Patent application title: TARGETING CELLS WITH ALTERED MICRORNA EXPRESSION
Inventors:
Michael Zenon Michael (Belair, ZA)
Assignees:
VIMAR S.P.A.
IPC8 Class: AA61K317088FI
USPC Class:
514 44 R
Class name:
Publication date: 2012-07-26
Patent application number: 20120190730
Abstract:
The present invention relates to a method of modulating development of a
cell. The method includes the step of introducing into the cell a nucleic
acid with the capacity to modulate development of the cell, the nucleic
acid including a target site for binding of a microRNA, wherein the
activity and/or concentration of the microRNA in the cell results in a
level of activity and/or concentration of the nucleic acid in the cell
sufficient to modulate development of the cell.Claims:
1. A method of modulating development of a cell, the method including the
step of introducing into the cell a nucleic acid with the capacity to
modulate development of the cell, the nucleic acid including a target
site for binding of a microRNA, wherein the activity and/or concentration
of the microRNA in the cell results in a level of activity and/or
concentration of the nucleic acid in the cell sufficient to modulate
development of the cell.
2. A method according to claim 1, wherein the nucleic acid has the capacity to inhibit development of the cell.
3. A method according to claim 2, wherein the nucleic acid has cytotoxic or cytostatic activity.
4. A method according to claim 3, wherein the nucleic acid encodes a gene selected from the group consisting of herpes simplex thymidine kinase, E. coli cytosine deaminase, E. coli nitroreductase, P. aeruginosa carboxypeptidase, horseradish peroxidase, and E. coli purine nucleoside phosphorylase, or an active fragment or variant of any of these genes.
5. A method according to any one of claims 1 to 4, wherein the cell is selected from the group consisting of a cancerous cell, a pre-cancerous cell, an embryonic stem cell, an adult stem cell, a haemopoietic cell including a haemopoietic precursor cell, an adipocyte, a neuronal cell, a sperm cell or a sperm producing cell, a pancreatic islet cell, and a virally infected cell.
6. A method according to claim 5, wherein the cancerous cell is a colorectal cancer cell, a lung cancer cell, a thymus cancer cell, a bladder cancer cell, a breast cancer cell, a prostate cancer cell or a cancerous B cell.
7. A method according to any one of claims 2 to 7, wherein the method is used to inhibit development of a cell with a reduced activity and/or concentration of the microRNA.
8. A method according to claim 7, wherein the method is used to ablate the cell.
9. A method according to claim 8, wherein the microRNA is selected from the group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the corresponding orthologues of the aforementioned microRNAs.
10. A method according to claim 1, wherein the nucleic acid has the capacity to promote development of the cell.
11. A method according to claim 2, wherein the nucleic acid is a nucleic acid encoding a cytokine, a therapeutic protein, or an active fragment or variant of the aforementioned.
12. A method according to claims 10 or 11, wherein the method is used to promote development of a cell with a reduced activity and/or concentration of a microRNA.
13. A method according to any one of claims 1 to 12, wherein the nucleic acid includes two or more target sites for binding of the same or different microRNAs.
14. A method according to any one of claims 1 to 13, wherein the cell is a cell in an animal or human subject.
15. A method according to any one of claims 1 to 14, wherein the method is used to prevent and/or treat a disease, condition or state in an animal or human subject.
16. A nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a binding site for a microRNA.
17. A nucleic acid according to claim 16, wherein the nucleic acid has the capacity to inhibit development of a cell.
18. A nucleic acid according to claim 17, wherein the nucleic acid has cytotoxic or cytostatic activity.
19. A nucleic acid according to claim 18, wherein the nucleic acid encodes a gene selected from the group consisting of herpes simplex thymidine kinase, E. coli cytosine deaminase, E. coli nitroreductase, P. aeruginosa carboxypeptidase, horseradish peroxidase, and E. coli purine nucleoside phosphorylase, or an active fragment or variant of any of these genes.
20. A nucleic acid according to any one of claims 16 to 19, wherein the binding site is a binding site for a microRNA selected from the group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the corresponding orthologues of the aforementioned microRNAs.
21. A nucleic acid according to any one of claims 16 to 20, wherein the nucleic acid includes two or more binding sites for binding of the same or different microRNAs.
22. A nucleic acid according to claim 16, wherein the nucleic acid has the capacity to promote development of the cell.
23. A nucleic acid according to claim 22, wherein the nucleic acid is a nucleic acid encoding a cytokine, a therapeutic protein, or an active fragment or variant of the aforementioned.
24. A nucleic acid according to any one of claims 16 to 23, wherein the binding site is a binding for a microRNA that is differentially expressed and/or differentially active.
25. A vector including the nucleic acid according to any one of claims 16 to 24.
26. A vector according to claim 25, wherein the vector is a viral vector.
27. A composition for administration to an animal or human subject, the composition including a nucleic acid according to any one of claims 16 to 26.
28. A cell including a nucleic acid according to any one of claims 16 to 26.
29. An animal including a cell according to claim 28.
30. A nucleic acid according to any one of claims 16 to 26, wherein the nucleic acid is used to inhibit the development of a cell in an animal or human subject.
31. A nucleic acid according to claim 30, wherein the nucleic acid is used to ablate cells in an animal or human subject.
32. A nucleic acid including a non-naturally occurring binding site for a microRNA that is differentially expressed and/or has differential activity.
33. A nucleic acid according to claim 32, wherein the binding site is a binding site for a microRNA that is differentially expressed and/or differentially active in a cancerous cell as compared to a similar non-cancerous cell.
34. A nucleic acid according to claim 32 or 33, wherein the binding site is a binding site for a microRNA that is downregulated in the cancerous cell as compared to the non-cancerous cell.
35. A nucleic acid according to any one of claims 32 to 34, wherein the binding site is a binding site for a microRNA selected from the group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the corresponding orthologues of the aforementioned microRNAs.
36. A nucleic acid according to any one of claims 32 to 35, wherein the nucleic acid includes two or more binding sites for binding of the same or different microRNAs that are differentially expressed and/or differentially active.
37. A nucleic acid according to any one of claims 32 to 36, wherein the nucleic acid has the capacity to inhibit development of a cell.
38. A nucleic acid according to claim 37, wherein the nucleic acid has cytotoxic or cytostatic activity.
39. A nucleic acid according to claim 37 or 38, wherein the nucleic acid encodes a gene selected from the group consisting of herpes simplex thymidine kinase, E. coli cytosine deaminase, E. coli nitroreductase, P. aeruginosa carboxypeptidase, horseradish peroxidase, and E. coli purine nucleoside phosphorylase, or an active fragment or variant of any of these genes.
40. A nucleic acid according to claim 32, wherein the nucleic acid has the capacity to promote development of the cell.
41. A nucleic acid according to claim 40, wherein the nucleic acid is a nucleic acid encoding a cytokine, a therapeutic protein, or an active fragment or variant of the aforementioned.
42. A vector including the nucleic acid according to any one of claims 32 to 41.
43. A vector according to claim 42, wherein the vector is a viral vector.
44. A composition for administration to an animal or human subject, the composition including a nucleic acid according to any one of claims 32 to 43.
45. A cell including a nucleic acid according to any one of claims 32 to 43.
46. An animal including a cell according to claim 45.
47. A nucleic acid according to any one of claims 32 to 43, wherein the nucleic acid is used to modulate the development of cells in an animal or human subject.
48. A nucleic acid according to claim 47, wherein the nucleic acid is used to inhibit the development of cells in an animal or human subject.
49. A nucleic acid according to claim 47, wherein the nucleic acid is used to ablate cells in an animal or human subject.
50. A cancerous cell including an exogenous nucleic acid including a binding site for a microRNA, wherein the cancerous cell has a reduced activity and/or concentration of the microRNA as compared to a similar non-cancerous cell.
51. A cancerous cell according to claim 50, wherein the cancerous cell is a colorectal cancer cell, a lung cancer cell, a thymus cancer cell, a bladder cancer cell, a breast cancer cell, a prostate cancer cell or a cancerous B cell.
52. A cancerous cell according to claim 50 or 51, wherein the microRNA is selected from the group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the corresponding orthologues of the aforementioned microRNAs.
53. A cancerous cell according to any one of claims 50 to 52, wherein the exogenous nucleic acid includes two or more binding sites for binding of the same or different microRNAs that are differentially expressed and/or differentially active in the cancerous cell.
54. A cancerous cell according to any one of claims 50 to 53, wherein the exogenous nucleic acid has the capacity to inhibit development of the cell.
55. A cancerous cell according to claim 54, wherein the nucleic acid has cytotoxic or cytostatic activity.
56. A cancerous cell according to claim 55, wherein the exogenous nucleic acid encodes a gene selected from the group consisting of herpes simplex thymidine kinase, E. coli cytosine deaminase, E. coli nitroreductase, P. aeruginosa carboxypeptidase, horseradish peroxidase, and E. coli purine nucleoside phosphorylase, or an active fragment or variant of any of these genes.
57. An animal including a cancerous cell according to any one of claims 50 to 56.
58. An animal according to claim 57, wherein the animal is a transgenic animal.
59. An animal according to claim 57 or 58, wherein the animal is used to identify microRNAs that are differentially expressed between cancerous and non-cancerous cells.
60. A method of preventing and/or treating a disease, condition or state associated with target cells in a subject, the method including the step of introducing into cells in the subject a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a target site for binding of the microRNA, wherein the activity of the microRNA in the target cells results in a level of activity of the nucleic acid sufficient to modulate development of the target cells in the subject.
61. A method according to claim 60, wherein the disease, condition or state is selected from the group consisting of a cancer, including colorectal cancer, lung cancer, thymus cancer, bladder cancer, breast cancer and prostate cancer; human B cell chronic lymphocytic leukemia; B cell (Burkitt) Lymphoma; a disease or disorder of pancreatic endocrine cells including diabetes; a disease or condition associated with viral infection of cells including EBV, HIV, Hepatitis and Herpes infection of cells; 5q-myelodysplastic syndrome (macrocytic anaemia); a disease or conditions associated with haemopoietic dysfunction, an autoimmune and inflammatory diseases including Crohn's disease; fragile X mental retardation; Di George syndrome; Wilms tumour; a disease or condition associated with neuron dysfunction; a disease or condition associated with adipocyte dysfunction; a disease that can be treated with embryonic or adult stem cells; and a disease or condition associated with sperm producing cells.
62. A method according to claim 61, wherein the disease is a cancer.
63. A method according to claim 62, wherein the target cell is a cancerous cell or a pre-cancerous cell.
64. A method according to claim 63, wherein the cancerous cell or pre-cancerous is a colorectal cancer cell, a lung cancer cell, a thymus cancer cell, a bladder cancer cell, a breast cancer cell, a prostate cancer cell or a cancerous B cell.
65. A method according to any one of claims 60 to 64, wherein the nucleic acid has the capacity to inhibit development of the cell.
66. A method according to claim 65, wherein the nucleic acid has cytotoxic or cytostatic activity.
67. A method according to claim 66, wherein the nucleic acid encodes a gene selected from the group consisting of herpes simplex thymidine kinase, E. coli cytosine deaminase, E. coli nitroreductase, P. aeruginosa carboxypeptidase, horseradish peroxidase, and E. coli purine nucleoside phosphorylase, or an active fragment or variant of any of these genes.
68. A method according to any one of claims 60 to 67, wherein the target cells have a reduced activity and/or expression of the microRNA.
69. A method according to any one of claims 60 to 68, wherein the method is used to ablate the target cells in the subject.
70. A method according to any one of claims 60 to 69, wherein the microRNA is selected from the group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-181b-1, hsa-miR-155, hsa-miR-124a, hsa-miR-9 and the corresponding orthologues of the aforementioned microRNAs.
71. A method according to claim 60, wherein the nucleic acid has the capacity to promote development of the cell.
72. A method according to claim 71, wherein the nucleic acid is a nucleic acid encoding a cytokine, a therapeutic protein, or an active fragment or variant of the aforementioned.
73. A method according to claim 71 or 72, wherein the method is used for the promotion of development a cell with a reduced activity and/or concentration of a microRNA.
74. A method of inhibiting development of a cell, the cell having a reduced activity and/or concentration of a microRNA, the method including the step of introducing into the cell a nucleic acid with the capacity to inhibit development of the cell, the nucleic acid including a target site for binding of the microRNA, wherein the reduced activity and/or concentration of the microRNA in the cell results in a level of activity and/or concentration of the nucleic acid in the cell sufficient to inhibit development of the cell.
75. A method of promoting development of a cell, the cell having a reduced activity and/or concentration of a microRNA, the method including the step of introducing into the cell a nucleic acid with the capacity to promote development of the cell, the nucleic acid including a target site for binding of the microRNA, wherein the reduced activity and/or concentration of the microRNA in the cell results in a level of activity and/or concentration of the nucleic acid in the cell sufficient to promote development of the cell.
76. A method of detecting altered microRNA activity and/or concentration in a cancerous or pre-cancerous cell, the method including the steps of: determining the level of expression of a reporter nucleic acid in the cancerous or pre-cancerous cells and determining the level of expression of a reporter nucleic acid in non-cancerous cells; and detecting a reduced activity of the microRNA in the cancerous cells by an increase in the expression of the reporter nucleic acid in the cancerous cells as compared to the level of expression of the reporter nucleic acid in the non-cancerous cells.
77. A method of modulating the concentration of a nucleic acid expressed in a cancerous cell, the cancerous cell having an altered activity and/or concentration of a microRNA as compared to a similar non-cancerous cell, the method including the step of introducing a target site for binding of the microRNA into the nucleic acid to be expressed in the cell.
Description:
RELATED APPLICATIONS
[0001] This application claims priority to International Patent Application No. PCT/AU2006/000750, International Filing Date Jun. 2, 2006, entitled Targeting Cells with Altered MicroRNA Expression; and claims priority to U.S. Provisional Application Ser. No. 60/687,547 filed Jun. 3, 2005, both of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to a method of modulating the development of a cell with altered microRNA activity, and to a method of preventing and/or treating a disease, condition or state associated with altered microRNA activity.
[0003] The present invention also relates to nucleic acids having a binding site for a microRNA, cells and animals including such nucleic acids, and compositions including the nucleic acids.
BACKGROUND OF THE INVENTION
[0004] Targeted gene expression is one of the most difficult and important goals in the development of effective therapies for a variety of disorders, including cell proliferative disorders such as cancer. The ultimate aim of such therapies is the provision of controlled, sustained, and site-specific expression of a therapeutic agent such that surrounding healthy tissue remains relatively unaffected by the effects of the therapeutic agent.
[0005] However, one major limitation of current gene therapy protocols has been the inability to control expression of the therapeutic gene, and in particular, the inability to restrict expression of the delivered gene to the desired tissue or type of cell. In this regard, although tissue specific promoters may be adequate to achieve specific expression of an agent in some target tissues, for diseases such as cancer they have proved to be of less value as non-diseased cells may also express from the promoter. Accordingly, there is a need to identify new methods of targeting expression of therapeutic nucleic acids.
[0006] Recently, short 20-22 nucleotide RNA molecules known as microRNAs (miRNAs) have been identified as regulating gene expression in variety of eukaryotic systems. In Caenorhabditis elegans, miRNAs coordinate the transitions between stages of larval development by regulating the translation of heterochromic genes. A specific miRNA in Arabidopsis has been shown to direct the cleavage of transcripts encoding several putative transcription factors. The Drosophila bantam gene encodes a miRNA that regulates cell proliferation and the proapoptotic gene hid. More recently, human miR143 has been shown to regulate adipocyte differentiation.
[0007] miRNAs are formed from larger transcripts that fold to produce hairpin structures and serve as substrates for the Dicer family of RNase III enzymes. They share this process with an experimental system, RNA interference (RNAi), which may be used to silence the expression of endogenous genes in eukaryotic cells. The products of Dicer cleavage are short dsRNA molecules, one strand of which is retained in a ribonucleoprotein complex called the RNA-induced silencing complex (RISC). The retained RNA acts as a guide to target this complex to a complementary mRNA sequence which is inactivated either by cleavage or translational interference, depending on the degree of complementarity between the miRNA and its target.
[0008] The present invention relates to a method of modulating the development of cells with altered microRNA levels, and arises from the recognition that some diseased cells have altered expression levels of endogenous microRNAs and that expression of therapeutic nucleic acids may be effectively targeted to such cells by exploiting the altered expression of the microRNAs in these cells.
[0009] A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims.
SUMMARY OF THE INVENTION
[0010] The present invention provides a method of modulating development of a cell, the method including the step of introducing into the cell a nucleic acid with the capacity to modulate development of the cell, the nucleic acid including a target site for binding of a microRNA, wherein the activity and/or concentration of the microRNA in the cell results in a level of activity and/or concentration of the nucleic acid in the cell sufficient to modulate development of the cell.
[0011] The present invention also provides a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a binding site for a microRNA.
[0012] The present invention also provides a nucleic acid including a non-naturally occurring binding site for a microRNA that is differentially expressed and/or has differential activity.
[0013] The present invention also provides a cancerous cell including an exogenous nucleic acid including a binding site for a microRNA, wherein the cancerous cell has a reduced activity and/or concentration of the microRNA as compared to a similar non-cancerous cell.
[0014] The present invention also provides an animal including cancerous cells, the cancerous cells including an exogenous nucleic acid including a target site for binding of a microRNA.
[0015] The present invention also provides a method of preventing and/or treating a disease, condition or state associated with target cells in a subject, the method including the step of introducing into cells in the subject a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a target site for binding of the microRNA, wherein the activity of the microRNA in the target cells results in a level of activity of the nucleic acid sufficient to modulate development of the target cells in the subject.
[0016] The present invention also provides a method of detecting altered microRNA activity and/or concentration in a cancerous or pre-cancerous cell, the method including the steps of: [0017] determining the level of expression of a reporter nucleic acid in the cancerous or pre-cancerous cells and determining the level of expression of a reporter nucleic acid in non-cancerous cells; and [0018] detecting a reduced activity of the microRNA in the cancerous cells by an increase in the expression of the reporter nucleic acid in the cancerous cells as compared to the level of expression of the reporter nucleic acid in the non-cancerous cells.
[0019] The present invention also provides a method of modulating the concentration of a nucleic acid expressed in a cancerous cell, the cancerous cell having an altered activity and/or concentration of a microRNA as compared to a similar non-cancerous cell, the method including the step of introducing a target site for binding of the microRNA into the nucleic acid to be expressed in the cell.
[0020] The present invention arises from the recognition that many cells, including cancerous cells, have altered expression levels of endogenous microRNAs, and that expression of therapeutic nucleic acids may be more effectively targeted to such cells by exploiting the altered expression of the microRNAs in these cells.
[0021] In addition, it has also been recognised that the levels of some microRNAs are modulated during differentiation of cells or during their normal developmental programme, and accordingly, expression of nucleic acids may also be targeted to these cells at specific times in their developmental programme and/or at times when the level of the microRNAs changes.
[0022] Various terms that will be used throughout the specification have meanings that will be well understood by a skilled addressee. However, for ease of reference, some of these terms will now be defined.
[0023] The term "development" as used throughout the specification in relation to the development of a cell is to be understood to mean the continuance of a cell in its current state or the continuance of a cell in its normal developmental and/or metabolic program.
[0024] In this regard, modulation of the development of a cell may, for example, result in an inhibition or cessation of cell growth, cell death, or an alteration in the normal developmental pathway that a cell undergoes. Alternatively, modulation of the development of a cell may result, for example, in increased cell survival or rescue, or increased cell proliferation.
[0025] The term "modulate" or variants thereof as used throughout the specification is to be understood to mean any alteration (increase or decrease) in the activity of a process. For example, alteration may result in activation of a process, inhibition of a process, a change in the timing of a process or a change in probability that a process may occur.
[0026] The term "nucleic acid" as used throughout the specification is to be understood to mean to any oligonucleotide or polynucleotide. The nucleic acid may be DNA or RNA and may be single stranded or double stranded. The nucleic acid may be any type of nucleic acid, including a nucleic acid of genomic origin, cDNA origin (ie derived from a mRNA), derived from a virus, or of synthetic origin. It will be appreciated that a nucleic acid with the capacity to modulate development of a cell is a nucleic acid that in a particular cell either inhibits or promotes development of the cell.
[0027] In this regard, an oligonucleotide or polynucleotide may be modified at the base moiety, sugar moiety, or phosphate backbone, and may include other appending groups to facilitate the function of the nucleic acid. The oligonucleotide or polynucleotide may be modified at any position on its structure with constituents generally known in the art. For example, an oligonucleotide may include at least one modified base moiety which is selected from the group including 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyliydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine.
[0028] The oligonucleotide or polynucleotide may also include at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose. In addition, the oligonucleotide or polynucleotide may include at least one modified phosphate backbone, such as a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or any analogue thereof.
[0029] The term "subject" as used throughout the specification is to be understood to mean any multicellular organism, including an animal or human subject. For example, the subject may be a mammal such as a primate, a livestock animal (eg. A horse, a cow, a sheep, a pig, a goat), a companion animal (eg. a dog, a cat), a laboratory test animal (eg. a mouse, a rat, a guinea pig, a bird), an animal of veterinary significance, or an animal of economic significance.
[0030] The term "variant" as used throughout the specification is to be understood to mean an amino acid sequence of a polypeptide or protein that is altered by one or more amino acids. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties to the replaced amino acid (e.g., replacement of leucine with isoleucine). A variant may also have "non-conservative" changes (e.g., replacement of a glycine with a tryptophan) or a deletion and/or insertion of one or more amino acids. The term also includes within its scope any insertions/deletions of amino acids for a particular polypeptide or protein. A "functional variant" will be understood to mean a variant that retains the functional capacity of a reference protein or polypeptide.
BRIEF DESCRIPTION OF THE FIGURES
[0031] FIG. 1 shows in the top panel the stem-loop structure of the hsa-miR-143 precursor and the nucleotide sequence of the mature hsa-miR-143 microRNA. The bottom panel shows the stem-loop structure of the hsa-miR-145 precursor and the nucleotide sequence of the mature hsa-miR-145 microRNA.
[0032] FIG. 2 shows EGFP fluorescence (three days post-transfection) from HeLa cells cotransfected with 0.1 μg EGFP/RICS-miR145 target sequence expression vector (pMM095) and varying levels of pri-miR145 (single--pMM109, and tandem--pMM107) expression plasmids, antisense (A/S; pMM106) and empty vector controls (pcDNA3.1). Data are representative of two experiments.
[0033] FIG. 3 shows the map for plasmid pMM043.
[0034] FIG. 4 shows the map for plasmid pMM095. The nucleotide sequence of pMM095 is provided in the sequence listing and is designated SEQ ID NO. 153.
[0035] FIG. 5 shows the map for plasmid pMM105. The nucleotide sequence of pMM105 is provided in the sequence listing and is designated SEQ ID NO. 154.
[0036] FIG. 6 shows the map for plasmid pMM106. The nucleotide sequence of pMM106 is provided in the sequence listing and is designated SEQ ID NO. 155.
[0037] FIG. 7 shows the map for plasmid pMM107. The nucleotide sequence of pMM107 is provided in the sequence listing and is designated SEQ ID NO. 156.
[0038] FIG. 8 shows the map for plasmid pMM109. The nucleotide sequence of pMM109 is provided in the sequence listing and is designated SEQ ID NO. 157.
[0039] FIG. 9 shows the map for plasmid pMM-TK/miRTarg. The nucleotide sequence of pMM-TK/miRTarg is provided in the sequence listing and is designated SEQ ID NO. 158.
[0040] FIG. 10 shows the map for plasmid pMM-CD/miRTarg. The nucleotide sequence of pMM-CD/miRTarg is provided in the sequence listing and is designated SEQ ID NO. 159.
[0041] FIG. 11 shows in the top panel real time RT-PCR quantitation of relative pri-miR145 levels 24 h post Dox-induction. The lower panel shows accumulation of mature miR145 in HeLa Tet-On/pMM110d line, following 24 h incubation in 1 μg/mL doxycycline, by Northern analysis: 20 μg total RNA/sample, 15% denaturing PAGE minigel. The ethidium bromide stained gel is shown to compare loading of samples.
[0042] FIG. 12 shows the effect of increasing miRNA target sequences in the 3'UTR of a transgene. Cells of the stable pMM110 transgenic HeLa Tet On cell line, HTO110e, were grown in the presence, or absence, of 2 quadratureg doxycycline/mL medium and FuGene6-transfected, one after plating, with 80 ng plasmid. The plasmids used for transfection were all derived from pMM043, with varying numbers of miR145 target sequences inserted in the EGFP 3'UTR NotI site. Plasmids were: pMM043 (no targets), pMM095 (1 target), pMM117 (2 targets), pMM119 (8 targets). Values displayed are the mean fluorescence (n=3) at 46 hours after transfection.
GENERAL DESCRIPTION OF THE INVENTION
[0043] As mentioned above, in one form the present invention provides a method of modulating development of a cell, the method including the step of introducing into the cell a nucleic acid with the capacity to modulate development of the cell, the nucleic acid including a target site for binding of a microRNA, wherein the activity and/or concentration of the microRNA in the cell results in a level of activity and/or concentration of the nucleic acid in the cell sufficient to modulate development of the cell.
[0044] The present invention arises from the recognition that some diseased cells have altered expression levels of endogenous microRNAs, and that expression of nucleic acids may be effectively targeted to these cells by exploiting the altered expression of the microRNAs in the cells.
[0045] It will be appreciated that in the case of a reduced miRNA expression, the expression of the nucleic acids is in fact effectively de-targeted.
[0046] Thus, the present invention has application in fields such as genetic engineering and therapeutic gene transfer.
[0047] The present invention is suitable for example for targeting expression of a cytotoxic nucleic acid to a diseased cell so as to ablate the cell, or alternatively, for targeting expression of a therapeutic nucleic acid to a diseased cell to improve one or more characteristics of the cell (eg for gene therapy purposes).
[0048] For example, previous studies of microRNAs differentially expressed between colonic adenocarcinoma cells and matched normal mucosa have identified two microRNAs, miR-143 and miR-145, that show significantly reduced levels of the fully processed miRNA in tumors compared to normal tissues. These miRNAs are produced from hairpin precursor (pre-miRNAs) that are cleaved to the shorter mature miRNA, as shown in FIG. 1. Thus, the present invention may be used, for example, to modulate the development of cells having reduced expression of the miR-143 or miR-145 microRNAs.
[0049] The alteration in the level and/or activity of the one or more microRNAs in the cell may be a constitutive alteration, or alternatively, may be an alteration that occurs at a specific point(s) in the developmental programme of the cell. For example, the present invention is suitable for modulating development of a cancer cell that shows a reduced constitutive expression and/or activity of a particular miRNA, for modulating development of a cell infected with a virus which causes altered expression and/or activity of a miRNA, or for modulating development of an embryonic or adult stem cell that modulates the activity of a specific miRNA at specific stages of its developmental programme.
[0050] Confirmation that a cell has an altered activity and/or expression of a specific miRNA may be achieved by a suitable method known in the art, such as Northern analysis, reverse transcription PCR (RT-PCR) or RNase protection.
[0051] Alternatively confirmation that a cell has an altered activity and/or expression of a specific miRNA may be achieved by way of expression of a reporter gene linked to a target site for the particular miRNA. In this case, the level of expression of the reporter gene will inversely reflect the activity and/or expression level of the miRNA in the cell.
[0052] Methods for the construction of reporter genes including a target site for a miRNA are known in the art. For example, a target site may be cloned into the 3'UTR of GFP, and the construct introduced into the cell. Methods for the cloning of nucleic acid sequences are as described in Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratroy Press, New York. (1989).
[0053] As discussed previously, a reduced activity and/or expression of a miRNA may be correlated with a disease, condition or state. For example, cancerous cells often have a reduced level of one or more specific miRNAs. Indeed, for many cancers a reduced level of miRNA activity and/or expression is associated with the progression of a normal cell to a cancerous cell. Thus, the cell in this form of the present invention may be a cancerous cell or a pre-cancerous cell.
[0054] Examples of cancerous cells that show a reduced activity and/or expression of a miRNA include colorectal cancer cells, lung cancer cells, thymus cancer cells, bladder cancer cells, breast cancer cells and prostate cancer cells.
[0055] Examples of cancerous cells generally include cells associated with the cancers such as bladder cancer, bone cancer, brain tumours, breast cancer, cervical cancer, colorectal cancer including cancer of the colon, rectum, anus, and appendix, cancer of the esophagus, Hodgkin's disease, kidney cancer, cancer of the larynx, leukemia, liver cancer, lung cancer, lymphoma, melanoma, moles and dysplastic nevi, multiple myeloma, muscular cancer, non-Hodgkin's lymphoma, oral cancer, ovarian cancer, cancer of the pancreas, prostate cancer, skin cancer, stomach cancer, testicular cancer, teratoma, thyroid cancer, and cancer of the uterus. The present invention also includes pre-cancerous cells, including for example, pre-cancerous cells associated with the aforementioned cancers.
[0056] In one form, the cell in the various forms of the present invention is cancerous cell from a colorectal cancer or colorectal polyp, including a cancerous cell from a colorectal adenocarcinoma or an adenomatous polyp.
[0057] However, as discussed above, the cell in the various forms of the present invention may also be for example an embryonic stem (ES) cell or an adult stem cell. In this regard, microRNAs have been identified in the mouse for which expression is repressed as the ES cells differentiate into embryoid bodies and is undetectable in adult organs, indicating that these miRNAs may have a role in the maintenance of the pluripotent cell state and in the regulation of early mammalian development.
[0058] Examples of other cells suitable for the various forms of the present invention include haemopoietic cells including haemopoietic precursor cells, adipocytes, chronic lymphocytic B cells, neuronal cells, sperm cells or sperm producing cells, pancreatic endocrine cells including pancreatic islet cells, and virally infected cells including EBV, HIV, Hepatitis and Herpes infected cells.
[0059] It will be appreciated that the cell for which development is modulated in the various forms of the present invention may be an isolated cell in vitro, or a cell present in a biological system such as a cell in an organ or tissue, or a cell present in an entire organism (eg animal or human subject). In this regard, the term "biological system" is to be understood to mean any multi-cellular system, and includes isolated groups of cells to whole organisms.
[0060] Thus, the present invention may be used to modulate the development of a target cell in a biological system.
[0061] Accordingly, in another form the present invention provides a method of modulating development of a target cell in a biological system, the method including the step of introducing into a target cell in the biological system a nucleic acid with the capacity to modulate development of the cells in the biological system, the nucleic acid including a target site for binding of a microRNA, wherein the activity and/or concentration of the microRNA in the target cell results in a level of activity and/or concentration of the nucleic acid in the target cell sufficient to modulate the development of the target cell.
[0062] In one form, the biological system is an animal or human subject, including an animal or human that is susceptible to, or suffering from, a disease, condition or state associated with altered microRNA activity and/or expression.
[0063] The present invention is therefore suitable for preventing and/or treating a disease, condition or state associated with target cells having an altered activity of a microRNA in a subject.
[0064] Accordingly, in another form the present invention provides a method of preventing and/or treating a disease, condition or state associated with target cells in a subject, the method including the step of introducing into cells in the subject a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a target site for binding of the microRNA, wherein the altered activity of the microRNA in the target cells results in a level of activity of the nucleic acid sufficient to modulate development of the target cells in the subject.
[0065] Examples of diseases, conditions or states associated with altered microRNA activity and/or expression in the various forms of the present invention are as previously discussed, including cancers such as colorectal cancer, lung cancer, thymus cancer, bladder cancer, breast cancer and prostate cancer; human B cell chronic lymphocytic leukemia; B cell (Burkitt) Lymphoma; disorders of pancreatic endocrine cells such as diabetes; diseases and conditions associated with virally infection of cells such as EBV, HIV, Hepatitis and Herpes infected cells; 5q-myelodysplastic syndrome (macrocytic anaemia); diseases and conditions associated with haemopoietic dysfunction; autoimmune and inflammatory diseases (eg Crohn's); fragile X mental retardation; Di George syndrome; Wilms tumour; a disease or condition associated with adipocyte dysfunction; a disease that can be treated with embryonic or adult stem cells; and a disease or condition associated with sperm producing cells.
[0066] It will be appreciated that an amount of the nucleic acid effective to provide a therapeutic or desired effect will be introduced/administered to the cell, biological system or subject in the various relevant forms of the present invention.
[0067] For example, methods for introducing exogenous DNAs into cells are as described in Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratory Press, New York. (1989).
[0068] The present invention may be used to either inhibit the development of target cells by use of a nucleic acid that inhibits the development of target cells, or alternatively, to promote the development of target cells by the use of a nucleic acid that promotes the development of target cells. For example, the present invention may be used to selectively ablate or rescue cells. Methods for determining whether the development of a cell have been inhibited or promoted are known in the art.
[0069] Thus, in one form of the present invention the development of a cell may be inhibited.
[0070] In this case, the nucleic acid introduced into the cell will have the capacity to inhibit development of the cell. As the nucleic acid will include one or more target sites for binding of one or more miRNAs, a reduction in activity and/or expression of the one or more miRNAs in a cell will result in an increased expression of the nucleic acid (as compared to a similar cell which does not have a reduced activity of the one or more miRNAs) and consequently result in a level of expression of the nucleic acid sufficient to inhibit development of the cell.
[0071] Accordingly, in another form the present invention provides a method of inhibiting development of a cell, the cell having a reduced activity and/or concentration of a microRNA, the method including the step of introducing into the cell a nucleic acid with the capacity to inhibit development of the cell, the nucleic acid including a target site for binding of the microRNA, wherein the reduced activity and/or concentration of the microRNA in the cell results in a level of activity and/or concentration of the nucleic acid in the cell sufficient to inhibit development of the cell.
[0072] In one form, the nucleic acid with the capacity to inhibit development of a cell is a nucleic acid with cytotoxic or cytostatic activity, or a nucleic acid encoding a suicide gene. In this case, the introduction of such a nucleic acid including one or more target sites for binding of one or more miRNAs into cells will result in an inhibition of development in those cells that have a reduced activity and/or expression of the one or more miRNAs. In cells that do not have a reduced activity and/or expression of the one or more miRNAs, the miRNAs will act to reduce the expression of the nucleic acid sufficiently that cell development is not inhibited, or at least less inhibited than the cells with the reduced activity and/or expression of the miRNA.
[0073] Thus, the present invention allows the selective inhibition of cells with a reduced activity and/or expression of a specific miRNA. In one form, the present invention may be used to selectively ablate target cells with a reduced activity and/or expression of a specific miRNA.
[0074] Examples of cytotoxic or suicide genes are generally as described in Greco and Dachs (2001) J Cell Physiol. 187(1):22-36 and include herpes simplex thymidine kinase [NC--001798:c48000-46870 (HSV2 genome)] [gi| 9629267], E. coli cytosine deaminase [NC--000913: 355395-356678 (E. coli genome)] [gi| 49175990], bacterial E. coli nitroreductase [NC--000913: c603994-604647] [gi| 49175990, P. aeruginosa carboxypeptidase G2 [AE004706.1: 3474-4712], horseradish peroxidase [X57564] [gi|16095], and E. coli purine nucleoside phosphorylase [U00096.2: 4618906-4619625 (E. coli genome)] [gi| 48994873]. It will also be appreciated that active fragments of these genes may be used, or a functional variant may be used.
[0075] In one form, the nucleic acid with the capacity to inhibit development of the cell is selected from one of the group consisting of herpes simplex thymidine kinase, a purine nucleoside phosphorylase and a cytosine deaminase.
[0076] The nucleotide sequence of the HSV thymidine kinase gene is designated SEQ ID NO. 151.
[0077] The nucleotide sequence of E. coli cytosine deaminase is designated SEQ ID NO. 152. In this case, it should be noted that the initiation codon is modified from GTG to ATG for mammalian expression constructs.
[0078] An example of a plasmid encoding the HSV thymidine kinase gene and the miRNA target sequence for miR-145 is plasmid pMM-TK/miR-Targ, which is shown in FIG. 9. The nucleotide sequence of this plasmid is designated SEQ ID NO.158.
[0079] An example of a plasmid encoding the E. coli cytosine deaminase and the miRNA target sequence for miR-145 is plasmid pMM-CD/miR-Targ, which is shown in FIG. 10. The nucleotide sequence of this plasmid is designated SEQ ID NO.159.
[0080] In another form, the present invention allows the development of a cell to be promoted.
[0081] In this case, the nucleic acid introduced into the cell will have the capacity to promote development of the cell. As the nucleic acid will include one or more target sites for binding of one or more miRNAs, a reduction in activity and/or expression of the one or more miRNAs will result in an increased expression of the nucleic acid (as compared to a similar cell which does not have a reduced activity of the one or more miRNAs) and consequently result in a level of expression of the nucleic acid sufficient to promote development of the cell.
[0082] Accordingly, in another form the present invention provides a method of promoting development of a cell, the cell having a reduced activity and/or concentration of a microRNA, the method including the step of introducing into the cell a nucleic acid with the capacity to promote development of the cell, the nucleic acid including a target site for binding of the microRNA, wherein the reduced activity and/or concentration of the microRNA in the cell results in a level of activity and/or concentration of the nucleic acid in the cell sufficient to promote development of the cell.
[0083] Examples of nucleic acids that have the capacity to promote development in a cell include therapeutic genes or a cytokine gene such as granulocyte macrophage-colony stimulating factor (GM-CSF; human: NM--000758), G-CSF (human: NM--000759; NM--172219; NM--172220), Interleukin 11 (human: NM--000641), and Tumour Necrosis Factor alpha (human: NM--000594). Thus, the nucleic acid may encode a cytokine, a therapeutic protein or an active fragment of a cytokine or a therapeutic protein.
[0084] In the case of a cytokine gene, the introduction of a nucleic acid encoding a cytokine into cells will result in a promotion of development in cells that have a reduced activity and/or expression of the one or more miRNAs. In this case, it will be appreciated that the cells will be susceptible to the effects of the cytokine. In cells that do not have a reduced activity and/or expression of the one or more miRNAs, the miRNAs will act to reduce the expression of the nucleic acid sufficiently that cell development is not promoted, or at least less promoted to an extent that is less than the cells with the reduced activity and/or expression of the miRNA.
[0085] Thus, the present invention allows the selective promotion of development of target cells with a reduced activity and/or expression of a specific miRNA.
[0086] It will be appreciated, that the expression of the nucleic acid with the capacity to modulate development of a cell will require various regulatory elements known in the art for the expression of the inserted nucleic acids in particular cell types, such as promoters for driving the expression of an inserted nucleic acid in a particular cell, poly A signals for efficient polyadenylation of mRNA transcribed from inserted nucleic acids, or other regulatory elements to control translation, transcription or mRNA stability.
[0087] Depending upon the cell type to be modulated, the promoter driving the expression may be a constitutive promoter, an inducible promoter or a cell or tissue specific promoter.
[0088] Constitutive mammalian promoters include hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate kinase, phosphoglycerate kinase (which has intrinsic bi-directional activity) and β-actin. Exemplary viral promoters which function constitutively in eukaryotic cells include promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
[0089] Inducible promoters include synthetic promoters regulated by the TetO/TetR system and inducible promoters such as metallothionein promoter, which may be used to induce transcription in the presence of certain metal ions. Other inducible promoters are known in the art.
[0090] The tissue-specific promoter will depend upon the particular cell type. For example, promoters that allow expression in colon cancer cells include the regulatory sequences of human carcinoembryonic antigen (CEA) [accession:U17131; gi/967132].
[0091] Examples of microRNAs that are correlated with human cancer, or the progression of a normal cell to a cancerous cell in humans, are as follows (5' to 3'):
TABLE-US-00001 hsa-let-7a-1 pre-miRNA precursor: (SEQ ID NO. 1) ugggaugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaau cuacugucuuuccua hsa-let-7 mature miRNA: (SEQ ID NO. 2) ugagguaguagguuguauaguu hsa-let-7a-2 pre-miRNA precursor: (SEQ ID NO. 3) agguugagguaguagguuguauaguuuagaauuacaucaagggagauaacuguacagccu ccuagcuuuccu hsa-let-7a mature miRNA: (SEQ ID NO. 4) ugagguaguagguuguauaguu hsa-let-7a-3 pre-miRNA precursor: (SEQ ID NO. 5) gggugagguaguagguuguauaguuuggggcucugcccugcuaugggauaacuauacaaucuacu gucuuuccu hsa-let-7a mature miRNA: (SEQ ID NO. 6) ugagguaguagguuguauaguu hsa-let-7b pre-miRNA precursor: (SEQ ID NO. 7) cggggugagguaguagguugugugguuucagggcagugauguugccccucggaagauaacuauac aaccuacugccuucccug hsa-let-7b mature miRNA: (SEQ ID NO. 8) ugagguaguagguugugugguu hsa-let-7c pre-miRNA precursor: (SEQ ID NO. 9) gcauccggguugagguaguagguuguaugguuuagaguuacacccugggaguuaacuguacaacc uucuagcuuuccuuggagc hsa-let-7c mature miRNA: (SEQ ID NO. 10) ugagguaguagguuguaugguu hsa-let-7f-1 pre-miRNA precursor: (SEQ ID NO. 11) ucagagugagguaguagauuguauaguugugggguagugauuuuacccuguucaggagauaacua uacaaucuauugccuucccuga hsa-let-7f mature miRNA: (SEQ ID NO. 12) ugagguaguagauuguauaguu hsa-let-7f-2 pre-miRNA precursor: (SEQ ID NO. 13) ugugggaugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacag ucuacugucuuucccacg hsa-let-7f mature miRNA: (SEQ ID NO. 14) ugagguaguagauuguauaguu hsa-mir-10b pre-miRNA precursor: (SEQ ID NO. 15) ccagagguuguaacguugucuauauauacccuguagaaccgaauuugugugguauccguauaguc acagauucgauucuaggggaauauauggucgaugcaaaaacuuca hsa-miR-10b mature miRNA: (SEQ ID NO. 16) uacccuguagaaccgaauuugu hsa-mir-15b pre-miRNA precursor: (SEQ ID NO. 17) uugaggccuuaaaguacuguagcagcacaucaugguuuacaugcuacagucaagaugcgaaucauu auuugcugcucuagaaauuuaaggaaauucau hsa-miR-15b mature miRNA: (SEQ ID NO. 18) uagcagcacaucaugguuuaca hsa-mir-16-1 pre-miRNA precursor: (SEQ ID NO. 19) gucagcagugccuuagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaac ugugcugcugaaguaagguugac hsa-miR-16 mature miRNA: (SEQ ID NO. 20) uagcagcacguaaauauuggcg hsa-mir-16-2 pre-miRNA precursor: (SEQ ID NO. 21) guuccacucuagcagcacguaaauauuggcguagugaaauauauauuaaacaccaauauuacugu gcugcuuuagugugac hsa-miR-16 mature miRNA: (SEQ ID NO. 22) uagcagcacguaaauauuggcg hsa-mir-19b-1 pre-miRNA precursor: (SEQ ID NO. 23) cacuguucuaugguuaguuuugcagguuugcauccagcugugugauauucugcugugcaaauccau gcaaaacugacugugguagug hsa-miR-19b mature miRNA: (SEQ ID NO. 24) ugugcaaauccaugcaaaacuga hsa-mir-19b-2 pre-miRNA precursor: (SEQ ID NO. 25) acauugcuacuuacaauuaguuuugcagguuugcauuucagcguauauauguauauguggcugug caaauccaugcaaaacugauugugauaaugu hsa-miR-19b mature miRNA: (SEQ ID NO. 26) ugugcaaauccaugcaaaacuga hsa-mir-20 pre-miRNA precursor: (SEQ ID NO. 27) guagcacuaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaag uacugc hsa-miR-20 mature miRNA: (SEQ ID NO. 28) uaaagugcuuauagugcagguag hsa-mir-21 pre-miRNA precursor: (SEQ ID NO. 29) ugucggguagcuuaucagacugauguugacuguugaaucucauggcaacaccagucgaugggcugu cugaca hsa-miR-21 mature miRNA: (SEQ ID NO. 30) uagcuuaucagacugauguuga hsa-mir-22 pre-miRNA precursor: (SEQ ID NO. 31) ggcugagccgcaguaguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguuga agaacuguugcccucugcc hsa-miR-22 mature miRNA: (SEQ ID NO. 32) aagcugccaguugaagaacugu hsa-mir-23a pre-miRNA precursor: (SEQ ID NO. 33) ggccggcugggguuccuggggaugggauuugcuuccugucacaaaucacauugccagggauuucca accgacc hsa-miR-23a mature miRNA: (SEQ ID NO. 34) aucacauugccagggauuucc hsa-mir-24-1 pre-miRNA precursor: (SEQ ID NO. 35) cuccggugccuacugagcugauaucaguucucauuuuacacacuggcucaguucagcaggaacagg ag hsa-miR-24 mature miRNA: (SEQ ID NO. 36) uggcucaguucagcaggaacag hsa-miR-189 mature miRNA: (SEQ ID NO. 37) gugccuacugagcugauaucagu hsa-mir-24-2 pre-miRNA precursor: (SEQ ID NO. 38) cucugccucccgugccuacugagcugaaacacaguugguuuguguacacuggcucaguucagcagg aacaggg hsa-miR-24 mature miRNA: (SEQ ID NO. 39) uggcucaguucagcaggaacag hsa-mir-26a-1 pre-miRNA precursor: (SEQ ID NO. 40) guggccucguucaaguaauccaggauaggcugugcaggucccaaugggccuauucuugguuacuug cacggggacgc hsa-miR-26 mature miRNA: (SEQ ID NO. 41) auucaaguaauccaggauaggc hsa-mir-26b pre-miRNA precursor: (SEQ ID NO. 42) ccgggacccaguucaaguaauucaggauagguugugugcuguccagccuguucuccauuacuuggc ucggggaccgg hsa-miR-26b mature miRNA: (SEQ ID NO. 43) uucaaguaauucaggauagguu hsa-mir-26a-2 pre-miRNA precursor: (SEQ ID NO. 44) ggcuguggcuggauucaaguaauccaggauaggcuguuuccaucugugaggccuauucuugauuac uuguuucuggaggcagcu hsa-miR-26a mature miRNA: (SEQ ID NO. 45) uucaaguaauccaggauaggc hsa-mir-27b pre-miRNA precursor: (SEQ ID NO. 46) accucucuaacaaggugcagagcuuagcugauuggugaacagugauugguuuccgcuuuguucaca guggcuaaguucugcaccugaagagaaggug hsa-miR-27b mature miRNA: (SEQ ID NO. 47) uucacaguggcuaaguucugc hsa-mir-29a pre-miRNA precursor: (SEQ ID NO. 48) augacugauuucuuuugguguucagagucaauauaauuuucuagcaccaucugaaaucgguuau hsa-miR-29a mature miRNA: (SEQ ID NO. 49) uagcaccaucugaaaucgguu hsa-mir-30a pre-miRNA precursor: (SEQ ID NO. 50) gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugca gcugc hsa-miR-30a-3p mature miRNA: (SEQ ID NO. 51)
cuuucagucggauguuugcagc hsa-miR-30a-5p mature miRNA: (SEQ ID NO. 52) uguaaacauccucgacuggaag hsa-mir-141 pre-miRNA precursor: (SEQ ID NO. 53) cggccggcccuggguccaucuuccaguacaguguuggauggucuaauugugaagcuccuaacacug ucugguaaagauggcucccggguggguuc hsa-miR-141 mature miRNA: (SEQ ID NO. 54) uaacacugucugguaaagaugg hsa-mir-142 pre-miRNA precursor: (SEQ ID NO. 55) gacagugcagucacccauaaaguagaaagcacuacuaacagcacuggaggguguaguguuuccuac uuuauggaugaguguacugug hsa-miR-142-5p mature miRNA: (SEQ ID NO. 56) cauaaaguagaaagcacuac hsa-miR-142-3p mature miRNA: (SEQ ID NO. 57) uguaguguuuccuacuuuaugga hsa-mir-143 pre-miRNA precursor: (SEQ ID NO. 58) gcgcagcgcccugucucccagccugaggugcagugcugcaucucuggucaguugggagucugagau gaagcacuguagcucaggaagagagaaguuguucugcagc hsa-miR-143 mature miRNA: (SEQ ID NO. 59) ugagaugaagcacuguagcuca hsa-mir-145 pre-miRNA precursor: (SEQ ID NO. 60) caccuuguccucacgguccaguuuucccaggaaucccuuagaugcuaagauggggauuccuggaaa uacuguucuugaggucaugguu hsa-miR-145 mature miRNA: (SEQ ID NO. 61) guccaguuuucccaggaaucccuu hsa-mir-192 pre-miRNA precursor: (SEQ ID NO. 62) gccgagaccgagugcacagggcucugaccuaugaauugacagccagugcucucgucuccccucuggc ugccaauuccauaggucacagguauguucgccucaaugccagc hsa-miR-192 mature miRNA: (SEQ ID NO. 63) cugaccuaugaauugacagcc hsa-mir-194-1 pre-miRNA precursor: (SEQ ID NO. 64) augguguuaucaaguguaacagcaacuccauguggacuguguaccaauuuccaguggagaugcug uuacuuuugaugguuaccaa hsa-miR-194 mature miRNA: (SEQ ID NO. 65) uguaacagcaacuccaugugga hsa-mir-194-2 pre-miRNA precursor: (SEQ ID NO. 66) ugguucccgcccccuguaacagcaacuccauguggaagugcccacugguuccaguggggcugcugu uaucuggggcgagggccag hsa-miR-194 mature miRNA: (SEQ ID NO. 67) uguaacagcaacuccaugugga hsa-mir-199b pre-miRNA precursor: (SEQ ID NO. 68) ccagaggacaccuccacuccgucuacccaguguuuagacuaucuguucaggacucccaaauuguac aguagucugcacauugguuaggcugggcuggguuagacccucgg hsa-miR-199b mature miRNA: (SEQ ID NO. 69) cccaguguuuagacuaucuguuc hsa-mir-200b pre-miRNA precursor: (SEQ ID NO. 70) ccagcucgggcagccguggccaucuuacugggcagcauuggauggagucaggucucuaauacugcc ugguaaugaugacggcggagcccugcacg hsa-miR-200b mature miRNA: (SEQ ID NO. 71) uaauacugccugguaaugaugac hsa-mir-200c pre-miRNA precursor: (SEQ ID NO. 72) cccucgucuuacccagcaguguuugggugcgguugggagucucuaauacugccggguaaugaugga gg hsa-miR-200c mature miRNA: (SEQ ID NO. 73) uaauacugccggguaaugaugg hsa-mir-320 pre-miRNA precursor: (SEQ ID NO. 74) gcuucgcuccccuccgccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggc gaaaaaggaugaggu hsa-miR-320 mature miRNA: (SEQ ID NO. 75) aaaagcuggguugagagggcgaa hsa-miR-321 mature miRNA: (SEQ ID NO. 76) uaagccagggauuguggguuc hsa-mir-30a pre-miRNA precursor: (SEQ ID NO. 77) gcgacuguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugca gcugc hsa-miR-30a-3p mature miRNA: (SEQ ID NO. 78) cuuucagucggauguuugcagc hsa-miR-30a-5p mature miRNA: (SEQ ID NO. 79) uguaaacauccucgacuggaag hsa-mir-29b-1 pre-miRNA precursor: (SEQ ID NO. 80) cuucaggaagcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaa ucaguguucuuggggg hsa-miR-29b mature miRNA: (SEQ ID NO. 81) uagcaccauuugaaaucaguguu hsa-mir-125b-1 pre-miRNA precursor: (SEQ ID NO. 82) ugcgcuccucucagucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcu cuugggagcugcgagucgugcu hsa-miR-125b mature miRNA: (SEQ ID NO. 83) ucccugagacccuaacuuguga hsa-mir-125a pre-miRNA precursor: (SEQ ID NO. 84) ugccagucucuaggucccugagacccuuuaaccugugaggacauccagggucacaggugagguucu ugggagccuggcgucuggcc hsa-miR-125a mature miRNA: (SEQ ID NO. 85) ucccugagacccuuuaaccugug hsa-mir-125b-2 pre-miRNA precursor: (SEQ ID NO. 86) accagacuuuuccuagucccugagacccuaacuugugagguauuuuaguaacaucacaagucaggc ucuugggaccuaggcggagggga hsa-miR-125b mature miRNA: (SEQ ID NO. 87) ucccugagacccuaacuuguga hsa-mir-15a pre-miRNA precursor: (SEQ ID NO. 88) ccuuggaguaaaguagcagcacauaaugguuuguggauuuugaaaaggugcaggccauauugugc ugccucaaaaauacaagg hsa-miR-15a mature miRNA: (SEQ ID NO. 89) uagcagcacauaaugguuugug hsa-mir-126 pre-miRNA precursor: (SEQ ID NO. 90) cgcuggcgacgggacauuauuacuuuugguacgcgcugugacacuucaaacucguaccgugaguaa uaaugcgccguccacggca hsa-miR-126* mature miRNA: (SEQ ID NO. 91) cauuauuacuuuugguacgcg hsa-miR-126 mature miRNA: (SEQ ID NO. 92) ucguaccgugaguaauaaugc hsa-mir-188 pre-miRNA precursor: (SEQ ID NO. 93) ugcucccucucucacaucccuugcaugguggagggugagcuuucugaaaaccccucccac augcaggguuugcaggauggcgagcc hsa-miR-188 mature miRNA: (SEQ ID NO. 94) caucccuugcaugguggagggu hsa-mir-331 pre-miRNA precursor: (SEQ ID NO. 95) gaguuugguuuuguuuggguuuguucuagguauggucccagggaucccagaucaaaccag gccccugggccuauccuagaaccaaccuaagcuc hsa-miR-331 mature miRNA: (SEQ ID NO. 96) gccccugggccuauccuagaa hsa-mir-155 pre-miRNA precursor: (SEQ ID NO. 97) cuguuaaugcuaaucgugauagggguuuuugccuccaacugacuccuacauauuagcauu aacag hsa-miR-155 mature miRNA: (SEQ ID NO. 98) uuaaugcuaaucgugauagggg
[0092] An example of a microRNA that is associated with the regulation of insulin secretion is hsa-miR-375:
TABLE-US-00002 hsa-mir-375 pre-miRNA precursor: (SEQ ID NO. 160) ccccgcgacgagccccucgcacaaaccggaccugagcguuuuguucguucggcucgcgugaggc hsa-miR-375 mature miRNA: (SEQ ID NO. 161) uuuguucguucggcucgcguga
[0093] Based on experiments in mice, hsa-miR-181b-1 is likely to be involved in haemopoiesis (B lineage cell differentiation):
TABLE-US-00003 hsa-mir-181b-1 pre-miRNA precursor: (SEQ ID NO. 162) ccugugcagagauuauuuuuuaaaaggucacaaucaacauucauugcugucgguggguugaacug uguggacaagcucacugaacaaugaaugcaacuguggccccgcuu hsa-miR-181b mature miRNA: (SEQ ID NO. 163) aacauucauugcugucgguggg hsa-mir-124a-3 pre-miRNA precursor: (SEQ ID NO. 166) UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUAC AAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCC hsa-miR-124a mature miRNA: (SEQ ID NO. 167) UUAAGGCACGCGGUGAAUGCCA hsa-mir-9-2 pre-miRNA precursor: (SEQ ID NO. 168) GGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUC UUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCA hsa-miR-9 mature miRNA: (SEQ ID NO. 169) UCUUUGGUUAUCUAGCUGUAUGA
[0094] The present invention also provides orthologues of the above human miRNAs, which may identified by method known in the art. A database of miRNAs is found at the miRBase registry (http://microrna.sanger.ac.uk/sequences/).
[0095] Thus, the present invention specifically provides in its various forms the following microRNAs: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7f, hsa-miR-10b, hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-19b mature miRNA, hsa-miR-20, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-24, hsa-miR-189, hsa-miR-24, hsa-miR-26, hsa-miR-26b, hsa-miR-26a, hsa-miR-27b, hsa-miR-29a, hsa-miR-30a-3p, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-145, hsa-miR-192, hsa-miR-194, hsa-miR-199b, hsa-miR-200b, hsa-miR-200c, hsa-miR-320, hsa-miR-321, hsa-miR-30a-3p, hsa-miR-30a-5p, hsa-miR-29b, hsa-miR-125b, hsa-miR-125a, hsa-miR-125b, hsa-miR-126*, hsa-miR-126, hsa-miR-188, hsa-miR-331, hsa-miR-155, hsa-miR-181b-1, hsa-miR-124a, hsa-miR-9 and corresponding orthologues from other species.
[0096] Methods for identifying a corresponding orthologue are known in the art, such as Weber M J. (2005) New human and mouse microRNA genes found by homology search. FEBS J. 272(1):59-73.
[0097] As described previously, miRNAs are small RNA molecules endogenously encoded in the genome of many species that regulate gene expression by binding to specific mRNAs. miRNAs are formed from larger transcripts that fold to produce hairpin structures and serve as substrates for the Dicer family of RNase III enzymes. The products of Dicer cleavage are short dsRNA molecules, one strand of which is retained in a ribonucleoprotein complex called the RNA-induced silencing complex (RISC). The retained RNA acts as a guide to direct this complex to a target site in the mRNA which is then inactivated either by cleavage or translational interference, depending on the degree of complementarity between the miRNA and its target site.
[0098] Accordingly, the modulation of the development of a cell in the various forms of the present invention may be by way of cleavage (or lack of cleavage) of the nucleic acid with the capacity to modulate the development of the cell, and/or by way of translational interference (or lack of translational interference) of the nucleic acid with the capacity to modulate the development of the cell.
[0099] The target site in the various forms of the present invention may be a nucleotide sequence that has exact complementarity to the miRNA, or alternatively, be a target site with a reduced degree of complementarity. Methods for determining the extent of complementarity required for binding of a miRNA (so as to cleave the target or translationally interfere with the target) are known in the art, for example Lewis B P, Burge CB, Bartel D P., (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120(1):15-20 and Saetrom O, Snove O Jr, Saetrom P., (2005) Weighted sequence motifs as an improved seeding step in microRNA target prediction algorithms. RNA 11(7):995-1003.
[0100] The target site may be a natural target site or a non-naturally occurring target site. In the case of a target site occurring in a gene, it will be appreciated that the target site may be introduced into the nucleic acid with one or more addition nucleotides from the gene. For example, the target site may be introduced by way of using the entire 3'UTR of a gene having a suitable target site in that untranslated region of the mRNA.
[0101] The ability of a miRNA to bind to a target site and cleave the mRNA and/or interfere with translation may be confirmed experimentally by a suitable method known in the art. For example, the psiCHECK®2 Luciferase assay system (Promega) can be used to determine miRNA activity both in vitro and in vivo. Northern blot and RT-PCR analyses can also be used to determine cleavage of a target transcript, while Western blot analysis will detect reduced translation of encoded proteins.
[0102] In the case of the miRNAs discussed previously herein, complementary target sites for the binding of the miRNAs are as follows (5' to 3'):
TABLE-US-00004 hsa-let-7 mature miRNA target site: AACUAUACAACCUACUACCUCA (SEQ ID NO. 99) hsa-let-7a mature miRNA target site: AACUAUACAACCUACUACCUCA (SEQ ID NO. 100) hsa-let-7a mature miRNA target site: AACUAUACAACCUACUACCUCA (SEQ ID NO. 101) hsa-let-7b mature miRNA target site: AACCACACAACCUACUACCUCA (SEQ ID NO. 102) hsa-let-7c mature miRNA target site: AACCAUACAACCUACUACCUCA (SEQ ID NO. 103) hsa-let-7f mature miRNA target site: AACUAUACAAUCUACUACCUCA (SEQ ID NO. 104) hsa-let-7f mature miRNA target site: AACUAUACAAUCUACUACCUCA (SEQ ID NO. 105) hsa-miR-10b mature miRNA target site: ACAAAUUCGGUUCUACAGGGUA (SEQ ID NO. 106) hsa-miR-15b mature miRNA target site: UGUAAACCAUGAUGUGCUGCUA (SEQ ID NO. 107) hsa-miR-16 mature miRNA target site: CGCCAAUAUUUACGUGCUGCUA (SEQ ID NO. 108) hsa-miR-16 mature miRNA target site: CGCCAAUAUUUACGUGCUGCUA (SEQ ID NO. 109) hsa-miR-19b mature miRNA target site: UCAGUUUUGCAUGGAUUUGCACA (SEQ ID NO. 110) hsa-miR-19b mature miRNA target site: UCAGUUUUGCAUGGAUUUGCACA (SEQ ID NO. 111) hsa-miR-20 mature miRNA target site: CUACCUGCACUAUAAGCACUUUA (SEQ ID NO. 112) hsa-miR-21 mature miRNA target site: UCAACAUCAGUCUGAUAAGCUA (SEQ ID NO. 113) hsa-miR-22 mature miRNA target site: ACAGUUCUUCAACUGGCAGCUU (SEQ ID NO. 114) hsa-miR-23a mature miRNA target site: GGAAAUCCCUGGCAAUGUGAU (SEQ ID NO. 115) hsa-miR-24 mature miRNA target site: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO. 116) hsa-miR-189 mature miRNA target site: ACUGAUAUCAGCUCAGUAGGCAC (SEQ ID NO. 117) hsa-miR-24 mature miRNA target site: CUGUUCCUGCUGAACUGAGCCA (SEQ ID NO. 118) hsa-miR-26 mature miRNA target site: GCCUAUCCUGGAUUACUUGAAU (SEQ ID NO. 119) hsa-miR-26b mature miRNA target site: AACCUAUCCUGAAUUACUUGAA (SEQ ID NO. 120) hsa-miR-26a mature miRNA target site: GCCUAUCCUGGAUUACUUGAA (SEQ ID NO. 121) hsa-miR-27b mature miRNA target site: GCAGAACUUAGCCACUGUGAA (SEQ ID NO. 122) hsa-miR-29a mature miRNA target site: AACCGAUUUCAGAUGGUGCUA (SEQ ID NO. 123) hsa-miR-30a-3p mature miRNA target site: GCUGCAAACAUCCGACUGAAAG (SEQ ID NO. 124) hsa-miR-30a-5p mature miRNA target site: CUUCCAGUCGAGGAUGUUUACA (SEQ ID NO. 125) hsa-miR-141 mature miRNA target site: CCAUCUUUACCAGACAGUGUUA (SEQ ID NO. 126) hsa-miR-142-5p mature miRNA target site: GUAGUGCUUUCUACUUUAUG (SEQ ID NO. 127) hsa-miR-142-3p mature miRNA: UCCAUAAAGUAGGAAACACUACA (SEQ ID NO. 128) hsa-miR-143 mature miRNA target site: UGAGCUACAGUGCUUCAUCUCA (SEQ ID NO. 129) hsa-miR-145 mature miRNA target site: AAGGGAUUCCUGGGAAAACUGGAC (SEQ ID NO. 130) hsa-miR-192 mature miRNA target site: GGCUGUCAAUUCAUAGGUCAG (SEQ ID NO. 131) hsa-miR-194 mature miRNA target site: UCCACAUGGAGUUGCUGUUACA (SEQ ID NO. 132) hsa-miR-194 mature miRNA target site: UCCACAUGGAGUUGCUGUUACA (SEQ ID NO. 133) hsa-miR-199b mature miRNA target site: GAACAGAUAGUCUAAACACUGGG (SEQ ID NO. 134) hsa-miR-200b mature miRNA target site: GUCAUCAUUACCAGGCAGUAUUA (SEQ ID NO. 135) hsa-miR-200c mature miRNA target site: CCAUCAUUACCCGGCAGUAUUA (SEQ ID NO. 136) hsa-miR-320 mature miRNA target site: UUCGCCCUCUCAACCCAGCUUUU (SEQ ID NO. 137) hsa-miR-321 mature miRNA target site: GAACCCACAAUCCCUGGCUUA (SEQ ID NO. 138) hsa-miR-30a-3p mature miRNA target site: GCUGCAAACAUCCGACUGAAAG (SEQ ID NO. 139) hsa-miR-30a-5p mature miRNA target site: CUUCCAGUCGAGGAUGUUUACA (SEQ ID NO. 140) hsa-miR-29b mature miRNA target site: AACACUGAUUUCAAAUGGUGCUA (SEQ ID NO. 141) hsa-miR-125b mature miRNA target site: UCACAAGUUAGGGUCUCAGGGA (SEQ ID NO. 142) hsa-miR-125a mature miRNA target site: CACAGGUUAAAGGGUCUCAGGGA (SEQ ID NO. 143) hsa-miR-125b mature miRNA target site: UCACAAGUUAGGGUCUCAGGGA (SEQ ID NO. 144) hsa-miR-15a mature miRNA target site: CACAAACCAUUAUGUGCUGCUA (SEQ ID NO. 145) hsa-miR-126* mature miRNA target site: CGCGUACCAAAAGUAAUAAUG (SEQ ID NO. 146) hsa-miR-126 mature miRNA target site: GCAUUAUUACUCACGGUACGA (SEQ ID NO. 147) hsa-miR-188 mature miRNA target site: ACCCUCCACCAUGCAAGGGAUG (SEQ ID NO. 148) hsa-miR-331 mature miRNA target site: UUCUAGGAUAGGCCCAGGGGC (SEQ ID NO. 149) hsa-miR-155 mature miRNA target site: CCCCUAUCACGAUUAGCAUUAA (SEQ ID NO. 150) hsa-miR-375 mature miRNA target site: UCACGCGAGCCGAACGAACAAA (SEQ ID NO. 164) hsa-miR-181b mature miRNA target site: CCCACCGACAGCAAUGAAUGUU (SEQ ID NO. 165) hsa-miR-124a mature miRNA target site: UGGCAUUCACCGCGUGCCUUAA (SEQ ID NO. 170) hsa-miR-9 mature miRNA target site: UCAUACAGCUAGAUAACCAAAGA (SEQ ID NO. 171)
[0103] In the case of the nucleic acid molecule being a DNA, a person skilled in the art will appreciate that the above target sequences will have the U bases substituted for T bases.
[0104] The target site for binding of a microRNA in the various forms of the present invention may be a non-naturally occurring binding site for the particular miRNA, or alternatively, may be a target site present in a naturally occurring gene or mRNA, such as a target site found in the 3'UTR of a gene. In this regard, naturally and non-naturally occurring targets for a microRNA may be identified as described in Krek et al. (2005) Nature Genetics 37(5): 495-500.
[0105] For example, in the case of the miR-143 miRNA, Table 1 provides a listing of human mRNAs predicted to contain target sites for hsa-miR-143, using the method as described in Krek et al. (2005) Nature Genetics 37(5): 495-500, using default parameters.
TABLE-US-00005 TABLE 1 human Refseq PicTar Rank Id score annotation 1 NM_138962 8.75 Homo sapiens musashi homolog 2 (Drosophila) (MSI2), transcript variant 1, mRNA. 2 NM_033389 6.92 Homo sapiens slingshot homolog 2 (Drosophila) (SSH2), mRNA. 3 NM_004720 6.71 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4 (EDG4), mRNA. 4 NM_203445 6.71 Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 9 (ABCB9), transcript variant 3, mRNA. 5 NM_004738 6.67 Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C (VAPB), mRNA. 6 NM_006517 6.47 Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 2 (SLC16A2), mRNA. 7 NM_005104 6.27 Homo sapiens bromodomain containing 2 (BRD2), mRNA. 8 NM_198452 6.23 Homo sapiens pregnancy upregulated non-ubiquitously expressed CaM kinase (PNCK), mRNA. 9 NM_015575 5.42 Homo sapiens trinucleotide repeat containing 15 (TNRC15) mRNA. 10 NM_005644 5.26 Homo sapiens TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20 kDa (TAF12), mRNA. 11 NM_004985 5.1 Homo sapiens v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog (KRAS2), transcript variant b, mRNA. 12 NM_033360 5.1 Homo sapiens v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog (KRAS2), transcript variant a, mRNA. 13 NM_007306 5.06 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-exon4, mRNA. 14 NM_144633 5.05 Homo sapiens potassium voltage-gated channel, subfamily H (eag-related), member 8 (KCNH8), mRNA. 15 NM_153649 4.98 Homo sapiens tropomyosin 3 (TPM3), mRNA. 16 NM_004798 4.78 Homo sapiens kinesin family member 3B (KIF3B), mRNA. 17 NM_021907 4.69 Homo sapiens dystrobrevin, beta (DTNB), transcript variant 1, mRNA. 18 NM_183360 4.69 Homo sapiens dystrobrevin, beta (DTNB), transcript variant 4, mRNA. 19 NM_033148 4.69 Homo sapiens dystrobrevin, beta (DTNB), transcript variant 3, mRNA. 20 NM_183361 4.69 Homo sapiens dystrobrevin, beta (DTNB), transcript variant 5, mRNA. 21 NM_033147 4.69 Homo sapiens dystrobrevin, beta (DTNB), transcript variant 2, mRNA. 22 NM_014112 4.56 Homo sapiens trichorhinophalangeal syndrome I (TRPS1), mRNA. 23 NM_014502 4.51 Homo sapiens PRP19/PSO4 homolog (S. cerevisiae) (PRP19), mRNA. 24 NM_004210 4.48 Homo sapiens neuralized-like (Drosophila) (NEURL), mRNA. 25 NM_003284 4.46 Homo sapiens transition protein 1 (during histone to protamine replacement) (TNP1), mRNA. 26 NM_001282 4.42 Homo sapiens adaptor-related protein complex 2, beta 1 subunit (AP2B1), mRNA. 27 NM_007200 4.41 Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), transcript variant 2, mRNA. 28 NM_144767 4.41 Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), transcript variant 3, mRNA. 29 NM_006738 4.41 Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), transcript variant 1, mRNA. 30 NM_182901 4.29 Homo sapiens chromosome 11 open reading frame 17 (C11orf17), transcript variant 1, mRNA. 31 NM_016018 4.27 Homo sapiens CGI-72 protein (CGI-72), transcript variant 1, mRNA. 32 NM_018013 4.23 Homo sapiens hypothetical protein FLJ10159 (FLJ10159), mRNA. 33 NM_006302 4.23 Homo sapiens glucosidase I (GCS1), mRNA. 34 NM_024915 4.17 Homo sapiens transcription factor CP2-like 3 (TFCP2L3), mRNA. 35 NM_000168 4.13 Homo sapiens GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) (GLI3), mRNA. 36 NM_014450 3.99 Homo sapiens SHP2-interacting transmembrane adaptor protein (SIT), mRNA. 37 NM_014346 3.95 Homo sapiens chromosome 22 open reading frame 4 (C22orf4), mRNA. 38 NM_000633 3.86 Homo sapiens B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant alpha, mRNA. 39 NM_002314 3.86 Homo sapiens LIM domain kinase 1 (LIMK1), transcript variant 1, mRNA. 40 NM_173478 3.84 Homo sapiens hypothetical protein FLJ40137 (FLJ40137), mRNA. 41 NM_030952 3.84 Homo sapiens likely ortholog of rat SNF1/AMP-activated protein kinase (SNARK), mRNA. 42 NM_018579 3.8 Homo sapiens mitochondrial solute carrier protein (MSCP), mRNA. 43 NM_004089 3.75 Homo sapiens delta sleep inducing peptide, immunoreactor (DSIPI), transcript variant 2, mRNA. 44 NM_198057 3.75 Homo sapiens delta sleep inducing peptide, immunoreactor (DSIPI), transcript variant 1, mRNA. 45 NM_002830 3.72 Homo sapiens protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) (PTPN4), mRNA. 46 NM_006206 3.68 Homo sapiens platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), mRNA. 47 NM_033004 3.64 Homo sapiens NACHT, leucine rich repeat and PYD (pyrin domain) containing 1 (NALP1), transcript variant 1, mRNA. 48 NM_033007 3.64 Homo sapiens NACHT, leucine rich repeat and PYD (pyrin domain) containing 1 (NALP1), transcript variant 4, mRNA. 49 NM_001987 3.64 Homo sapiens ets variant gene 6 (TEL oncogene) (ETV6), mRNA. 50 NM_033006 3.64 Homo sapiens NACHT, leucine rich repeat and PYD (pyrin domain) containing 1 (NALP1), transcript variant 3, mRNA. 51 NM_014922 3.64 Homo sapiens NACHT, leucine rich repeat and PYD (pyrin domain) containing 1 (NALP1), transcript variant 2, mRNA. 52 NM_018398 3.63 Homo sapiens calcium channel, voltage-dependent, alpha 2/delta 3 subunit (CACNA2D3), mRNA. 53 NM_147159 3.6 Homo sapiens opioid receptor, sigma 1 (OPRS1), transcript variant 4, mRNA. 54 NM_000920 3.6 Homo sapiens pyruvate carboxylase (PC), nuclear gene encoding mitochondrial protein, transcript variant A, mRNA. 55 NM_022172 3.6 Homo sapiens pyruvate carboxylase (PC), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA. 56 NM_005139 3.54 Homo sapiens annexin A3 (ANXA3), mRNA. 57 NM_152933 3.49 Homo sapiens protein phosphatase, EF hand calcium- binding domain 2 (PPEF2), transcript variant 2, mRNA. 58 NM_020665 3.45 Homo sapiens transmembrane protein 27 (TMEM27), mRNA. 59 NM_015513 3.44 Homo sapiens cysteine-rich with EGF-like domains 1 (CRELD1), mRNA. 60 NM_006357 3.41 Homo sapiens ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3), transcript variant 1, mRNA. 61 NM_182678 3.41 Homo sapiens ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3), transcript variant 2, mRNA. 62 NM_138731 3.4 Homo sapiens mirror-image polydactyly 1 (MIPOL1), mRNA. 63 NM_052953 3.39 Homo sapiens leucine rich repeat containing 3B (LRRC3B), mRNA. 64 NM_017896 3.39 Homo sapiens chromosome 20 open reading frame 11 (C20orf11), mRNA. 65 NM_152410 3.39 Homo sapiens PARK2 co-regulated (PACRG), mRNA. 66 NM_014892 3.36 Homo sapiens RNA binding motif protein 16 (RBM16), mRNA. 67 NM_015516 3.36 Homo sapiens likely ortholog of chicken tsukushi (TSK), mRNA. 68 NM_017699 3.35 Homo sapiens SID1 transmembrane family, member 1 (SIDT1), mRNA. 69 NM_144709 3.35 Homo sapiens hypothetical protein FLJ32312 (FLJ32312), mRNA. 70 NM_015509 3.32 Homo sapiens DKFZP566B183 protein (DKFZP566B183), mRNA. 71 NM_022822 3.28 Homo sapiens likely ortholog of kinesin light chain 2 (KLC2), mRNA. 72 NM_182579 3.25 Homo sapiens hypothetical protein FLJ40343 (FLJ40343), mRNA. 73 NM_079834 3.21 Homo sapiens secretory carrier membrane protein 4 (SCAMP4), mRNA. 74 NM_021120 3.18 Homo sapiens discs, large homolog 3 (neuroendocrine-dlg, Drosophila) (DLG3), mRNA. 75 NM_198261 3.15 Homo sapiens similar to splicing factor, arginine/serine-rich 4 (FLJ11021), transcript variant 2, mRNA. 76 NM_198263 3.15 n/a 77 NM_023012 3.15 Homo sapiens similar to splicing factor, arginine/serine-rich 4 (FLJ11021), transcript variant 1, mRNA. 78 NM_198262 3.15 Homo sapiens similar to splicing factor, arginine/serine-rich 4 (FLJ11021), transcript variant 3, mRNA. 79 NM_018036 3.15 Homo sapiens chromosome 14 open reading frame 103 (C14orf103), mRNA. 80 NM_003188 3.14 Homo sapiens mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant A, mRNA. 81 NM_145331 3.14 Homo sapiens mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant B, mRNA. 82 NM_001795 3.12 Homo sapiens cadherin 5, type 2, VE-cadherin (vascular epithelium) (CDH5), mRNA. 83 NM_024490 3.12 Homo sapiens ATPase, Class V, type 10A (ATP10A), mRNA. 84 NM_019102 3.08 Homo sapiens homeo box A5 (HOXA5), mRNA. 85 NM_007375 3.06 Homo sapiens TAR DNA binding protein (TARDBP), mRNA. 86 NM_006769 3.04 Homo sapiens LIM domain only 4 (LMO4), mRNA. 87 NM_014603 2.99 Homo sapiens paraneoplastic antigen (HUMPPA), mRNA. 88 NM_031913 2.98 Homo sapiens chr3 synaptotagmin (CHR3SYT), mRNA. 89 NM_014399 2.97 Homo sapiens transmembrane 4 superfamily member 13 (TM4SF13), mRNA. 90 NM_005369 2.96 Homo sapiens MCF.2 cell line derived transforming sequence (MCF2), mRNA. 91 NM_021999 2.92 Homo sapiens integral membrane protein 2B (ITM2B), mRNA. 92 NM_144776 2.88 Homo sapiens formyltetrahydrofolate dehydrogenase (FTHFD), transcript variant 2, mRNA. 93 NM_001901 2.88 Homo sapiens connective tissue growth factor (CTGF), mRNA. 94 NM_004637 2.87 Homo sapiens RAB7, member RAS oncogene family (RAB7), mRNA. 95 NM_000210 2.86 Homo sapiens integrin, alpha 6 (ITGA6), mRNA. 96 NM_014939 2.85 Homo sapiens KIAA1012 (KIAA1012), mRNA. 97 NM_138717 2.83 Homo sapiens palmitoyl-protein thioesterase 2 (PPT2), transcript variant 2, mRNA. 98 NM_152934 2.83 Homo sapiens protein phosphatase, EF hand calcium- binding domain 2 (PPEF2), transcript variant 3, mRNA. 99 NM_145333 2.83 Homo sapiens mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant D, mRNA. 100 NM_145332 2.83 Homo sapiens mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C, mRNA. 101 NM_005155 2.82 Homo sapiens palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, mRNA. 102 NM_001001330 2.81 Homo sapiens chromosome 10 open reading frame 74 (C10orf74), mRNA. 103 NM_206909 2.8 Homo sapiens pleckstrin and Sec7 domain containing 3 (PSD3), transcript variant 2, mRNA. 104 NM_178450 2.8 Homo sapiens membrane-associated RING-CH protein III (MARCH-III), mRNA. 105 NM_016626 2.76 Homo sapiens ring finger and KH domain containing 2 (RKHD2), mRNA. 106 NM_005584 2.73 Homo sapiens mab-21-like 1 (C. elegans) (MAB21L1), mRNA. 107 NM_022051 2.72 Homo sapiens egl nine homolog 1 (C. elegans) (EGLN1), mRNA. 108 NM_006621 2.72 Homo sapiens S-adenosylhomocysteine hydrolase-like 1 (AHCYL1), mRNA. 109 NM_003077 2.72 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 (SMARCD2), mRNA. 110 NM_005668 2.72 Homo sapiens sialyltransferase 8D (alpha-2,8- polysialyltransferase) (SIAT8D), transcript variant 1, mRNA. 111 NM_019903 2.68 Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 2, mRNA. 112 NM_032975 2.68 Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 2, mRNA. 113 NM_001390 2.68 Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 1, mRNA. 114 NM_032980 2.68 Homo sapiens dystrobrevin, alpha (DTNA), transcript variant 6, mRNA. 115 NM_016824 2.68 Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 1, mRNA. 116 NM_000291 2.68 Homo sapiens phosphoglycerate kinase 1 (PGK1), mRNA. 117 NM_153184 2.67 Homo sapiens immunoglobulin superfamily, member 4D (IGSF4D), mRNA.
118 NM_004384 2.67 Homo sapiens casein kinase 1, gamma 3 (CSNK1G3), mRNA. 119 NM_022552 2.65 Homo sapiens DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 3, mRNA. 120 NM_175629 2.65 Homo sapiens DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 1, mRNA. 121 NM_153759 2.65 Homo sapiens DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), transcript variant 2, mRNA. 122 NM_178835 2.62 Homo sapiens hypothetical protein LOC152485 (LOC152485), mRNA. 123 NM_004999 2.61 Homo sapiens myosin VI (MYO6), mRNA. 124 NM_002222 2.6 Homo sapiens inositol 1,4,5-triphosphate receptor, type 1 (ITPR1), mRNA. 125 NM_015719 2.59 Homo sapiens collagen, type V, alpha 3 (COL5A3), mRNA. 126 NM_013316 2.57 Homo sapiens CCR4-NOT transcription complex, subunit 4 (CNOT4), mRNA. 127 NM_001094 2.57 Homo sapiens amiloride-sensitive cation channel 1, neuronal (degenerin) (ACCN1), transcript variant 2, mRNA. 128 NM_031412 2.57 Homo sapiens GABA(A) receptor-associated protein like 1 (GABARAPL1), mRNA. 129 NM_183377 2.57 Homo sapiens amiloride-sensitive cation channel 1, neuronal (degenerin) (ACCN1), transcript variant 1, mRNA. 130 NM_014614 2.53 Homo sapiens proteasome (prosome, macropain) activator subunit 4 (PSME4), mRNA. 131 NM_005871 2.51 Homo sapiens survival motor neuron domain containing 1 (SMNDC1), mRNA. 132 NM_003744 2.49 Homo sapiens numb homolog (Drosophila) (NUMB), transcript variant 3, mRNA. 133 NM_001005745 2.49 Homo sapiens numb homolog (Drosophila) (NUMB), transcript variant 4, mRNA. 134 NM_001005744 2.49 Homo sapiens numb homolog (Drosophila) (NUMB), transcript variant 2, mRNA. 135 NM_001005743 2.49 Homo sapiens numb homolog (Drosophila) (NUMB), transcript variant 1, mRNA. 136 NM_004274 2.48 Homo sapiens A kinase (PRKA) anchor protein 6 (AKAP6), mRNA. 137 NM_003489 2.47 Homo sapiens nuclear receptor interacting protein 1 (NRIP1), mRNA. 138 NM_017903 2.47 Homo sapiens hypothetical protein FLJ20618 (FLJ20618), mRNA. 139 NM_156036 2.47 Homo sapiens homeo box B6 (HOXB6), transcript variant 3, mRNA. 140 NM_002356 2.46 Homo sapiens myristoylated alanine-rich protein kinase C substrate (MARCKS), mRNA. 141 NM_004768 2.46 Homo sapiens splicing factor, arginine/serine-rich 11 (SFRS11), mRNA. 142 NM_145734 2.45 Homo sapiens septin 3 (SEPT3), transcript variant C, mRNA. 143 NM_001331 2.45 Homo sapiens catenin (cadherin-associated protein), delta 1 (CTNND1), mRNA. 144 NM_030571 2.43 Homo sapiens Nedd4 family interacting protein 1 (NDFIP1), mRNA. 145 NM_004059 2.41 Homo sapiens cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase) (CCBL1), mRNA. 146 NM_080670 2.41 Homo sapiens solute carrier family 35, member A4 (SLC35A4), mRNA. 147 NM_052822 2.38 Homo sapiens secretory carrier membrane protein 1 (SCAMP1), transcript variant 2, mRNA. 148 NM_030802 2.38 Homo sapiens C/EBP-induced protein (LOC81558), mRNA. 149 NM_080417 2.37 Homo sapiens peanut-like 2 (Drosophila) (PNUTL2), transcript variant 4, mRNA. 150 NM_032458 2.36 Homo sapiens PHD finger protein 6 (PHF6), mRNA. 151 NM_006148 2.35 Homo sapiens LIM and SH3 protein 1 (LASP1), mRNA. 152 NM_024994 2.35 Homo sapiens hypothetical protein FLJ12595 (FLJ12595), mRNA. 153 NM_013437 2.34 Homo sapiens low density lipoprotein-related protein 12 (LRP12), mRNA. 154 NM_020925 2.33 Homo sapiens KIAA1573 protein (KIAA1573), mRNA. 155 NM_138799 2.32 Homo sapiens O-acyltransferase (membrane bound) domain containing 2 (OACT2), mRNA. 156 NM_017623 2.28 Homo sapiens cyclin M3 (CNNM3), transcript variant 1, mRNA. 157 NM_199078 2.28 Homo sapiens cyclin M3 (CNNM3), transcript variant 2, mRNA. 158 NM_014424 2.28 Homo sapiens heat shock 27 kDa protein family, member 7 (cardiovascular) (HSPB7), mRNA. 159 NM_000599 2.27 Homo sapiens insulin-like growth factor binding protein 5 (IGFBP5), mRNA. 160 NM_021212 2.25 Homo sapiens HCF-binding transcription factor Zhangfei (ZF), mRNA. 161 NM_005110 2.24 Homo sapiens glutamine-fructose-6-phosphate transaminase 2 (GFPT2), mRNA. 162 NM_022780 2.24 Homo sapiens hypothetical protein FLJ13910 (FLJ13910), mRNA. 163 NM_014574 2.23 Homo sapiens striatin, calmodulin binding protein 3 (STRN3), mRNA. 164 NM_153020 2.21 Homo sapiens RNA binding motif protein 24 (RBM24), mRNA. 165 NM_032221 2.2 Homo sapiens chromodomain helicase DNA binding protein 6 (CHD6), mRNA. 166 NM_004080 2.19 Homo sapiens diacylglycerol kinase, beta 90 kDa (DGKB), transcript variant 1, mRNA. 167 NM_000800 2.19 Homo sapiens fibroblast growth factor 1 (acidic) (FGF1), transcript variant 1, mRNA. 168 NM_000963 2.18 Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA. 169 NM_003413 2.16 Homo sapiens Zic family member 3 heterotaxy 1 (odd-paired homolog, Drosophila) (ZIC3), mRNA. 170 NM_199182 2.1 Homo sapiens hLAT1-3TM (IMAA), mRNA. 171 NM_033137 2.09 Homo sapiens fibroblast growth factor 1 (acidic) (FGF1), transcript variant 3, mRNA. 172 NM_033136 2.09 Homo sapiens fibroblast growth factor 1 (acidic) (FGF1), transcript variant 2, mRNA. 173 NM_004132 2.08 Homo sapiens hyaluronan binding protein 2 (HABP2), mRNA. 174 NM_173557 2.05 Homo sapiens ring finger protein 152 (RNF152), mRNA. 175 NM_014906 2.04 Homo sapiens protein phosphatase 1E (PP2C domain containing) (PPM1E), mRNA. 176 NM_032010 2.02 Homo sapiens microtubule-associated protein 1B (MAP1B), transcript variant 2, mRNA. 177 NM_005909 2.02 Homo sapiens microtubule-associated protein 1B (MAP1B), transcript variant 1, mRNA. 178 NM_020432 2.02 Homo sapiens putative homeodomain transcription factor 2 (PHTF2), mRNA. 179 NM_018712 2 Homo sapiens ELMO domain containing 1 (ELMOD1), mRNA. 180 NM_004529 2 Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (MLLT3), mRNA. 181 NM_032385 2 Homo sapiens chromosome 5 open reading frame 4 (C5orf4), mRNA. 182 NM_002310 1.99 Homo sapiens leukemia inhibitory factor receptor (LIFR), mRNA. 183 NM_000393 1.99 Homo sapiens collagen, type V, alpha 2 (COL5A2), mRNA. 184 NM_000321 1.98 Homo sapiens retinoblastoma 1 (including osteosarcoma) (RB1), mRNA. 185 NM_031211 1.98 Homo sapiens LAT1-3TM protein (LAT1-3TM), mRNA. 186 NM_207044 1.86 Homo sapiens endosulfine alpha (ENSA), transcript variant 4, mRNA. 187 NM_207047 1.86 Homo sapiens endosulfine alpha (ENSA), transcript variant 7, mRNA. 188 NM_207043 1.86 Homo sapiens endosulfine alpha (ENSA), transcript variant 2, mRNA. 189 NM_006489 1.86 Homo sapiens neuro-oncological ventral antigen 1 (NOVA1), transcript variant 2, mRNA. 190 NM_019087 1.86 Homo sapiens ADP-ribosylation factor related protein 2 (ARFRP2), mRNA. 191 NM_002515 1.86 Homo sapiens neuro-oncological ventral antigen 1 (NOVA1), transcript variant 1, mRNA. 192 NM_015200 1.81 Homo sapiens SCC-112 protein (SCC-112), mRNA. 193 NM_017423 1.81 Homo sapiens UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- acetylgalactosaminyltransferase 7 (GalNAc-T7) (GALNT7), mRNA. 194 NM_014876 1.8 Homo sapiens KIAA0063 gene product (KIAA0063), mRNA. 195 NM_032228 1.78 Homo sapiens male sterility domain containing 2 (MLSTD2), mRNA. 196 NM_022845 1.77 Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 1, mRNA. 197 NM_001755 1.74 Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 2, mRNA. 198 NM_006788 1.73 Homo sapiens ralA binding protein 1 (RALBP1), mRNA. 199 NM_001560 1.68 Homo sapiens interleukin 13 receptor, alpha 1 (IL13RA1), mRNA. 200 NM_004926 1.66 Homo sapiens zinc finger protein 36, C3H type-like 1 (ZFP36L1), mRNA. 201 NM_018976 1.64 Homo sapiens solute carrier family 38, member 2 (SLC38A2), mRNA. 202 NM_000868 1.63 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C (HTR2C), mRNA. 203 NM_014810 1.63 Homo sapiens centrosome-associated protein 350 (CAP350), mRNA. 204 NM_000721 1.61 Homo sapiens calcium channel, voltage-dependent, alpha 1E subunit (CACNA1E), mRNA. 205 NM_002076 1.6 Homo sapiens glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) (GNS), mRNA. 206 NM_182646 1.58 Homo sapiens cytoplasmic polyadenylation element binding protein 2 (CPEB2), transcript variant A, mRNA. 207 NM_182485 1.58 Homo sapiens cytoplasmic polyadenylation element binding protein 2 (CPEB2), transcript variant B, mRNA. 208 NM_021079 1.55 Homo sapiens N-myristoyltransferase 1 (NMT1), mRNA. 209 NM_199324 1.47 Homo sapiens HIV-1 induced protein HIN-1 (HSHIN1), transcript variant 1, mRNA. 210 NM_145808 1.44 Homo sapiens myotrophin (MTPN), mRNA. 211 NM_005400 1.43 Homo sapiens protein kinase C, epsilon (PRKCE), mRNA. 212 NM_181897 1.42 Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha (PPP2R3A), transcript variant 2, mRNA. 213 NM_002718 1.42 Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha (PPP2R3A), transcript variant 1, mRNA. 214 NM_001438 1.2 Homo sapiens estrogen-related receptor gamma (ESRRG), transcript variant 1, mRNA. 215 NM_206594 1.2 Homo sapiens estrogen-related receptor gamma (ESRRG), transcript variant 2, mRNA. 216 NM_206595 1.2 Homo sapiens estrogen-related receptor gamma (ESRRG), transcript variant 3, mRNA.
[0106] In the case of the miR-145 miRNA, for example, Table 2 provides a listing of human mRNAs predicted to contain target sites for hsa-miR-145, using the method as described in Krek et al. (2005) Nature Genetics 37(5): 495-500, using default parameters.
TABLE-US-00006 TABLE 2 Human Refseq PicTar Rank Id score annotation 1 NM_013994 13.62 Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 3, mRNA. 2 NM_013993 13.62 Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 1, mRNA. 3 NM_001954 13.62 Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 2, mRNA. 4 NM_015094 10 Homo sapiens hypermethylated in cancer 2 (HIC2), mRNA. 5 NM_002017 9.85 Homo sapiens Friend leukemia virus integration 1 (FLI1), mRNA. 6 NM_005797 7.62 Homo sapiens epithelial V-like antigen 1 (EVA1), transcript variant 1, mRNA. 7 NM_014871 7.58 Homo sapiens ubiquitin specific protease 52 (USP52), mRNA. 8 NM_001128 7.54 Homo sapiens adaptor-related protein complex 1 gamma 1 subunit (AP1G1), mRNA. 9 NM_015271 7.44 Homo sapiens tripartite motif-containing 2 (TRIM2), mRNA. 10 NM_017999 7.08 Homo sapiens ring finger protein 31 (RNF31), mRNA. 11 NM_018011 6.83 Homo sapiens hypothetical protein FLJ10154 (FLJ10154), mRNA. 12 NM_199072 6.47 Homo sapiens I-mfa domain-containing protein (HIC), mRNA. 13 NM_033046 6.27 Homo sapiens rhotekin (RTKN), mRNA. 14 NM_173797 6.25 Homo sapiens PAP associated domain containing 4 (PAPD4), mRNA. 15 NM_016824 6.16 Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 1, mRNA. 16 NM_019903 6.16 Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 2, mRNA. 17 NM_006506 6.05 Homo sapiens RAS p21 protein activator 2 (RASA2), mRNA. 18 NM_021832 5.84 Homo sapiens a disintegrin and metalloproteinase domain 17 (tumor necrosis factor, alpha, converting enzyme) (ADAM17), transcript variant 2, mRNA. 19 NM_182492 5.67 Homo sapiens hypothetical protein DKFZp434O0213 (DKFZp434O0213), mRNA. 20 NM_144497 5.5 Homo sapiens A kinase (PRKA) anchor protein (gravin) 12 (AKAP12), transcript variant 2, mRNA. 21 NM_005100 5.5 Homo sapiens A kinase (PRKA) anchor protein (gravin) 12 (AKAP12), transcript variant 1, mRNA. 22 NM_005717 5.45 Homo sapiens actin related protein 2/3 complex, subunit 5, 16 kDa (ARPC5), mRNA. 23 NM_014923 5.35 Homo sapiens fibronectin type III domain containing 3 (FNDC3), mRNA. 24 NM_020762 5.31 Homo sapiens SLIT-ROBO Rho GTPase activating protein 1 (SRGAP1), mRNA. 25 NM_005347 5.3 Homo sapiens heat shock 70 kDa protein 5 (glucose-regulated protein, 78 kDa) (HSPA5), mRNA. 26 NM_015184 5.21 Homo sapiens phospholipase C-like 2 (PLCL2), mRNA. 27 NM_052830 5.18 Homo sapiens gamma-glutamyltransferase-like 3 (GGTL3), transcript variant 1, mRNA. 28 NM_002657 5.13 Homo sapiens pleiomorphic adenoma gene-like 2 (PLAGL2), mRNA. 29 NM_001002924 5.13 Homo sapiens adaptor-related protein complex 3, sigma 1 subunit (AP3S1), transcript variant 2, mRNA. 30 NM_013279 5.06 Homo sapiens chromosome 11 open reading frame 9 (C11orf9), mRNA. 31 NM_014903 4.9 Homo sapiens neuron navigator 3 (NAV3), mRNA. 32 NM_032726 4.8 Homo sapiens phospholipase C, delta 4 (PLCD4), mRNA. 33 NM_004714 4.77 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1B (DYRK1B), transcript variant a, mRNA. 34 NM_006484 4.77 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1B (DYRK1B), transcript variant c, mRNA. 35 NM_006483 4.77 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1B (DYRK1B), transcript variant b, mRNA. 36 NM_033274 4.7 Homo sapiens a disintegrin and metalloproteinase domain 19 (meltrin beta) (ADAM19), transcript variant 2, mRNA. 37 NM_020909 4.67 Homo sapiens erythrocyte membrane protein band 4.1 like 5 (EPB41L5), mRNA. 38 NM_024643 4.48 Homo sapiens chromosome 14 open reading frame 140 (C14orf140), mRNA. 39 NM_017913 4.44 Homo sapiens cell division cycle 37 homolog (S. cerevisiae)-like 1 (CDC37L1), mRNA. 40 NM_005384 4.42 Homo sapiens nuclear factor, interleukin 3 regulated (NFIL3), mRNA. 41 NM_178026 4.42 Homo sapiens gamma-glutamyltransferase-like 3 (GGTL3), transcript variant 3, mRNA. 42 NM_018360 4.32 Homo sapiens chromosome X open reading frame 15 (CXorf15), mRNA. 43 NM_016032 4.29 Homo sapiens zinc finger, DHHC domain containing 9 (ZDHHC9), mRNA. 44 NM_016258 4.28 Homo sapiens YTH domain family, member 2 (YTHDF2), mRNA. 45 NM_182664 4.23 Homo sapiens Ras association (RalGDS/AF-6) domain family 5 (RASSF5), transcript variant 2, mRNA. 46 NM_006702 4.22 Homo sapiens neuropathy target esterase (NTE), mRNA. 47 NM_006080 4.2 Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A (SEMA3A), mRNA. 48 NM_004276 4.12 Homo sapiens calcium binding protein 1 (calbrain) (CABP1), transcript variant 2, mRNA. 49 NM_031205 4.12 Homo sapiens calcium binding protein 1 (calbrain) (CABP1), transcript variant 1, mRNA. 50 NM_147193 4.05 Homo sapiens GLIS family zinc finger 1 (GLIS1), mRNA. 51 NM_004865 4.02 Homo sapiens TBP-like 1 (TBPL1), mRNA. 52 NM_001284 4.02 Homo sapiens adaptor-related protein complex 3, sigma 1 subunit (AP3S1), transcript variant 1, mRNA. 53 NM_022652 3.98 Homo sapiens dual specificity phosphatase 6 (DUSP6), transcript variant 2, mRNA. 54 NM_001946 3.98 Homo sapiens dual specificity phosphatase 6 (DUSP6), transcript variant 1, mRNA. 55 NM_001967 3.93 Homo sapiens eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2), mRNA. 56 NM_000944 3.92 Homo sapiens protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha) (PPP3CA), mRNA. 57 NM_002013 3.88 Homo sapiens FK506 binding protein 3, 25 kDa (FKBP3), mRNA. 58 NM_005433 3.82 Homo sapiens v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 (YES1), mRNA. 59 NM_002973 3.81 Homo sapiens ataxin 2 (ATXN2), mRNA. 60 NM_145799 3.81 Homo sapiens septin 6 (SEPT6), transcript variant I, mRNA. 61 NM_001386 3.79 Homo sapiens dihydropyrimidinase-like 2 (DPYSL2), mRNA. 62 NM_005723 3.78 Homo sapiens transmembrane 4 superfamily member 9 (TM4SF9), mRNA. 63 NM_007146 3.71 Homo sapiens zinc finger protein 161 (ZNF161), mRNA. 64 NM_024586 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 6, mRNA. 65 NM_148909 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 7, mRNA. 66 NM_148906 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 3, mRNA. 67 NM_052887 3.7 Homo sapiens toll-interleukin 1 receptor (TIR) domain containing adaptor protein (TIRAP), transcript variant 1, mRNA. 68 NM_148907 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 4, mRNA. 69 NM_148908 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 5, mRNA. 70 NM_148905 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 2, mRNA. 71 NM_148904 3.7 Homo sapiens oxysterol binding protein-like 9 (OSBPL9), transcript variant 1, mRNA. 72 NM_020307 3.68 Homo sapiens cyclin L1 (CCNL1), mRNA. 73 NM_184042 3.63 Homo sapiens Cohen syndrome 1 (COH1), transcript variant 2, mRNA. 74 NM_001457 3.63 Homo sapiens filamin B, beta (actin binding protein 278) (FLNB), mRNA. 75 NM_032511 3.56 Homo sapiens chromosome 6 open reading frame 168 (C6orf168), mRNA. 76 NM_016389 3.55 Homo sapiens influenza virus NS1A binding protein (IVNS1ABP), transcript variant 2, mRNA. 77 NM_001326 3.54 Homo sapiens cleavage stimulation factor, 3' pre-RNA, subunit 3, 77 kDa (CSTF3), mRNA. 78 NM_152600 3.52 Homo sapiens zinc finger protein 579 (ZNF579), mRNA. 79 NM_014016 3.5 Homo sapiens SAC1 suppressor of actin mutations 1-like (yeast) (SACM1L), mRNA. 80 NM_052925 3.48 Homo sapiens leukocyte receptor cluster (LRC) member 8 (LENG8), mRNA. 81 NM_052911 3.47 Homo sapiens establishment factor-like protein (EFO1), mRNA. 82 NM_015129 3.46 Homo sapiens septin 6 (SEPT6), transcript variant II, mRNA. 83 NM_002924 3.43 Homo sapiens regulator of G-protein signalling 7 (RGS7), mRNA. 84 NM_002229 3.42 Homo sapiens jun B proto-oncogene (JUNB), mRNA. 85 NM_153498 3.35 Homo sapiens calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 2, mRNA. 86 NM_005119 3.34 Homo sapiens thyroid hormone receptor associated protein 3 (THRAP3), mRNA. 87 NM_173078 3.34 Homo sapiens SLIT and NTRK-like family, member 4 (SLITRK4), mRNA. 88 NM_003893 3.31 Homo sapiens LIM domain binding 1 (LDB1), mRNA. 89 NM_000346 3.3 Homo sapiens SRY (sex determining region Y)- box 9 (campomelic dysplasia, autosomal sex- reversal) (SOX9), mRNA. 90 NM_032222 3.27 Homo sapiens hypothetical protein FLJ22374 (FLJ22374), mRNA. 91 NM_133370 3.24 Homo sapiens splicing factor YT521-B (YT521), mRNA. 92 NM_015069 3.23 Homo sapiens zinc finger protein 423 (ZNF423), mRNA. 93 NM_018271 3.23 Homo sapiens hypothetical protein FLJ10916 (FLJ10916), mRNA. 94 NM_030962 3.2 Homo sapiens SET binding factor 2 (SBF2), mRNA. 95 NM_014363 3.19 Homo sapiens spastic ataxia of Charlevoix- Saguenay (sacsin) (SACS), mRNA. 96 NM_017640 3.15 Homo sapiens leucine rich repeat containing 16 (LRRC16), mRNA. 97 NM_005544 3.14 Homo sapiens insulin receptor substrate 1 (IRS1), mRNA. 98 NM_002912 3.09 Homo sapiens REV3-like, catalytic subunit of DNA polymerase zeta (yeast) (REV3L), mRNA. 99 NM_001614 3.09 Homo sapiens actin, gamma 1 (ACTG1), mRNA. 100 NM_015361 3.09 Homo sapiens R3H domain (binds single- stranded nucleic acids) containing (R3HDM), mRNA. 101 NM_152390 3.09 Homo sapiens hypothetical protein MGC33926 (MGC33926), mRNA. 102 NM_025076 3.07 Homo sapiens UDP-glucuronate decarboxylase 1 (UXS1), mRNA. 103 NM_152945 3.06 Homo sapiens developmentally regulated RNA- binding protein 1 (DRB1), mRNA. 104 NM_014267 3.04 Homo sapiens small acidic protein (SMAP), mRNA. 105 NM_007345 3.04 Homo sapiens zinc finger protein 236 (ZNF236), mRNA. 106 NM_023071 3.03 Homo sapiens spermatogenesis associated, serine-rich 2 (SPATS2), mRNA. 107 NM_004755 3.01 Homo sapiens ribosomal protein S6 kinase, 90 kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA. 108 NM_001901 2.99 Homo sapiens connective tissue growth factor (CTGF), mRNA. 109 NM_018270 2.98 Homo sapiens chromosome 20 open reading frame 20 (C20orf20), mRNA. 110 NM_001092 2.98 Homo sapiens active BCR-related gene (ABR), transcript variant 2, mRNA. 111 NM_021962 2.98 Homo sapiens active BCR-related gene (ABR), transcript variant 1, mRNA. 112 NM_182527 2.97 Homo sapiens calcium binding protein 7 (CABP7), mRNA. 113 NM_021612 2.96 Homo sapiens a disintegrin and metalloproteinase domain 11 (ADAM11), transcript variant 2, mRNA. 114 NM_020806 2.96 Homo sapiens gephyrin (GPHN), mRNA. 115 NM_000959 2.95 Homo sapiens prostaglandin F receptor (FP)
(PTGFR), mRNA. 116 NM_016322 2.94 Homo sapiens RAB14, member RAS oncogene family (RAB14), mRNA. 117 NM_138440 2.94 Homo sapiens vasorin (LOC114990), mRNA. 118 NM_194293 2.93 Homo sapiens cardiomyopathy associated 1 (CMYA1), mRNA. 119 NM_022650 2.92 Homo sapiens RAS p21 protein activator (GTPase activating protein) 1 (RASA1), transcript variant 2, mRNA. 120 NM_002890 2.92 Homo sapiens RAS p21 protein activator (GTPase activating protein) 1 (RASA1), transcript variant 1, mRNA. 121 NM_001616 2.92 Homo sapiens activin A receptor, type II (ACVR2), mRNA. 122 NM_018607 2.9 Homo sapiens hypothetical protein PRO1853 (PRO1853), transcript variant 2, mRNA. 123 NM_033346 2.87 Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 2, mRNA. 124 NM_007005 2.87 Homo sapiens transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (TLE4), mRNA. 125 NM_033505 2.87 Homo sapiens selenoprotein I (SELI), mRNA. 126 NM_014800 2.85 Homo sapiens engulfment and cell motility 1 (ced-12 homolog, C. elegans) (ELMO1), transcript variant 1, mRNA. 127 NM_130442 2.85 Homo sapiens engulfment and cell motility 1 (ced-12 homolog, C. elegans) (ELMO1), transcript variant 2, mRNA. 128 NM_023929 2.82 Homo sapiens zinc finger and BTB domain containing 10 (ZBTB10), mRNA. 129 NM_198138 2.82 Homo sapiens SEC31-like 2 (S. cerevisiae) (SEC31L2), transcript variant 2, mRNA. 130 NM_015277 2.8 Homo sapiens neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L), mRNA. 131 NM_017732 2.8 Homo sapiens hypoxia-inducible factor prolyl 4- hydroxylase (PH-4), transcript variant 2, mRNA. 132 NM_133476 2.79 Homo sapiens zinc finger protein 384 (ZNF384), mRNA. 133 NM_022845 2.79 Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 1, mRNA. 134 NM_207424 2.77 Homo sapiens FLJ40536 protein (FLJ40536), mRNA. 135 NM_017641 2.76 Homo sapiens kinesin family member 21A (KIF21A), mRNA. 136 NM_001755 2.76 Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 2, mRNA. 137 NM_014840 2.76 Homo sapiens AMP-activated protein kinase family member 5 (ARK5), mRNA. 138 NM_022977 2.75 Homo sapiens acyl-CoA synthetase long-chain family member 4 (ACSL4), transcript variant 2, mRNA. 139 NM_004458 2.75 Homo sapiens acyl-CoA synthetase long-chain family member 4 (ACSL4), transcript variant 1, mRNA. 140 NM_022832 2.73 Homo sapiens ubiquitin specific protease 46 (USP46), mRNA. 141 NM_025057 2.73 Homo sapiens chromosome 14 open reading frame 45 (C14orf45), mRNA. 142 NM_130436 2.72 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1A (DYRK1A), transcript variant 2, mRNA. 143 NM_001396 2.72 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1A (DYRK1A), transcript variant 1, mRNA. 144 NM_004096 2.72 Homo sapiens eukaryotic translation initiation factor 4E binding protein 2 (EIF4EBP2), mRNA. 145 NM_052900 2.71 Homo sapiens CUB and Sushi multiple domains 3 (CSMD3), transcript variant c, mRNA. 146 NM_198123 2.71 Homo sapiens CUB and Sushi multiple domains 3 (CSMD3), transcript variant a, mRNA. 147 NM_198124 2.71 Homo sapiens CUB and Sushi multiple domains 3 (CSMD3), transcript variant b, mRNA. 148 NM_016231 2.7 Homo sapiens nemo like kinase (NLK), mRNA. 149 NM_031284 2.7 Homo sapiens ADP-dependent glucokinase (ADPGK), mRNA. 150 NM_020772 2.7 Homo sapiens 82-kD FMRP Interacting Protein (182-FIP), mRNA. 151 NM_018993 2.69 Homo sapiens Ras and Rab interactor 2 (RIN2), mRNA. 152 NM_173640 2.68 Homo sapiens likely ortholog of mouse roof plate-specific spondin (R-spondin), mRNA. 153 NM_014212 2.67 Homo sapiens homeo box C11 (HOXC11), mRNA. 154 NM_001259 2.67 Homo sapiens cyclin-dependent kinase 6 (CDK6), mRNA. 155 NM_005721 2.64 Homo sapiens ARP3 actin-related protein 3 homolog (yeast) (ACTR3), mRNA. 156 NM_014603 2.64 Homo sapiens paraneoplastic antigen (HUMPPA), mRNA. 157 NM_015187 2.62 Homo sapiens KIAA0746 protein (KIAA0746), mRNA. 158 NM_138638 2.6 Homo sapiens cofilin 2 (muscle) (CFL2), transcript variant 2, mRNA. 159 NM_021914 2.6 Homo sapiens cofilin 2 (muscle) (CFL2), transcript variant 1, mRNA. 160 NM_052905 2.58 Homo sapiens formin-like 2 (FMNL2), transcript variant 2, mRNA. 161 NM_018227 2.56 Homo sapiens hypothetical protein FLJ10808 (FLJ10808), mRNA. 162 NM_020796 2.56 Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A (SEMA6A), mRNA. 163 NM_017903 2.54 Homo sapiens hypothetical protein FLJ20618 (FLJ20618), mRNA. 164 NM_002745 2.53 Homo sapiens mitogen-activated protein kinase 1 (MAPK1), transcript variant 1, mRNA. 165 NM_001004422 2.52 Homo sapiens formin-like 2 (FMNL2), transcript variant 3, mRNA. 166 NM_006922 2.52 Homo sapiens sodium channel, voltage-gated, type III, alpha (SCN3A), mRNA. 167 NM_032017 2.52 Homo sapiens Ser/Thr-like kinase (MGC4796), mRNA. 168 NM_024595 2.51 Homo sapiens hypothetical protein FLJ12666 (FLJ12666), mRNA. 169 NM_004393 2.5 Homo sapiens dystroglycan 1 (dystrophin- associated glycoprotein 1) (DAG1), mRNA. 170 NM_198793 2.48 Homo sapiens CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (CD47), transcript variant 2, mRNA. 171 NM_001004417 2.48 Homo sapiens formin-like 2 (FMNL2), transcript variant 4, mRNA. 172 NM_001777 2.48 Homo sapiens CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (CD47), transcript variant 1, mRNA. 173 NM_152253 2.48 Homo sapiens choline kinase beta (CHKB), transcript variant 2, mRNA. 174 NM_032432 2.47 Homo sapiens actin binding LIM protein family, member 2 (ABLIM2), mRNA. 175 NM_001004421 2.46 Homo sapiens formin-like 2 (FMNL2), transcript variant 1, mRNA. 176 NM_173809 2.46 Homo sapiens biogenesis of lysosome-related organelles complex-1, subunit 2 (BLOC1S2), transcript variant 1, mRNA. 177 NM_002859 2.46 Homo sapiens paxillin (PXN), mRNA. 178 NM_001001342 2.46 Homo sapiens biogenesis of lysosome-related organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2, mRNA. 179 NM_021224 2.45 Homo sapiens zinc finger protein 462 (ZNF462), mRNA. 180 NM_032196 2.45 Homo sapiens homolog of yeast INO80 (INO80), transcript variant 2, mRNA. 181 NM_015455 2.43 Homo sapiens carbon catabolite repression 4 protein (KIAA1194), mRNA. 182 NM_032229 2.43 Homo sapiens SLIT and NTRK-like family, member 6 (SLITRK6), mRNA. 183 NM_130438 2.41 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1A (DYRK1A), transcript variant 5, mRNA. 184 NM_145686 2.39 Homo sapiens mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), transcript variant 2, mRNA. 185 NM_004834 2.39 Homo sapiens mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), transcript variant 1, mRNA. 186 NM_145687 2.39 Homo sapiens mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), transcript variant 3, mRNA. 187 NM_130437 2.38 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1A (DYRK1A), transcript variant 4, mRNA. 188 NM_101395 2.38 Homo sapiens dual-specificity tyrosine-(Y)- phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3, mRNA. 189 NM_014666 2.38 Homo sapiens enthoprotin (ENTH), mRNA. 190 NM_024713 2.36 Homo sapiens chromosome 15 open reading frame 29 (C15orf29), mRNA. 191 NM_003076 2.35 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 (SMARCD1), transcript variant 1, mRNA. 192 NM_015074 2.35 Homo sapiens kinesin family member 1B (KIF1B), transcript variant 1, mRNA. 193 NM_014742 2.34 Homo sapiens transmembrane 9 superfamily protein member 4 (TM9SF4), mRNA. 194 NM_139071 2.34 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 (SMARCD1), transcript variant 2, mRNA. 195 NM_017553 2.32 Homo sapiens homolog of yeast INO80 (INO80), transcript variant 1, mRNA. 196 NM_206909 2.32 Homo sapiens pleckstrin and Sec7 domain containing 3 (PSD3), transcript variant 2, mRNA. 197 NM_005863 2.27 Homo sapiens neuroepithelial cell transforming gene 1 (NET1), mRNA. 198 NM_145341 2.25 Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor) (PDCD4), transcript variant 2, mRNA. 199 NM_014456 2.25 Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor) (PDCD4), transcript variant 1, mRNA. 200 NM_015176 2.25 Homo sapiens F-box protein 28 (FBXO28), mRNA. 201 NM_002142 2.23 Homo sapiens homeo box A9 (HOXA9), transcript variant 2, mRNA. 202 NM_017772 2.22 Homo sapiens chromosome 6 open reading frame 197 (C6orf197), mRNA. 203 NM_017582 2.22 Homo sapiens ubiquitin-conjugating enzyme E2Q (putative) (UBE2Q), mRNA. 204 NM_006469 2.22 Homo sapiens influenza virus NS1A binding protein (IVNS1ABP), transcript variant 1, mRNA. 205 NM_002840 2.19 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 1, mRNA. 206 NM_130440 2.19 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 2, mRNA. 207 NM_199437 2.17 Homo sapiens PR domain containing 10 (PRDM10), transcript variant 2, mRNA. 208 NM_199439 2.17 Homo sapiens PR domain containing 10 (PRDM10), transcript variant 4, mRNA. 209 NM_199438 2.17 Homo sapiens PR domain containing 10 (PRDM10), transcript variant 3, mRNA. 210 NM_005604 2.17 Homo sapiens POU domain, class 3, transcription factor 2 (POU3F2), mRNA. 211 NM_020228 2.17 Homo sapiens PR domain containing 10 (PRDM10), transcript variant 1, mRNA. 212 NM_019084 2.16 Homo sapiens cyclin J (CCNJ), mRNA. 213 NM_173619 2.16 Homo sapiens hypothetical protein MGC34761 (MGC34761), mRNA. 214 NM_017902 2.15 Homo sapiens hypoxia-inducible factor 1, alpha subunit inhibitor (HIF1AN), mRNA. 215 NM_022735 2.14 Homo sapiens acyl-Coenzyme A binding domain containing 3 (ACBD3), mRNA. 216 NM_002193 2.13 Homo sapiens inhibin, beta B (activin AB beta polypeptide) (INHBB), mRNA. 217 NM_207438 2.12 Homo sapiens FLJ43808 protein (FLJ43808), mRNA. 218 NM_020689 2.12 Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 (SLC24A3), mRNA. 219 NM_012271 2.1 Homo sapiens huntingtin interacting protein B (HYPB), transcript variant 2, mRNA. 220 NM_023079 2.09 Homo sapiens hypothetical protein FLJ13855 (FLJ13855), mRNA. 221 NM_001759 2.09 Homo sapiens cyclin D2 (CCND2), mRNA. 222 NM_018246 2.07 Homo sapiens hypothetical protein FLJ10853 (FLJ10853), mRNA. 223 NM_016201 2.06 Homo sapiens angiomotin like 2 (AMOTL2), mRNA. 224 NM_020925 2.06 Homo sapiens KIAA1573 protein (KIAA1573), mRNA. 225 NM_207406 2.05 Homo sapiens FLJ43965 protein (FLJ43965), mRNA. 226 NM_020248 2.05 Homo sapiens catenin, beta interacting protein 1 (CTNNBIP1), mRNA. 227 NM_003204 2.03 Homo sapiens nuclear factor (erythroid-derived 2)-like 1 (NFE2L1), mRNA. 228 NM_006459 2.02 Homo sapiens SPFH domain family, member 1
(SPFH1), mRNA. 229 NM_006403 1.99 Homo sapiens neural precursor cell expressed, developmentally down-regulated 9 (NEDD9), mRNA. 230 NM_003483 1.93 Homo sapiens high mobility group AT-hook 2 (HMGA2), mRNA. 231 NM_203351 1.92 Homo sapiens mitogen-activated protein kinase kinase kinase 3 (MAP3K3), transcript variant 1, mRNA. 232 NM_002401 1.92 Homo sapiens mitogen-activated protein kinase kinase kinase 3 (MAP3K3), transcript variant 2, mRNA. 233 NM_003887 1.92 Homo sapiens development and differentiation enhancing factor 2 (DDEF2), mRNA. 234 NM_013449 1.85 Homo sapiens bromodomain adjacent to zinc finger domain, 2A (BAZ2A), mRNA. 235 NM_003507 1.84 Homo sapiens frizzled homolog 7 (Drosophila) (FZD7), mRNA. 236 NM_014686 1.81 Homo sapiens KIAA0355 (KIAA0355), mRNA. 237 NM_003759 1.81 Homo sapiens solute carrier family 4, sodium bicarbonate cotransporter, member 4 (SLC4A4), mRNA. 238 NM_006380 1.79 Homo sapiens amyloid beta precursor protein (cytoplasmic tail) binding protein 2 (APPBP2), mRNA. 239 NM_199040 1.78 Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4), transcript variant 2, mRNA. 240 NM_019094 1.78 Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4), transcript variant 1, mRNA. 241 NM_014919 1.76 Homo sapiens Wolf-Hirschhorn syndrome candidate 1 (WHSC1), transcript variant 4, mRNA. 242 NM_080760 1.75 Homo sapiens dachshund homolog 1 (Drosophila) (DACH1), transcript variant 2, mRNA. 243 NM_004392 1.75 Homo sapiens dachshund homolog 1 (Drosophila) (DACH1), transcript variant 3, mRNA. 244 NM_080759 1.75 Homo sapiens dachshund homolog 1 (Drosophila) (DACH1), transcript variant 1, mRNA. 245 NM_133333 1.72 Homo sapiens Wolf-Hirschhorn syndrome candidate 1 (WHSC1), transcript variant 6, mRNA. 246 NM_133332 1.7 Homo sapiens Wolf-Hirschhorn syndrome candidate 1 (WHSC1), transcript variant 5, mRNA. 247 NM_025146 1.62 Homo sapiens Mak3 homolog (S. cerevisiae) (MAK3), mRNA. 248 NM_002015 1.56 Homo sapiens forkhead box O1A (rhabdomyosarcoma) (FOXO1A), mRNA. 249 NM_003458 1.56 Homo sapiens bassoon (presynaptic cytomatrix protein) (BSN), mRNA. 250 NM_001204 1.53 Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 1, mRNA. 251 NM_004921 1.48 Homo sapiens chloride channel, calcium activated, family member 3 (CLCA3), mRNA. 252 NM_005502 1.47 Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 1 (ABCA1), mRNA. 253 NM_148171 1.4 Homo sapiens ubiquitin associated protein 2 (UBAP2), transcript variant 3, mRNA. 254 NM_015071 1.38 Homo sapiens Rho GTPase activating protein 26 (ARHGAP26), mRNA. 255 NM_030627 1.34 Homo sapiens cytoplasmic polyadenylation element binding protein 4 (CPEB4), mRNA. 256 NM_030918 1.19 Homo sapiens sorting nexin family member 27 (SNX27), mRNA. 257 NM_004171 1.11 Homo sapiens solute carrier family 1 (glial high affinity glutamate transporter), member 2 (SLC1A2), mRNA. 258 NM_021813 0.97 Homo sapiens BTB and CNC homology 1, basic leucine zipper transcription factor 2 (BACH2), mRNA.
[0107] A target site for the binding of the microRNA may be introduced into the nucleic acid with the capacity to modulate the development of cell at a suitable position in the nucleic acid. For example, in the case of the target site being introduced into a mRNA (by way, for example, of cloning the target site into the appropriate position in a plasmid encoding a gene to be transcribed), the target site(s) may be introduced into one or more of the 3'UTR, coding region and 5'UTR of the mRNA. Methods for the cloning of nucleic acid sequences are essentially as described in Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratroy Press, New York. (1989).
[0108] For example, the target site for the miR-143 and/or miR-145 microRNAs may be cloned into the 3'UTR of the HSV thymidine kinase gene. This construct, when expressed in cells with a reduced activity and/or expression of the miR-143 or miR-145 microRNAs, will lead to selective ablation of these cells.
[0109] In the case of a non-naturally occurring target site, the target site for introduction into the nucleic acid may be produced by a method known in the art, such as chemical synthesis. For example, phosphorothioate oligonucleotides may be synthesized by the method as described in Stein et al. (1988) Nucl. Acids Res. 16: 3209. The target site may then be introduced into the nucleic acid by a method known in the art. For example, complementary oligonucleotides containing the binding site may be annealed and then introduced into the appropriate restriction site in a plasmid.
[0110] The nucleic acid with the capacity to modulate development of a cell may include more than one copy of a target site for binding of the miRNA. For example, the nucleic acid may contain 2, 3, 4 or more copies of a target site. Indeed, it is anticipated that multiple copies of a target site may provide a greater degree of control of the level of expression of the nucleic acid with the capacity to modulate development of the cell.
[0111] It will also be appreciated that the copies of the target site may be copies of the same or a similar target sequence, or one or more copies of a target sequence for one or more different microRNA(s).
[0112] The present invention also provides a cell including an exogenous nucleic acid including a binding site for a microRNA, or a cell including a nucleic acid with a non-naturally occurring binding site for a microRNA.
[0113] In one form, the cell is a cancerous or pre-cancerous cell with a reduced activity of a microRNA. Examples of cancerous and pre-cancerous cells are as previously discussed herein.
[0114] Accordingly, in another form the present invention provides a cancerous or pre-cancerous cell including an exogenous nucleic acid including a binding site for a microRNA, wherein the cancerous or pre-cancerous cell has a reduced activity and/or concentration of the microRNA as compared to a similar non-cancerous cell.
[0115] The cell, such as a pre-cancerous or cancerous cell, may be present in vitro or in vivo. For example, the cell may be an isolated cell in vitro, or a cell present in a biological system such as an organ, tissue, or an entire organism (eg an animal or human subject).
[0116] Thus, the present invention also provides an animal or human including non-cancerous cells and cancerous cells, the non-cancerous and cancerous cells both including and/or expressing an exogenous nucleic acid with a target site for binding of a microRNA.
[0117] Accordingly, in another form the present invention provides an animal including cancerous cells, the cancerous cells including an exogenous nucleic acid including a target site for binding of a microRNA.
[0118] In one form, the target site for binding of a microRNA is a target site for a microRNA that has reduced expression and/or activity in the cancerous cell, as compared to a similar non-cancerous cell. Examples of such binding sites are as previously herein discussed and include the binding site for the miR-143 and/or miR-145 microRNAs.
[0119] In one form, the exogenous nucleic acid has the capacity to modulate the development of a cell in the animal. Examples of such nucleic acids are as previously discussed herein.
[0120] The expression of an exogenous nucleic acid in a cell may be by way of introducing the nucleic acid into the cells by a method known in the art. Methods for introducing exogenous DNAs into prokaryotic and eukaryotic cells are essentially as described in Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratory Press, New York. (1989).
[0121] In the case of an animal, the animal may also be a transgenic animal with the nucleic acid stably integrated into the genome of the cells of the animal. Methods for producing transgenic animals are known in the art.
[0122] The present invention also provides a nucleic acid that has the capacity to modulate development of a cell and which includes a binding site for a microRNA.
[0123] Nucleic acids in the various forms of the present invention may be produced by a method known in the art, such as cloning, in vitro transcription (for a RNA), chemical synthesis or any combination of such methods. The present invention also provides vectors including the nucleic acids of the present invention, and cells including the vectors and nucleic acids.
[0124] Examples of nucleic acids with the capacity to modulate the development of cells are as previously discussed herein. Thus, the nucleic acid may have the capacity to inhibit the development of a cell (eg cytostatic or cytotoxic activity), or alternatively, may have the capacity to promote development of a cell.
[0125] Accordingly, in another form the present invention provides a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a binding site for a microRNA. Examples of binding sites for microRNAs are as previously discussed herein.
[0126] In one form, the binding site for the microRNA is a binding site for a microRNA that has an altered activity and/or concentration in a cell, as compared to another cell.
[0127] Thus, the nucleic acid may include a binding for a microRNA that is differentially expressed and/or differentially active.
[0128] The nucleic acid may have the capacity to either inhibit or promote development of a cell. Examples of nucleic acids that have the capacity to modulate development are as discussed previously herein.
[0129] It will be appreciated that the nucleic acids of the present invention may be used in a composition for exposure to a cell, so as to introduce the nucleic acid into the cell, or a composition for administration to an animal or human subject, or be part of a vector, such as a viral vector, for introducing the nucleic acids into cells in vitro, or cells in a biological system, such as cells in an animal or human subject.
[0130] In this case, the nucleic acid may be used for example to inhibit the development of a cell(s) in an animal or human subject, such as ablating the cell(s) in an animal or human subject.
[0131] The nucleic acid in the various forms of the present invention may be an isolated nucleic acid. In this regard, the term "isolated" is to be understood to mean an entity, for example a nucleic acid, a polypeptide, or a cell, which is removed from its natural environment.
[0132] The nucleic acid in the various forms of the present invention may also be present and/or expressed in a cell.
[0133] Accordingly, in another form the present invention also provides a cell including an exogenous nucleic with the capacity to modulate development of the cell, the nucleic acid including a binding site for a microRNA.
[0134] The cell may be a prokaryotic cell or a eukaryotic cell.
[0135] An example of a suitable prokaryotic cell is Escherichia coli. Such a cell is useful for maintaining and/or propagating plasmids including the nucleic acid. An example of a suitable eukaryotic cell is a human colon cell, or cell derived therefrom.
[0136] In one form, the cell is a eukaryotic cell that has an altered level and/or activity of one or more microRNAs. Examples of such cells are as previously discussed herein.
[0137] The cell may be an isolated cell in vitro, or a cell present in a biological system such as an organ, tissue, or an entire organism (eg an animal or human subject).
[0138] In one form, the cell is a cancerous or pre-cancerous cell with a reduced activity of a microRNA.
[0139] Accordingly, in another form the present invention provides a cancerous or pre-cancerous cell with reduced activity of a microRNA, the cancerous or pre-cancerous cell including an exogenous nucleic with the capacity to modulate development of the cell, the nucleic acid including a binding site for the microRNA. The reduced activity of the microRNA is as compared to a similar non-cancerous cell.
[0140] The cancerous or pre-cancerous cell may be an isolated cell in vitro, or a cell present in a biological system such as an organ, tissue, or an entire organism (eg an animal or human subject).
[0141] For example, the cells may be present in a whole animal or human that contains non-cancerous cells and cancerous cells, both of which express an exogenous nucleic with the capacity to modulate development of the cell, the nucleic acid including a binding site for a microRNA.
[0142] Thus, the present invention also provides an animal including non-cancerous cells and cancerous cells, the non-cancerous and cancerous cells both including and/or expressing an exogenous nucleic acid with the capacity to modulate development of the cell, the nucleic acid including a binding site for a microRNA.
[0143] In one form, the binding site for the microRNA is a binding site for a microRNA that has an altered activity and/or concentration in the cancerous cells as compared to the non-cancerous cells.
[0144] The present invention also provides a nucleic acid including a non-naturally occurring binding site for a microRNA that is differentially expressed and/or has differential activity.
[0145] Accordingly, in another form the present invention provides a nucleic acid including a non-naturally occurring binding site for a microRNA, wherein the microRNA is differentially expressed or differentially active between cells.
[0146] The nucleic acid may be an isolated nucleic acid. The nucleic acid may be present and/or expressed in a cell.
[0147] The binding site for the differentially expressed or active microRNA is a binding site of a microRNA that has altered expression and/or activity between different types of cells. In one form, the cells are of a similar type.
[0148] Examples of differentially expressed microRNAs include the miR-143 and miR-145 microRNAs, which are differentially expressed between colonic tumours and normal colonic tissue.
[0149] In one form, the binding site is a non-naturally occurring binding site for a microRNA that has an altered expression and/or activity in cancerous or pre-cancerous cells, as compared to the level of expression and/or activity in normal or non-cancerous cells. For example, the microRNA may have a reduced expression and/or activity in cancerous or pre-cancerous cells, as compared to the level of expression and/or activity in normal or non-cancerous cells.
[0150] Accordingly, in another form the present invention provides an isolated nucleic acid including a non-naturally occurring binding site for a microRNA that is down-regulated in a cancerous cell as compared to a similar non-cancerous cell.
[0151] In one form, the nucleic acid is a nucleic acid with the capacity to modulate development of a cell. Nucleic acids that have the capacity to modulate the development of a cell are as previously discussed herein. Thus, the nucleic acid may inhibit (eg have cytotoxic or cytostatic activity) or promote the development of a cell.
[0152] In one form, the nucleic acid includes two or more binding sites for binding of the same or different microRNAs that are differentially expressed and/or differentially active.
[0153] It will be appreciated that the nucleic acid may be used in a composition for exposure to a cell, so as to introduce the nucleic acid into the cell, or for administration to an animal or human subject, or be part of a vector, such as a viral vector, for introducing into cells, including cells in an animal or human subject.
[0154] In one form, the nucleic acid is used to inhibit the development of a cell(s) in an animal or human subject, including the ablation of the cell(s) in an animal or human subject.
[0155] Methods for the design of target sites for microRNAs are as previously discussed herein.
[0156] Methods for determining whether the binding site occurs naturally are known in the art.
[0157] For example, the BLAST algorithm can be used for determining the extent of nucleotide homology between a target sequence and sequences in a specific genome. BLAST identifies local alignments between the sequences in the database and predicts the probability of the local alignment occurring by chance. The BLAST algorithm is as described in Altschul et al. (1990) J. Mol. Biol. 215:403-410.
[0158] The nucleic acid may be an exogenous nucleic acid introduced into a cell and then expressed.
[0159] Accordingly, the present invention also provides a cell including a nucleic acid including a non-naturally occurring binding site for a microRNA that is differentially expressed and/or differentially active.
[0160] The cell may be a prokaryotic cell or a eukaryotic cell.
[0161] An example of a suitable prokaryotic cell is Escherichia coli. Such a cell is useful for maintaining and/or propagating plasmids including the nucleic acid.
[0162] In one form, the cell is a eukaryotic cell that has an altered level and/or activity of one or more microRNAs. Examples of such cells are as previously described herein.
[0163] The cell may be an isolated cell in vitro, or a cell present in a biological system such as cell present in an organ, tissue, or an entire organism (eg an animal or human subject).
[0164] In one form, the cell is a cancerous or pre-cancerous cell.
[0165] Accordingly, in another form the present invention provides a cancerous or pre-cancerous cell including a nucleic acid including a non-naturally occurring binding site for a microRNA.
[0166] In one form, the cell is a cancerous or pre-cancerous cell with a reduced activity of a microRNA.
[0167] Accordingly, in another form the present invention provides a cancerous or pre-cancerous cell with reduced activity of a microRNA, the cancerous or pre-cancerous cell including a nucleic acid including a non-naturally occurring binding site for a microRNA that is differentially expressed and/or differentially active in the cancerous or pre-cancerous cell as compared to a similar non-cancerous cell.
[0168] For example, the cells may be present in a whole animal or human that contains non-cancerous cells and cancerous cells, either or both of which include and/or express a nucleic acid including a non-naturally occurring binding site for a microRNA.
[0169] Accordingly, in another form the present invention provides an animal including cancerous cells, the cancerous cells including a nucleic acid including a non-naturally occurring binding site for a microRNA.
[0170] In one form, the microRNA is differentially expressed or differentially active in the cancerous cells as compared to non-cancerous cells.
[0171] Accordingly, in another form the present invention provides an animal including non-cancerous cells and cancerous cells, the non-cancerous and cancerous cells both including and/or expressing a nucleic acid including a non-naturally occurring binding site for a microRNA that is differentially expressed or differentially active in the cancerous cell as compared to the non-cancerous cell.
[0172] The nucleic acids of the present invention may be introduced into a cell by a suitable method known in art. For example, the nucleic acid may be introduced into a cell by transformation using calcium phosphate, viral infection, electroporation, lipofection, or particle bombardment. In this regard, transformed cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, or cells which transiently express the inserted DNA or RNA for limited periods of time. Methods for introducing exogenous DNAs into prokaryotic and eukaryotic cells are essentially as described in Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratory Press, New York. (1989).
[0173] In the case of the nucleic acid being a mRNA, the mRNA may be produced in the cell by transcription of the relevant DNA. Alternatively, the mRNA may be an exogenous mRNA introduced into the cell. Methods for producing mRNAs in vitro are known in the art.
[0174] For a mRNA expressed in the cell from a DNA template, the target site may be cloned into a suitable expression vector for use in the cell type of interest by methods known in the art. Methods for the isolation of nucleic acid sequences and their cloning into a suitable expression vector are essentially as described in Sambrook, J, Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd. ed. Cold Spring Harbor Laboratroy Press, New York. (1989). The recombinant molecule may then be introduced into the cell and the cloned nucleic acid expressed. The vector may be any nucleic acid capable of having a foreign nucleic acid inserted into the vector. For example, the vector may be a plasmid, all or part of a viral genome, or any other nucleic acid capable of autonomous replication in a prokaryotic or eukaryotic host.
[0175] The present invention also provides a vector including the various nucleic acids of the present invention.
[0176] In one form, the vector is a viral vector that allows the nucleic acid to be introduced into the target cells by infection. Examples of such viral vectors that can be employed to deliver the nucleic acid to a cell include a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, a recombinant adeno-associated virus (AAV), a recombinant herpesvirus, a recombinant SV-40 virus, an Epstein-Barr virus, or a recombinant pox virus, such as a recombinant vaccinia virus.
[0177] Accordingly, in one form the present invention provides a viral vector including a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a binding site for a microRNA.
[0178] In another form, the present invention also provides a viral vector including a nucleic acid including a non-naturally occurring binding site for a differentially expressed microRNA.
[0179] In this case, it will be appreciated that the viral vector may be formed from all or part of a viral genome. The viral vector may also be a naturally occurring or a recombinant virus and further may be replication deficient or replication proficient.
[0180] As will be appreciated, expression of the relevant inserted DNA in plasmid or viral vectors will generally require various regulatory elements known in the art for the expression of inserted nucleic acids, for example promoters for driving the expression of an inserted nucleic acid in a particular cell, poly A signals for efficient polyadenylation of mRNA transcribed from inserted nucleic acids, or other regulatory elements to control translation, transcription or mRNA stability.
[0181] Depending upon the cell type to be modulated, the promoter driving the expression may be a constitutive promoter, an inducible promoter or a cell or tissue specific promoter.
[0182] Constitutive mammalian promoters include hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, phosphoglycerate kinase, pyruvate kinase, and β-actin. Exemplary viral promoters which function constitutively in eukaryotic cells include promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
[0183] Inducible promoters include synthetic promoters regulated by the TetO/TetR system and inducible promoters such as metallothionein promoter, which may be used to induced transcription in the presence of certain metal ions. Other inducible promoters are known in the art.
[0184] The tissue-specific promoter will depend upon the particular cell type. For example, promoters that allow expression in colon cancer cells include the regulatory sequences of human carcinoembryonic antigen (CEA) [accession:U17131; gi/967132].
[0185] The present invention also provides a composition including the various nucleic acids described herein.
[0186] Accordingly, in one form the present invention also provides a composition including a nucleic acid with the capacity to modulate development of a cell, the nucleic acid including a binding site for a microRNA.
[0187] In another form, the present provides a composition including a nucleic acid including a non-naturally occurring binding site for a differentially expressed or differentially active microRNA.
[0188] The compositions are suitable for exposing the nucleic acids of the present invention to cells. Methods of introducing nucleic acids into cells are as previously discussed herein.
[0189] The compositions of the present invention are also suitable for administration to a subject to prevent and/or treat a disease, condition or state associated with cells that have an altered activity and/or expression of a microRNA.
[0190] For example, the nucleic acids may be combined with a pharmaceutically acceptable carrier, stabilizer, buffer or diluent to produce a composition for administration to a subject. Thus, the present invention also provides a pharmaceutical composition including one or more nucleic acids of the invention in an acceptable carrier.
[0191] The nucleic acid may be delivered to a cell or a subject by a method known in the art. For example, the nucleic acid molecules can be administered to cells by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins, poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres, biodegradable nanocapsules, and bioadhesive microspheres. The nucleic acid molecules may also be formulated or complexed with polyethyleneimine and derivatives thereof, such as polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine-polyethyleneglycol-tri-N-acetylgalac-tosamine (PEI-PEG-triGAL) derivatives.
[0192] For administration to a subject, the nucleic acids can be administered and introduced by standard means, with or without stabilizers, buffers, and the like, to form a pharmaceutical composition. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, by injection, or delivery by way of infection with a virus.
[0193] When it is desired to use a liposome delivery mechanism, standard protocols for formation of liposomes can be followed. The compositions of the present invention can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for injectable administration, and the other compositions known in the art.
[0194] Surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes) offer a method for increasing the accumulation of drugs in target tissues. Such liposomes have been shown to accumulate selectively in tumors.
[0195] Administration routes that lead to systemic absorption include intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular routes. Each of these administration routes exposes the nucleic acids of the present invention to cells or tissue.
[0196] The nucleic acids of the present invention will generally be delivered at a pharmaceutically effective dose to prevent, inhibit the occurrence, or treat (so as to alleviate a symptom to some extent) a disease, condition or state. The pharmaceutically effective dose depends on the type of disease or condition being treated, the composition used, the route of administration, the type of subject being treated, the physical characteristics of the specific subject under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered.
[0197] The nucleic acid molecules of the present invention, and compositions and formulations thereof, can be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles. The term "parenteral" includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like.
[0198] As discussed previously, the present invention also provides a pharmaceutical composition including a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier. One or more nucleic acid molecules of the invention can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients. The pharmaceutical compositions containing nucleic acid molecules of the invention can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
[0199] Compositions intended for oral use can be prepared according to a suitable method known in the to the art. The composition may contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide a pharmaceutically acceptable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
[0200] Formulations for oral use can also be presented as hard gelatin capsules, wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
[0201] Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
[0202] Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid
[0203] Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.
[0204] Pharmaceutical compositions of the present invention can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions can also contain sweetening and flavoring agents.
[0205] Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents. The pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated as known in the art using suitable dispersing or wetting agents and suspending agents that have been discussed previously. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
[0206] The nucleic acid molecules of the present invention can also be administered in the form of suppositories, e.g., for rectal administration of the drug. These compositions can be prepared by mixing the nucleic acid with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the nucleic acid. Such materials include cocoa butter and polyethylene glycols.
[0207] The nucleic acid molecules of the present invention can also be administered parenterally in a sterile medium. The nucleic acid, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
[0208] It is understood that the specific dose level for any particular subject will depend upon a variety of factors including the age, body weight, general health, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
[0209] For administration to non-human animals, the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
[0210] The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
[0211] It will be appreciated that the various compositions of the present invention can also be formulated for administering the nucleic acid molecules of the invention to specific cell types. For example, receptors such as the asialoglycoprotein receptor are unique to hepatocytes and bind branched galactose-terminal glycoproteins, such as asialoorosomucoid. Alternatively, some receptors such as the folate receptor are overexpressed in many cancer cells. The use of galactose, galactosamine, or folate based conjugates to transport exogenous compounds across cell membranes can provide a targeted delivery approach to, for example, the treatment of liver disease, cancers of the liver, or other cancers.
[0212] The nucleic acid molecules of the present invention may also be complexed with or covalently attached to nanoparticles, such as Hepatitis B virus or L envelope proteins.
[0213] Alternatively, certain the nucleic molecules of the present invention can be expressed within cells from eukaryotic promoters as previously discussed.
[0214] Viral vectors expressing the nucleic acids of the present invention may be constructed based upon, for example, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The viral vectors can either be use to introduce the nucleic acid into cells, or alternatively, the viral vector can be packaged and infections used to introduce the nucleic acids of the present invention to cells. The viral vectors can provide for transient expression or stable expression of the nucleic acid molecules.
[0215] Therapeutic delivery of biolomolecules is generally as described in Bladon, C. (2002) "Pharmaceutical Chemistry: Therapeutic Aspects of Biomolecules" John Wiley & Sons Ltd.
[0216] Viral and gene therapy techniques are as generally described in "Viral Vectors for Gene Therapy Methods and Protocols" Edited by Jules G Constant, Curtis A Machida (2003) Humana Press Inc., "Gene Delivery to Mammalian Cells: Viral Gene Transfer Techniques" Edited by William C Heiser (2004) Humana Press Inc., "Viruses in Human Gene Therapy" Edited by J. H. Vos (1995) Carolina Academic Press, and "Viral Therapy Of Human Cancers" Edited by J. G. Sinkovics and J. C. Horwath (2005) Marcel Dekker.
[0217] The present invention is also suitable for modulating the concentration of a nucleic acid in a cancerous cell or pre-cancerous cell.
[0218] In this case, an altered activity and/or concentration of a microRNA in a cancerous cell allows the concentration of the nucleic acid in the cell to be modulated by including in the nucleic acid a target site for binding of the microRNA. As will be appreciated, the modulation of the concentration of the nucleic acid is as compared to a similar cell not having an altered activity and/or expression of the microRNA.
[0219] For example, a reduced activity and/or concentration of a microRNA in a cancerous cell allows the concentration of the nucleic acid in the cell to be modulated by including in the nucleic acid a target site for binding of the microRNA.
[0220] Accordingly, the present invention also provides a method of modulating the concentration of a nucleic acid expressed in a cancerous cell, the cancerous cell having an altered activity and/or concentration of a microRNA as compared to a similar non-cancerous cell, the method including the step of introducing a target site for binding of the microRNA into the nucleic acid to be expressed in the cell.
[0221] Methods for cloning and introducing nucleic acids into cells are as previously discussed. Determination that the concentration of a nucleic acid may be accomplished by a suitable method known in the art, such as Northern analysis, RT-PCR or RNase protection.
[0222] The present invention is also suitable for detecting an altered microRNA activity and/or concentration in a cancerous or pre-cancerous cell, such as a cancerous cell in vitro, or a cancerous or pre-cancerous cell in an animal or human. In this case, the cancerous cells and non-cancerous cells both express a reporter nucleic acid including a target site for binding of a microRNA, and an altered activity of the microRNA may be detected in the cancerous cells by determining the level of expression of the reporter nucleic acid in the cancerous and non-cancerous cells, and detecting a change in the activity of the microRNA in the cancerous cells by a change in the expression of the reporter nucleic acid in the cancerous cells as compared to the level of expression of the reporter nucleic acid in the non-cancerous cells.
[0223] For example, the present invention is suitable for detecting a reduced microRNA activity and/or concentration in a cancerous or pre-cancerous cell. a reduced activity of the microRNA may be detected in the cancerous cells by determining the level of expression of the reporter nucleic acid in the cancerous and non-cancerous cells, and detecting a reduced activity of the microRNA in the cancerous cells by an increase in the expression of the reporter nucleic acid in the cancerous cells as compared to the level of expression of the reporter nucleic acid in the non-cancerous cells.
[0224] Accordingly, in another form the present invention provides a method of detecting altered microRNA activity and/or concentration in a cancerous or pre-cancerous cell, the method including the steps of: [0225] determining the level of expression of a reporter nucleic acid in the cancerous or pre-cancerous cells and determining the level of expression of a reporter nucleic acid in non-cancerous cells; and [0226] detecting a reduced activity of the microRNA in the cancerous cells by an increase in the expression of the reporter nucleic acid in the cancerous cells as compared to the level of expression of the reporter nucleic acid in the non-cancerous cells.
[0227] In one form, the cancerous cells are present in an animal or human subject.
[0228] The non-cancerous cell may be the same or similar cells. In one embodiment, the cancerous (or precancerous cells) and the non-cancerous cells are both present in an animal or human subject.
[0229] In one form, the method may be used to detect a reduced activity of the microRNA by detecting an increase in the expression of the reporter nucleic acid in the cancerous cells as compared to the level of expression of the reporter nucleic acid in the non-cancerous cells.
[0230] In one form, the reporter nucleic acid in the cancerous (or pre-cancerous cells) is the same or a similar reporter nucleic acid as present in the non-cancerous cells.
[0231] Suitable reporter nucleic acids are known in the art. For example, the reporter nucleic acid may produce a detectable product such as LacZ, or GFP. Alternatively, the reporter nucleic acid may be detected by an immunological detection method, with use of antibodies raised to the protein encoded by the reporter nucleic acid. Another method of detecting the reporter nucleic acid is by use of hybridization with a detectably labelled complementary nucleic acid probe.
[0232] Finally, standard techniques may be used for recombinant DNA technology, oligonucleotide synthesis, and tissue culture and transfection (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0233] Reference will now be made to experiments that embody the above general principles of the present invention. However, it is to be understood that the following description is not to limit the generality of the above description.
Example 1
RNA Isolation From Tissue Samples and Cell Lines
[0234] Cell lines may be maintained in an appropriate medium. Colorectal tumors and the corresponding normal mucosae may be obtained from fresh surgical resections, following informed consent from patients, and then classified according to standard histopathological classification methods.
[0235] RNA may isolated from cell lines, using Trizol reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. RNA may be purified from colorectal tissues using the procedure of Chomczynski, P. and Sacchi, N. (1987). Anal. Biochem. 162: 156-159.
Example 2
Cloning of MicroRNAs miRNAs may be cloned essentially as described by Elbashir et al. (2001) Genes Dev. 15: 188-200, except that nucleic acids may be electroeluted from acrylamide gel slices using the Biotrap system (Schleicher and Schuell GmbH, Dassel, Germany). Briefly, small RNA fractions of between 18 and 26 bases may be size selected on a denaturing polyacrylamide gel. Adapter oligonucleotides, containing EcoRI restriction sites, may then be directionally ligated to the RNA molecules. The adapter-ligated RNA may then be amplified by RT-PCR. Concatamerized fragments, containing multimers of religated, EcoRI-digested PCR products, between 200 and 650 bp, are size selected on an agarose gel and recovered by electroelution. The concatamers may then be end-repaired and dA-tailed with Taq DNA polymerase, then cloned into pGEM T-easy (Promega, Madison, Wis.) or pTOPO (Invitrogen) according to the manufacturers' instructions. Plasmid inserts from the resultant colonies may be analyzed by PCR using primers to vector sequences. The nucleic acid sequence of selected inserts may then be determined following treatment of the PCR products with Exonuclease I and Shrimp Alkaline Phosphatase according to the ExoSAP-IT protocol (USB Corporation, Cleveland, Ohio). Clones created by this procedure will contain concatamers of PCR products, and generally likely to represent between two and five independent small RNAs.
Example 3
Northern Analysis
[0236] Total RNA (20 μg) may be separated on a 15% denaturing polyacrylamide gel. Loadings are visualized by ethidium bromide staining. The RNA may then be transferred to Hybond N+ nylon membrane by semi-dry blotting (OWL Separation Systems, Portsmouth, N.H.). Probes may be generated by T4 Polynucleotide Kinase (New England Biolabs, Beverly, Mass.) mediated end-labeling of DNA oligonucleotides with [γ-32P]ATP. To increase the specific activity of the probes, the miRNA sequence may be concatamerized as a trimer of direct repeats, then cloned into pGEM T-easy and the insert amplified using PCR with M13 forward and reverse primers. Antisense probes may then be synthesized using Taq polymerase-generated linear amplification from the Sephadex G-50-purified PCR products to incorporate multiple [γ-32P]dCTP bases.
[0237] Filter hybridization may be performed in QuikHyb Solution (Stratagene, La Jolla, Calif.) containing 106 cpm/ml probe for 1 h, with washes, as per the manufacturers' recommendations. Filters may be analyzed using a Fujifilm-BAS 2500 phoshorimager and signal intensity quantitated (as photostimulated luminescence/mm2) using Analytical Imaging Station (version 3.0) software (Imaging Research Inc., Brock University, Ontario, Canada).
[0238] miRNA sequences may be identified by BLAST (as described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410) by comparison to the Genbank and EMBL public nucleotide databases. MicroRNAs may also be identified by comparison with the databases of the miRNA registry. The secondary structures of putative pre-miRNA hairpins may be determined using the Mfold 3.1 algorithm (as described in Mathews et al. (1999) J. Mol. Biol. 288: 911-940). Potential mRNA target sequences may be identified by searching the Genbank nonredundant and dbEST databases using BLAST and FASTA algorithms (as described in Pearson, W. R. and Lipman, D. J. (1988) Proc. Natl. Acad. Sci. USA, 85: 2444-2448) algorithms.
Example 4
Identification of Colorectal MicroRNAs
[0239] Small RNA fragments (between 18 and 27 bases) in total RNA, purified from both a colonic adenocarcinoma and its matched normal mucosa, may be size fractionated and cloned. The clones from the cancer-derived sample and clones representing normal mucosa may then be sequenced. Sequence analysis and comparison with public database nucleotide sequences will enable identification of many of the clones or assignment to a possible genomic origin for the transcripts.
Example 5
Accumulation of MicroRNAs in Colorectal Tissues and in Cancer Cell Lines
[0240] To confirm that the various sequences accumulate as miRNAs and investigate whether changes in miRNA steady-state levels are associated with neoplastic epithelium, Northern blot analysis may be undertaken against a panel of RNAs from matched colorectal cancer and normal mucosa specimens.
[0241] Northern blot analysis may be used to determine the levels of mature miRNAs and precursor hairpin molecules in cell lines derived from a variety of cancerous human tissues.
Example 6
Cloning of the miR145 Target Sequence into GFP
[0242] A mammalian Enhanced Green Fluorescence Protein (EGFP) expression cassette (pMM043; FIG. 2) was created by directionally inserting the EGFP coding sequence from pEGFP1 (Clontech) as a Bg/II/NotI fragment, into BamHI/NotI linearized pcDNA3.1(+) (Invitrogen). The unique NotI and XbaI sites in the reporter gene 3' untranslated region provided convenient sites for the insertion of miRNA-complementary and predicted in vivo target sequences. pMM095 (FIG. 3) was created by annealing the oligonucleotides #527 (5'-CTAGCAGATCCTGGGAAAACTGGAC-3'; SEQ ID NO.1) and #528 (5'-CTAGGTCCAGTTTTCCCAGGATCTG-3'; SEQ ID NO.2), then ligating the hybrid, which contains the predicted RIGS gene miR145-target sequence, into the XbaI site of pMM043. The nucleotide sequence of pMM095 is provided in the sequence listing and is designated SEQ ID NO. 153.
Example 7
Expression of GFP with the miR145 Target Sequence is Repressed in Cells that Overexpress the miR145 Precursor Molecule
[0243] (i) Pri-miR145 Expression Constructs:
[0244] A fragment of the pri-miR145 transcript was cloned by PCR amplification of the sequence corresponding to positions 184 and 734 of cDNA clone F1136638 fis (Genbank ID:21752921). The oligonucleotides used were #556 (5'-TCCGGTACTTTTCAGGGCAA-3'; SEQ ID NO.4) and #557 (5'-CAAGAAACGCATGCCTGATG-3'; SEQ ID NO.5) in a standard PCR reaction using 50 ng HeLa genomic DNA as template with cycling conditions: 94° C. 3 minutes; 40 amplification cycles 94° C. 30 sec., 55° C. 30 sec., 72° C. 1 min; 72° C. 10 minutes and final extension 72° C. 10 min. The 550 bp product was agarose gel purified and cloned into pGEMT-easy (Promega) to create plasmid pMM105. The EcoRI insert of pMM105 (SEQ ID NO. 154) was then ligated into EcoRI linearised pcDNA3.1(+) (Invitrogen) to create the expression constructs: pMM109 (single sense insert; FIG. 8), pMM106 (single antisense insert; FIG. 6), and pMM107 (tandem sense inserts; FIG. 7). The nucleotide sequence of pMM106 is provided in the sequence listing and is designated SEQ ID NO. 155. The nucleotide sequence of pMM107 is provided in the sequence listing and is designated SEQ ID NO. 156. The nucleotide sequence of pMM109 is provided in the sequence listing and is designated SEQ ID NO. 157.
[0245] (ii) Transfections:
[0246] Cotransfections of HeLa cells involved FuGene 6 (Roche)-mediated transfection of 0.1 μg of pMM095 with between 0.1 μg and 1 μg pri-miR145 expression vector (pMM109, pMM106, pMM107) in 24 well culture plates, using standard FuGene 6 (Roche) protocols. EGFP activity was detected as direct fluorescence of live cells, 3 days following transfection, on a Typhoon fluorimager (Amersham Biosciences) and quantified using Imagequant software.
[0247] The miRNA, miR145, accumulates to only very low levels in HeLa (cervical carcinoma) cells. It was found that an enhanced Green Fluorescence Protein (EGFP) reporter gene construct containing the miR145 target sequence (from the RIGS transcript) is as active in these cells as an EGFP construct lacking the target sequence, as detected by fluorescence of the transfected cells.
[0248] However, as shown in FIG. 2, if cells are co-transfected with a construct that overexpresses the miR145 precursor molecule, pri-miR145, EGFP activity is severely repressed, with the repression occurring in a dose responsive manner.
Example 8
Incorporating miRNA Target Sequences into Reporter and Cytotoxic Genes
[0249] A series of constructs will be created to contain combinations of the complementary target sequences for miR143 and miR145 in the 3'UTR of reporter genes (EGFP, LacZ, Renilla luciferase) within constitutive expression vectors. These vectors will include plasmids (for liposome mediated transfection and mouse transgenesis) and lentiviral systems.
[0250] As the contribution of independent targets sequences (or miRNA response elements; MREs) to the repression of a transcript are known to be cumulative, combinations that include up to four copies of each MRE will also be created.
[0251] The EGFP construct described previously will be used, in conjunction with clones that contain several (up to four copies of the miR145 and miR143 complementary sequences), cloned into the NotI site of the 3'UTR. LacZ constructs will be based on the synthetic, codon-optimised β-galactosidase sequence, described by Anson and Limberis (2004) J. Biotechnology 108: 17-30.
[0252] The LacZ plasmid vectors will be based on the pcDNA3.1(+) expression backbone and that target sequences will also be inserted into the NotI site of the 3'UTR.
[0253] Luciferase constructs will be created using the psiCHECK®-2 vector (Promega) by insertion of target sequences into the multiple cloning region in the 3'UTR of the synthetic Renilla luciferase gene. The psiCHECK®-2 vector also provides firefly luciferase as an internal control to normalise for transfection efficiency. Luciferase activities of transfected and transduced (in the case of lentiviral derivations) cells will be detected using the Dual Luciferase® Assay system (Promega) according to manufacturer's instructions.
Example 9
Effect of miRNA Target Sequences in Cultured Cells
[0254] The discovery that diseased (cancer) cells lack the repressive function provided by miR143 and miR145 allows us to address the possibility that we can exploit this phenomenon to control the expression of therapeutic genes in these cells.
[0255] Results from experiments using the RIGS MRE in EGFP constructs show that the presence of miR145 will limit expression of foreign genes (that contain complementary 3'UTR sequences) in those cells.
[0256] A mammalian cell line that accumulates significant levels of mature miR143 or miR145 has not yet been identified. A lack of miR143 accumulation in cell lines has also been reported by others and is postulated to be a consequence of the control of fundamental processes (such as proliferation) by these miRNAs.
[0257] To generate systems in which these miRNAs can be induced, to mimic the status of "normal" cells, dox-inducible miR145 HeLa cell lines will be produced to allow an investigation of the stoichiometry between miR145 levels and target sequences and the ability to silence gene expression. This will enable us to determine, in vitro, whether a threshold level of cytoplasmic miR145 is required to suppress reporter gene (EGFP, LacZ, luciferase) activity and cytotoxic gene (herpes simplex virus thymidine kinase) function.
[0258] Doxycycline-inducible pri-miR145 expression constructs were created by incorporating the PmeI insert from pMM106 (containing the pri-miR145 subfragment described earlier) to displace EGFP in the Tet-inducible expression cassette pMM060 between the unique Ascl (blunted) and PmII sites. pMM060 utilises both the Tet-responsive promoter and tTR modified transrepressor described by Rossi et al. (1998) Nat. Genet. 20(4):389-93, with the transrepressor under the control of constitutive murine phosphoglycerate kinase regulatory sequences. The construct with a single sense copy of the 550 bp pri-miR145 subsequence is called pMM110.
[0259] HeLa Tet-On cells (Clontech) have been stably-transformed with the pMM110 construct using FuGene 6-mediated transfection and following selection on both genticin and puromycin, clonal lines have been isolated. Different HeLa Tet-On/pMM110 lines display varying levels of pri-miR145 induction and mature miR145 accumulation, following 24 h exposure to 1 μg doxycycline/mL growth medium. The data is shown in FIG. 11.
Example 10
Effect of miRNA Target Sequences in Primary Colonic Cells
[0260] It is necessary to determine whether miR143 and miR145MREs will enable disease specific expression of transgenes in mammalian tissues. To develop a rapid assay for miR143/miR145 retarded gene expression in colonic epithelium and adenocarcinomas, the expression of LacZ (+/-multiple miR145 MREs in 3'UTR) in colonic mucosa and compare that with expression in tumour cells will be examined.
[0261] Normal murine intestinal tissues and tumours from an azoxymethane (AOM)-treated p53-knockout mouse (Hu et al. (2005) Int. J. Cancer 115: 561-567), will be maintained in culture to establish this study and also to refine the process and vectors.
[0262] Culture conditions will be essentially as described by Whitehead et al. (1999) Gastroenterology 117:858-65.
[0263] Normal intestinal mucosa, adenomatous and cancer tissues will also be obtained from the resections of consenting cancer patients and cultured as above.
[0264] Reporter gene constructs will be inserted into a lentiviral vector system as described in Anson and Fuller (2003) J. Gene Med. 5:829-838, and Fuller and Anson (2001) Human Gene Therapy 12: 2081-2093, and used to infect cultured explants.
[0265] All constructs will also incorporate a constitutive EYFP expression cassette to define and normalise the level of lentiviral infection between samples. Initial experiments will use only a constitutive EYFP expression cassette in the lentivirus vector, to establish this system. It will also be determined whether a dual luciferase assay (psiCHECK® 2; Promega) is more informative, than the lacZ marker, in this system.
[0266] If this approach is successful, the LacZ reporter gene will be replaced with the conditional cytotoxic gene, thymidine kinase, to determine whether MRE-derived tissue specificity is sufficient to selectively ablate tumour cells. Naturally, this will lead to the creation of constructs with tissue-specific promoters to enhance disease-specificity.
Example 11
Effect of miRNA Target Sequences on Gene Expression In Vivo
[0267] Transgenic mice will be created that express a LacZ reporter gene, containing multiple miR145 and miR143 complementary sequences in the 3'UTR, under the control of a constitutive promoter (CMV). The transgene construct will also comprise a second reporter gene (EGFP) that does not contain such targeting sequences, but uses the same promoter. Direct fluorescence (or immunohistochemical detection of EGFP) will define the tissue distribution of transgene expression while the subset of cells that also stain for LacZ activity will indicate those which are not affected by microRNA-mediated silencing.
[0268] Fluorescence will entail direct observation of fresh or paraformaldehyde-fixed tissues using an inverted fluorescence microscope. Fixed tissue may be pre-treated with 0.1% sodium borohydride, to reduce autofluorescence. GFP specific antibodies (Living Colours® Peptide Antibody; Clontech) will be used for immunohistochemical detection, using standard procedures.
[0269] While the entire transgenic mouse will be assessed, particular attention will be paid to colorectal tissues.
[0270] Favourable transgenic mouse lines will be crossed with a p53 knockout mouse strain that is currently being used by the Young group to generate a murine model of colorectal cancer following administration of the carcinogen, azoxymethane (Hu et al. (2005) Int. J. Cancer 115: 561-567). The progeny of this cross will be examined for enhanced LacZ expression in tumour cells relative to surrounding epithelium.
[0271] To create transgenic mice, pronuclear injection of constructs (linear DNA fragments containing expression cassettes) into embryos isolated from pregnant, superovulated C57BL/6, females will be performed and embryos reimplanted commercially at the GenSA facility (IMVS, Adelaide). Resultant lines will be genotyped (by PCR) for appropriate genomic insertion of the injected sequences, as described in Rulicke T. and Hubscher U. (2000) Exp. Physiol. 85: 589-601.
[0272] These founder lines will be assessed for low copy number insertion of the intact introduced expression cassettes and screened for appropriate expression of the transgenes using real-time RT-PCR and immunohistochemistry. Relative copy number determinations will be made using PCR of genomic DNA and/or Southern Blot analysis. Real time RT-PCR will utilize transgene mRNA-specific primers and cDNA templates in a 1×SYBR green PCR Master Mix (Applied Biosystems) reaction. A Corbett Rotorgene 2000 (Corbett Research Pty. Ltd., Australia) will be used for PCR amplification and detection.
[0273] The final hybrid line will be inbred to ensure homozygosity for the transgenes, before cross-breeding with the p53 mutant mouse line and other murine models for cancer and polyposis.
Example 12
Effect of miRNA Target Sequences on Gene Expression in Stem Cells and Their Derivatives
[0274] MicroRNA target sequences in the 3'UTR of reporter and therapeutic genes will be used to assess the potential for exploiting tissue (or cell lineage)-specific microRNAs to limit transgene expression to defined cell lineages and tissues.
[0275] For example, target sequences for the neural-specific miRNAs, miR124a and miR9, will be inserted into the 3'UTR of the EGFP or LacZ reporter genes. A lentiviral delivery system will then deliver the synthetic gene into the genomes of murine embryonic stem cells. Transduced embryonic stem cells will then be induced to differentiate into a variety of cells types, including neural progenitors (using the stromal-cell derived induction method of Kawasaki et al. (2000) Neuron 28: 31-40). Reporter gene activity will be correlated with the expression of molecular markers to define which cell lineages allow expression of the introduced gene and which display miR9/124a-mediated silencing. Alternatively, the transduced murine ES cells will be transferred into blastocysts to generate chimeric mice, from which stable transgenic germ lines will be generated (Pfeifer et al. (2001) Proc. Natl. Acad. Sci. USA 99: 2140-2145). The spatial expression of reporter genes will be determined using direct detection (EGFP fluorescence or 3-galactosidase staining) or immunohistochemistry.
[0276] Other experiments will study miRNA-mediated transgene regulation in cells that derive from transgenic adult stem cells. These will involve in vitro and in vivo studies of transduced bone marrow-derived stem cells, or haematopoietic progenitor cells, containing reporter genes (or therapeutic genes) with embedded miRNA target sequences. The target sequences will bind with haematopoietic lineage-specific miRNAs, such as miR142-3p. For example, the methodology may be accomplished as described in Brown et al. (2006) Nature Medicine 12: 585-591.
Example 13
The Effect of Increasing miRNA Target Sequences in the 3'UTR of a Transgene
[0277] Cells of the stable pMM110 transgenic HeLa Tet On cell line, HT0110e, were grown in the presence, or absence, of 2 quadratureg doxycycline/mL medium and FuGene6-transfected, one day after plating, with 80 ng plasmid. The plasmids used for transfection were all derived from pMM043, with varying numbers of miR145 target sequences inserted in the EGFP 3'UTR NotI site. Plasmids were: pMM043 (no targets), pMM095 (1 target), pMM117 (2 targets), pMM119 (8 targets). In this cell line, doxycycline induces the expression of mature miR145 above the low background level present in HeLa cells. Values displayed are the mean fluorescence (n=3) at 46 hours after transfection.
[0278] The data is shown in FIG. 12. The data demonstrates the Dox-inducible miR145 silencing of EGFP fluorescence in the transiently transfected cell line HT0110e, with the extent of silencing correlating with the number of miR145 target sequences present in the 3'UTR of EGFP.
[0279] Finally, it will be appreciated that various modifications and variations of the methods and compositions of the invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are apparent to those skilled in the art are intended to be within the scope of the present invention.
Sequence CWU
1
171180RNAHomo sapiens 1ugggaugagg uaguagguug uauaguuuua gggucacacc
caccacuggg agauaacuau 60acaaucuacu gucuuuccua
80222RNAHomo sapiens 2ugagguagua gguuguauag uu
22372RNAHomo sapiens
3agguugaggu aguagguugu auaguuuaga auuacaucaa gggagauaac uguacagccu
60ccuagcuuuc cu
72422RNAHomo sapiens 4ugagguagua gguuguauag uu
22574RNAHomo sapiens 5gggugaggua guagguugua uaguuugggg
cucugcccug cuaugggaua acuauacaau 60cuacugucuu uccu
74622RNAHomo sapiens 6ugagguagua
gguuguauag uu 22783RNAHomo
sapiens 7cggggugagg uaguagguug ugugguuuca gggcagugau guugccccuc
ggaagauaac 60uauacaaccu acugccuucc cug
83822RNAHomo sapiens 8ugagguagua gguugugugg uu
22984RNAHomo sapiens 9gcauccgggu
ugagguagua gguuguaugg uuuagaguua cacccuggga guuaacugua 60caaccuucua
gcuuuccuug gagc 841022RNAHomo
sapiens 10ugagguagua gguuguaugg uu
221187RNAHomo sapiens 11ucagagugag guaguagauu guauaguugu gggguaguga
uuuuacccug uucaggagau 60aacuauacaa ucuauugccu ucccuga
871222RNAHomo sapiens 12ugagguagua gauuguauag uu
221383RNAHomo sapiens
13ugugggauga gguaguagau uguauaguuu uagggucaua ccccaucuug gagauaacua
60uacagucuac ugucuuuccc acg
831422RNAHomo sapiens 14ugagguagua gauuguauag uu
2215110RNAHomo sapiens 15ccagagguug uaacguuguc
uauauauacc cuguagaacc gaauuugugu gguauccgua 60uagucacaga uucgauucua
ggggaauaua uggucgaugc aaaaacuuca 1101622RNAHomo sapiens
16uacccuguag aaccgaauuu gu
221798RNAHomo sapiens 17uugaggccuu aaaguacugu agcagcacau caugguuuac
augcuacagu caagaugcga 60aucauuauuu gcugcucuag aaauuuaagg aaauucau
981822RNAHomo sapiens 18uagcagcaca ucaugguuua ca
221989RNAHomo sapiens
19gucagcagug ccuuagcagc acguaaauau uggcguuaag auucuaaaau uaucuccagu
60auuaacugug cugcugaagu aagguugac
892022RNAHomo sapiens 20uagcagcacg uaaauauugg cg
222181RNAHomo sapiens 21guuccacucu agcagcacgu
aaauauuggc guagugaaau auauauuaaa caccaauauu 60acugugcugc uuuaguguga c
812222RNAHomo sapiens
22uagcagcacg uaaauauugg cg
222387RNAHomo sapiens 23cacuguucua ugguuaguuu ugcagguuug cauccagcug
ugugauauuc ugcugugcaa 60auccaugcaa aacugacugu gguagug
872423RNAHomo sapiens 24ugugcaaauc caugcaaaac uga
232596RNAHomo sapiens
25acauugcuac uuacaauuag uuuugcaggu uugcauuuca gcguauauau guauaugugg
60cugugcaaau ccaugcaaaa cugauuguga uaaugu
962623RNAHomo sapiens 26ugugcaaauc caugcaaaac uga
232771RNAHomo sapiens 27guagcacuaa agugcuuaua
gugcagguag uguuuaguua ucuacugcau uaugagcacu 60uaaaguacug c
712823RNAHomo sapiens
28uaaagugcuu auagugcagg uag
232972RNAHomo sapiens 29ugucggguag cuuaucagac ugauguugac uguugaaucu
cauggcaaca ccagucgaug 60ggcugucuga ca
723022RNAHomo sapiens 30uagcuuauca gacugauguu ga
223185RNAHomo sapiens
31ggcugagccg caguaguucu ucaguggcaa gcuuuauguc cugacccagc uaaagcugcc
60aguugaagaa cuguugcccu cugcc
853222RNAHomo sapiens 32aagcugccag uugaagaacu gu
223373RNAHomo sapiens 33ggccggcugg gguuccuggg
gaugggauuu gcuuccuguc acaaaucaca uugccaggga 60uuuccaaccg acc
733421RNAHomo sapiens
34aucacauugc cagggauuuc c
213568RNAHomo sapiens 35cuccggugcc uacugagcug auaucaguuc ucauuuuaca
cacuggcuca guucagcagg 60aacaggag
683622RNAHomo sapiens 36uggcucaguu cagcaggaac ag
223723RNAHomo sapiens
37gugccuacug agcugauauc agu
233873RNAHomo sapiens 38cucugccucc cgugccuacu gagcugaaac acaguugguu
uguguacacu ggcucaguuc 60agcaggaaca ggg
733922RNAHomo sapiens 39uggcucaguu cagcaggaac ag
224077RNAHomo sapiens
40guggccucgu ucaaguaauc caggauaggc ugugcagguc ccaaugggcc uauucuuggu
60uacuugcacg gggacgc
774122RNAHomo sapiens 41auucaaguaa uccaggauag gc
224277RNAHomo sapiens 42ccgggaccca guucaaguaa
uucaggauag guugugugcu guccagccug uucuccauua 60cuuggcucgg ggaccgg
774322RNAHomo sapiens
43uucaaguaau ucaggauagg uu
224484RNAHomo sapiens 44ggcuguggcu ggauucaagu aauccaggau aggcuguuuc
caucugugag gccuauucuu 60gauuacuugu uucuggaggc agcu
844521RNAHomo sapiens 45uucaaguaau ccaggauagg c
214697RNAHomo sapiens
46accucucuaa caaggugcag agcuuagcug auuggugaac agugauuggu uuccgcuuug
60uucacagugg cuaaguucug caccugaaga gaaggug
974721RNAHomo sapiens 47uucacagugg cuaaguucug c
214864RNAHomo sapiens 48augacugauu ucuuuuggug
uucagaguca auauaauuuu cuagcaccau cugaaaucgg 60uuau
644921RNAHomo sapiens
49uagcaccauc ugaaaucggu u
215071RNAHomo sapiens 50gcgacuguaa acauccucga cuggaagcug ugaagccaca
gaugggcuuu cagucggaug 60uuugcagcug c
715122RNAHomo sapiens 51cuuucagucg gauguuugca gc
225222RNAHomo sapiens
52uguaaacauc cucgacugga ag
225395RNAHomo sapiens 53cggccggccc uggguccauc uuccaguaca guguuggaug
gucuaauugu gaagcuccua 60acacugucug guaaagaugg cucccgggug gguuc
955422RNAHomo sapiens 54uaacacuguc ugguaaagau gg
225587RNAHomo sapiens
55gacagugcag ucacccauaa aguagaaagc acuacuaaca gcacuggagg guguaguguu
60uccuacuuua uggaugagug uacugug
875620RNAHomo sapiens 56cauaaaguag aaagcacuac
205723RNAHomo sapiens 57uguaguguuu ccuacuuuau gga
2358106RNAHomo sapiens
58gcgcagcgcc cugucuccca gccugaggug cagugcugca ucucugguca guugggaguc
60ugagaugaag cacuguagcu caggaagaga gaaguuguuc ugcagc
1065922RNAHomo sapiens 59ugagaugaag cacuguagcu ca
226088RNAHomo sapiens 60caccuugucc ucacggucca
guuuucccag gaaucccuua gaugcuaaga uggggauucc 60uggaaauacu guucuugagg
ucaugguu 886124RNAHomo sapiens
61guccaguuuu cccaggaauc ccuu
2462110RNAHomo sapiens 62gccgagaccg agugcacagg gcucugaccu augaauugac
agccagugcu cucgucuccc 60cucuggcugc caauuccaua ggucacaggu auguucgccu
caaugccagc 1106321RNAHomo sapiens 63cugaccuaug aauugacagc c
216485RNAHomo sapiens
64augguguuau caaguguaac agcaacucca uguggacugu guaccaauuu ccaguggaga
60ugcuguuacu uuugaugguu accaa
856522RNAHomo sapiens 65uguaacagca acuccaugug ga
226685RNAHomo sapiens 66ugguucccgc ccccuguaac
agcaacucca uguggaagug cccacugguu ccaguggggc 60ugcuguuauc uggggcgagg
gccag 856722RNAHomo sapiens
67uguaacagca acuccaugug ga
2268110RNAHomo sapiens 68ccagaggaca ccuccacucc gucuacccag uguuuagacu
aucuguucag gacucccaaa 60uuguacagua gucugcacau ugguuaggcu gggcuggguu
agacccucgg 1106923RNAHomo sapiens 69cccaguguuu agacuaucug
uuc 237095RNAHomo sapiens
70ccagcucggg cagccguggc caucuuacug ggcagcauug gauggaguca ggucucuaau
60acugccuggu aaugaugacg gcggagcccu gcacg
957123RNAHomo sapiens 71uaauacugcc ugguaaugau gac
237268RNAHomo sapiens 72cccucgucuu acccagcagu
guuugggugc gguugggagu cucuaauacu gccggguaau 60gauggagg
687322RNAHomo sapiens
73uaauacugcc ggguaaugau gg
227482RNAHomo sapiens 74gcuucgcucc ccuccgccuu cucuucccgg uucuucccgg
agucgggaaa agcuggguug 60agagggcgaa aaaggaugag gu
827523RNAHomo sapiens 75aaaagcuggg uugagagggc gaa
237621RNAHomo sapiens
76uaagccaggg auuguggguu c
217771RNAHomo sapiens 77gcgacuguaa acauccucga cuggaagcug ugaagccaca
gaugggcuuu cagucggaug 60uuugcagcug c
717822RNAHomo sapiens 78cuuucagucg gauguuugca gc
227922RNAHomo sapiens
79uguaaacauc cucgacugga ag
228081RNAHomo sapiens 80cuucaggaag cugguuucau auggugguuu agauuuaaau
agugauuguc uagcaccauu 60ugaaaucagu guucuugggg g
818123RNAHomo sapiens 81uagcaccauu ugaaaucagu guu
238288RNAHomo sapiens
82ugcgcuccuc ucagucccug agacccuaac uugugauguu uaccguuuaa auccacgggu
60uaggcucuug ggagcugcga gucgugcu
888322RNAHomo sapiens 83ucccugagac ccuaacuugu ga
228486RNAHomo sapiens 84ugccagucuc uaggucccug
agacccuuua accugugagg acauccaggg ucacagguga 60gguucuuggg agccuggcgu
cuggcc 868523RNAHomo sapiens
85ucccugagac ccuuuaaccu gug
238689RNAHomo sapiens 86accagacuuu uccuaguccc ugagacccua acuugugagg
uauuuuagua acaucacaag 60ucaggcucuu gggaccuagg cggagggga
898722RNAHomo sapiens 87ucccugagac ccuaacuugu ga
228883RNAHomo sapiens
88ccuuggagua aaguagcagc acauaauggu uuguggauuu ugaaaaggug caggccauau
60ugugcugccu caaaaauaca agg
838922RNAHomo sapiens 89uagcagcaca uaaugguuug ug
229085RNAHomo sapiens 90cgcuggcgac gggacauuau
uacuuuuggu acgcgcugug acacuucaaa cucguaccgu 60gaguaauaau gcgccgucca
cggca 859121RNAHomo sapiens
91cauuauuacu uuugguacgc g
219221RNAHomo sapiens 92ucguaccgug aguaauaaug c
219386RNAHomo sapiens 93ugcucccucu cucacauccc
uugcauggug gagggugagc uuucugaaaa ccccucccac 60augcaggguu ugcaggaugg
cgagcc 869422RNAHomo sapiens
94caucccuugc augguggagg gu
229594RNAHomo sapiens 95gaguuugguu uuguuugggu uuguucuagg uaugguccca
gggaucccag aucaaaccag 60gccccugggc cuauccuaga accaaccuaa gcuc
949621RNAHomo sapiens 96gccccugggc cuauccuaga a
219765RNAHomo sapiens
97cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca uauuagcauu
60aacag
659822RNAHomo sapiens 98uuaaugcuaa ucgugauagg gg
229922RNAHomo sapiens 99aacuauacaa ccuacuaccu ca
2210022RNAHomo sapiens
100aacuauacaa ccuacuaccu ca
2210122RNAHomo sapiens 101aacuauacaa ccuacuaccu ca
2210222RNAHomo sapiens 102aaccacacaa ccuacuaccu ca
2210322RNAHomo sapiens
103aaccauacaa ccuacuaccu ca
2210422RNAHomo sapiens 104aacuauacaa ucuacuaccu ca
2210522RNAHomo sapiens 105aacuauacaa ucuacuaccu ca
2210622RNAHomo sapiens
106acaaauucgg uucuacaggg ua
2210722RNAHomo sapiens 107uguaaaccau gaugugcugc ua
2210822RNAHomo sapiens 108cgccaauauu uacgugcugc ua
2210922RNAHomo sapiens
109cgccaauauu uacgugcugc ua
2211023RNAHomo sapiens 110ucaguuuugc auggauuugc aca
2311123RNAHomo sapiens 111ucaguuuugc auggauuugc aca
2311223RNAHomo sapiens
112cuaccugcac uauaagcacu uua
2311322RNAHomo sapiens 113ucaacaucag ucugauaagc ua
2211422RNAHomo sapiens 114acaguucuuc aacuggcagc uu
2211521RNAHomo sapiens
115ggaaaucccu ggcaauguga u
2111622RNAHomo sapiens 116cuguuccugc ugaacugagc ca
2211723RNAHomo sapiens 117acugauauca gcucaguagg cac
2311822RNAHomo sapiens
118cuguuccugc ugaacugagc ca
2211922RNAHomo sapiens 119gccuauccug gauuacuuga au
2212022RNAHomo sapiens 120aaccuauccu gaauuacuug aa
2212121RNAHomo sapiens
121gccuauccug gauuacuuga a
2112221RNAHomo sapiens 122gcagaacuua gccacuguga a
2112321RNAHomo sapiens 123aaccgauuuc agauggugcu a
2112422RNAHomo sapiens
124gcugcaaaca uccgacugaa ag
2212522RNAHomo sapiens 125cuuccagucg aggauguuua ca
2212622RNAHomo sapiens 126ccaucuuuac cagacagugu ua
2212720RNAHomo sapiens
127guagugcuuu cuacuuuaug
2012823RNAHomo sapiens 128uccauaaagu aggaaacacu aca
2312922RNAHomo sapiens 129ugagcuacag ugcuucaucu ca
2213024RNAHomo sapiens
130aagggauucc ugggaaaacu ggac
2413121RNAHomo sapiens 131ggcugucaau ucauagguca g
2113222RNAHomo sapiens 132uccacaugga guugcuguua ca
2213322RNAHomo sapiens
133uccacaugga guugcuguua ca
2213423RNAHomo sapiens 134gaacagauag ucuaaacacu ggg
2313523RNAHomo sapiens 135gucaucauua ccaggcagua uua
2313622RNAHomo sapiens
136ccaucauuac ccggcaguau ua
2213723RNAHomo sapiens 137uucgcccucu caacccagcu uuu
2313821RNAHomo sapiens 138gaacccacaa ucccuggcuu a
2113922RNAHomo sapiens
139gcugcaaaca uccgacugaa ag
2214022RNAHomo sapiens 140cuuccagucg aggauguuua ca
2214123RNAHomo sapiens 141aacacugauu ucaaauggug cua
2314222RNAHomo sapiens
142ucacaaguua gggucucagg ga
2214323RNAHomo sapiens 143cacagguuaa agggucucag gga
2314422RNAHomo sapiens 144ucacaaguua gggucucagg ga
2214522RNAHomo sapiens
145cacaaaccau uaugugcugc ua
2214621RNAHomo sapiens 146cgcguaccaa aaguaauaau g
2114721RNAHomo sapiens 147gcauuauuac ucacgguacg a
2114822RNAHomo sapiens
148acccuccacc augcaaggga ug
2214921RNAHomo sapiens 149uucuaggaua ggcccagggg c
2115022RNAHomo sapiens 150ccccuaucac gauuagcauu aa
221511131DNAherpes simplex
virus 7 151atggcttctc acgccggcca acagcacgcg cctgcgttcg gtcaggctgc
tcgtgcgagc 60gggcctaccg acggccgcgc ggcgtcccgt cctagccatc gccagggggc
ctccggagcc 120cgcggggatc cggagctgcc cacgctgctg cgggtttata tagacggacc
ccacggggtg 180gggaagacca ccacctccgc gcagctgatg gaggccctgg ggccgcgcga
caatatcgtc 240tacgtccccg agccgatgac ttactggcag gtgctggggg cctccgagac
cctgacgaac 300atctacaaca cgcagcaccg tctggaccgc ggcgagatat cggccgggga
ggcggcggtg 360gtaatgacca gcgcccagat aacaatgagc acgccttatg cggcgacgga
cgccgttttg 420gctcctcata tcggggggga ggctgtgggc ccgcaagccc cgcccccggc
cctcaccctt 480gttttcgacc ggcaccctat cgcctccctg ctgtgctacc cggccgcgcg
gtacctcatg 540ggaagcatga ccccccaggc cgtgttggcg ttcgtggccc tcatgccccc
gaccgcgccc 600ggcacgaacc tggtcctggg tgtccttccg gaggccgaac acgccgaccg
cctggccaga 660cgccaacgcc cgggcgagcg gcttgacctg gccatgctgt ccgccattcg
ccgtgtctac 720gatctactcg ccaacacggt gcggtacctg cagcgcggcg ggaggtggcg
ggaggactgg 780ggccggctga cgggggtcgc cgcggcgacc ccgcgccccg accccgagga
cggcgcgggg 840tctctgcccc gcatcgagga cacgctgttt gccctgttcc gcgttcccga
gctgctggcc 900cccaacgggg acttgtacca catttttgcc tgggtcttgg acgtcttggc
cgaccgcctc 960cttccgatgc atctatttgt cctggattac gatcagtcgc ccgtcgggtg
tcgagacgcc 1020ctgttgcgcc tcaccgccgg gatgatccca acccgcgtca caaccgccgg
gtccatcgcc 1080gagatacgcg acctggcgcg cacgtttgcc cgcgaggtgg ggggagttta g
11311521284DNAEscherichia coli 152gtgtcgaata acgctttaca
aacaattatt aacgcccggt taccaggcga agaggggctg 60tggcagattc atctgcagga
cggaaaaatc agcgccattg atgcgcaatc cggcgtgatg 120cccataactg aaaacagcct
ggatgccgaa caaggtttag ttataccgcc gtttgtggag 180ccacatattc acctggacac
cacgcaaacc gccggacaac cgaactggaa tcagtccggc 240acgctgtttg aaggcattga
acgctgggcc gagcgcaaag cgttattaac ccatgacgat 300gtgaaacaac gcgcatggca
aacgctgaaa tggcagattg ccaacggcat tcagcatgtg 360cgtacccatg tcgatgtttc
ggatgcaacg ctaactgcgc tgaaagcaat gctggaagtg 420aagcaggaag tcgcgccgtg
gattgatctg caaatcgtcg ccttccctca ggaagggatt 480ttgtcgtatc ccaacggtga
agcgttgctg gaagaggcgt tacgcttagg ggcagatgta 540gtgggggcga ttccgcattt
tgaatttacc cgtgaatacg gcgtggagtc gctgcataaa 600accttcgccc tggcgcaaaa
atacgaccgt ctcatcgacg ttcactgtga tgagatcgat 660gacgagcagt cgcgctttgt
cgaaaccgtt gctgccctgg cgcaccatga aggcatgggc 720gcgcgagtca ccgccagcca
caccacggca atgcactcct ataacggggc gtatacctca 780cgcctgttcc gcttgctgaa
aatgtccggt attaactttg tcgccaaccc gctggtcaat 840attcatctgc aaggacgttt
cgatacgtat ccaaaacgtc gcggcatcac gcgcgttaaa 900gagatgctgg agtccggcat
taacgtctgc tttggtcacg atgatgtctt cgatccgtgg 960tatccgctgg gaacggcgaa
tatgctgcaa gtgctgcata tggggctgca tgtttgccag 1020ttgatgggct acgggcagat
taacgatggc ctgaatttaa tcacccacca cagcgcaagg 1080acgttgaatt tgcaggatta
cggcattgcc gccggaaaca gcgccaacct gattatcctg 1140ccggctgaaa atgggtttga
tgcgctgcgc cgtcaggttc cggtacgtta ttcggtacgt 1200ggcggcaagg tgattgccag
cacacaaccg gcacaaacca ccgtatatct ggagcagcca 1260gaagccatcg attacaaacg
ttga 12841536195DNAplasmid
pMM095 153gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc
tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct
gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg
aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg
cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat
agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg
cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata
gggactttcc 420attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta
catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc
gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac
gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga
tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg
ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg
caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact
agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa
gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atctcgagct caagcttcga
attctgcagt 960cgacggtacc gcgggcccgg gatccaccgg tcgccaccat ggtgagcaag
ggcgaggagc 1020tgttcaccgg ggtggtgccc atcctggtcg agctggacgg cgacgtaaac
ggccacaagt 1080tcagcgtgtc cggcgagggc gagggcgatg ccacctacgg caagctgacc
ctgaagttca 1140tctgcaccac cggcaagctg cccgtgccct ggcccaccct cgtgaccacc
ctgacctacg 1200gcgtgcagtg cttcagccgc taccccgacc acatgaagca gcacgacttc
ttcaagtccg 1260ccatgcccga aggctacgtc caggagcgca ccatcttctt caaggacgac
ggcaactaca 1320agacccgcgc cgaggtgaag ttcgagggcg acaccctggt gaaccgcatc
gagctgaagg 1380gcatcgactt caaggaggac ggcaacatcc tggggcacaa gctggagtac
aactacaaca 1440gccacaacgt ctatatcatg gccgacaagc agaagaacgg catcaaggtg
aacttcaaga 1500tccgccacaa catcgaggac ggcagcgtgc agctcgccga ccactaccag
cagaacaccc 1560ccatcggcga cggccccgtg ctgctgcccg acaaccacta cctgagcacc
cagtccgccc 1620tgagcaaaga ccccaacgag aagcgcgatc acatggtcct gctggagttc
gtgaccgccg 1680ccgggatcac tctcggcatg gacgagctgt acaagtaaag cggccgctcg
agtctagcag 1740atcctgggaa aactggacct agagggcccg tttaaacccg ctgatcagcc
tcgactgtgc 1800cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg
accctggaag 1860gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat
tgtctgagta 1920ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag
gattgggaag 1980acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctgaggcg
gaaagaacca 2040gctggggctc tagggggtat ccccacgcgc cctgtagcgg cgcattaagc
gcggcgggtg 2100tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc
gctcctttcg 2160ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct
ctaaatcggg 2220ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa
aaacttgatt 2280agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc
cctttgacgt 2340tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca
ctcaacccta 2400tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat
tggttaaaaa 2460atgagctgat ttaacaaaaa tttaacgcga attaattctg tggaatgtgt
gtcagttagg 2520gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc
atctcaatta 2580gtcagcaacc aggtgtggaa agtccccagg ctccccagca ggcagaagta
tgcaaagcat 2640gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc
cgcccctaac 2700tccgcccagt tccgcccatt ctccgcccca tggctgacta atttttttta
tttatgcaga 2760ggccgaggcc gcctctgcct ctgagctatt ccagaagtag tgaggaggct
tttttggagg 2820cctaggcttt tgcaaaaagc tcccgggagc ttgtatatcc attttcggat
ctgatcaaga 2880gacaggatga ggatcgtttc gcatgattga acaagatgga ttgcacgcag
gttctccggc 2940cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg
gctgctctga 3000tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca
agaccgacct 3060gtccggtgcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc
tggccacgac 3120gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg
actggctgct 3180attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg
ccgagaaagt 3240atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta
cctgcccatt 3300cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag
ccggtcttgt 3360cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac
tgttcgccag 3420gctcaaggcg cgcatgcccg acggcgagga tctcgtcgtg acccatggcg
atgcctgctt 3480gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg
gccggctggg 3540tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg
aagagcttgg 3600cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg
attcgcagcg 3660catcgccttc tatcgccttc ttgacgagtt cttctgagcg ggactctggg
gttcgaaatg 3720accgaccaag cgacgcccaa cctgccatca cgagatttcg attccaccgc
cgccttctat 3780gaaaggttgg gcttcggaat cgttttccgg gacgccggct ggatgatcct
ccagcgcggg 3840gatctcatgc tggagttctt cgcccacccc aacttgttta ttgcagctta
taatggttac 3900aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact
gcattctagt 3960tgtggtttgt ccaaactcat caatgtatct tatcatgtct gtataccgtc
gacctctagc 4020tagagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta
tccgctcaca 4080attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc
ctaatgagtg 4140agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg
aaacctgtcg 4200tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg
tattgggcgc 4260tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg
gcgagcggta 4320tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa
cgcaggaaag 4380aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc
gttgctggcg 4440tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc
aagtcagagg 4500tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag
ctccctcgtg 4560cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct
cccttcggga 4620agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta
ggtcgttcgc 4680tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc
cttatccggt 4740aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc
agcagccact 4800ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt
gaagtggtgg 4860cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct
gaagccagtt 4920accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc
tggtagcggt 4980ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga
agatcctttg 5040atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg
gattttggtc 5100atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg
aagttttaaa 5160tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt
aatcagtgag 5220gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact
ccccgtcgtg 5280tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat
gataccgcga 5340gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg
aagggccgag 5400cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg
ttgccgggaa 5460gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat
tgctacaggc 5520atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc
ccaacgatca 5580aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt
cggtcctccg 5640atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc
agcactgcat 5700aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga
gtactcaacc 5760aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc
gtcaatacgg 5820gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa
acgttcttcg 5880gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta
acccactcgt 5940gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg
agcaaaaaca 6000ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg
aatactcata 6060ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat
gagcggatac 6120atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt
tccccgaaaa 6180gtgccacctg acgtc
61951543567DNAplasmid pMM105 154aattcgattt ccggtacttt
tcagggcaat tgaagttccg gtcactactc ccccccagag 60caataagcca catccggcga
cgtgtggcac cccaccctgg ctgctacaga tggggctgga 120tgcagaagag aactccagct
ggtccttagg gacacggcgg ccttggcgct gaaggccact 180cgctcccacc ttgtcctcac
ggtccagttt tcccaggaat cccttagatg ctaagatggg 240gattcctgga aatactgttc
ttgaggtcat ggtttcacag ctggatttgc ctccttccca 300ccccacagtt gccccccaat
ggggcctcgg ctggctcaca ggatgagggt tcaagaagaa 360ggctgtccct ggaggtaaga
gggcttatga accatgttcc aaacctttgc gttgcttttc 420tttccatcgt gtctatttca
taacatccct gtgaggctgg atgtgggaac ttcagcactg 480ccgtactctt gggaaatttg
tccaaggcca cccggctgag cagcggttga accaggacac 540atcaggcatg cgtttcttga
atcactagtg aattcgcggc cgcctgcagg tcgaccatat 600gggagagctc ccaacgcgtt
ggatgcatag cttgagtatt ctatagtgtc acctaaatag 660cttggcgtaa tcatggtcat
agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc 720acacaacata cgagccggaa
gcataaagtg taaagcctgg ggtgcctaat gagtgagcta 780actcacatta attgcgttgc
gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca 840gctgcattaa tgaatcggcc
aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc 900cgcttcctcg ctcactgact
cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 960tcactcaaag gcggtaatac
ggttatccac agaatcaggg gataacgcag gaaagaacat 1020gtgagcaaaa ggccagcaaa
aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 1080ccataggctc cgcccccctg
acgagcatca caaaaatcga cgctcaagtc agaggtggcg 1140aaacccgaca ggactataaa
gataccaggc gtttccccct ggaagctccc tcgtgcgctc 1200tcctgttccg accctgccgc
ttaccggata cctgtccgcc tttctccctt cgggaagcgt 1260ggcgctttct catagctcac
gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 1320gctgggctgt gtgcacgaac
cccccgttca gcccgaccgc tgcgccttat ccggtaacta 1380tcgtcttgag tccaacccgg
taagacacga cttatcgcca ctggcagcag ccactggtaa 1440caggattagc agagcgaggt
atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 1500ctacggctac actagaagaa
cagtatttgg tatctgcgct ctgctgaagc cagttacctt 1560cggaaaaaga gttggtagct
cttgatccgg caaacaaacc accgctggta gcggtggttt 1620ttttgtttgc aagcagcaga
ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 1680cttttctacg gggtctgacg
ctcagtggaa cgaaaactca cgttaaggga ttttggtcat 1740gagattatca aaaaggatct
tcacctagat ccttttaaat taaaaatgaa gttttaaatc 1800aatctaaagt atatatgagt
aaacttggtc tgacagttac caatgcttaa tcagtgaggc 1860acctatctca gcgatctgtc
tatttcgttc atccatagtt gcctgactcc ccgtcgtgta 1920gataactacg atacgggagg
gcttaccatc tggccccagt gctgcaatga taccgcgaga 1980cccacgctca ccggctccag
atttatcagc aataaaccag ccagccggaa gggccgagcg 2040cagaagtggt cctgcaactt
tatccgcctc catccagtct attaattgtt gccgggaagc 2100tagagtaagt agttcgccag
ttaatagttt gcgcaacgtt gttgccattg ctacaggcat 2160cgtggtgtca cgctcgtcgt
ttggtatggc ttcattcagc tccggttccc aacgatcaag 2220gcgagttaca tgatccccca
tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 2280cgttgtcaga agtaagttgg
ccgcagtgtt atcactcatg gttatggcag cactgcataa 2340ttctcttact gtcatgccat
ccgtaagatg cttttctgtg actggtgagt actcaaccaa 2400gtcattctga gaatagtgta
tgcggcgacc gagttgctct tgcccggcgt caatacggga 2460taataccgcg ccacatagca
gaactttaaa agtgctcatc attggaaaac gttcttcggg 2520gcgaaaactc tcaaggatct
taccgctgtt gagatccagt tcgatgtaac ccactcgtgc 2580acccaactga tcttcagcat
cttttacttt caccagcgtt tctgggtgag caaaaacagg 2640aaggcaaaat gccgcaaaaa
agggaataag ggcgacacgg aaatgttgaa tactcatact 2700cttccttttt caatattatt
gaagcattta tcagggttat tgtctcatga gcggatacat 2760atttgaatgt atttagaaaa
ataaacaaat aggggttccg cgcacatttc cccgaaaagt 2820gccacctgat gcggtgtgaa
ataccgcaca gatgcgtaag gagaaaatac cgcatcagga 2880aattgtaagc gttaatattt
tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt 2940ttttaaccaa taggccgaaa
tcggcaaaat cccttataaa tcaaaagaat agaccgagat 3000agggttgagt gttgttccag
tttggaacaa gagtccacta ttaaagaacg tggactccaa 3060cgtcaaaggg cgaaaaaccg
tctatcaggg cgatggccca ctacgtgaac catcacccta 3120atcaagtttt ttggggtcga
ggtgccgtaa agcactaaat cggaacccta aagggagccc 3180ccgatttaga gcttgacggg
gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc 3240gaaaggagcg ggcgctaggg
cgctggcaag tgtagcggtc acgctgcgcg taaccaccac 3300acccgccgcg cttaatgcgc
cgctacaggg cgcgtccatt cgccattcag gctgcgcaac 3360tgttgggaag ggcgatcggt
gcgggcctct tcgctattac gccagctggc gaaaggggga 3420tgtgctgcaa ggcgattaag
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa 3480acgacggcca gtgaattgta
atacgactca ctatagggcg aattgggccc gacgtcgcat 3540gctcccggcc gccatggcgg
ccgcggg 35671555998DNAplasmid
pMM106 155aattcactag tgattcaaga aacgcatgcc tgatgtgtcc tggttcaacc
gctgctcagc 60cgggtggcct tggacaaatt tcccaagagt acggcagtgc tgaagttccc
acatccagcc 120tcacagggat gttatgaaat agacacgatg gaaagaaaag caacgcaaag
gtttggaaca 180tggttcataa gccctcttac ctccagggac agccttcttc ttgaaccctc
atcctgtgag 240ccagccgagg ccccattggg gggcaactgt ggggtgggaa ggaggcaaat
ccagctgtga 300aaccatgacc tcaagaacag tatttccagg aatccccatc ttagcatcta
agggattcct 360gggaaaactg gaccgtgagg acaaggtggg agcgagtggc cttcagcgcc
aaggccgccg 420tgtccctaag gaccagctgg agttctcttc tgcatccagc cccatctgta
gcagccaggg 480tggggtgcca cacgtcgccg gatgtggctt attgctctgg gggggagtag
tgaccggaac 540ttcaattgcc ctgaaaagta ccggaaatcg aattctgcag atatccagca
cagtggcggc 600cgctcgagtc tagagggccc gtttaaaccc gctgatcagc ctcgactgtg
ccttctagtt 660gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa
ggtgccactc 720ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt
aggtgtcatt 780ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa
gacaatagca 840ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc
agctggggct 900ctagggggta tccccacgcg ccctgtagcg gcgcattaag cgcggcgggt
gtggtggtta 960cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc
gctttcttcc 1020cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg
gggctccctt 1080tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat
tagggtgatg 1140gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg
ttggagtcca 1200cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct
atctcggtct 1260attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa
aatgagctga 1320tttaacaaaa atttaacgcg aattaattct gtggaatgtg tgtcagttag
ggtgtggaaa 1380gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt
agtcagcaac 1440caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca
tgcatctcaa 1500ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa
ctccgcccag 1560ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag
aggccgaggc 1620cgcctctgcc tctgagctat tccagaagta gtgaggaggc ttttttggag
gcctaggctt 1680ttgcaaaaag ctcccgggag cttgtatatc cattttcgga tctgatcaag
agacaggatg 1740aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg
ccgcttgggt 1800ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg
atgccgccgt 1860gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc
tgtccggtgc 1920cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg ctggccacga
cgggcgttcc 1980ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc
tattgggcga 2040agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag
tatccatcat 2100ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat
tcgaccacca 2160agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg
tcgatcagga 2220tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca
ggctcaaggc 2280gcgcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct
tgccgaatat 2340catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg
gtgtggcgga 2400ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg
gcggcgaatg 2460ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc
gcatcgcctt 2520ctatcgcctt cttgacgagt tcttctgagc gggactctgg ggttcgaaat
gaccgaccaa 2580gcgacgccca acctgccatc acgagatttc gattccaccg ccgccttcta
tgaaaggttg 2640ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg
ggatctcatg 2700ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta
caaataaagc 2760aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag
ttgtggtttg 2820tccaaactca tcaatgtatc ttatcatgtc tgtataccgt cgacctctag
ctagagcttg 2880gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac
aattccacac 2940aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt
gagctaactc 3000acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc
gtgccagctg 3060cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg
ctcttccgct 3120tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
atcagctcac 3180tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
gaacatgtga 3240gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
gtttttccat 3300aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
gtggcgaaac 3360ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
gcgctctcct 3420gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg
aagcgtggcg 3480ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg
ctccaagctg 3540ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
taactatcgt 3600cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
tggtaacagg 3660attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg
gcctaactac 3720ggctacacta gaagaacagt atttggtatc tgcgctctgc tgaagccagt
taccttcgga 3780aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
tttttttgtt 3840tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt
gatcttttct 3900acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
catgagatta 3960tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa
atcaatctaa 4020agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga
ggcacctatc 4080tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt
gtagataact 4140acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg
agacccacgc 4200tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga
gcgcagaagt 4260ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga
agctagagta 4320agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg
catcgtggtg 4380tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc
aaggcgagtt 4440acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc
gatcgttgtc 4500agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca
taattctctt 4560actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac
caagtcattc 4620tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg
ggataatacc 4680gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc
ggggcgaaaa 4740ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg
tgcacccaac 4800tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac
aggaaggcaa 4860aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat
actcttcctt 4920tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata
catatttgaa 4980tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa
agtgccacct 5040gacgtcgacg gatcgggaga tctcccgatc ccctatggtg cactctcagt
acaatctgct 5100ctgatgccgc atagttaagc cagtatctgc tccctgcttg tgtgttggag
gtcgctgagt 5160agtgcgcgag caaaatttaa gctacaacaa ggcaaggctt gaccgacaat
tgcatgaaga 5220atctgcttag ggttaggcgt tttgcgctgc ttcgcgatgt acgggccaga
tatacgcgtt 5280gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta
gttcatagcc 5340catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc
tgaccgccca 5400acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg
ccaataggga 5460ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg
gcagtacatc 5520aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa
tggcccgcct 5580ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac
atctacgtat 5640tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg
cgtggatagc 5700ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg
agtttgtttt 5760ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca
ttgacgcaaa 5820tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctctctgg
ctaactagag 5880aacccactgc ttactggctt atcgaaatta atacgactca ctatagggag
acccaagctg 5940gctagcgttt aaacttaagc ttggtaccga gctcggatcc actagtccag
tgtggtgg 59981566568DNAplasmid pMM107 156aattcgattt ccggtacttt
tcagggcaat tgaagttccg gtcactactc ccccccagag 60caataagcca catccggcga
cgtgtggcac cccaccctgg ctgctacaga tggggctgga 120tgcagaagag aactccagct
ggtccttagg gacacggcgg ccttggcgct gaaggccact 180cgctcccacc ttgtcctcac
ggtccagttt tcccaggaat cccttagatg ctaagatggg 240gattcctgga aatactgttc
ttgaggtcat ggtttcacag ctggatttgc ctccttccca 300ccccacagtt gccccccaat
ggggcctcgg ctggctcaca ggatgagggt tcaagaagaa 360ggctgtccct ggaggtaaga
gggcttatga accatgttcc aaacctttgc gttgcttttc 420tttccatcgt gtctatttca
taacatccct gtgaggctgg atgtgggaac ttcagcactg 480ccgtactctt gggaaatttg
tccaaggcca cccggctgag cagcggttga accaggacac 540atcaggcatg cgtttcttga
atcactagtg aattcgattt ccggtacttt tcagggcaat 600tgaagttccg gtcactactc
ccccccagag caataagcca catccggcga cgtgtggcac 660cccaccctgg ctgctacaga
tggggctgga tgcagaagag aactccagct ggtccttagg 720gacacggcgg ccttggcgct
gaaggccact cgctcccacc ttgtcctcac ggtccagttt 780tcccaggaat cccttagatg
ctaagatggg gattcctgga aatactgttc ttgaggtcat 840ggtttcacag ctggatttgc
ctccttccca ccccacagtt gccccccaat ggggcctcgg 900ctggctcaca ggatgagggt
tcaagaagaa ggctgtccct ggaggtaaga gggcttatga 960accatgttcc aaacctttgc
gttgcttttc tttccatcgt gtctatttca taacatccct 1020gtgaggctgg atgtgggaac
ttcagcactg ccgtactctt gggaaatttg tccaaggcca 1080cccggctgag cagcggttga
accaggacac atcaggcatg cgtttcttga atcactagtg 1140aattctgcag atatccagca
cagtggcggc cgctcgagtc tagagggccc gtttaaaccc 1200gctgatcagc ctcgactgtg
ccttctagtt gccagccatc tgttgtttgc ccctcccccg 1260tgccttcctt gaccctggaa
ggtgccactc ccactgtcct ttcctaataa aatgaggaaa 1320ttgcatcgca ttgtctgagt
aggtgtcatt ctattctggg gggtggggtg gggcaggaca 1380gcaaggggga ggattgggaa
gacaatagca ggcatgctgg ggatgcggtg ggctctatgg 1440cttctgaggc ggaaagaacc
agctggggct ctagggggta tccccacgcg ccctgtagcg 1500gcgcattaag cgcggcgggt
gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg 1560ccctagcgcc cgctcctttc
gctttcttcc cttcctttct cgccacgttc gccggctttc 1620cccgtcaagc tctaaatcgg
gggctccctt tagggttccg atttagtgct ttacggcacc 1680tcgaccccaa aaaacttgat
tagggtgatg gttcacgtag tgggccatcg ccctgataga 1740cggtttttcg ccctttgacg
ttggagtcca cgttctttaa tagtggactc ttgttccaaa 1800ctggaacaac actcaaccct
atctcggtct attcttttga tttataaggg attttgccga 1860tttcggccta ttggttaaaa
aatgagctga tttaacaaaa atttaacgcg aattaattct 1920gtggaatgtg tgtcagttag
ggtgtggaaa gtccccaggc tccccagcag gcagaagtat 1980gcaaagcatg catctcaatt
agtcagcaac caggtgtgga aagtccccag gctccccagc 2040aggcagaagt atgcaaagca
tgcatctcaa ttagtcagca accatagtcc cgcccctaac 2100tccgcccatc ccgcccctaa
ctccgcccag ttccgcccat tctccgcccc atggctgact 2160aatttttttt atttatgcag
aggccgaggc cgcctctgcc tctgagctat tccagaagta 2220gtgaggaggc ttttttggag
gcctaggctt ttgcaaaaag ctcccgggag cttgtatatc 2280cattttcgga tctgatcaag
agacaggatg aggatcgttt cgcatgattg aacaagatgg 2340attgcacgca ggttctccgg
ccgcttgggt ggagaggcta ttcggctatg actgggcaca 2400acagacaatc ggctgctctg
atgccgccgt gttccggctg tcagcgcagg ggcgcccggt 2460tctttttgtc aagaccgacc
tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg 2520gctatcgtgg ctggccacga
cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga 2580agcgggaagg gactggctgc
tattgggcga agtgccgggg caggatctcc tgtcatctca 2640ccttgctcct gccgagaaag
tatccatcat ggctgatgca atgcggcggc tgcatacgct 2700tgatccggct acctgcccat
tcgaccacca agcgaaacat cgcatcgagc gagcacgtac 2760tcggatggaa gccggtcttg
tcgatcagga tgatctggac gaagagcatc aggggctcgc 2820gccagccgaa ctgttcgcca
ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt 2880gacccatggc gatgcctgct
tgccgaatat catggtggaa aatggccgct tttctggatt 2940catcgactgt ggccggctgg
gtgtggcgga ccgctatcag gacatagcgt tggctacccg 3000tgatattgct gaagagcttg
gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat 3060cgccgctccc gattcgcagc
gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc 3120gggactctgg ggttcgaaat
gaccgaccaa gcgacgccca acctgccatc acgagatttc 3180gattccaccg ccgccttcta
tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc 3240tggatgatcc tccagcgcgg
ggatctcatg ctggagttct tcgcccaccc caacttgttt 3300attgcagctt ataatggtta
caaataaagc aatagcatca caaatttcac aaataaagca 3360tttttttcac tgcattctag
ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc 3420tgtataccgt cgacctctag
ctagagcttg gcgtaatcat ggtcatagct gtttcctgtg 3480tgaaattgtt atccgctcac
aattccacac aacatacgag ccggaagcat aaagtgtaaa 3540gcctggggtg cctaatgagt
gagctaactc acattaattg cgttgcgctc actgcccgct 3600ttccagtcgg gaaacctgtc
gtgccagctg cattaatgaa tcggccaacg cgcggggaga 3660ggcggtttgc gtattgggcg
ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 3720gttcggctgc ggcgagcggt
atcagctcac tcaaaggcgg taatacggtt atccacagaa 3780tcaggggata acgcaggaaa
gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 3840aaaaaggccg cgttgctggc
gtttttccat aggctccgcc cccctgacga gcatcacaaa 3900aatcgacgct caagtcagag
gtggcgaaac ccgacaggac tataaagata ccaggcgttt 3960ccccctggaa gctccctcgt
gcgctctcct gttccgaccc tgccgcttac cggatacctg 4020tccgcctttc tcccttcggg
aagcgtggcg ctttctcata gctcacgctg taggtatctc 4080agttcggtgt aggtcgttcg
ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 4140gaccgctgcg ccttatccgg
taactatcgt cttgagtcca acccggtaag acacgactta 4200tcgccactgg cagcagccac
tggtaacagg attagcagag cgaggtatgt aggcggtgct 4260acagagttct tgaagtggtg
gcctaactac ggctacacta gaagaacagt atttggtatc 4320tgcgctctgc tgaagccagt
taccttcgga aaaagagttg gtagctcttg atccggcaaa 4380caaaccaccg ctggtagcgg
tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 4440ggatctcaag aagatccttt
gatcttttct acggggtctg acgctcagtg gaacgaaaac 4500tcacgttaag ggattttggt
catgagatta tcaaaaagga tcttcaccta gatcctttta 4560aattaaaaat gaagttttaa
atcaatctaa agtatatatg agtaaacttg gtctgacagt 4620taccaatgct taatcagtga
ggcacctatc tcagcgatct gtctatttcg ttcatccata 4680gttgcctgac tccccgtcgt
gtagataact acgatacggg agggcttacc atctggcccc 4740agtgctgcaa tgataccgcg
agacccacgc tcaccggctc cagatttatc agcaataaac 4800cagccagccg gaagggccga
gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 4860tctattaatt gttgccggga
agctagagta agtagttcgc cagttaatag tttgcgcaac 4920gttgttgcca ttgctacagg
catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 4980agctccggtt cccaacgatc
aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 5040gttagctcct tcggtcctcc
gatcgttgtc agaagtaagt tggccgcagt gttatcactc 5100atggttatgg cagcactgca
taattctctt actgtcatgc catccgtaag atgcttttct 5160gtgactggtg agtactcaac
caagtcattc tgagaatagt gtatgcggcg accgagttgc 5220tcttgcccgg cgtcaatacg
ggataatacc gcgccacata gcagaacttt aaaagtgctc 5280atcattggaa aacgttcttc
ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 5340agttcgatgt aacccactcg
tgcacccaac tgatcttcag catcttttac tttcaccagc 5400gtttctgggt gagcaaaaac
aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 5460cggaaatgtt gaatactcat
actcttcctt tttcaatatt attgaagcat ttatcagggt 5520tattgtctca tgagcggata
catatttgaa tgtatttaga aaaataaaca aataggggtt 5580ccgcgcacat ttccccgaaa
agtgccacct gacgtcgacg gatcgggaga tctcccgatc 5640ccctatggtg cactctcagt
acaatctgct ctgatgccgc atagttaagc cagtatctgc 5700tccctgcttg tgtgttggag
gtcgctgagt agtgcgcgag caaaatttaa gctacaacaa 5760ggcaaggctt gaccgacaat
tgcatgaaga atctgcttag ggttaggcgt tttgcgctgc 5820ttcgcgatgt acgggccaga
tatacgcgtt gacattgatt attgactagt tattaatagt 5880aatcaattac ggggtcatta
gttcatagcc catatatgga gttccgcgtt acataactta 5940cggtaaatgg cccgcctggc
tgaccgccca acgacccccg cccattgacg tcaataatga 6000cgtatgttcc catagtaacg
ccaataggga ctttccattg acgtcaatgg gtggagtatt 6060tacggtaaac tgcccacttg
gcagtacatc aagtgtatca tatgccaagt acgcccccta 6120ttgacgtcaa tgacggtaaa
tggcccgcct ggcattatgc ccagtacatg accttatggg 6180actttcctac ttggcagtac
atctacgtat tagtcatcgc tattaccatg gtgatgcggt 6240tttggcagta catcaatggg
cgtggatagc ggtttgactc acggggattt ccaagtctcc 6300accccattga cgtcaatggg
agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat 6360gtcgtaacaa ctccgcccca
ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct 6420atataagcag agctctctgg
ctaactagag aacccactgc ttactggctt atcgaaatta 6480atacgactca ctatagggag
acccaagctg gctagcgttt aaacttaagc ttggtaccga 6540gctcggatcc actagtccag
tgtggtgg 65681575998DNAplasmid
pMM109 157aattcgattt ccggtacttt tcagggcaat tgaagttccg gtcactactc
ccccccagag 60caataagcca catccggcga cgtgtggcac cccaccctgg ctgctacaga
tggggctgga 120tgcagaagag aactccagct ggtccttagg gacacggcgg ccttggcgct
gaaggccact 180cgctcccacc ttgtcctcac ggtccagttt tcccaggaat cccttagatg
ctaagatggg 240gattcctgga aatactgttc ttgaggtcat ggtttcacag ctggatttgc
ctccttccca 300ccccacagtt gccccccaat ggggcctcgg ctggctcaca ggatgagggt
tcaagaagaa 360ggctgtccct ggaggtaaga gggcttatga accatgttcc aaacctttgc
gttgcttttc 420tttccatcgt gtctatttca taacatccct gtgaggctgg atgtgggaac
ttcagcactg 480ccgtactctt gggaaatttg tccaaggcca cccggctgag cagcggttga
accaggacac 540atcaggcatg cgtttcttga atcactagtg aattctgcag atatccagca
cagtggcggc 600cgctcgagtc tagagggccc gtttaaaccc gctgatcagc ctcgactgtg
ccttctagtt 660gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa
ggtgccactc 720ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt
aggtgtcatt 780ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa
gacaatagca 840ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc
agctggggct 900ctagggggta tccccacgcg ccctgtagcg gcgcattaag cgcggcgggt
gtggtggtta 960cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc
gctttcttcc 1020cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg
gggctccctt 1080tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat
tagggtgatg 1140gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg
ttggagtcca 1200cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct
atctcggtct 1260attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa
aatgagctga 1320tttaacaaaa atttaacgcg aattaattct gtggaatgtg tgtcagttag
ggtgtggaaa 1380gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt
agtcagcaac 1440caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca
tgcatctcaa 1500ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa
ctccgcccag 1560ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag
aggccgaggc 1620cgcctctgcc tctgagctat tccagaagta gtgaggaggc ttttttggag
gcctaggctt 1680ttgcaaaaag ctcccgggag cttgtatatc cattttcgga tctgatcaag
agacaggatg 1740aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg
ccgcttgggt 1800ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg
atgccgccgt 1860gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc
tgtccggtgc 1920cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg ctggccacga
cgggcgttcc 1980ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc
tattgggcga 2040agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag
tatccatcat 2100ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat
tcgaccacca 2160agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg
tcgatcagga 2220tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca
ggctcaaggc 2280gcgcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct
tgccgaatat 2340catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg
gtgtggcgga 2400ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg
gcggcgaatg 2460ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc
gcatcgcctt 2520ctatcgcctt cttgacgagt tcttctgagc gggactctgg ggttcgaaat
gaccgaccaa 2580gcgacgccca acctgccatc acgagatttc gattccaccg ccgccttcta
tgaaaggttg 2640ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg
ggatctcatg 2700ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta
caaataaagc 2760aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag
ttgtggtttg 2820tccaaactca tcaatgtatc ttatcatgtc tgtataccgt cgacctctag
ctagagcttg 2880gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac
aattccacac 2940aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt
gagctaactc 3000acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc
gtgccagctg 3060cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg
ctcttccgct 3120tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
atcagctcac 3180tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
gaacatgtga 3240gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
gtttttccat 3300aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
gtggcgaaac 3360ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
gcgctctcct 3420gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg
aagcgtggcg 3480ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg
ctccaagctg 3540ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
taactatcgt 3600cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
tggtaacagg 3660attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg
gcctaactac 3720ggctacacta gaagaacagt atttggtatc tgcgctctgc tgaagccagt
taccttcgga 3780aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
tttttttgtt 3840tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt
gatcttttct 3900acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
catgagatta 3960tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa
atcaatctaa 4020agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga
ggcacctatc 4080tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt
gtagataact 4140acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg
agacccacgc 4200tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga
gcgcagaagt 4260ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga
agctagagta 4320agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg
catcgtggtg 4380tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc
aaggcgagtt 4440acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc
gatcgttgtc 4500agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca
taattctctt 4560actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac
caagtcattc 4620tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg
ggataatacc 4680gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc
ggggcgaaaa 4740ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg
tgcacccaac 4800tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac
aggaaggcaa 4860aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat
actcttcctt 4920tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata
catatttgaa 4980tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa
agtgccacct 5040gacgtcgacg gatcgggaga tctcccgatc ccctatggtg cactctcagt
acaatctgct 5100ctgatgccgc atagttaagc cagtatctgc tccctgcttg tgtgttggag
gtcgctgagt 5160agtgcgcgag caaaatttaa gctacaacaa ggcaaggctt gaccgacaat
tgcatgaaga 5220atctgcttag ggttaggcgt tttgcgctgc ttcgcgatgt acgggccaga
tatacgcgtt 5280gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta
gttcatagcc 5340catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc
tgaccgccca 5400acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg
ccaataggga 5460ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg
gcagtacatc 5520aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa
tggcccgcct 5580ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac
atctacgtat 5640tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg
cgtggatagc 5700ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg
agtttgtttt 5760ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca
ttgacgcaaa 5820tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctctctgg
ctaactagag 5880aacccactgc ttactggctt atcgaaatta atacgactca ctatagggag
acccaagctg 5940gctagcgttt aaacttaagc ttggtaccga gctcggatcc actagtccag
tgtggtgg 59981586606DNAplasmid pMM-TK/miRTarg 158gacggatcgg
gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt
aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat
ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag
gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240gattattgac
tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300tggagttccg
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420attgacgtca
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480atcatatgcc
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540atgcccagta
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600tcgctattac
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt
acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840ctgcttactg
gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900gtttaaactt
aagcttggta ccgagctcgg atctcgagct caagcttcga attctgcagt 960cgacggtacc
gcgggcccgg gatccaccgg tcgccaccat ggcttctcac gccggccaac 1020agcacgcgcc
tgcgttcggt caggctgctc gtgcgagcgg gcctaccgac ggccgcgcgg 1080cgtcccgtcc
tagccatcgc cagggggcct ccggagcccg cggggatccg gagctgccca 1140cgctgctgcg
ggtttatata gacggacccc acggggtggg gaagaccacc acctccgcgc 1200agctgatgga
ggccctgggg ccgcgcgaca atatcgtcta cgtccccgag ccgatgactt 1260actggcaggt
gctgggggcc tccgagaccc tgacgaacat ctacaacacg cagcaccgtc 1320tggaccgcgg
cgagatatcg gccggggagg cggcggtggt aatgaccagc gcccagataa 1380caatgagcac
gccttatgcg gcgacggacg ccgttttggc tcctcatatc gggggggagg 1440ctgtgggccc
gcaagccccg cccccggccc tcacccttgt tttcgaccgg caccctatcg 1500cctccctgct
gtgctacccg gccgcgcggt acctcatggg aagcatgacc ccccaggccg 1560tgttggcgtt
cgtggccctc atgcccccga ccgcgcccgg cacgaacctg gtcctgggtg 1620tccttccgga
ggccgaacac gccgaccgcc tggccagacg ccaacgcccg ggcgagcggc 1680ttgacctggc
catgctgtcc gccattcgcc gtgtctacga tctactcgcc aacacggtgc 1740ggtacctgca
gcgcggcggg aggtggcggg aggactgggg ccggctgacg ggggtcgccg 1800cggcgacccc
gcgccccgac cccgaggacg gcgcggggtc tctgccccgc atcgaggaca 1860cgctgtttgc
cctgttccgc gttcccgagc tgctggcccc caacggggac ttgtaccaca 1920tttttgcctg
ggtcttggac gtcttggccg accgcctcct tccgatgcat ctatttgtcc 1980tggattacga
tcagtcgccc gtcgggtgtc gagacgccct gttgcgcctc accgccggga 2040tgatcccaac
ccgcgtcaca accgccgggt ccatcgccga gatacgcgac ctggcgcgca 2100cgtttgcccg
cgaggtgggg ggagtttaga gcggccgctc gagtctagca gatcctggga 2160aaactggacc
tagagggccc gtttaaaccc gctgatcagc ctcgactgtg ccttctagtt 2220gccagccatc
tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc 2280ccactgtcct
ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt 2340ctattctggg
gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca 2400ggcatgctgg
ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc agctggggct 2460ctagggggta
tccccacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta 2520cgcgcagcgt
gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc 2580cttcctttct
cgccacgttc gccggctttc cccgtcaagc tctaaatcgg gggctccctt 2640tagggttccg
atttagtgct ttacggcacc tcgaccccaa aaaacttgat tagggtgatg 2700gttcacgtag
tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca 2760cgttctttaa
tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcggtct 2820attcttttga
tttataaggg attttgccga tttcggccta ttggttaaaa aatgagctga 2880tttaacaaaa
atttaacgcg aattaattct gtggaatgtg tgtcagttag ggtgtggaaa 2940gtccccaggc
tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac 3000caggtgtgga
aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 3060ttagtcagca
accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag 3120ttccgcccat
tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc 3180cgcctctgcc
tctgagctat tccagaagta gtgaggaggc ttttttggag gcctaggctt 3240ttgcaaaaag
ctcccgggag cttgtatatc cattttcgga tctgatcaag agacaggatg 3300aggatcgttt
cgcatgattg aacaagatgg attgcacgca ggttctccgg ccgcttgggt 3360ggagaggcta
ttcggctatg actgggcaca acagacaatc ggctgctctg atgccgccgt 3420gttccggctg
tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc 3480cctgaatgaa
ctgcaggacg aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc 3540ttgcgcagct
gtgctcgacg ttgtcactga agcgggaagg gactggctgc tattgggcga 3600agtgccgggg
caggatctcc tgtcatctca ccttgctcct gccgagaaag tatccatcat 3660ggctgatgca
atgcggcggc tgcatacgct tgatccggct acctgcccat tcgaccacca 3720agcgaaacat
cgcatcgagc gagcacgtac tcggatggaa gccggtcttg tcgatcagga 3780tgatctggac
gaagagcatc aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc 3840gcgcatgccc
gacggcgagg atctcgtcgt gacccatggc gatgcctgct tgccgaatat 3900catggtggaa
aatggccgct tttctggatt catcgactgt ggccggctgg gtgtggcgga 3960ccgctatcag
gacatagcgt tggctacccg tgatattgct gaagagcttg gcggcgaatg 4020ggctgaccgc
ttcctcgtgc tttacggtat cgccgctccc gattcgcagc gcatcgcctt 4080ctatcgcctt
cttgacgagt tcttctgagc gggactctgg ggttcgaaat gaccgaccaa 4140gcgacgccca
acctgccatc acgagatttc gattccaccg ccgccttcta tgaaaggttg 4200ggcttcggaa
tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg 4260ctggagttct
tcgcccaccc caacttgttt attgcagctt ataatggtta caaataaagc 4320aatagcatca
caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg 4380tccaaactca
tcaatgtatc ttatcatgtc tgtataccgt cgacctctag ctagagcttg 4440gcgtaatcat
ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 4500aacatacgag
ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 4560acattaattg
cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 4620cattaatgaa
tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 4680tcctcgctca
ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 4740tcaaaggcgg
taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 4800gcaaaaggcc
agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 4860aggctccgcc
cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 4920ccgacaggac
tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 4980gttccgaccc
tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 5040ctttctcata
gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 5100ggctgtgtgc
acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 5160cttgagtcca
acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 5220attagcagag
cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 5280ggctacacta
gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 5340aaaagagttg
gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tttttttgtt 5400tgcaagcagc
agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 5460acggggtctg
acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 5520tcaaaaagga
tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 5580agtatatatg
agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 5640tcagcgatct
gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 5700acgatacggg
agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 5760tcaccggctc
cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 5820ggtcctgcaa
ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 5880agtagttcgc
cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 5940tcacgctcgt
cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 6000acatgatccc
ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 6060agaagtaagt
tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 6120actgtcatgc
catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 6180tgagaatagt
gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 6240gcgccacata
gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 6300ctctcaagga
tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 6360tgatcttcag
catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 6420aatgccgcaa
aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 6480tttcaatatt
attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 6540tgtatttaga
aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 6600gacgtc
66061596759DNAplasmid pMM1-CD/miRTarg 159gacggatcgg gagatctccc gatcccctat
ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg
cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag
gcttgaccga caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg
atgtacgggc cagatatacg cgttgacatt 240gattattgac tagttattaa tagtaatcaa
ttacggggtc attagttcat agcccatata 300tggagttccg cgttacataa cttacggtaa
atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg
ttcccatagt aacgccaata gggactttcc 420attgacgtca atgggtggag tatttacggt
aaactgccca cttggcagta catcaagtgt 480atcatatgcc aagtacgccc cctattgacg
tcaatgacgg taaatggccc gcctggcatt 540atgcccagta catgacctta tgggactttc
ctacttggca gtacatctac gtattagtca 600tcgctattac catggtgatg cggttttggc
agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg atttccaagt ctccacccca
ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta
acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa
gcagagctct ctggctaact agagaaccca 840ctgcttactg gcttatcgaa attaatacga
ctcactatag ggagacccaa gctggctagc 900gtttaaactt aagcttggta ccgagctcgg
atctcgagct caagcttcga attctgcagt 960cgacggtacc gcgggcccgg gatccaccgg
tcgccaccat gtcgaataac gctttacaaa 1020caattattaa cgcccggtta ccaggcgaag
aggggctgtg gcagattcat ctgcaggacg 1080gaaaaatcag cgccattgat gcgcaatccg
gcgtgatgcc cataactgaa aacagcctgg 1140atgccgaaca aggtttagtt ataccgccgt
ttgtggagcc acatattcac ctggacacca 1200cgcaaaccgc cggacaaccg aactggaatc
agtccggcac gctgtttgaa ggcattgaac 1260gctgggccga gcgcaaagcg ttattaaccc
atgacgatgt gaaacaacgc gcatggcaaa 1320cgctgaaatg gcagattgcc aacggcattc
agcatgtgcg tacccatgtc gatgtttcgg 1380atgcaacgct aactgcgctg aaagcaatgc
tggaagtgaa gcaggaagtc gcgccgtgga 1440ttgatctgca aatcgtcgcc ttccctcagg
aagggatttt gtcgtatccc aacggtgaag 1500cgttgctgga agaggcgtta cgcttagggg
cagatgtagt gggggcgatt ccgcattttg 1560aatttacccg tgaatacggc gtggagtcgc
tgcataaaac cttcgccctg gcgcaaaaat 1620acgaccgtct catcgacgtt cactgtgatg
agatcgatga cgagcagtcg cgctttgtcg 1680aaaccgttgc tgccctggcg caccatgaag
gcatgggcgc gcgagtcacc gccagccaca 1740ccacggcaat gcactcctat aacggggcgt
atacctcacg cctgttccgc ttgctgaaaa 1800tgtccggtat taactttgtc gccaacccgc
tggtcaatat tcatctgcaa ggacgtttcg 1860atacgtatcc aaaacgtcgc ggcatcacgc
gcgttaaaga gatgctggag tccggcatta 1920acgtctgctt tggtcacgat gatgtcttcg
atccgtggta tccgctggga acggcgaata 1980tgctgcaagt gctgcatatg gggctgcatg
tttgccagtt gatgggctac gggcagatta 2040acgatggcct gaatttaatc acccaccaca
gcgcaaggac gttgaatttg caggattacg 2100gcattgccgc cggaaacagc gccaacctga
ttatcctgcc ggctgaaaat gggtttgatg 2160cgctgcgccg tcaggttccg gtacgttatt
cggtacgtgg cggcaaggtg attgccagca 2220cacaaccggc acaaaccacc gtