Trp
Ala Leu Leu Leu1 5 10
15Arg Leu Ala Gln Ser Glu Pro Tyr Thr Thr Ile His Gln Pro Gly Tyr
20 25 30Cys Ala Phe Tyr Asp Glu Cys
Gly Lys Asn Pro Glu Leu Ser Gly Ser 35 40
45Leu Met Thr Leu Ser Asn Val Ser Cys Leu Ser Asn Thr Pro Ala
Arg 50 55 60Lys Ile Thr Gly Asp His
Leu Ile Leu Leu Gln Lys Ile Cys Pro Arg65 70
75 80Leu Tyr Thr Gly Pro Asn Thr Gln Ala Cys Cys
Ser Ala Lys Gln Leu 85 90
95Val Ser Leu Glu Ala Ser Leu Ser Ile Thr Lys Ala Leu Leu Thr Arg
100 105 110Cys Pro Ala Cys Ser Asp
Asn Phe Val Asn Leu His Cys His Asn Thr 115 120
125Cys Ser Pro Asn Gln Ser Leu Phe Ile Asn Val Thr Arg Val
Ala Gln 130 135 140Leu Gly Ala Gly Gln
Leu Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr145 150
155 160Gln His Ser Phe Ala Glu Gln Ser Tyr Asp
Ser Cys Ser Arg Val Arg 165 170
175Val Pro Ala Ala Ala Thr Leu Ala Val Gly Thr Met Cys Gly Val Tyr
180 185 190Gly Ser Ala Leu Cys
Asn Ala Gln Arg Trp Leu Asn Phe Gln Gly Asp 195
200 205Thr Gly Asn Gly Leu Ala Pro Leu Asp Ile Thr Phe
His Leu Leu Glu 210 215 220Pro Gly Gln
Ala Val Gly Ser Gly Ile Gln Pro Leu Asn Glu Gly Val225
230 235 240Ala Arg Cys Asn Glu Ser Gln
Gly Asp Asp Val Ala Thr Cys Ser Cys 245
250 255Gln Asp Cys Ala Ala Ser Cys Pro Ala Ile Ala Arg
Pro Gln Ala Leu 260 265 270Asp
Ser Thr Phe Tyr Leu Gly Gln Met Pro Gly Ser Leu Val Leu Ile 275
280 285Ile Ile Leu Cys Ser Val Phe Ala Val
Val Thr Ile Leu Leu Val Gly 290 295
300Phe Arg Val Ala Pro Ala Arg Asp Lys Ser Lys Met Val Asp Pro Lys305
310 315 320Lys Gly Thr Ser
Leu Ser Asp Lys Leu Ser Phe Ser Thr His Thr Leu 325
330 335Leu Gly Gln Phe Phe Gln Gly Trp Gly Thr
Trp Val Ala Ser Trp Pro 340 345
350Leu Thr Ile Leu Val Leu Ser Val Ile Pro Val Val Ala Leu Ala Ala
355 360 365Gly Leu Val Phe Thr Glu Leu
Thr Thr Asp Pro Val Glu Leu Trp Ser 370 375
380Ala Pro Asn Ser Gln Ala Arg Ser Glu Lys Ala Phe His Asp Gln
His385 390 395 400Phe Gly
Pro Phe Phe Arg Thr Asn Gln Val Ile Leu Thr Ala Pro Asn
405 410 415Arg Ser Ser Tyr Arg Tyr Asp
Ser Leu Leu Leu Gly Pro Lys Asn Phe 420 425
430Ser Gly Ile Leu Asp Leu Asp Leu Leu Leu Glu Leu Leu Glu
Leu Gln 435 440 445Glu Arg Leu Arg
His Leu Gln Val Trp Ser Pro Glu Ala Gln Arg Asn 450
455 460Ile Ser Leu Gln Asp Ile Cys Tyr Ala Pro Leu Asn
Pro Asp Asn Thr465 470 475
480Ser Leu Tyr Asp Cys Cys Ile Asn Ser Leu Leu Gln Tyr Phe Gln Asn
485 490 495Asn Arg Thr Leu Leu
Leu Leu Thr Ala Asn Gln Thr Leu Met Gly Gln 500
505 510Thr Ser Gln Val Asp Trp Lys Asp His Phe Leu Tyr
Cys Ala Asn Ala 515 520 525Pro Leu
Thr Phe Lys Asp Gly Thr Ala Leu Ala Leu Ser Cys Met Ala 530
535 540Asp Tyr Gly Ala Pro Val Phe Pro Phe Leu Ala
Ile Gly Gly Tyr Lys545 550 555
560Gly Lys Asp Tyr Ser Glu Ala Glu Ala Leu Ile Met Thr Phe Ser Leu
565 570 575Asn Asn Tyr Pro
Ala Gly Asp Pro Arg Leu Ala Gln Ala Lys Leu Trp 580
585 590Glu Glu Ala Phe Leu Glu Glu Met Arg Ala Phe
Gln Arg Arg Met Ala 595 600 605Gly
Met Phe Gln Val Thr Phe Thr Ala Glu Arg Ser Leu Glu Asp Glu 610
615 620Ile Asn Arg Thr Thr Ala Glu Asp Leu Pro
Ile Phe Ala Thr Ser Tyr625 630 635
640Ile Val Ile Phe Leu Tyr Ile Ser Leu Ala Leu Gly Ser Tyr Ser
Ser 645 650 655Trp Ser Arg
Val Met Val Asp Ser Lys Ala Thr Leu Gly Leu Gly Gly 660
665 670Val Ala Val Val Leu Gly Ala Val Met Ala
Ala Met Gly Phe Phe Ser 675 680
685Tyr Leu Gly Ile Arg Ser Ser Leu Val Ile Leu Gln Val Val Pro Phe 690
695 700Leu Val Leu Ser Val Gly Ala Asp
Asn Ile Phe Ile Phe Val Leu Glu705 710
715 720Tyr Gln Arg Leu Pro Arg Arg Pro Gly Glu Pro Arg
Glu Val His Ile 725 730
735Gly Arg Ala Leu Gly Arg Val Ala Pro Ser Met Leu Leu Cys Ser Leu
740 745 750Ser Glu Ala Ile Cys Phe
Phe Leu Gly Ala Leu Thr Pro Met Pro Ala 755 760
765Val Arg Thr Phe Ala Leu Thr Ser Gly Leu Ala Val Ile Leu
Asp Phe 770 775 780Leu Leu Gln Met Ser
Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys785 790
795 800Arg Gln Glu Ala Ser Arg Leu Asp Val Cys
Cys Cys Val Lys Pro Gln 805 810
815Glu Leu Pro Pro Pro Gly Gln Gly Glu Gly Leu Leu Leu Gly Phe Phe
820 825 830Gln Lys Ala Tyr Ala
Pro Phe Leu Leu His Trp Ile Thr Arg Gly Val 835
840 845Val Leu Leu Leu Phe Leu Ala Leu Phe Gly Val Ser
Leu Tyr Ser Met 850 855 860Cys His Ile
Ser Val Gly Leu Asp Gln Glu Leu Ala Leu Pro Lys Asp865
870 875 880Ser Tyr Leu Leu Asp Tyr Phe
Leu Phe Leu Asn Arg Tyr Phe Glu Val 885
890 895Gly Ala Pro Val Tyr Phe Val Thr Thr Leu Gly Tyr
Asn Phe Ser Ser 900 905 910Glu
Ala Gly Met Asn Ala Ile Cys Ser Ser Ala Gly Cys Asn Asn Phe 915
920 925Ser Phe Thr Gln Lys Ile Gln Tyr Ala
Thr Glu Phe Pro Glu Gln Ser 930 935
940Tyr Leu Ala Ile Pro Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp945
950 955 960Leu Thr Pro Ser
Ser Cys Cys Arg Leu Tyr Ile Ser Gly Pro Asn Lys 965
970 975Asp Lys Phe Cys Pro Ser Thr Val Asn Ser
Leu Asn Cys Leu Lys Asn 980 985
990Cys Met Ser Ile Thr Met Gly Ser Val Arg Pro Ser Val Glu Gln Phe
995 1000 1005His Lys Tyr Leu Pro Trp
Phe Leu Asn Asp Arg Pro Asn Ile Lys 1010 1015
1020Cys Pro Lys Gly Gly Leu Ala Ala Tyr Ser Thr Ser Val Asn
Leu 1025 1030 1035Thr Ser Asp Gly Gln
Val Leu Ala Ser Arg Phe Met Ala Tyr His 1040 1045
1050Lys Pro Leu Lys Asn Ser Gln Asp Tyr Thr Glu Ala Leu
Arg Ala 1055 1060 1065Ala Arg Glu Leu
Ala Ala Asn Ile Thr Ala Asp Leu Arg Lys Val 1070
1075 1080Pro Gly Thr Asp Pro Ala Phe Glu Val Phe Pro
Tyr Thr Ile Thr 1085 1090 1095Asn Val
Phe Tyr Glu Gln Tyr Leu Thr Ile Leu Pro Glu Gly Leu 1100
1105 1110Phe Met Leu Ser Leu Cys Leu Val Pro Thr
Phe Ala Val Ser Cys 1115 1120 1125Leu
Leu Leu Gly Leu Asp Leu Arg Ser Gly Leu Leu Asn Leu Leu 1130
1135 1140Ser Ile Val Met Ile Leu Val Asp Thr
Val Gly Phe Met Ala Leu 1145 1150
1155Trp Asp Ile Ser Tyr Asn Ala Val Ser Leu Ile Asn Leu Val Ser
1160 1165 1170Ala Val Gly Met Ser Val
Glu Phe Val Ser His Ile Thr Arg Ser 1175 1180
1185Phe Ala Ile Ser Thr Lys Pro Thr Trp Leu Glu Arg Ala Lys
Glu 1190 1195 1200Ala Thr Ile Ser Met
Gly Ser Ala Val Phe Ala Gly Val Ala Met 1205 1210
1215Thr Asn Leu Pro Gly Ile Leu Val Leu Gly Leu Ala Lys
Ala Gln 1220 1225 1230Leu Ile Gln Ile
Phe Phe Phe Arg Leu Asn Leu Leu Ile Thr Leu 1235
1240 1245Leu Gly Leu Leu His Gly Leu Val Phe Leu Pro
Val Ile Leu Ser 1250 1255 1260Tyr Val
Gly Pro Asp Val Asn Pro Ala Leu Ala Leu Glu Gln Lys 1265
1270 1275Arg Ala Glu Glu Ala Val Ala Ala Val Met
Val Ala Ser Cys Pro 1280 1285 1290Asn
His Pro Ser Arg Val Ser Thr Ala Asp Asn Ile Tyr Val Asn 1295
1300 1305His Ser Phe Glu Gly Ser Ile Lys Gly
Ala Gly Ala Ile Ser Asn 1310 1315
1320Phe Leu Pro Asn Asn Gly Arg Gln Phe 1325
13305885DNARattus sp. 5ccacgcgtcc gcacctgcaa gtgtggtccc ctgaggcaga
gcgcaacatc tccctccagg 60acatctgcta tgcccccctc aacccatata acaccagcct
ctccgactgc tgtgtcaaca 120gcctccttca gtacttccag aacaaccgca ccctcctgat
gctcacggcc aaccagactc 180tgaatggcca gacctccctg gtggactgga aggaccattt
cctctactgt gcaaatgccc 240ctctcacgtt caaagatggc acgtctctgg ccctgagctg
catggctgac tacggggctc 300ctgtcttccc cttccttgct gttgggggat accaaggcac
ggactattcc gaggcagaag 360cgctgatcat aaccttctct ctcaataact accccgctga
tgatccccgc atggcccagg 420ccaagctctg ggaggaggct ttcttgaagg aaatggaatc
cttccagagg aacacaagtg 480acaagttcca ggttgcgttc tcagctgagc gctctctgga
ggatgagatc aaccgcacca 540ccatccagga cctgcctgtc tttgccgtca gctacattat
cgtcttcctg tacatctccc 600tggccctggg cagctactcc agatgcagcc gagtagcggt
ggagtccaag gctactctgg 660gcctaggtgg ggtgatagtg tgctgggagc agttctggct
tgcatggggc ttctaactcc 720tacctgggtg tcccctcttc tctggttatc atccaagtgg
tacctttcct ggtgcttaag 780ctgtgggagc tggacacatc tacatcctag acttgagtac
cagaggtacc taggaagccg 840cggaacagcg aaaaggacac attgggcgca ccctgggcat
gtggc 8856458DNARattus sp. 6gaccagatgt taaccaagct
ctggtacagg aggagaaact agccagcgag gcagcagtgg 60ccccagagcc ttcttgccca
cagtacccct cccctgctga tgcggatgcc aatgttaact 120acggctttgc cccagaactt
gcccacggag ctaatgctgc tagaagctct ttgcccaaaa 180gtgaccaaaa gttctaatgg
agtaggagct tgtccatgct tctgctgatg agggatcatg 240aaggtcttcc ctctggttgt
cctcaaggcc tggggggagg ttgttcagag aaaaatggct 300ggcattcctg ccacgaggca
accggcagct tggcactgac tccttggtct cataggtccc 360taaggcttgg tcagattact
cctcatggag agactatctt aagtatctaa gctatcgatt 420gggatgcatc gctgttcatt
aaaaaggcta tggctatg 4587896DNARattus sp.
7ccacgcgtcc gcagtttcat aagtacctgc cctggttcct gaatgatccg cccaatatca
60gatgtcccaa agggggtcta gcagcgtata gaacgtctgt gaatttgagc tcagatggcc
120aggttatagc ctcccagttc atggcctacc acaagccctt aaggaactca caggacttca
180cagaagctct ccgggcgtcc cggttgctag cagccaacat cacagctgac ctacggaagg
240tgcctgggac agatccaaac tttgaggtct tcccttacac gatctccaac gtgttctacc
300agcaatacct gacggtcctt cctgagggaa tcttcaccct tgctctttgc tttgtgccca
360cctttgttgt ctgctacctc ctactgggcc tggacatgtg ctcagggatc ctcaacctac
420tctccatcat tatgattctc gtggacacca ttggcctcat ggctgtgtgg ggtatcagct
480ataatgcggt atccctcatc aaccttgtca cggcagtggg catgtctgtg gagtttgtgt
540cccacatcac tcggtccttt gcttgtaagc accaagccta cccggctgga gagggctaaa
600agatgctact gtcttcatgg gcagtgcggt gtttgctgga gtggccatga ccaacttccc
660aggcatcctc atcttggggg ctttgcccca agcccaggct tattcagatc ttcttcttcc
720gcctcaacct tctgatcacc tttgctgggg tctgctgcat ggctggtctt cctgcccggt
780ttgtcctcag ctatctggga ccagatgtaa ccaaggctct gctacccgga ggagaaacta
840gccagcgagg gcagcagtgg ccccagagac ttcttgccca caagtaccct tccctg
89683124DNARattus sp. 8tgcaagtgtg gtcccctgag gcagagcgca acatctccct
ccaggacatc tgctatgccc 60ccctcaaccc atataacacc agcctctccg actgctgtgt
caacagcctc cttcagtact 120tccagaacaa ccgcaccctc ctgatgctca cggccaacca
gactctgaat ggccagacct 180ccctggtgga ctggaaggac catttcctct actgtgcaaa
tgcccctctc acgttcaaag 240atggcacgtc tctggccctg agctgcatgg ctgactacgg
ggctcctgtc ttccccttcc 300ttgctgttgg gggataccaa ggcacggact attccgaggc
agaagcgctg atcataacct 360tctctctcaa taactacccc gctgatgatc cccgcatggc
ccaggccaag ctctgggagg 420aggctttctt gaaggaaatg gaatccttcc agaggaacac
aagtgacaag ttccaggttg 480cgttctcagc tgagcgctct ctggaggatg agatcaaccg
caccaccatc caggacctgc 540ctgtctttgc cgtcagctac attatcgtct tcctgtacat
ctccctggcc ctgggcagct 600actccagatg cagccgagta gcggtggagt ccaaggctac
tctgggccta ggtggggtga 660ttgttgtgct gggagcagtt ctggctgcca tgggcttcta
ctcctacctg ggtgtcccct 720cttctctggt tatcatccaa gtggtacctt tcctggtgct
agctgtggga gctgacaaca 780tcttcatctt tgttcttgag taccagaggc tacctaggat
gcctggggaa cagcgagagg 840ctcacattgg ccgcaccctg ggcagtgtgg cccccagcat
gctgctgtgc agcctctctg 900aggccatctg cttctttcta ggggccctga cccccatgcc
agctgtgagg accttcgcct 960tgacctctgg cttagcaatt atcctcgact tcctgctcca
gatgactgcc tttgtggccc 1020tgctctccct ggatagcaag aggcaggagg cctctcgccc
ggatgtctta tgctgctttt 1080caacccggaa gctgccccca cctaaagaaa aagaaggcct
cttactccgc ttcttccgca 1140agatatacgc tcctttcctg ctgcacagat tcatccgccc
tgttgtgatg ctgctgtttc 1200tgaccctgtt tggagcaaat ctctacttaa tgtgcaacat
caacgtgggg ctagaccagg 1260agctggctct gcccaaggac tcgtacttga tagactactt
cctctttctg aaccgatacc 1320ttgaagtggg gcctccagtg tactttgtca ccacctcggg
cttcaacttc tccagcgagg 1380caggcatgaa cgccacttgc tctagcgcag gctgtaagag
cttctcccta acccagaaaa 1440tccagtatgc cagtgaattc cctgaccagt cttacgtggc
tattgctgca tcctcctggg 1500tagatgactt catcgactgg ctgaccccgt cctcctcctg
ctgtcgcctt tatatacgtg 1560gcccccataa ggatgagttc tgtccctcaa cggatacttc
cttcaactgc ttaaaaaact 1620gcatgaaccg cactctgggt cctgtgaggc ccacagcgga
acagtttcat aagtacctgc 1680cctggttcct gaatgatccg cccaatatca gatgtcccaa
agggggtcta gcagcgtata 1740gaacgtctgt gaatttgagc tcagatggcc aggttatagc
ctcccagttc atggcctacc 1800acaagccctt aaggaactca caggacttca cagaagctct
ccgggcgtcc cggttgctag 1860cagccaacat cacagctgac ctacggaagg tgcctgggac
agatccaaac tttgaggtct 1920tcccttacac gatctccaac gtgttctacc agcaatacct
gacggtcctt cctgagggaa 1980tcttcaccct tgctctttgc tttgtgccca cctttgttgt
ctgctacctc ctactgggcc 2040tggacatgtg ctcagggatc ctcaacctac tctccatcat
tatgattctc gtggacacca 2100ttggcctcat ggctgtgtgg ggtatcagct ataatgcggt
atccctcatc aaccttgtca 2160cggcagtggg catgtctgtg gagtttgtgt cccacatcac
tcggtccttt gctgtaagca 2220ccaagcctac ccggctggag agggctaaag atgctactgt
cttcatgggc agtgcggtgt 2280ttgctggagt ggccatgacc aacttcccag gcatcctcat
cttgggcttt gcccaagccc 2340agcttattca gatcttcttc ttccgcctca accttctgat
caccttgctg ggtctgctgc 2400atggcctggt cttcctgccg gttgtcctca gctatctggg
accagatgtt aaccaagctc 2460tggtacagga ggagaaacta gccagcgagg cagcagtggc
cccagagcct tcttgcccac 2520agtacccctc ccctgctgat gcggatgcca atgttaacta
cggctttgcc ccagaacttg 2580cccacggagc taatgctgct agaagctctt tgcccaaaag
tgaccaaaag ttctaatgga 2640gtaggagctt gtccatgctt cttgctgatg agggatcatg
aaggtcttcc ctctggttgt 2700cctcaaggcc tggggggagg ttgtttcaga gaaaaatggc
tggcattcct gccacgaggc 2760aaccggcagc attggcactg acctccttgc tctcataggt
ccctaaggcc ttggtcagat 2820tacctcctcc atggagagac tatcttaagt atcttaagta
tcgtatggga tgcatcgcct 2880gtcaattaaa aaggctatgg cctatggctc aggcagggcc
atccggaaga agagaggatt 2940ctgggataaa gccaggtggg agattcgcct ggggaaaatg
tgacaatggt tcctgagcat 3000gggcaatcag ccatgtggca gaatgtaaat taatataaat
gggttgtctt aagttatgat 3060tctagctggg gaggagccta gctgtgtagc caagatattt
gtaaatataa aaaaaaaaaa 3120aaaa
312494484DNARattus sp. 9atggcagctg cctggctggg
atggctgctc tgggccctgc tcctgagcgc ggcccagggt 60gagctataca cacccaaaca
cgaagctggg gtctgcacct tttacgaaga gtgcgggaaa 120aacccagagc tctctggagg
cctcacgtca ctatccaatg tatcctgcct gtctaacacc 180ccggcccgcc acgtcacggg
tgaacacctg gctcttctcc agcgcatctg tccccgcctg 240tacaacggcc ccaataccac
ttttgcctgt tgctctacca agcagctgct gtccttagaa 300agcagcatgt ccatcaccaa
ggcccttctc acgcgctgcc cggcctgctc tgacaatttt 360gtgagcttac actgccacaa
cacttgcagc cctgaccaga gcctcttcat caacgtcacc 420cgggtggttg agcggggcgc
tggagagcct cctgccgtgg tggcctatga ggccttttat 480cagcgcagct ttgctgagaa
ggcctatgag tcctgcagcc aggtgcgcat ccctgcggcc 540gcttccttgg ccgtgggcag
catgtgtgga gtgtatggct ccgccctctg caatgctcag 600cgctggctca acttccaagg
agacacaggg aatggcctgg ctccgctgga tatcaccttc 660cacctcttgg agcctggcca
ggccctaccg gatgggatcc agccactgaa tgggaagatc 720gcaccctgca acgagtctca
gggtgatgac tcagcagtct gctcctgcca ggactgtgcg 780gcgtcctgcc ctgtcatccc
tccgcccgag gccttgcgcc cttccttcta catgggtcgc 840atgccaggct ggctggccct
catcatcatc ttcactgctg tctttgtgtt gctctctgca 900gtccttgtgc gtctccgagt
ggtttccaac aggaacaaga acaaggcaga aggcccccag 960gaagccccca aactccctca
taagcacaaa ctctcacccc ataccatcct gggccggttc 1020ttccagaact ggggcacaag
ggtggcctcg tggccactca ccgtcttagc actgtccttc 1080atcgttgtga tagccttagc
agcaggcctg acctttattg aactcaccac agaccctgtg 1140gaactgtggt cggcccccaa
gagccaggcc cggaaagaga agtctttcca tgatgagcat 1200ttcggcccct tctttcgaac
caaccagatt ttcgtgacag ctcggaacag gtccagctac 1260aagtacgact ccctactgct
agggtccaag aacttcagtg ggatcctgtc cctggacttc 1320ctgctggagc tgctggagct
tcaggagagg cttcgacacc tgcaagtgtg gtcccctgag 1380gcagagcgca acatctccct
ccaggacatc tgctatgccc ccctcaaccc atataacacc 1440agcctctccg actgctgtgt
caacagcctc cttcagtact tccagaacaa ccgcaccctc 1500ctgatgctca cggccaacca
gactctgaat ggccagacct ccctggtgga ctggaaggac 1560catttcctct actgtgcaaa
tgcccctctc acgttcaaag atggcacgtc tctggccctg 1620agctgcatgg ctgactacgg
ggctcctgtc ttccccttcc ttgctgttgg gggataccaa 1680ggcacggact attccgaggc
agaagcgctg atcataacct tctctctcaa taactacccc 1740gctgatgatc cccgcatggc
ccaggccaag ctctgggagg aggctttctt gaaggaaatg 1800gaatccttcc agaggaacac
aagtgacaag ttccaggttg cgttctcagc tgagcgctct 1860ctggaggatg agatcaaccg
caccaccatc caggacctgc ctgtctttgc cgtcagctac 1920attatcgtct tcctgtacat
ctccctggcc ctgggcagct actccagatg cagccgagta 1980gcggtggagt ccaaggctac
tctgggccta ggtggggtga ttgttgtgct gggagcagtt 2040ctggctgcca tgggcttcta
ctcctacctg ggtgtcccct cttctctggt tatcatccaa 2100gtggtacctt tcctggtgct
agctgtggga gctgacaaca tcttcatctt tgttcttgag 2160taccagaggc tacctaggat
gcctggggaa cagcgagagg ctcacattgg ccgcaccctg 2220ggcagtgtgg cccccagcat
gctgctgtgc agcctctctg aggccatctg cttctttcta 2280ggggccctga cccccatgcc
agctgtgagg accttcgcct tgacctctgg cttagcaatt 2340atcctcgact tcctgctcca
gatgactgcc tttgtggccc tgctctccct ggatagcaag 2400aggcaggagg cctctcgccc
ggatgtctta tgctgctttt caacccggaa gctgccccca 2460cctaaagaaa aagaaggcct
cttactccgc ttcttccgca agatatacgc tcctttcctg 2520ctgcacagat tcatccgccc
tgttgtgatg ctgctgtttc tgaccctgtt tggagcaaat 2580ctctacttaa tgtgcaacat
caacgtgggg ctagaccagg agctggctct gcccaaggac 2640tcgtacttga tagactactt
cctctttctg aaccgatacc ttgaagtggg gcctccagtg 2700tactttgtca ccacctcggg
cttcaacttc tccagcgagg caggcatgaa cgccacttgc 2760tctagcgcag gctgtaagag
cttctcccta acccagaaaa tccagtatgc cagtgaattc 2820cctgaccagt cttacgtggc
tattgctgca tcctcctggg tagatgactt catcgactgg 2880ctgaccccgt cctcctcctg
ctgtcgcctt tatatacgtg gcccccataa ggatgagttc 2940tgtccctcaa cggatacttc
cttcaactgc ttaaaaaact gcatgaaccg cactctgggt 3000cctgtgaggc ccacagcgga
acagtttcat aagtacctgc cctggttcct gaatgatccg 3060cccaatatca gatgtcccaa
agggggtcta gcagcgtata gaacgtctgt gaatttgagc 3120tcagatggcc aggttatagc
ctcccagttc atggcctacc acaagccctt aaggaactca 3180caggacttca cagaagctct
ccgggcgtcc cggttgctag cagccaacat cacagctgac 3240ctacggaagg tgcctgggac
agatccaaac tttgaggtct tcccttacac gatctccaac 3300gtgttctacc agcaatacct
gacggtcctt cctgagggaa tcttcaccct tgctctttgc 3360tttgtgccca cctttgttgt
ctgctacctc ctactgggcc tggacatgtg ctcagggatc 3420ctcaacctac tctccatcat
tatgattctc gtggacacca ttggcctcat ggctgtgtgg 3480ggtatcagct ataatgcggt
atccctcatc aaccttgtca cggcagtggg catgtctgtg 3540gagtttgtgt cccacatcac
tcggtccttt gctgtaagca ccaagcctac ccggctggag 3600agggctaaag atgctactgt
cttcatgggc agtgcggtgt ttgctggagt ggccatgacc 3660aacttcccag gcatcctcat
cttgggcttt gcccaagccc agcttattca gatcttcttc 3720ttccgcctca accttctgat
caccttgctg ggtctgctgc atggcctggt cttcctgccg 3780gttgtcctca gctatctggg
accagatgtt aaccaagctc tggtacagga ggagaaacta 3840gccagcgagg cagcagtggc
cccagagcct tcttgcccac agtacccctc ccctgctgat 3900gcggatgcca atgttaacta
cggctttgcc ccagaacttg cccacggagc taatgctgct 3960agaagctctt tgcccaaaag
tgaccaaaag ttctaatgga gtaggagctt gtccatgctt 4020cttgctgatg agggatcatg
aaggtcttcc ctctggttgt cctcaaggcc tggggggagg 4080ttgtttcaga gaaaaatggc
tggcattcct gccacgaggc aaccggcagc attggcactg 4140acctccttgc tctcataggt
ccctaaggcc ttggtcagat tacctcctcc atggagagac 4200tatcttaagt atcttaagta
tcgtatggga tgcatcgcct gtcaattaaa aaggctatgg 4260cctatggctc aggcagggcc
atccggaaga agagaggatt ctgggataaa gccaggtggg 4320agattcgcct ggggaaaatg
tgacaatggt tcctgagcat gggcaatcag ccatgtggca 4380gaatgtaaat taatataaat
gggttgtctt aagttatgat tctagctggg gaggagccta 4440gctgtgtagc caagatattt
gtaaatataa aaaaaaaaaa aaaa 4484103993DNARattus
sp.misc_feature(1)..(3993)n is g or a or t or c 10atggcngcng cntggytngg
ntggytnytn tgggcnytny tnytnwsngc ngcncarggn 60garytntaya cnccnaarca
ygargcnggn gtntgyacnt tytaygarga rtgyggnaar 120aayccngary tnwsnggngg
nytnacnwsn ytnwsnaayg tnwsntgyyt nwsnaayacn 180ccngcnmgnc aygtnacngg
ngarcayytn gcnytnytnc armgnathtg yccnmgnytn 240tayaayggnc cnaayacnac
nttygcntgy tgywsnacna arcarytnyt nwsnytngar 300wsnwsnatgw snathacnaa
rgcnytnytn acnmgntgyc cngcntgyws ngayaaytty 360gtnwsnytnc aytgycayaa
yacntgywsn ccngaycarw snytnttyat haaygtnacn 420mgngtngtng armgnggngc
nggngarccn ccngcngtng tngcntayga rgcnttytay 480carmgnwsnt tygcngaraa
rgcntaygar wsntgywsnc argtnmgnat hccngcngcn 540gcnwsnytng cngtnggnws
natgtgyggn gtntayggnw sngcnytntg yaaygcncar 600mgntggytna ayttycargg
ngayacnggn aayggnytng cnccnytnga yathacntty 660cayytnytng arccnggnca
rgcnytnccn gayggnathc arccnytnaa yggnaarath 720gcnccntgya aygarwsnca
rggngaygay wsngcngtnt gywsntgyca rgaytgygcn 780gcnwsntgyc cngtnathcc
nccnccngar gcnytnmgnc cnwsnttyta yatgggnmgn 840atgccnggnt ggytngcnyt
nathathath ttyacngcng tnttygtnyt nytnwsngcn 900gtnytngtnm gnytnmgngt
ngtnwsnaay mgnaayaara ayaargcnga rggnccncar 960gargcnccna arytnccnca
yaarcayaar ytnwsnccnc ayacnathyt nggnmgntty 1020ttycaraayt ggggnacnmg
ngtngcnwsn tggccnytna cngtnytngc nytnwsntty 1080athgtngtna thgcnytngc
ngcnggnytn acnttyathg arytnacnac ngayccngtn 1140garytntggw sngcnccnaa
rwsncargcn mgnaargara arwsnttyca ygaygarcay 1200ttyggnccnt tyttymgnac
naaycarath ttygtnacng cnmgnaaymg nwsnwsntay 1260aartaygayw snytnytnyt
nggnwsnaar aayttywsng gnathytnws nytngaytty 1320ytnytngary tnytngaryt
ncargarmgn ytnmgncayy tncargtntg gwsnccngar 1380gcngarmgna ayathwsnyt
ncargayath tgytaygcnc cnytnaaycc ntayaayacn 1440wsnytnwsng aytgytgygt
naaywsnytn ytncartayt tycaraayaa ymgnacnytn 1500ytnatgytna cngcnaayca
racnytnaay ggncaracnw snytngtnga ytggaargay 1560cayttyytnt aytgygcnaa
ygcnccnytn acnttyaarg ayggnacnws nytngcnytn 1620wsntgyatgg cngaytaygg
ngcnccngtn ttyccnttyy tngcngtngg nggntaycar 1680ggnacngayt aywsngargc
ngargcnytn athathacnt tywsnytnaa yaaytayccn 1740gcngaygayc cnmgnatggc
ncargcnaar ytntgggarg argcnttyyt naargaratg 1800garwsnttyc armgnaayac
nwsngayaar ttycargtng cnttywsngc ngarmgnwsn 1860ytngargayg arathaaymg
nacnacnath cargayytnc cngtnttygc ngtnwsntay 1920athathgtnt tyytntayat
hwsnytngcn ytnggnwsnt aywsnmgntg ywsnmgngtn 1980gcngtngarw snaargcnac
nytnggnytn ggnggngtna thgtngtnyt nggngcngtn 2040ytngcngcna tgggnttyta
ywsntayytn ggngtnccnw snwsnytngt nathathcar 2100gtngtnccnt tyytngtnyt
ngcngtnggn gcngayaaya thttyathtt ygtnytngar 2160taycarmgny tnccnmgnat
gccnggngar carmgngarg cncayathgg nmgnacnytn 2220ggnwsngtng cnccnwsnat
gytnytntgy wsnytnwsng argcnathtg yttyttyytn 2280ggngcnytna cnccnatgcc
ngcngtnmgn acnttygcny tnacnwsngg nytngcnath 2340athytngayt tyytnytnca
ratgacngcn ttygtngcny tnytnwsnyt ngaywsnaar 2400mgncargarg cnwsnmgncc
ngaygtnytn tgytgyttyw snacnmgnaa rytnccnccn 2460ccnaargara argarggnyt
nytnytnmgn ttyttymgna arathtaygc nccnttyytn 2520ytncaymgnt tyathmgncc
ngtngtnatg ytnytnttyy tnacnytntt yggngcnaay 2580ytntayytna tgtgyaayat
haaygtnggn ytngaycarg arytngcnyt nccnaargay 2640wsntayytna thgaytaytt
yytnttyytn aaymgntayy tngargtngg nccnccngtn 2700tayttygtna cnacnwsngg
nttyaaytty wsnwsngarg cnggnatgaa ygcnacntgy 2760wsnwsngcng gntgyaarws
nttywsnytn acncaraara thcartaygc nwsngartty 2820ccngaycarw sntaygtngc
nathgcngcn wsnwsntggg tngaygaytt yathgaytgg 2880ytnacnccnw snwsnwsntg
ytgymgnytn tayathmgng gnccncayaa rgaygartty 2940tgyccnwsna cngayacnws
nttyaaytgy ytnaaraayt gyatgaaymg nacnytnggn 3000ccngtnmgnc cnacngcnga
rcarttycay aartayytnc cntggttyyt naaygayccn 3060ccnaayathm gntgyccnaa
rggnggnytn gcngcntaym gnacnwsngt naayytnwsn 3120wsngayggnc argtnathgc
nwsncartty atggcntayc ayaarccnyt nmgnaaywsn 3180cargayttya cngargcnyt
nmgngcnwsn mgnytnytng cngcnaayat hacngcngay 3240ytnmgnaarg tnccnggnac
ngayccnaay ttygargtnt tyccntayac nathwsnaay 3300gtnttytayc arcartayyt
nacngtnytn ccngarggna thttyacnyt ngcnytntgy 3360ttygtnccna cnttygtngt
ntgytayytn ytnytnggny tngayatgtg ywsnggnath 3420ytnaayytny tnwsnathat
hatgathytn gtngayacna thggnytnat ggcngtntgg 3480ggnathwsnt ayaaygcngt
nwsnytnath aayytngtna cngcngtngg natgwsngtn 3540garttygtnw sncayathac
nmgnwsntty gcngtnwsna cnaarccnac nmgnytngar 3600mgngcnaarg aygcnacngt
nttyatgggn wsngcngtnt tygcnggngt ngcnatgacn 3660aayttyccng gnathytnat
hytnggntty gcncargcnc arytnathca rathttytty 3720ttymgnytna ayytnytnat
hacnytnytn ggnytnytnc ayggnytngt nttyytnccn 3780gtngtnytnw sntayytngg
nccngaygtn aaycargcny tngtncarga rgaraarytn 3840gcnwsngarg cngcngtngc
nccngarccn wsntgyccnc artayccnws nccngcngay 3900gcngaygcna aygtnaayta
yggnttygcn ccngarytng cncayggngc naaygcngcn 3960mgnwsnwsny tnccnaarws
ngaycaraar tty 3993114002DNAMus
sp.CDS(1)..(4002) 11atg gca gct gcc tgg cag gga tgg ctg ctc tgg gcc ctg
ctc ctg aat 48Met Ala Ala Ala Trp Gln Gly Trp Leu Leu Trp Ala Leu
Leu Leu Asn1 5 10 15tcg
gcc cag ggt gag ctc tac aca ccc act cac aaa gct ggc ttc tgc 96Ser
Ala Gln Gly Glu Leu Tyr Thr Pro Thr His Lys Ala Gly Phe Cys 20
25 30acc ttt tat gaa gag tgt ggg aag
aac cca gag ctt tct gga ggc ctc 144Thr Phe Tyr Glu Glu Cys Gly Lys
Asn Pro Glu Leu Ser Gly Gly Leu 35 40
45aca tca cta tcc aat atc tcc tgc ttg tct aat acc cca gcc cgc cat
192Thr Ser Leu Ser Asn Ile Ser Cys Leu Ser Asn Thr Pro Ala Arg His
50 55 60gtc aca ggt gac cac ctg gct ctt
ctc cag cgc gtc tgt ccc cgc cta 240Val Thr Gly Asp His Leu Ala Leu
Leu Gln Arg Val Cys Pro Arg Leu65 70 75
80tac aat ggc ccc aat gac acc tat gcc tgt tgc tct acc
aag cag ctg 288Tyr Asn Gly Pro Asn Asp Thr Tyr Ala Cys Cys Ser Thr
Lys Gln Leu 85 90 95gtg
tca tta gac agt agc ctg tct atc acc aag gcc ctc ctt aca cgc 336Val
Ser Leu Asp Ser Ser Leu Ser Ile Thr Lys Ala Leu Leu Thr Arg
100 105 110tgc ccg gca tgc tct gaa aat
ttt gtg agc ata cac tgt cat aat acc 384Cys Pro Ala Cys Ser Glu Asn
Phe Val Ser Ile His Cys His Asn Thr 115 120
125tgc agc cct gac cag agc ctc ttc atc aat gtt act cgc gtg gtt
cag 432Cys Ser Pro Asp Gln Ser Leu Phe Ile Asn Val Thr Arg Val Val
Gln 130 135 140cgg gac cct gga cag ctt
cct gct gtg gtg gcc tat gag gcc ttt tat 480Arg Asp Pro Gly Gln Leu
Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr145 150
155 160caa cgc agt ttt gca gag aag gcc tat gag tcc
tgt agc cgg gtg cgc 528Gln Arg Ser Phe Ala Glu Lys Ala Tyr Glu Ser
Cys Ser Arg Val Arg 165 170
175atc cct gca gct gcc tcg ctg gct gtg ggc agc atg tgt gga gtg tat
576Ile Pro Ala Ala Ala Ser Leu Ala Val Gly Ser Met Cys Gly Val Tyr
180 185 190ggc tct gcc ctc tgc aat
gct cag cgc tgg ctc aac ttc caa gga gac 624Gly Ser Ala Leu Cys Asn
Ala Gln Arg Trp Leu Asn Phe Gln Gly Asp 195 200
205aca ggg aat ggc ctg gct ccg ctg gac atc acc ttc cac ctc
ttg gag 672Thr Gly Asn Gly Leu Ala Pro Leu Asp Ile Thr Phe His Leu
Leu Glu 210 215 220cct ggc cag gcc ctg
gca gat ggg atg aag cca ctg gat ggg aag atc 720Pro Gly Gln Ala Leu
Ala Asp Gly Met Lys Pro Leu Asp Gly Lys Ile225 230
235 240aca ccc tgc aat gag tcc cag ggt gaa gac
tcg gca gcc tgt tcc tgc 768Thr Pro Cys Asn Glu Ser Gln Gly Glu Asp
Ser Ala Ala Cys Ser Cys 245 250
255cag gac tgt gca gca tcc tgc cct gtc atc cct ccg ccc ccg gcc ctg
816Gln Asp Cys Ala Ala Ser Cys Pro Val Ile Pro Pro Pro Pro Ala Leu
260 265 270cgc cct tct ttc tac atg
ggt cga atg cca ggc tgg ctg gct ctc atc 864Arg Pro Ser Phe Tyr Met
Gly Arg Met Pro Gly Trp Leu Ala Leu Ile 275 280
285atc atc ttc act gct gtc ttt gta ttg ctc tct gtt gtc ctt
gtg tat 912Ile Ile Phe Thr Ala Val Phe Val Leu Leu Ser Val Val Leu
Val Tyr 290 295 300ctc cga gtg gct tcc
aac agg aac aag aac aag aca gca ggc tcc cag 960Leu Arg Val Ala Ser
Asn Arg Asn Lys Asn Lys Thr Ala Gly Ser Gln305 310
315 320gaa gcc ccc aac ctc cct cgt aag cgc aga
ttc tca cct cac act gtc 1008Glu Ala Pro Asn Leu Pro Arg Lys Arg Arg
Phe Ser Pro His Thr Val 325 330
335ctt ggc cgg ttc ttc gag agc tgg gga aca agg gtg gcc tca tgg cca
1056Leu Gly Arg Phe Phe Glu Ser Trp Gly Thr Arg Val Ala Ser Trp Pro
340 345 350ctc act gtc ttg gca ctg
tcc ttc ata gtt gtg ata gcc ttg tca gta 1104Leu Thr Val Leu Ala Leu
Ser Phe Ile Val Val Ile Ala Leu Ser Val 355 360
365ggc ctg acc ttt ata gaa ctc acc aca gac cct gtg gaa ctg
tgg tcg 1152Gly Leu Thr Phe Ile Glu Leu Thr Thr Asp Pro Val Glu Leu
Trp Ser 370 375 380gcc cct aaa agc caa
gcc cgg aaa gaa aag gct ttc cat gac gag cat 1200Ala Pro Lys Ser Gln
Ala Arg Lys Glu Lys Ala Phe His Asp Glu His385 390
395 400ttt ggc ccc ttc ttc cga acc aac cag att
ttt gtg aca gct aag aac 1248Phe Gly Pro Phe Phe Arg Thr Asn Gln Ile
Phe Val Thr Ala Lys Asn 405 410
415agg tcc agc tac aag tac gac tcc ctg ctg cta ggg ccc aag aac ttc
1296Arg Ser Ser Tyr Lys Tyr Asp Ser Leu Leu Leu Gly Pro Lys Asn Phe
420 425 430agt ggg atc cta tcc ctg
gac ttg ctg cag gag ctg ttg gag cta cag 1344Ser Gly Ile Leu Ser Leu
Asp Leu Leu Gln Glu Leu Leu Glu Leu Gln 435 440
445gag aga ctt cga cac ctg caa gtg tgg tcc cat gag gca cag
cgc aac 1392Glu Arg Leu Arg His Leu Gln Val Trp Ser His Glu Ala Gln
Arg Asn 450 455 460atc tcc ctc cag gac
atc tgc tat gct ccc ctc aac ccg cat aac acc 1440Ile Ser Leu Gln Asp
Ile Cys Tyr Ala Pro Leu Asn Pro His Asn Thr465 470
475 480agc ctc act gac tgc tgt gtc aac agc ctc
ctt caa tac ttc cag aac 1488Ser Leu Thr Asp Cys Cys Val Asn Ser Leu
Leu Gln Tyr Phe Gln Asn 485 490
495aac cac aca ctc ctg ctg ctc aca gcc aat cag act ctg aat ggc cag
1536Asn His Thr Leu Leu Leu Leu Thr Ala Asn Gln Thr Leu Asn Gly Gln
500 505 510acc tcc ctg gtg gac tgg
aag gac cat ttc ctc tac tgt gcc aat gcc 1584Thr Ser Leu Val Asp Trp
Lys Asp His Phe Leu Tyr Cys Ala Asn Ala 515 520
525cct ctc acg tac aaa gat ggc aca gcc ctg gcc ctg agc tgc
ata gct 1632Pro Leu Thr Tyr Lys Asp Gly Thr Ala Leu Ala Leu Ser Cys
Ile Ala 530 535 540gac tac ggg gca cct
gtc ttc ccc ttc ctt gct gtt ggg ggc tac caa 1680Asp Tyr Gly Ala Pro
Val Phe Pro Phe Leu Ala Val Gly Gly Tyr Gln545 550
555 560ggg acg gac tac tcg gag gca gaa gcc ctg
atc ata acc ttc tct atc 1728Gly Thr Asp Tyr Ser Glu Ala Glu Ala Leu
Ile Ile Thr Phe Ser Ile 565 570
575aat aac tac ccc gct gat gat ccc cgc atg gcc cac gcc aag ctc tgg
1776Asn Asn Tyr Pro Ala Asp Asp Pro Arg Met Ala His Ala Lys Leu Trp
580 585 590gag gag gct ttc ttg aag
gaa atg caa tcc ttc cag aga agc aca gct 1824Glu Glu Ala Phe Leu Lys
Glu Met Gln Ser Phe Gln Arg Ser Thr Ala 595 600
605gac aag ttc cag att gcg ttc tca gct gag cgt tct ctg gag
gac gag 1872Asp Lys Phe Gln Ile Ala Phe Ser Ala Glu Arg Ser Leu Glu
Asp Glu 610 615 620atc aat cgc act acc
atc cag gac ctg cct gtc ttt gcc atc agc tac 1920Ile Asn Arg Thr Thr
Ile Gln Asp Leu Pro Val Phe Ala Ile Ser Tyr625 630
635 640ctt atc gtc ttc ctg tac atc tcc ctg gcc
ctg ggc agc tac tcc aga 1968Leu Ile Val Phe Leu Tyr Ile Ser Leu Ala
Leu Gly Ser Tyr Ser Arg 645 650
655tgg agc cga gtt gcg gtg gat tcc aag gct act ctg ggc cta ggt ggg
2016Trp Ser Arg Val Ala Val Asp Ser Lys Ala Thr Leu Gly Leu Gly Gly
660 665 670gtg gct gtt gtg ctg gga
gca gtc gtc gct gcc atg ggc ttc tac tcc 2064Val Ala Val Val Leu Gly
Ala Val Val Ala Ala Met Gly Phe Tyr Ser 675 680
685tac ctg ggt gtc ccc tcc tct ctg gtc atc att caa gtg gta
cct ttc 2112Tyr Leu Gly Val Pro Ser Ser Leu Val Ile Ile Gln Val Val
Pro Phe 690 695 700ctg gtg ctg gct gtg
gga gct gac aac atc ttc atc ttt gtt ctt gag 2160Leu Val Leu Ala Val
Gly Ala Asp Asn Ile Phe Ile Phe Val Leu Glu705 710
715 720tac cag agg ctg cct agg atg ccc ggg gag
cag cga gag gct cac att 2208Tyr Gln Arg Leu Pro Arg Met Pro Gly Glu
Gln Arg Glu Ala His Ile 725 730
735ggc cgc acc ctg ggt agt gtg gcc ccc agc atg ctg ctg tgc agc ctc
2256Gly Arg Thr Leu Gly Ser Val Ala Pro Ser Met Leu Leu Cys Ser Leu
740 745 750tct gag gcc atc tgc ttc
ttt cta ggg gcc ctg acc tcc atg cca gct 2304Ser Glu Ala Ile Cys Phe
Phe Leu Gly Ala Leu Thr Ser Met Pro Ala 755 760
765gtg agg acc ttt gcc ttg acc tct ggc tta gca atc atc ttt
gac ttc 2352Val Arg Thr Phe Ala Leu Thr Ser Gly Leu Ala Ile Ile Phe
Asp Phe 770 775 780ctg ctc cag atg aca
gcc ttt gtg gcc ctg ctc tcc ctg gat agc aag 2400Leu Leu Gln Met Thr
Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys785 790
795 800agg cag gag gcc tct cgc ccc gac gtc gtg
tgc tgc ttt tca agc cga 2448Arg Gln Glu Ala Ser Arg Pro Asp Val Val
Cys Cys Phe Ser Ser Arg 805 810
815aat ctg ccc cca ccg aaa caa aaa gaa ggc ctc tta ctt tgc ttc ttc
2496Asn Leu Pro Pro Pro Lys Gln Lys Glu Gly Leu Leu Leu Cys Phe Phe
820 825 830cgc aag ata tac act ccc
ttc ctg ctg cac aga ttc atc cgc cct gtt 2544Arg Lys Ile Tyr Thr Pro
Phe Leu Leu His Arg Phe Ile Arg Pro Val 835 840
845gtg ctg ctg ctc ttt ctg gtc ctg ttt gga gca aac ctc tac
tta atg 2592Val Leu Leu Leu Phe Leu Val Leu Phe Gly Ala Asn Leu Tyr
Leu Met 850 855 860tgc aac atc agc gtg
ggg ctg gac cag gat ctg gct ctg ccc aag gat 2640Cys Asn Ile Ser Val
Gly Leu Asp Gln Asp Leu Ala Leu Pro Lys Asp865 870
875 880tcc tac ctg ata gac tac ttc ctc ttt ctg
aac cgg tac ttg gaa gtg 2688Ser Tyr Leu Ile Asp Tyr Phe Leu Phe Leu
Asn Arg Tyr Leu Glu Val 885 890
895ggg cct cca gtg tac ttt gac acc acc tca ggc tac aac ttt tcc acc
2736Gly Pro Pro Val Tyr Phe Asp Thr Thr Ser Gly Tyr Asn Phe Ser Thr
900 905 910gag gca ggc atg aac gcc
att tgc tct agt gca ggc tgt gag agc ttc 2784Glu Ala Gly Met Asn Ala
Ile Cys Ser Ser Ala Gly Cys Glu Ser Phe 915 920
925tcc cta acc cag aaa atc cag tat gcc agt gaa ttc cct aat
cag tct 2832Ser Leu Thr Gln Lys Ile Gln Tyr Ala Ser Glu Phe Pro Asn
Gln Ser 930 935 940tat gtg gct att gct
gca tcc tcc tgg gta gat gac ttc atc gac tgg 2880Tyr Val Ala Ile Ala
Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp945 950
955 960ctg acc cca tcc tcc tcc tgc tgc cgc att
tat acc cgt ggc ccc cat 2928Leu Thr Pro Ser Ser Ser Cys Cys Arg Ile
Tyr Thr Arg Gly Pro His 965 970
975aaa gat gag ttc tgt ccc tca acg gat act tcc ttc aac tgt ctc aaa
2976Lys Asp Glu Phe Cys Pro Ser Thr Asp Thr Ser Phe Asn Cys Leu Lys
980 985 990aac tgc atg aac cgc act
ctg ggt ccc gtg aga ccc aca aca gaa cag 3024Asn Cys Met Asn Arg Thr
Leu Gly Pro Val Arg Pro Thr Thr Glu Gln 995 1000
1005ttt cat aag tac ctg ccc tgg ttc ctg aat gat acg
ccc aac atc 3069Phe His Lys Tyr Leu Pro Trp Phe Leu Asn Asp Thr
Pro Asn Ile 1010 1015 1020aga tgt cct
aaa ggg ggc cta gca gcg tat aga acc tct gtg aat 3114Arg Cys Pro
Lys Gly Gly Leu Ala Ala Tyr Arg Thr Ser Val Asn 1025
1030 1035ttg agc tca gat ggc cag att ata gcc tcc cag
ttc atg gcc tac 3159Leu Ser Ser Asp Gly Gln Ile Ile Ala Ser Gln
Phe Met Ala Tyr 1040 1045 1050cac aag
ccc tta cgg aac tca cag gac ttt aca gaa gct ctc cgg 3204His Lys
Pro Leu Arg Asn Ser Gln Asp Phe Thr Glu Ala Leu Arg 1055
1060 1065gca tcc cgg ttg cta gca gcc aac atc aca
gct gaa cta cgg aag 3249Ala Ser Arg Leu Leu Ala Ala Asn Ile Thr
Ala Glu Leu Arg Lys 1070 1075 1080gtg
cct ggg aca gat ccc aac ttt gag gtc ttc cct tac acg atc 3294Val
Pro Gly Thr Asp Pro Asn Phe Glu Val Phe Pro Tyr Thr Ile 1085
1090 1095tcc aat gtg ttc tac cag caa tac ctg
acg gtt ctc cct gag gga 3339Ser Asn Val Phe Tyr Gln Gln Tyr Leu
Thr Val Leu Pro Glu Gly 1100 1105
1110atc ttc act ctt gct ctc tgc ttc gtg ccc acc ttt gtg gtc tgc
3384Ile Phe Thr Leu Ala Leu Cys Phe Val Pro Thr Phe Val Val Cys
1115 1120 1125tac ctc cta ctg ggc ctg
gac ata cgc tca ggc atc ctc aac ctg 3429Tyr Leu Leu Leu Gly Leu
Asp Ile Arg Ser Gly Ile Leu Asn Leu 1130 1135
1140ctc tcc atc att atg atc ctc gtg gac acc atc ggc ctc atg
gct 3474Leu Ser Ile Ile Met Ile Leu Val Asp Thr Ile Gly Leu Met
Ala 1145 1150 1155gtg tgg ggt atc agc
tac aat gct gtg tcc ctc atc aac ctt gtc 3519Val Trp Gly Ile Ser
Tyr Asn Ala Val Ser Leu Ile Asn Leu Val 1160 1165
1170acg gca gtg ggc atg tct gtg gag ttc gtg tcc cac att
acc cgg 3564Thr Ala Val Gly Met Ser Val Glu Phe Val Ser His Ile
Thr Arg 1175 1180 1185tcc ttt gct gta
agc acc aag cct acc cgg ctg gag aga gcc aaa 3609Ser Phe Ala Val
Ser Thr Lys Pro Thr Arg Leu Glu Arg Ala Lys 1190
1195 1200gat gct act atc ttc atg ggc agt gcg gtg ttt
gct gga gtg gcc 3654Asp Ala Thr Ile Phe Met Gly Ser Ala Val Phe
Ala Gly Val Ala 1205 1210 1215atg acc
aac ttc ccg ggc atc ctc atc ctg ggc ttt gct cag gcc 3699Met Thr
Asn Phe Pro Gly Ile Leu Ile Leu Gly Phe Ala Gln Ala 1220
1225 1230cag ctt atc cag att ttc ttc ttc cgc ctc
aac ctc ctg atc acc 3744Gln Leu Ile Gln Ile Phe Phe Phe Arg Leu
Asn Leu Leu Ile Thr 1235 1240 1245ttg
ctg ggt ctg cta cac ggc ctg gtc ttc ctg ccc gtt gtc ctc 3789Leu
Leu Gly Leu Leu His Gly Leu Val Phe Leu Pro Val Val Leu 1250
1255 1260agc tat ctg ggg cca gat gtt aac caa
gct ctg gta ctg gag gag 3834Ser Tyr Leu Gly Pro Asp Val Asn Gln
Ala Leu Val Leu Glu Glu 1265 1270
1275aaa cta gcc act gag gca gcc atg gtc tca gag cct tct tgc cca
3879Lys Leu Ala Thr Glu Ala Ala Met Val Ser Glu Pro Ser Cys Pro
1280 1285 1290cag tac ccc ttc ccg gct
gat gca aac acc agt gac tat gtt aac 3924Gln Tyr Pro Phe Pro Ala
Asp Ala Asn Thr Ser Asp Tyr Val Asn 1295 1300
1305tac ggc ttt aat cca gaa ttt atc cct gaa att aat gct gct
agc 3969Tyr Gly Phe Asn Pro Glu Phe Ile Pro Glu Ile Asn Ala Ala
Ser 1310 1315 1320agc tct ctg ccc aaa
agt gac caa aag ttc taa 4002Ser Ser Leu Pro Lys
Ser Asp Gln Lys Phe 1325 1330121333PRTMus sp. 12Met
Ala Ala Ala Trp Gln Gly Trp Leu Leu Trp Ala Leu Leu Leu Asn1
5 10 15Ser Ala Gln Gly Glu Leu Tyr
Thr Pro Thr His Lys Ala Gly Phe Cys 20 25
30Thr Phe Tyr Glu Glu Cys Gly Lys Asn Pro Glu Leu Ser Gly
Gly Leu 35 40 45Thr Ser Leu Ser
Asn Ile Ser Cys Leu Ser Asn Thr Pro Ala Arg His 50 55
60Val Thr Gly Asp His Leu Ala Leu Leu Gln Arg Val Cys
Pro Arg Leu65 70 75
80Tyr Asn Gly Pro Asn Asp Thr Tyr Ala Cys Cys Ser Thr Lys Gln Leu
85 90 95Val Ser Leu Asp Ser Ser
Leu Ser Ile Thr Lys Ala Leu Leu Thr Arg 100
105 110Cys Pro Ala Cys Ser Glu Asn Phe Val Ser Ile His
Cys His Asn Thr 115 120 125Cys Ser
Pro Asp Gln Ser Leu Phe Ile Asn Val Thr Arg Val Val Gln 130
135 140Arg Asp Pro Gly Gln Leu Pro Ala Val Val Ala
Tyr Glu Ala Phe Tyr145 150 155
160Gln Arg Ser Phe Ala Glu Lys Ala Tyr Glu Ser Cys Ser Arg Val Arg
165 170 175Ile Pro Ala Ala
Ala Ser Leu Ala Val Gly Ser Met Cys Gly Val Tyr 180
185 190Gly Ser Ala Leu Cys Asn Ala Gln Arg Trp Leu
Asn Phe Gln Gly Asp 195 200 205Thr
Gly Asn Gly Leu Ala Pro Leu Asp Ile Thr Phe His Leu Leu Glu 210
215 220Pro Gly Gln Ala Leu Ala Asp Gly Met Lys
Pro Leu Asp Gly Lys Ile225 230 235
240Thr Pro Cys Asn Glu Ser Gln Gly Glu Asp Ser Ala Ala Cys Ser
Cys 245 250 255Gln Asp Cys
Ala Ala Ser Cys Pro Val Ile Pro Pro Pro Pro Ala Leu 260
265 270Arg Pro Ser Phe Tyr Met Gly Arg Met Pro
Gly Trp Leu Ala Leu Ile 275 280
285Ile Ile Phe Thr Ala Val Phe Val Leu Leu Ser Val Val Leu Val Tyr 290
295 300Leu Arg Val Ala Ser Asn Arg Asn
Lys Asn Lys Thr Ala Gly Ser Gln305 310
315 320Glu Ala Pro Asn Leu Pro Arg Lys Arg Arg Phe Ser
Pro His Thr Val 325 330
335Leu Gly Arg Phe Phe Glu Ser Trp Gly Thr Arg Val Ala Ser Trp Pro
340 345 350Leu Thr Val Leu Ala Leu
Ser Phe Ile Val Val Ile Ala Leu Ser Val 355 360
365Gly Leu Thr Phe Ile Glu Leu Thr Thr Asp Pro Val Glu Leu
Trp Ser 370 375 380Ala Pro Lys Ser Gln
Ala Arg Lys Glu Lys Ala Phe His Asp Glu His385 390
395 400Phe Gly Pro Phe Phe Arg Thr Asn Gln Ile
Phe Val Thr Ala Lys Asn 405 410
415Arg Ser Ser Tyr Lys Tyr Asp Ser Leu Leu Leu Gly Pro Lys Asn Phe
420 425 430Ser Gly Ile Leu Ser
Leu Asp Leu Leu Gln Glu Leu Leu Glu Leu Gln 435
440 445Glu Arg Leu Arg His Leu Gln Val Trp Ser His Glu
Ala Gln Arg Asn 450 455 460Ile Ser Leu
Gln Asp Ile Cys Tyr Ala Pro Leu Asn Pro His Asn Thr465
470 475 480Ser Leu Thr Asp Cys Cys Val
Asn Ser Leu Leu Gln Tyr Phe Gln Asn 485
490 495Asn His Thr Leu Leu Leu Leu Thr Ala Asn Gln Thr
Leu Asn Gly Gln 500 505 510Thr
Ser Leu Val Asp Trp Lys Asp His Phe Leu Tyr Cys Ala Asn Ala 515
520 525Pro Leu Thr Tyr Lys Asp Gly Thr Ala
Leu Ala Leu Ser Cys Ile Ala 530 535
540Asp Tyr Gly Ala Pro Val Phe Pro Phe Leu Ala Val Gly Gly Tyr Gln545
550 555 560Gly Thr Asp Tyr
Ser Glu Ala Glu Ala Leu Ile Ile Thr Phe Ser Ile 565
570 575Asn Asn Tyr Pro Ala Asp Asp Pro Arg Met
Ala His Ala Lys Leu Trp 580 585
590Glu Glu Ala Phe Leu Lys Glu Met Gln Ser Phe Gln Arg Ser Thr Ala
595 600 605Asp Lys Phe Gln Ile Ala Phe
Ser Ala Glu Arg Ser Leu Glu Asp Glu 610 615
620Ile Asn Arg Thr Thr Ile Gln Asp Leu Pro Val Phe Ala Ile Ser
Tyr625 630 635 640Leu Ile
Val Phe Leu Tyr Ile Ser Leu Ala Leu Gly Ser Tyr Ser Arg
645 650 655Trp Ser Arg Val Ala Val Asp
Ser Lys Ala Thr Leu Gly Leu Gly Gly 660 665
670Val Ala Val Val Leu Gly Ala Val Val Ala Ala Met Gly Phe
Tyr Ser 675 680 685Tyr Leu Gly Val
Pro Ser Ser Leu Val Ile Ile Gln Val Val Pro Phe 690
695 700Leu Val Leu Ala Val Gly Ala Asp Asn Ile Phe Ile
Phe Val Leu Glu705 710 715
720Tyr Gln Arg Leu Pro Arg Met Pro Gly Glu Gln Arg Glu Ala His Ile
725 730 735Gly Arg Thr Leu Gly
Ser Val Ala Pro Ser Met Leu Leu Cys Ser Leu 740
745 750Ser Glu Ala Ile Cys Phe Phe Leu Gly Ala Leu Thr
Ser Met Pro Ala 755 760 765Val Arg
Thr Phe Ala Leu Thr Ser Gly Leu Ala Ile Ile Phe Asp Phe 770
775 780Leu Leu Gln Met Thr Ala Phe Val Ala Leu Leu
Ser Leu Asp Ser Lys785 790 795
800Arg Gln Glu Ala Ser Arg Pro Asp Val Val Cys Cys Phe Ser Ser Arg
805 810 815Asn Leu Pro Pro
Pro Lys Gln Lys Glu Gly Leu Leu Leu Cys Phe Phe 820
825 830Arg Lys Ile Tyr Thr Pro Phe Leu Leu His Arg
Phe Ile Arg Pro Val 835 840 845Val
Leu Leu Leu Phe Leu Val Leu Phe Gly Ala Asn Leu Tyr Leu Met 850
855 860Cys Asn Ile Ser Val Gly Leu Asp Gln Asp
Leu Ala Leu Pro Lys Asp865 870 875
880Ser Tyr Leu Ile Asp Tyr Phe Leu Phe Leu Asn Arg Tyr Leu Glu
Val 885 890 895Gly Pro Pro
Val Tyr Phe Asp Thr Thr Ser Gly Tyr Asn Phe Ser Thr 900
905 910Glu Ala Gly Met Asn Ala Ile Cys Ser Ser
Ala Gly Cys Glu Ser Phe 915 920
925Ser Leu Thr Gln Lys Ile Gln Tyr Ala Ser Glu Phe Pro Asn Gln Ser 930
935 940Tyr Val Ala Ile Ala Ala Ser Ser
Trp Val Asp Asp Phe Ile Asp Trp945 950
955 960Leu Thr Pro Ser Ser Ser Cys Cys Arg Ile Tyr Thr
Arg Gly Pro His 965 970
975Lys Asp Glu Phe Cys Pro Ser Thr Asp Thr Ser Phe Asn Cys Leu Lys
980 985 990Asn Cys Met Asn Arg Thr
Leu Gly Pro Val Arg Pro Thr Thr Glu Gln 995 1000
1005Phe His Lys Tyr Leu Pro Trp Phe Leu Asn Asp Thr
Pro Asn Ile 1010 1015 1020Arg Cys Pro
Lys Gly Gly Leu Ala Ala Tyr Arg Thr Ser Val Asn 1025
1030 1035Leu Ser Ser Asp Gly Gln Ile Ile Ala Ser Gln
Phe Met Ala Tyr 1040 1045 1050His Lys
Pro Leu Arg Asn Ser Gln Asp Phe Thr Glu Ala Leu Arg 1055
1060 1065Ala Ser Arg Leu Leu Ala Ala Asn Ile Thr
Ala Glu Leu Arg Lys 1070 1075 1080Val
Pro Gly Thr Asp Pro Asn Phe Glu Val Phe Pro Tyr Thr Ile 1085
1090 1095Ser Asn Val Phe Tyr Gln Gln Tyr Leu
Thr Val Leu Pro Glu Gly 1100 1105
1110Ile Phe Thr Leu Ala Leu Cys Phe Val Pro Thr Phe Val Val Cys
1115 1120 1125Tyr Leu Leu Leu Gly Leu
Asp Ile Arg Ser Gly Ile Leu Asn Leu 1130 1135
1140Leu Ser Ile Ile Met Ile Leu Val Asp Thr Ile Gly Leu Met
Ala 1145 1150 1155Val Trp Gly Ile Ser
Tyr Asn Ala Val Ser Leu Ile Asn Leu Val 1160 1165
1170Thr Ala Val Gly Met Ser Val Glu Phe Val Ser His Ile
Thr Arg 1175 1180 1185Ser Phe Ala Val
Ser Thr Lys Pro Thr Arg Leu Glu Arg Ala Lys 1190
1195 1200Asp Ala Thr Ile Phe Met Gly Ser Ala Val Phe
Ala Gly Val Ala 1205 1210 1215Met Thr
Asn Phe Pro Gly Ile Leu Ile Leu Gly Phe Ala Gln Ala 1220
1225 1230Gln Leu Ile Gln Ile Phe Phe Phe Arg Leu
Asn Leu Leu Ile Thr 1235 1240 1245Leu
Leu Gly Leu Leu His Gly Leu Val Phe Leu Pro Val Val Leu 1250
1255 1260Ser Tyr Leu Gly Pro Asp Val Asn Gln
Ala Leu Val Leu Glu Glu 1265 1270
1275Lys Leu Ala Thr Glu Ala Ala Met Val Ser Glu Pro Ser Cys Pro
1280 1285 1290Gln Tyr Pro Phe Pro Ala
Asp Ala Asn Thr Ser Asp Tyr Val Asn 1295 1300
1305Tyr Gly Phe Asn Pro Glu Phe Ile Pro Glu Ile Asn Ala Ala
Ser 1310 1315 1320Ser Ser Leu Pro Lys
Ser Asp Gln Lys Phe 1325 1330133999DNAMus
sp.misc_feature(1)..(3999)n is g or a or t or c 13atggcngcng cntggcargg
ntggytnytn tgggcnytny tnytnaayws ngcncarggn 60garytntaya cnccnacnca
yaargcnggn ttytgyacnt tytaygarga rtgyggnaar 120aayccngary tnwsnggngg
nytnacnwsn ytnwsnaaya thwsntgyyt nwsnaayacn 180ccngcnmgnc aygtnacngg
ngaycayytn gcnytnytnc armgngtntg yccnmgnytn 240tayaayggnc cnaaygayac
ntaygcntgy tgywsnacna arcarytngt nwsnytngay 300wsnwsnytnw snathacnaa
rgcnytnytn acnmgntgyc cngcntgyws ngaraaytty 360gtnwsnathc aytgycayaa
yacntgywsn ccngaycarw snytnttyat haaygtnacn 420mgngtngtnc armgngaycc
nggncarytn ccngcngtng tngcntayga rgcnttytay 480carmgnwsnt tygcngaraa
rgcntaygar wsntgywsnm gngtnmgnat hccngcngcn 540gcnwsnytng cngtnggnws
natgtgyggn gtntayggnw sngcnytntg yaaygcncar 600mgntggytna ayttycargg
ngayacnggn aayggnytng cnccnytnga yathacntty 660cayytnytng arccnggnca
rgcnytngcn gayggnatga arccnytnga yggnaarath 720acnccntgya aygarwsnca
rggngargay wsngcngcnt gywsntgyca rgaytgygcn 780gcnwsntgyc cngtnathcc
nccnccnccn gcnytnmgnc cnwsnttyta yatgggnmgn 840atgccnggnt ggytngcnyt
nathathath ttyacngcng tnttygtnyt nytnwsngtn 900gtnytngtnt ayytnmgngt
ngcnwsnaay mgnaayaara ayaaracngc nggnwsncar 960gargcnccna ayytnccnmg
naarmgnmgn ttywsnccnc ayacngtnyt nggnmgntty 1020ttygarwsnt ggggnacnmg
ngtngcnwsn tggccnytna cngtnytngc nytnwsntty 1080athgtngtna thgcnytnws
ngtnggnytn acnttyathg arytnacnac ngayccngtn 1140garytntggw sngcnccnaa
rwsncargcn mgnaargara argcnttyca ygaygarcay 1200ttyggnccnt tyttymgnac
naaycarath ttygtnacng cnaaraaymg nwsnwsntay 1260aartaygayw snytnytnyt
nggnccnaar aayttywsng gnathytnws nytngayytn 1320ytncargary tnytngaryt
ncargarmgn ytnmgncayy tncargtntg gwsncaygar 1380gcncarmgna ayathwsnyt
ncargayath tgytaygcnc cnytnaaycc ncayaayacn 1440wsnytnacng aytgytgygt
naaywsnytn ytncartayt tycaraayaa ycayacnytn 1500ytnytnytna cngcnaayca
racnytnaay ggncaracnw snytngtnga ytggaargay 1560cayttyytnt aytgygcnaa
ygcnccnytn acntayaarg ayggnacngc nytngcnytn 1620wsntgyathg cngaytaygg
ngcnccngtn ttyccnttyy tngcngtngg nggntaycar 1680ggnacngayt aywsngargc
ngargcnytn athathacnt tywsnathaa yaaytayccn 1740gcngaygayc cnmgnatggc
ncaygcnaar ytntgggarg argcnttyyt naargaratg 1800carwsnttyc armgnwsnac
ngcngayaar ttycarathg cnttywsngc ngarmgnwsn 1860ytngargayg arathaaymg
nacnacnath cargayytnc cngtnttygc nathwsntay 1920ytnathgtnt tyytntayat
hwsnytngcn ytnggnwsnt aywsnmgntg gwsnmgngtn 1980gcngtngayw snaargcnac
nytnggnytn ggnggngtng cngtngtnyt nggngcngtn 2040gtngcngcna tgggnttyta
ywsntayytn ggngtnccnw snwsnytngt nathathcar 2100gtngtnccnt tyytngtnyt
ngcngtnggn gcngayaaya thttyathtt ygtnytngar 2160taycarmgny tnccnmgnat
gccnggngar carmgngarg cncayathgg nmgnacnytn 2220ggnwsngtng cnccnwsnat
gytnytntgy wsnytnwsng argcnathtg yttyttyytn 2280ggngcnytna cnwsnatgcc
ngcngtnmgn acnttygcny tnacnwsngg nytngcnath 2340athttygayt tyytnytnca
ratgacngcn ttygtngcny tnytnwsnyt ngaywsnaar 2400mgncargarg cnwsnmgncc
ngaygtngtn tgytgyttyw snwsnmgnaa yytnccnccn 2460ccnaarcara argarggnyt
nytnytntgy ttyttymgna arathtayac nccnttyytn 2520ytncaymgnt tyathmgncc
ngtngtnytn ytnytnttyy tngtnytntt yggngcnaay 2580ytntayytna tgtgyaayat
hwsngtnggn ytngaycarg ayytngcnyt nccnaargay 2640wsntayytna thgaytaytt
yytnttyytn aaymgntayy tngargtngg nccnccngtn 2700tayttygaya cnacnwsngg
ntayaaytty wsnacngarg cnggnatgaa ygcnathtgy 2760wsnwsngcng gntgygarws
nttywsnytn acncaraara thcartaygc nwsngartty 2820ccnaaycarw sntaygtngc
nathgcngcn wsnwsntggg tngaygaytt yathgaytgg 2880ytnacnccnw snwsnwsntg
ytgymgnath tayacnmgng gnccncayaa rgaygartty 2940tgyccnwsna cngayacnws
nttyaaytgy ytnaaraayt gyatgaaymg nacnytnggn 3000ccngtnmgnc cnacnacnga
rcarttycay aartayytnc cntggttyyt naaygayacn 3060ccnaayathm gntgyccnaa
rggnggnytn gcngcntaym gnacnwsngt naayytnwsn 3120wsngayggnc arathathgc
nwsncartty atggcntayc ayaarccnyt nmgnaaywsn 3180cargayttya cngargcnyt
nmgngcnwsn mgnytnytng cngcnaayat hacngcngar 3240ytnmgnaarg tnccnggnac
ngayccnaay ttygargtnt tyccntayac nathwsnaay 3300gtnttytayc arcartayyt
nacngtnytn ccngarggna thttyacnyt ngcnytntgy 3360ttygtnccna cnttygtngt
ntgytayytn ytnytnggny tngayathmg nwsnggnath 3420ytnaayytny tnwsnathat
hatgathytn gtngayacna thggnytnat ggcngtntgg 3480ggnathwsnt ayaaygcngt
nwsnytnath aayytngtna cngcngtngg natgwsngtn 3540garttygtnw sncayathac
nmgnwsntty gcngtnwsna cnaarccnac nmgnytngar 3600mgngcnaarg aygcnacnat
httyatgggn wsngcngtnt tygcnggngt ngcnatgacn 3660aayttyccng gnathytnat
hytnggntty gcncargcnc arytnathca rathttytty 3720ttymgnytna ayytnytnat
hacnytnytn ggnytnytnc ayggnytngt nttyytnccn 3780gtngtnytnw sntayytngg
nccngaygtn aaycargcny tngtnytnga rgaraarytn 3840gcnacngarg cngcnatggt
nwsngarccn wsntgyccnc artayccntt yccngcngay 3900gcnaayacnw sngaytaygt
naaytayggn ttyaayccng arttyathcc ngarathaay 3960gcngcnwsnw snwsnytncc
naarwsngay caraartty 39991420DNAArtificial
sequenceprimer 14tcttcaccct tgctctttgc
201524DNAArtificial Sequenceprimer 15aatgatggag agtaggttga
ggat 241626DNAArtificial
Sequenceprimer 16tgcccacctt tgttgtctgc taccta
261721DNAArtificial Sequenceprimer 17atcgctgaca ggatgcagaa g
211822DNAArtificial
Sequenceprimer 18tcaggaggag caatgatctt ga
221930DNAArtificial Sequenceprimer 19agattactgc cctggctcct
agcaccatta 302020DNAArtificial
Sequenceprimer 20atcctcatcc tgggctttgc
202121DNAArtificial Sequenceprimer 21gcaaggtgat caggaggttg a
212229DNAArtificial
Sequenceprimer 22cccagcttat ccagattttc ttcttccgc
292320DNAArtificial Sequenceprimer 23tcttcaccct tgctctttgc
202424DNAArtificial
Sequenceprimer 24aatgatggag agtaggttga ggat
242524DNAArtificial Sequenceprimer 25tgcccacctt tgttgtctgc
tacc 242623DNAArtificial
Sequenceprimer 26agcacctgtc cactgaagat ttc
232721DNAArtificial Sequenceprimer 27tggacgctga gcttcagttc t
212824DNAArtificial
Sequenceprimer 28cttctctgcg ctgcctcgat ggaa
242921DNAArtificial Sequenceprimer 29agtaaaaagg gctcgcagga t
213021DNAArtificial
Sequenceprimer 30ggcagctggt gacatcagag a
213125DNAArtificial Sequenceprimer 31aggaggccat gcaggcctac
tctga 253221DNAArtificial
Sequenceprimer 32gagtccacgg tcagtccatg t
213323DNAArtificial Sequenceprimer 33ttatgaacaa caatgccaag
caa 233434DNAArtificial
Sequenceprimer 34agtccttagg tagtggctta gtccctggaa gctc
343552DNAArtificial Sequenceprobe 35gtaatacgac tcactatagg
gccctgacgg tccttcctga gggaatcttc ac 523650DNAArtificial
Sequenceprobe 36gtaatacgac tcactatagg gcctgggaag ttggtcatgg ccactccagc
50378PRTArtificial SequenceFLAG tag 37Asp Tyr Lys Asp Asp Asp
Asp Lys1 5384PRTArtificial Sequencemotif 38Tyr Gln Arg
Leu13919PRTArtificial Sequenceantigen 39Glu Gln Phe His Lys Tyr Leu Pro
Trp Phe Leu Asn Asp Pro Pro Asn1 5 10
15Ile Arg Cys4016PRTArtificial Sequenceantigen 40Glu Ala Phe
Tyr Gln Arg Ser Phe Ala Glu Lys Ala Tyr Glu Ser Cys1 5
10 154115PRTArtificial Sequenceantigen
41Gly Gln Thr Ser Leu Val Asp Trp Lys Asp His Phe Leu Tyr Cys1
5 10 154217PRTArtificial
Sequenceantigen 42Cys Ala Asn Ala Pro Leu Thr Phe Lys Asp Gly Thr Ala Leu
Ala Leu1 5 10
15Ser435092DNAHomo sapiensCDS(57)..(4136) 43cttggctgtt cctgaggcct
ggcctggctc cccgctgacc ccttcccaga cctggg atg 59
Met
1gcg gag gcc ggc ctg agg ggc tgg ctg ctg tgg
gcc ctg ctc ctg cgc 107Ala Glu Ala Gly Leu Arg Gly Trp Leu Leu Trp
Ala Leu Leu Leu Arg 5 10
15ttg gcc cag agt gag cct tac aca acc atc cac cag cct ggc tac tgc
155Leu Ala Gln Ser Glu Pro Tyr Thr Thr Ile His Gln Pro Gly Tyr Cys
20 25 30gcc ttc tat gac gaa tgt ggg aag
aac cca gag ctg tct gga agc ctc 203Ala Phe Tyr Asp Glu Cys Gly Lys
Asn Pro Glu Leu Ser Gly Ser Leu 35 40
45atg aca ctc tcc aac gtg tcc tgc ctg tcc aac acg ccg gcc cgc aag
251Met Thr Leu Ser Asn Val Ser Cys Leu Ser Asn Thr Pro Ala Arg Lys50
55 60 65atc aca ggt gat cac
ctg atc cta tta cag aag atc tgc ccc cgc ctc 299Ile Thr Gly Asp His
Leu Ile Leu Leu Gln Lys Ile Cys Pro Arg Leu 70
75 80tac acc ggc ccc aac acc caa gcc tgc tgc tcc
gcc aag cag ctg gta 347Tyr Thr Gly Pro Asn Thr Gln Ala Cys Cys Ser
Ala Lys Gln Leu Val 85 90
95tca ctg gaa gcg agt ctg tcg atc acc aag gcc ctc ctc acc cgc tgc
395Ser Leu Glu Ala Ser Leu Ser Ile Thr Lys Ala Leu Leu Thr Arg Cys
100 105 110cca gcc tgc tct gac aat ttt
gtg aac ctg cac tgc cac aac acg tgc 443Pro Ala Cys Ser Asp Asn Phe
Val Asn Leu His Cys His Asn Thr Cys 115 120
125agc ccc aat cag agc ctc ttc atc aat gtg acc cgc gtg gcc cag cta
491Ser Pro Asn Gln Ser Leu Phe Ile Asn Val Thr Arg Val Ala Gln Leu130
135 140 145ggg gct gga caa
ctc cca gct gtg gtg gcc tat gag gcc ttc tac cag 539Gly Ala Gly Gln
Leu Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr Gln 150
155 160cat agc ttt gcc gag cag agc tat gac tcc
tgc agc cgt gtg cgc gtc 587His Ser Phe Ala Glu Gln Ser Tyr Asp Ser
Cys Ser Arg Val Arg Val 165 170
175cct gca gct gcc acg ctg gct gtg ggc acc atg tgt ggc gtg tat ggc
635Pro Ala Ala Ala Thr Leu Ala Val Gly Thr Met Cys Gly Val Tyr Gly
180 185 190tct gcc ctt tgc aat gcc cag
cgc tgg ctc aac ttc cag gga gac aca 683Ser Ala Leu Cys Asn Ala Gln
Arg Trp Leu Asn Phe Gln Gly Asp Thr 195 200
205ggc aat ggt ctg gcc cca ctg gac atc acc ttc cac ctc ttg gag cct
731Gly Asn Gly Leu Ala Pro Leu Asp Ile Thr Phe His Leu Leu Glu Pro210
215 220 225ggc cag gcc gtg
ggg agt ggg att cag cct ctg aat gag ggg gtt gca 779Gly Gln Ala Val
Gly Ser Gly Ile Gln Pro Leu Asn Glu Gly Val Ala 230
235 240cgt tgc aat gag tcc caa ggt gac gac gtg
gcg acc tgc tcc tgc caa 827Arg Cys Asn Glu Ser Gln Gly Asp Asp Val
Ala Thr Cys Ser Cys Gln 245 250
255gac tgt gct gca tcc tgt cct gcc ata gcc cgc ccc cag gcc ctc gac
875Asp Cys Ala Ala Ser Cys Pro Ala Ile Ala Arg Pro Gln Ala Leu Asp
260 265 270tcc acc ttc tac ctg ggc cag
atg ccg ggc agt ctg gtc ctc atc atc 923Ser Thr Phe Tyr Leu Gly Gln
Met Pro Gly Ser Leu Val Leu Ile Ile 275 280
285atc ctc tgc tct gtc ttc gct gtg gtc acc atc ctg ctt gtg gga ttc
971Ile Leu Cys Ser Val Phe Ala Val Val Thr Ile Leu Leu Val Gly Phe290
295 300 305cgt gtg gcc ccc
gcc agg gac aaa agc aag atg gtg gac ccc aag aag 1019Arg Val Ala Pro
Ala Arg Asp Lys Ser Lys Met Val Asp Pro Lys Lys 310
315 320ggc acc agc ctc tct gac aag ctc agc ttc
tcc acc cac acc ctc ctt 1067Gly Thr Ser Leu Ser Asp Lys Leu Ser Phe
Ser Thr His Thr Leu Leu 325 330
335ggc cag ttc ttc cag ggc tgg ggc acg tgg gtg gct tcg tgg cct ctg
1115Gly Gln Phe Phe Gln Gly Trp Gly Thr Trp Val Ala Ser Trp Pro Leu
340 345 350acc atc ttg gtg cta tct gtc
atc ccg gtg gtg gcc ttg gca gcg ggc 1163Thr Ile Leu Val Leu Ser Val
Ile Pro Val Val Ala Leu Ala Ala Gly 355 360
365ctg gtc ttt aca gaa ctc act acg gac ccc gtg gag ctg tgg tcg gcc
1211Leu Val Phe Thr Glu Leu Thr Thr Asp Pro Val Glu Leu Trp Ser Ala370
375 380 385ccc aac agc caa
gcc cgg agt gag aaa gct ttc cat gac cag cat ttc 1259Pro Asn Ser Gln
Ala Arg Ser Glu Lys Ala Phe His Asp Gln His Phe 390
395 400ggc ccc ttc ttc cga acc aac cag gtg atc
ctg acg gct cct aac cgg 1307Gly Pro Phe Phe Arg Thr Asn Gln Val Ile
Leu Thr Ala Pro Asn Arg 405 410
415tcc agc tac agg tat gac tct ctg ctg ctg ggg ccc aag aac ttc agc
1355Ser Ser Tyr Arg Tyr Asp Ser Leu Leu Leu Gly Pro Lys Asn Phe Ser
420 425 430gga atc ctg gac ctg gac ttg
ctg ctg gag ctg cta gag ctg cag gag 1403Gly Ile Leu Asp Leu Asp Leu
Leu Leu Glu Leu Leu Glu Leu Gln Glu 435 440
445agg ctg cgg cac ctc cag gta tgg tcg ccc gaa gca cag cgc aac atc
1451Arg Leu Arg His Leu Gln Val Trp Ser Pro Glu Ala Gln Arg Asn Ile450
455 460 465tcc ctg cag gac
atc tgc tac gcc ccc ctc aat ccg gac aat acc agt 1499Ser Leu Gln Asp
Ile Cys Tyr Ala Pro Leu Asn Pro Asp Asn Thr Ser 470
475 480ctc tac gac tgc tgc atc aac agc ctc ctg
cag tat ttc cag aac aac 1547Leu Tyr Asp Cys Cys Ile Asn Ser Leu Leu
Gln Tyr Phe Gln Asn Asn 485 490
495cgc acg ctc ctg ctg ctc aca gcc aac cag aca ctg atg ggg cag acc
1595Arg Thr Leu Leu Leu Leu Thr Ala Asn Gln Thr Leu Met Gly Gln Thr
500 505 510tcc caa gtc gac tgg aag gac
cat ttt ctg tac tgt gcc aat gcc ccg 1643Ser Gln Val Asp Trp Lys Asp
His Phe Leu Tyr Cys Ala Asn Ala Pro 515 520
525ctc acc ttc aag gat ggc aca gcc ctg gcc ctg agc tgc atg gct gac
1691Leu Thr Phe Lys Asp Gly Thr Ala Leu Ala Leu Ser Cys Met Ala Asp530
535 540 545tac ggg gcc cct
gtc ttc ccc ttc ctt gcc att ggg ggg tac aaa gga 1739Tyr Gly Ala Pro
Val Phe Pro Phe Leu Ala Ile Gly Gly Tyr Lys Gly 550
555 560aag gac tat tct gag gca gag gcc ctg atc
atg acg ttc tcc ctc aac 1787Lys Asp Tyr Ser Glu Ala Glu Ala Leu Ile
Met Thr Phe Ser Leu Asn 565 570
575aat tac cct gcc ggg gac ccc cgt ctg gcc cag gcc aag ctg tgg gag
1835Asn Tyr Pro Ala Gly Asp Pro Arg Leu Ala Gln Ala Lys Leu Trp Glu
580 585 590gag gcc ttc tta gag gaa atg
cga gcc ttc cag cgt cgg atg gct ggc 1883Glu Ala Phe Leu Glu Glu Met
Arg Ala Phe Gln Arg Arg Met Ala Gly 595 600
605atg ttc cag gtc acg ttc atg gct gag cgc tct ctg gaa gac gag atc
1931Met Phe Gln Val Thr Phe Met Ala Glu Arg Ser Leu Glu Asp Glu Ile610
615 620 625aat cgc acc aca
gct gaa gac ctg ccc atc ttt gcc acc agc tac att 1979Asn Arg Thr Thr
Ala Glu Asp Leu Pro Ile Phe Ala Thr Ser Tyr Ile 630
635 640gtc ata ttc ctg tac atc tct ctg gcc ctg
ggc agc tat tcc agc tgg 2027Val Ile Phe Leu Tyr Ile Ser Leu Ala Leu
Gly Ser Tyr Ser Ser Trp 645 650
655agc cga gtg atg gtg gac tcc aag gcc acg ctg ggc ctc ggc ggg gtg
2075Ser Arg Val Met Val Asp Ser Lys Ala Thr Leu Gly Leu Gly Gly Val
660 665 670gcc gtg gtc ctg gga gca gtc
atg gct gcc atg ggc ttc ttc tcc tac 2123Ala Val Val Leu Gly Ala Val
Met Ala Ala Met Gly Phe Phe Ser Tyr 675 680
685ttg ggt atc cgc tcc tcc ctg gtc atc ctg caa gtg gtt cct ttc ctg
2171Leu Gly Ile Arg Ser Ser Leu Val Ile Leu Gln Val Val Pro Phe Leu690
695 700 705gtg ctg tcc gtg
ggg gct gat aac atc ttc atc ttt gtt ctc gag tac 2219Val Leu Ser Val
Gly Ala Asp Asn Ile Phe Ile Phe Val Leu Glu Tyr 710
715 720cag agg ctg ccc cgg agg cct ggg gag cca
cga gag gtc cac att ggg 2267Gln Arg Leu Pro Arg Arg Pro Gly Glu Pro
Arg Glu Val His Ile Gly 725 730
735cga gcc cta ggc agg gtg gct ccc agc atg ctg ttg tgc agc ctc tct
2315Arg Ala Leu Gly Arg Val Ala Pro Ser Met Leu Leu Cys Ser Leu Ser
740 745 750gag gcc atc tgc ttc ttc cta
ggg gcc ctg acc ccc atg cca gct gtg 2363Glu Ala Ile Cys Phe Phe Leu
Gly Ala Leu Thr Pro Met Pro Ala Val 755 760
765cgg acc ttt gcc ctg acc tct ggc ctt gca gtg atc ctt gac ttc ctc
2411Arg Thr Phe Ala Leu Thr Ser Gly Leu Ala Val Ile Leu Asp Phe Leu770
775 780 785ctg cag atg tca
gcc ttt gtg gcc ctg ctc tcc ctg gac agc aag agg 2459Leu Gln Met Ser
Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys Arg 790
795 800cag gag gcc tcc cgg ttg gac gtc tgc tgc
tgt gtc aag ccc cag gag 2507Gln Glu Ala Ser Arg Leu Asp Val Cys Cys
Cys Val Lys Pro Gln Glu 805 810
815ctg ccc ccg cct ggc cag gga gag ggg ctc ctg ctt ggc ttc ttc caa
2555Leu Pro Pro Pro Gly Gln Gly Glu Gly Leu Leu Leu Gly Phe Phe Gln
820 825 830aag gct tat gcc ccc ttc ctg
ctg cac tgg atc act cga ggt gtt gtg 2603Lys Ala Tyr Ala Pro Phe Leu
Leu His Trp Ile Thr Arg Gly Val Val 835 840
845ctg ctg ctg ttt ctc gcc ctg ttc gga gtg agc ctc tac tcc atg tgc
2651Leu Leu Leu Phe Leu Ala Leu Phe Gly Val Ser Leu Tyr Ser Met Cys850
855 860 865cac atc agc gtg
gga ctg gac cag gag ctg gcc ctg ccc aag gac tcg 2699His Ile Ser Val
Gly Leu Asp Gln Glu Leu Ala Leu Pro Lys Asp Ser 870
875 880tac ctg ctt gac tat ttc ctc ttt ctg aac
cgc tac ttc gag gtg ggg 2747Tyr Leu Leu Asp Tyr Phe Leu Phe Leu Asn
Arg Tyr Phe Glu Val Gly 885 890
895gcc ccg gtg tac ttt gtt acc acc ttg ggc tac aac ttc tcc agc gag
2795Ala Pro Val Tyr Phe Val Thr Thr Leu Gly Tyr Asn Phe Ser Ser Glu
900 905 910gct ggg atg aat gcc atc tgc
tcc agt gca ggc tgc aac aac ttc tcc 2843Ala Gly Met Asn Ala Ile Cys
Ser Ser Ala Gly Cys Asn Asn Phe Ser 915 920
925ttc acc cag aag atc cag tat gcc aca gag ttc cct gag cag tct tac
2891Phe Thr Gln Lys Ile Gln Tyr Ala Thr Glu Phe Pro Glu Gln Ser Tyr930
935 940 945ctg gcc atc cct
gcc tcc tcc tgg gtg gat gac ttc att gac tgg ctg 2939Leu Ala Ile Pro
Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp Leu 950
955 960acc ccg tcc tcc tgc tgc cgc ctt tat ata
tct ggc ccc aat aag gac 2987Thr Pro Ser Ser Cys Cys Arg Leu Tyr Ile
Ser Gly Pro Asn Lys Asp 965 970
975aag ttc tgc ccc tcg acc gtc aac tct ctg aac tgc cta aag aac tgc
3035Lys Phe Cys Pro Ser Thr Val Asn Ser Leu Asn Cys Leu Lys Asn Cys
980 985 990atg agc atc acg atg ggc tct
gtg agg ccc tcg gtg gag cag ttc cat 3083Met Ser Ile Thr Met Gly Ser
Val Arg Pro Ser Val Glu Gln Phe His 995 1000
1005aag tat ctt ccc tgg ttc ctg aac gac cgg ccc aac atc aaa tgt
3128Lys Tyr Leu Pro Trp Phe Leu Asn Asp Arg Pro Asn Ile Lys
Cys1010 1015 1020ccc aaa ggc ggc ctg gca
gca tac agc acc tct gtg aac ttg act 3173Pro Lys Gly Gly Leu Ala
Ala Tyr Ser Thr Ser Val Asn Leu Thr1025 1030
1035tca gat ggc cag gtt tta gac aca gtt gcc att ctg tca ccc agg
3218Ser Asp Gly Gln Val Leu Asp Thr Val Ala Ile Leu Ser Pro Arg1040
1045 1050ctg gag tac agt ggc aca atc tcg
gct cac tgc aac ctc tac ctc 3263Leu Glu Tyr Ser Gly Thr Ile Ser
Ala His Cys Asn Leu Tyr Leu1055 1060
1065ctg gat tca gcc tcc agg ttc atg gcc tat cac aag ccc ctg aaa
3308Leu Asp Ser Ala Ser Arg Phe Met Ala Tyr His Lys Pro Leu Lys1070
1075 1080aac tca cag gat tac aca gaa gct
ctg cgg gca gct cga gag ctg 3353Asn Ser Gln Asp Tyr Thr Glu Ala
Leu Arg Ala Ala Arg Glu Leu1085 1090
1095gca gcc aac atc act gct gac ctg cgg aaa gtg cct gga aca gac
3398Ala Ala Asn Ile Thr Ala Asp Leu Arg Lys Val Pro Gly Thr Asp1100
1105 1110ccg gct ttt gag gtc ttc ccc tac
acg atc acc aat gtg ttt tat 3443Pro Ala Phe Glu Val Phe Pro Tyr
Thr Ile Thr Asn Val Phe Tyr1115 1120
1125gag cag tac ctg acc atc ctc cct gag ggg ctc ttc atg ctc agc
3488Glu Gln Tyr Leu Thr Ile Leu Pro Glu Gly Leu Phe Met Leu Ser1130
1135 1140ctc tgc ctt gtg ccc acc ttc gct
gtc tcc tgc ctc ctg ctg ggc 3533Leu Cys Leu Val Pro Thr Phe Ala
Val Ser Cys Leu Leu Leu Gly1145 1150
1155ctg gac ctg cgc tcc ggc ctc ctc aac ctg ctc tcc att gtc atg
3578Leu Asp Leu Arg Ser Gly Leu Leu Asn Leu Leu Ser Ile Val Met1160
1165 1170atc ctc gtg gac act gtc ggc ttc
atg gcc ctg tgg ggc atc agt 3623Ile Leu Val Asp Thr Val Gly Phe
Met Ala Leu Trp Gly Ile Ser1175 1180
1185tac aat gct gtg tcc ctc atc aac ctg gtc tcg gcg gtg ggc atg
3668Tyr Asn Ala Val Ser Leu Ile Asn Leu Val Ser Ala Val Gly Met1190
1195 1200tct gtg gag ttt gtg tcc cac att
acc cgc tcc ttt gcc atc agc 3713Ser Val Glu Phe Val Ser His Ile
Thr Arg Ser Phe Ala Ile Ser1205 1210
1215acc aag ccc acc tgg ctg gag agg gcc aaa gag gcc acc atc tct
3758Thr Lys Pro Thr Trp Leu Glu Arg Ala Lys Glu Ala Thr Ile Ser1220
1225 1230atg gga agt gcg gtg ttt gca ggt
gtg gcc atg acc aac ctg cct 3803Met Gly Ser Ala Val Phe Ala Gly
Val Ala Met Thr Asn Leu Pro1235 1240
1245ggc atc ctt gtc ctg ggc ctc gcc aag gcc cag ctc att cag atc
3848Gly Ile Leu Val Leu Gly Leu Ala Lys Ala Gln Leu Ile Gln Ile1250
1255 1260ttc ttc ttc cgc ctc aac ctc ctg
atc act ctg ctg ggc ctg ctg 3893Phe Phe Phe Arg Leu Asn Leu Leu
Ile Thr Leu Leu Gly Leu Leu1265 1270
1275cat ggc ttg gtc ttc ctg ccc gtc atc ctc agc tac gtg ggg cct
3938His Gly Leu Val Phe Leu Pro Val Ile Leu Ser Tyr Val Gly Pro1280
1285 1290gac gtt aac ccg gct ctg gca ctg
gag cag aag cgg gct gag gag 3983Asp Val Asn Pro Ala Leu Ala Leu
Glu Gln Lys Arg Ala Glu Glu1295 1300
1305gcg gtg gca gca gtc atg gtg gcc tct tgc cca aat cac ccc tcc
4028Ala Val Ala Ala Val Met Val Ala Ser Cys Pro Asn His Pro Ser1310
1315 1320cga gtc tcc aca gct gac aac atc
tat gtc aac cac agc ttt gaa 4073Arg Val Ser Thr Ala Asp Asn Ile
Tyr Val Asn His Ser Phe Glu1325 1330
1335ggt tct atc aaa ggt gct ggt gcc atc agc aac ttc ttg ccc aac
4118Gly Ser Ile Lys Gly Ala Gly Ala Ile Ser Asn Phe Leu Pro Asn1340
1345 1350aat ggg cgg cag ttc tga tacagccaga
ggccctgtct aggctctatg 4166Asn Gly Arg Gln Phe1355gccctgaacc
aaagggttat ggggatcttc cttgtgactg ccccttgaca cacgccctcc 4226tcaaatccta
ggggaggcca ttcccatgag actgcctgtc actggaggat ggcctgctct 4286tgaggtatcc
aggcagcacc actgatggct cctctgctcc catagtgggt ccccagtttc 4346caagtcacct
aggccttggg cagtgcctcc tcctgggcct gggtctggaa gttggcagga 4406acagacacac
tccatgtttg tcccacactc actcactttc ctaggagccc acttctcatc 4466caacttttcc
cttctcagtt cctctctcga aagtcttaat tctgtgtcag taagtcttta 4526acacgtagca
gtgtccctga gaacacagac aatgaccact accctgggtg tgatatcaca 4586ggaggccaga
gagaggcaaa ggctcaggcc aagagccaac gctgtgggag gccggtcggc 4646agccactccc
tccagggcgc acctgcaggt ctgccatcca cggccttttc tggcaagaga 4706agggcccagg
aaggatgctc tcataaggcc caggaaggat gctctcataa gcaccttggt 4766catggattag
cccctcctgg aaaatggtgt tgggtttggt ctccagctcc aatacttatt 4826aaggctgttg
ctgccagtca aggccaccca ggagtctgaa ggctgggagc tcttggggct 4886gggctggtcc
tcccatcttc acctcgggcc tggatcccag gcctcaaacc agcccaaccc 4946gagcttttgg
acagctctcc agaagcatga actgcagtgg agatgaagat cctggctctg 5006tgctgtgcac
ataggtgttt aataaacatt tgttggcaga aaaaaaaaaa aaaaaaaaaa 5066aaaaaaaaaa
aaaaaaaaaa aaaaaa
5092441359PRTHomo sapiens 44Met Ala Glu Ala Gly Leu Arg Gly Trp Leu Leu
Trp Ala Leu Leu Leu1 5 10
15Arg Leu Ala Gln Ser Glu Pro Tyr Thr Thr Ile His Gln Pro Gly Tyr
20 25 30Cys Ala Phe Tyr Asp Glu Cys
Gly Lys Asn Pro Glu Leu Ser Gly Ser 35 40
45Leu Met Thr Leu Ser Asn Val Ser Cys Leu Ser Asn Thr Pro Ala
Arg 50 55 60Lys Ile Thr Gly Asp His
Leu Ile Leu Leu Gln Lys Ile Cys Pro Arg65 70
75 80Leu Tyr Thr Gly Pro Asn Thr Gln Ala Cys Cys
Ser Ala Lys Gln Leu 85 90
95Val Ser Leu Glu Ala Ser Leu Ser Ile Thr Lys Ala Leu Leu Thr Arg
100 105 110Cys Pro Ala Cys Ser Asp
Asn Phe Val Asn Leu His Cys His Asn Thr 115 120
125Cys Ser Pro Asn Gln Ser Leu Phe Ile Asn Val Thr Arg Val
Ala Gln 130 135 140Leu Gly Ala Gly Gln
Leu Pro Ala Val Val Ala Tyr Glu Ala Phe Tyr145 150
155 160Gln His Ser Phe Ala Glu Gln Ser Tyr Asp
Ser Cys Ser Arg Val Arg 165 170
175Val Pro Ala Ala Ala Thr Leu Ala Val Gly Thr Met Cys Gly Val Tyr
180 185 190Gly Ser Ala Leu Cys
Asn Ala Gln Arg Trp Leu Asn Phe Gln Gly Asp 195
200 205Thr Gly Asn Gly Leu Ala Pro Leu Asp Ile Thr Phe
His Leu Leu Glu 210 215 220Pro Gly Gln
Ala Val Gly Ser Gly Ile Gln Pro Leu Asn Glu Gly Val225
230 235 240Ala Arg Cys Asn Glu Ser Gln
Gly Asp Asp Val Ala Thr Cys Ser Cys 245
250 255Gln Asp Cys Ala Ala Ser Cys Pro Ala Ile Ala Arg
Pro Gln Ala Leu 260 265 270Asp
Ser Thr Phe Tyr Leu Gly Gln Met Pro Gly Ser Leu Val Leu Ile 275
280 285Ile Ile Leu Cys Ser Val Phe Ala Val
Val Thr Ile Leu Leu Val Gly 290 295
300Phe Arg Val Ala Pro Ala Arg Asp Lys Ser Lys Met Val Asp Pro Lys305
310 315 320Lys Gly Thr Ser
Leu Ser Asp Lys Leu Ser Phe Ser Thr His Thr Leu 325
330 335Leu Gly Gln Phe Phe Gln Gly Trp Gly Thr
Trp Val Ala Ser Trp Pro 340 345
350Leu Thr Ile Leu Val Leu Ser Val Ile Pro Val Val Ala Leu Ala Ala
355 360 365Gly Leu Val Phe Thr Glu Leu
Thr Thr Asp Pro Val Glu Leu Trp Ser 370 375
380Ala Pro Asn Ser Gln Ala Arg Ser Glu Lys Ala Phe His Asp Gln
His385 390 395 400Phe Gly
Pro Phe Phe Arg Thr Asn Gln Val Ile Leu Thr Ala Pro Asn
405 410 415Arg Ser Ser Tyr Arg Tyr Asp
Ser Leu Leu Leu Gly Pro Lys Asn Phe 420 425
430Ser Gly Ile Leu Asp Leu Asp Leu Leu Leu Glu Leu Leu Glu
Leu Gln 435 440 445Glu Arg Leu Arg
His Leu Gln Val Trp Ser Pro Glu Ala Gln Arg Asn 450
455 460Ile Ser Leu Gln Asp Ile Cys Tyr Ala Pro Leu Asn
Pro Asp Asn Thr465 470 475
480Ser Leu Tyr Asp Cys Cys Ile Asn Ser Leu Leu Gln Tyr Phe Gln Asn
485 490 495Asn Arg Thr Leu Leu
Leu Leu Thr Ala Asn Gln Thr Leu Met Gly Gln 500
505 510Thr Ser Gln Val Asp Trp Lys Asp His Phe Leu Tyr
Cys Ala Asn Ala 515 520 525Pro Leu
Thr Phe Lys Asp Gly Thr Ala Leu Ala Leu Ser Cys Met Ala 530
535 540Asp Tyr Gly Ala Pro Val Phe Pro Phe Leu Ala
Ile Gly Gly Tyr Lys545 550 555
560Gly Lys Asp Tyr Ser Glu Ala Glu Ala Leu Ile Met Thr Phe Ser Leu
565 570 575Asn Asn Tyr Pro
Ala Gly Asp Pro Arg Leu Ala Gln Ala Lys Leu Trp 580
585 590Glu Glu Ala Phe Leu Glu Glu Met Arg Ala Phe
Gln Arg Arg Met Ala 595 600 605Gly
Met Phe Gln Val Thr Phe Met Ala Glu Arg Ser Leu Glu Asp Glu 610
615 620Ile Asn Arg Thr Thr Ala Glu Asp Leu Pro
Ile Phe Ala Thr Ser Tyr625 630 635
640Ile Val Ile Phe Leu Tyr Ile Ser Leu Ala Leu Gly Ser Tyr Ser
Ser 645 650 655Trp Ser Arg
Val Met Val Asp Ser Lys Ala Thr Leu Gly Leu Gly Gly 660
665 670Val Ala Val Val Leu Gly Ala Val Met Ala
Ala Met Gly Phe Phe Ser 675 680
685Tyr Leu Gly Ile Arg Ser Ser Leu Val Ile Leu Gln Val Val Pro Phe 690
695 700Leu Val Leu Ser Val Gly Ala Asp
Asn Ile Phe Ile Phe Val Leu Glu705 710
715 720Tyr Gln Arg Leu Pro Arg Arg Pro Gly Glu Pro Arg
Glu Val His Ile 725 730
735Gly Arg Ala Leu Gly Arg Val Ala Pro Ser Met Leu Leu Cys Ser Leu
740 745 750Ser Glu Ala Ile Cys Phe
Phe Leu Gly Ala Leu Thr Pro Met Pro Ala 755 760
765Val Arg Thr Phe Ala Leu Thr Ser Gly Leu Ala Val Ile Leu
Asp Phe 770 775 780Leu Leu Gln Met Ser
Ala Phe Val Ala Leu Leu Ser Leu Asp Ser Lys785 790
795 800Arg Gln Glu Ala Ser Arg Leu Asp Val Cys
Cys Cys Val Lys Pro Gln 805 810
815Glu Leu Pro Pro Pro Gly Gln Gly Glu Gly Leu Leu Leu Gly Phe Phe
820 825 830Gln Lys Ala Tyr Ala
Pro Phe Leu Leu His Trp Ile Thr Arg Gly Val 835
840 845Val Leu Leu Leu Phe Leu Ala Leu Phe Gly Val Ser
Leu Tyr Ser Met 850 855 860Cys His Ile
Ser Val Gly Leu Asp Gln Glu Leu Ala Leu Pro Lys Asp865
870 875 880Ser Tyr Leu Leu Asp Tyr Phe
Leu Phe Leu Asn Arg Tyr Phe Glu Val 885
890 895Gly Ala Pro Val Tyr Phe Val Thr Thr Leu Gly Tyr
Asn Phe Ser Ser 900 905 910Glu
Ala Gly Met Asn Ala Ile Cys Ser Ser Ala Gly Cys Asn Asn Phe 915
920 925Ser Phe Thr Gln Lys Ile Gln Tyr Ala
Thr Glu Phe Pro Glu Gln Ser 930 935
940Tyr Leu Ala Ile Pro Ala Ser Ser Trp Val Asp Asp Phe Ile Asp Trp945
950 955 960Leu Thr Pro Ser
Ser Cys Cys Arg Leu Tyr Ile Ser Gly Pro Asn Lys 965
970 975Asp Lys Phe Cys Pro Ser Thr Val Asn Ser
Leu Asn Cys Leu Lys Asn 980 985
990Cys Met Ser Ile Thr Met Gly Ser Val Arg Pro Ser Val Glu Gln Phe
995 1000 1005His Lys Tyr Leu Pro Trp
Phe Leu Asn Asp Arg Pro Asn Ile Lys 1010 1015
1020Cys Pro Lys Gly Gly Leu Ala Ala Tyr Ser Thr Ser Val Asn
Leu 1025 1030 1035Thr Ser Asp Gly Gln
Val Leu Asp Thr Val Ala Ile Leu Ser Pro 1040 1045
1050Arg Leu Glu Tyr Ser Gly Thr Ile Ser Ala His Cys Asn
Leu Tyr 1055 1060 1065Leu Leu Asp Ser
Ala Ser Arg Phe Met Ala Tyr His Lys Pro Leu 1070
1075 1080Lys Asn Ser Gln Asp Tyr Thr Glu Ala Leu Arg
Ala Ala Arg Glu 1085 1090 1095Leu Ala
Ala Asn Ile Thr Ala Asp Leu Arg Lys Val Pro Gly Thr 1100
1105 1110Asp Pro Ala Phe Glu Val Phe Pro Tyr Thr
Ile Thr Asn Val Phe 1115 1120 1125Tyr
Glu Gln Tyr Leu Thr Ile Leu Pro Glu Gly Leu Phe Met Leu 1130
1135 1140Ser Leu Cys Leu Val Pro Thr Phe Ala
Val Ser Cys Leu Leu Leu 1145 1150
1155Gly Leu Asp Leu Arg Ser Gly Leu Leu Asn Leu Leu Ser Ile Val
1160 1165 1170Met Ile Leu Val Asp Thr
Val Gly Phe Met Ala Leu Trp Gly Ile 1175 1180
1185Ser Tyr Asn Ala Val Ser Leu Ile Asn Leu Val Ser Ala Val
Gly 1190 1195 1200Met Ser Val Glu Phe
Val Ser His Ile Thr Arg Ser Phe Ala Ile 1205 1210
1215Ser Thr Lys Pro Thr Trp Leu Glu Arg Ala Lys Glu Ala
Thr Ile 1220 1225 1230Ser Met Gly Ser
Ala Val Phe Ala Gly Val Ala Met Thr Asn Leu 1235
1240 1245Pro Gly Ile Leu Val Leu Gly Leu Ala Lys Ala
Gln Leu Ile Gln 1250 1255 1260Ile Phe
Phe Phe Arg Leu Asn Leu Leu Ile Thr Leu Leu Gly Leu 1265
1270 1275Leu His Gly Leu Val Phe Leu Pro Val Ile
Leu Ser Tyr Val Gly 1280 1285 1290Pro
Asp Val Asn Pro Ala Leu Ala Leu Glu Gln Lys Arg Ala Glu 1295
1300 1305Glu Ala Val Ala Ala Val Met Val Ala
Ser Cys Pro Asn His Pro 1310 1315
1320Ser Arg Val Ser Thr Ala Asp Asn Ile Tyr Val Asn His Ser Phe
1325 1330 1335Glu Gly Ser Ile Lys Gly
Ala Gly Ala Ile Ser Asn Phe Leu Pro 1340 1345
1350Asn Asn Gly Arg Gln Phe 1355454471DNAMus musculus
45ggatcacttc ctggctctgg gatggcagct gcctggcagg gatggctgct ctgggccctg
60ctcctgaatt cggcccaggg tgagctctac acacccactc acaaagctgg cttctgcacc
120ttttatgaag agtgtgggaa gaacccagag ctttctggag gcctcacatc actatccaat
180atctcctgct tgtctaatac cccagccccg ccatgtcaca ggtgaccacc tggctcttct
240ccagcgcgtc tgtccccgcc tatacaatgg ccccaatgac acctatgcct gttgctctac
300caagcagctg gtgtcattag acagtagcct gtctatcacc aaggccctcc ttacacgctg
360cccggcatgc tctgaaaatt ttgtgagcat acactgtcat aatacctgca gccctgacca
420gagcctcttc atcaatgtta ctcgcgtggt tcagcgggac cctggacagc ttcctgctgt
480ggtggcctat gaggcctttt atcaacgcag ttttgcagag aaggcctatg agtcctgtag
540ccgggtgcgc atccctgcag ctgcctcgct ggctgtgggc agcatgtgtg gagtgtatgg
600ctctgccctc tgcaatgctc agcgcctggc tcaacttcca aggagacaca gggaatggcc
660tggctccgct ggacatcacc ttccacctct tggagcctgg ccaggccctg gcagatggga
720tgaagccact ggatgggaag atcaaaccct gcaatgagtc ccagggtgaa gactcggcag
780cctgttcctg ccaggactgt gcagcatcct gccctgtcat ccctccgccc ccggccctgc
840gcccttcttt ctacatgggt cgaatgccag gctggctggc tctcatcatc atcttcactg
900ctgtctttgt attgctctct gttgtccttg tgtatctccg agtggcttcc aacaggaaca
960agaacaagac agcaggctcc caggaagccc ccaacctccc tcgtaagcgc agattctcac
1020ctcacactgt ccttggccgg ttcttcgaga gctggggaac aatggtggcc tcatggccac
1080tcactgtctt ggcactgtcc ttcatagttg tgatagcctt gtcagtaggc ctgaccttta
1140tagaactcac cacagaccct gtggaactgt ggtcggcccc taaaagccaa gcccggaaag
1200aaaaggcttt ccatgacgag cattttggcc ccttcttccg aaccaaccag atttttgtga
1260cagctaagaa caggtccagc tacaagtacg actccctgct gctagggccc aagaacttca
1320gtgggatcct atccctggac ttgctgcagg agctgttgga gctacaggag agacttcgac
1380acctgcaagt gtggtcccat gaggcacagc gcaacatctc cctccaggac atctgctatg
1440ctcccctcaa accgcataac accagcctca ctgactgctg tgtcaacagc ctccttcaat
1500acttccagaa caaccacaca ctcctgctgc tcacagccaa ccagactctg aatggccaga
1560cctccctggt ggactggaag gaccatttcc tctactgtgc caatgcccct ctcacgtaca
1620aagatggcac agccctggcc ctgagctgca tagctgacta cggggcgcct gtcttcccct
1680tccttgctgt tgggggctac caagggacgg actactcgga ggcagaagcc ctgatcataa
1740ccttctctat caataactac cccgctgatg atccccgcat ggcccacgcc aagctctggg
1800aggaggcttt cttgaaggaa atgcaatcct tccagagaag cacagctgac aagttccaga
1860ttgcgttctc agctgagcgt tctctggagg acgagatcaa tcgcactacc atccaggacc
1920tgcctgtctt tgccatcagc taccttatcg tcttcctgta catctccctg gccctgggca
1980gctactccag atggagccga gttgcggtgg attccaaggc tactctgggc ctaggtgggg
2040tggctgttgt gctgggagca gtcgtggctg ccatgggctt ctactcctac ctgggtgtcc
2100cctcctctct ggtcatcatt caagtggtac ctttcctggt gctggctgtg ggagctgaca
2160acatcttcat ctttgttctt gagtaccaga ggctgcctag gatgcccggg gagcagcgag
2220aggctcacat tggccgcacc ctgggtagtg tggcccccag catgctgctg tgcagcctct
2280ctgaggccat ctgcttcttt ctaggggccc tgacctccat gccagctgtg aggacctttg
2340ccttgacctc tggcttagca atcatctttg acttcctgct ccagatgaca gcctttgtgg
2400ccctgctctc cctggatagc aagaggcagg aggcctctcg ccccgacgtc gtgtgctgct
2460tttcaagccg aaatctgccc ccaccgaaac aaaaagaagg cctcttactt tgcttcttcc
2520gcaagatata cactcccttc ctgctgcaca gattcatccg ccctgttgtg ctgctgctct
2580ttctggtcct gtttggagca aacctctact taatgtgcaa catcagcgtg gggctggacc
2640aggatctggc tctgcccaag gattcctacc tgatagacta cttcctcttt ctgaaccggt
2700acttggaagt ggggcctcca gtgtactttg acaccacctc aggctacaac ttttccaccg
2760aggcaggcat gaacgccatt tgctctagtg caggctgtga gagcttctcc ctaacccaga
2820aaatccagta tgccagtgaa ttccctaatc agtcttatgt ggctattgct gcatcctcct
2880gggtagatga cttcatcgac tggctgaccc catcctcctc ctgctgccgc atttataccc
2940gtggccccca taaagatgag ttctgtccct caacggatac ttccttcaac tgtctcaaaa
3000actgcatgaa ccgcactctg ggtcccgtga gacccacaac agaacagttt cataagtacc
3060tgccctggtt cctgaatgat acgcccaaca tcagatgtct taaagggggc ctagcagcgt
3120atagaacctc tgtgaatttg atctcagatg gccagattat agcctcccag ttcatggcct
3180accacaagcc cttacggaac tcacaggact ttacagaagc tctccgggca tcccggttgc
3240tagcagccaa catcacagct gaactacgga aggtgcctgg gacagatccc aactttgagg
3300tcttccctta cacgatctcc aatgtgttct accagcaata cctgacggtt ctccctgagg
3360gaatcttcac tcttgctctc tgcttcgtgc ccacctttgt ggtctgctac ctcctactgg
3420gcctggacat acgctcaggc atcctcaacc tgctctccat cattatgatc ctcgtggaca
3480ccatcggcct catggctgtg tggggtatca gctacaatgc tgtgtccctc atcaaccttg
3540tcacggcagt gggcatgtct gtggagttcg tgtcccacat tacccggtcc tttgctgtaa
3600gcaccaagcc tacccggctg gagagagcca aagatgctac tatcttcatg ggcagtgcgg
3660tgtttgctgg agtggccatg accaacttcc cgggcatcct catcctgggc tttgctcagg
3720cccagcttat ccagattttc ttcttccgcc tcaacctcct gatcaccttg ctgggtctgc
3780tacacggcct ggtcttcctg cccgttgtcc tcagctatct ggggccagat gttaaccaag
3840ctctggtact ggaggagaaa ctagccactg aggcagccat ggtctcagag ccttcttgcc
3900cacagtaccc cttcccggct gatgcaaaca ccagtgacct atgttaacta aggctttaat
3960ccagaattta tccctgaaat taatgctgct agcagctctc tgcccaaaag tgaccaaaag
4020ttctaatgga gtaggagctt gtccaggctc catggttctt gctgataagg ggccacgagg
4080gtcttccctc tggttgtttc caaggcctgg ggaaagttgt tccagaaaaa aattgctggc
4140attcttgtcc tgaggcagcc agcactggcc actttgttgt cataggtccc cgaggccatg
4200atcagattac ctcctctgta aagagaatat cttgagtatt gtatgggatg tatcacatgt
4260caattaaaaa ggccatggcc tatggcttag gcaggaaata gggtgtggaa catccaggag
4320aagaaaggat tctgggataa aggacacttg ggaacgtgtg gcagtggtac ctgagcacag
4380gtaattagcc atgtggcgaa atgtagatta atataaatgc atatctaagt tatgattcta
4440gtctagctat atggccaagg tatttataaa t
44714625DNAArtificial sequenceprimer 46atgttaggtg agtctgaacc taccc
254725DNAArtificial sequenceprimer
47ggattgcatt tccttcaaga aagcc
254825DNAArtificial sequenceprimer 48tatggctctg ccctctgcaa tgctc
254928DNAArtificial sequenceprimer
49tcagcagcct ctgttccaca tacacttc
285025DNAArtificial sequenceprimer 50gttccacagg gtctgtggtg agttc
25513996DNAHomo
sapiensmisc_feature(1)..(3996)n is g or a or t or c 51atggcngarg
cnggnytnmg nggntggytn ytntgggcny tnytnytnmg nytngcncar 60wsngarccnt
ayacnacnat hcaycarccn ggntaytgyg cnttytayga ygartgyggn 120aaraayccng
arytnwsngg nwsnytnatg acnytnwsna aygtnwsntg yytnwsnaay 180acnccngcnm
gnaarathac nggngaycay ytnathytny tncaraarat htgyccnmgn 240ytntayacng
gnccnaayac ncargcntgy tgywsngcna arcarytngt nwsnytngar 300gcnwsnytnw
snathacnaa rgcnytnytn acnmgntgyc cngcntgyws ngayaaytty 360gtnaayytnc
aytgycayaa yacntgywsn ccnaaycarw snytnttyat haaygtnacn 420mgngtngcnc
arytnggngc nggncarytn ccngcngtng tngcntayga rgcnttytay 480carcaywsnt
tygcngarca rwsntaygay wsntgywsnm gngtnmgngt nccngcngcn 540gcnacnytng
cngtnggnac natgtgyggn gtntayggnw sngcnytntg yaaygcncar 600mgntggytna
ayttycargg ngayacnggn aayggnytng cnccnytnga yathacntty 660cayytnytng
arccnggnca rgcngtnggn wsnggnathc arccnytnaa ygarggngtn 720gcnmgntgya
aygarwsnca rggngaygay gtngcnacnt gywsntgyca rgaytgygcn 780gcnwsntgyc
cngcnathgc nmgnccncar gcnytngayw snacnttyta yytnggncar 840atgccnggnw
snytngtnyt nathathath ytntgywsng tnttygcngt ngtnacnath 900ytnytngtng
gnttymgngt ngcnccngcn mgngayaarw snaaratggt ngayccnaar 960aarggnacnw
snytnwsnga yaarytnwsn ttywsnacnc ayacnytnyt nggncartty 1020ttycarggnt
ggggnacntg ggtngcnwsn tggccnytna cnathytngt nytnwsngtn 1080athccngtng
tngcnytngc ngcnggnytn gtnttyacng arytnacnac ngayccngtn 1140garytntggw
sngcnccnaa ywsncargcn mgnwsngara argcnttyca ygaycarcay 1200ttyggnccnt
tyttymgnac naaycargtn athytnacng cnccnaaymg nwsnwsntay 1260mgntaygayw
snytnytnyt nggnccnaar aayttywsng gnathytnga yytngayytn 1320ytnytngary
tnytngaryt ncargarmgn ytnmgncayy tncargtntg gwsnccngar 1380gcncarmgna
ayathwsnyt ncargayath tgytaygcnc cnytnaaycc ngayaayacn 1440wsnytntayg
aytgytgyat haaywsnytn ytncartayt tycaraayaa ymgnacnytn 1500ytnytnytna
cngcnaayca racnytnatg ggncaracnw sncargtnga ytggaargay 1560cayttyytnt
aytgygcnaa ygcnccnytn acnttyaarg ayggnacngc nytngcnytn 1620wsntgyatgg
cngaytaygg ngcnccngtn ttyccnttyy tngcnathgg nggntayaar 1680ggnaargayt
aywsngargc ngargcnytn athatgacnt tywsnytnaa yaaytayccn 1740gcnggngayc
cnmgnytngc ncargcnaar ytntgggarg argcnttyyt ngargaratg 1800mgngcnttyc
armgnmgnat ggcnggnatg ttycargtna cnttyacngc ngarmgnwsn 1860ytngargayg
arathaaymg nacnacngcn gargayytnc cnathttygc nacnwsntay 1920athgtnatht
tyytntayat hwsnytngcn ytnggnwsnt aywsnwsntg gwsnmgngtn 1980atggtngayw
snaargcnac nytnggnytn ggnggngtng cngtngtnyt nggngcngtn 2040atggcngcna
tgggnttytt ywsntayytn ggnathmgnw snwsnytngt nathytncar 2100gtngtnccnt
tyytngtnyt nwsngtnggn gcngayaaya thttyathtt ygtnytngar 2160taycarmgny
tnccnmgnmg nccnggngar ccnmgngarg tncayathgg nmgngcnytn 2220ggnmgngtng
cnccnwsnat gytnytntgy wsnytnwsng argcnathtg yttyttyytn 2280ggngcnytna
cnccnatgcc ngcngtnmgn acnttygcny tnacnwsngg nytngcngtn 2340athytngayt
tyytnytnca ratgwsngcn ttygtngcny tnytnwsnyt ngaywsnaar 2400mgncargarg
cnwsnmgnyt ngaygtntgy tgytgygtna arccncarga rytnccnccn 2460ccnggncarg
gngarggnyt nytnytnggn ttyttycara argcntaygc nccnttyytn 2520ytncaytgga
thacnmgngg ngtngtnytn ytnytnttyy tngcnytntt yggngtnwsn 2580ytntaywsna
tgtgycayat hwsngtnggn ytngaycarg arytngcnyt nccnaargay 2640wsntayytny
tngaytaytt yytnttyytn aaymgntayt tygargtngg ngcnccngtn 2700tayttygtna
cnacnytngg ntayaaytty wsnwsngarg cnggnatgaa ygcnathtgy 2760wsnwsngcng
gntgyaayaa yttywsntty acncaraara thcartaygc nacngartty 2820ccngarcarw
sntayytngc nathccngcn wsnwsntggg tngaygaytt yathgaytgg 2880ytnacnccnw
snwsntgytg ymgnytntay athwsnggnc cnaayaarga yaarttytgy 2940ccnwsnacng
tnaaywsnyt naaytgyytn aaraaytgya tgwsnathac natgggnwsn 3000gtnmgnccnw
sngtngarca rttycayaar tayytnccnt ggttyytnaa ygaymgnccn 3060aayathaart
gyccnaargg nggnytngcn gcntaywsna cnwsngtnaa yytnacnwsn 3120gayggncarg
tnytngcnws nmgnttyatg gcntaycaya arccnytnaa raaywsncar 3180gaytayacng
argcnytnmg ngcngcnmgn garytngcng cnaayathac ngcngayytn 3240mgnaargtnc
cnggnacnga yccngcntty gargtnttyc cntayacnat hacnaaygtn 3300ttytaygarc
artayytnac nathytnccn garggnytnt tyatgytnws nytntgyytn 3360gtnccnacnt
tygcngtnws ntgyytnytn ytnggnytng ayytnmgnws nggnytnytn 3420aayytnytnw
snathgtnat gathytngtn gayacngtng gnttyatggc nytntgggay 3480athwsntaya
aygcngtnws nytnathaay ytngtnwsng cngtnggnat gwsngtngar 3540ttygtnwsnc
ayathacnmg nwsnttygcn athwsnacna arccnacntg gytngarmgn 3600gcnaargarg
cnacnathws natgggnwsn gcngtnttyg cnggngtngc natgacnaay 3660ytnccnggna
thytngtnyt nggnytngcn aargcncary tnathcarat httyttytty 3720mgnytnaayy
tnytnathac nytnytnggn ytnytncayg gnytngtntt yytnccngtn 3780athytnwsnt
aygtnggncc ngaygtnaay ccngcnytng cnytngarca raarmgngcn 3840gargargcng
tngcngcngt natggtngcn wsntgyccna aycayccnws nmgngtnwsn 3900acngcngaya
ayathtaygt naaycaywsn ttygarggnw snathaargg ngcnggngcn 3960athwsnaayt
tyytnccnaa yaayggnmgn cartty 3996
User Contributions:
Comment about this patent or add new information about this topic: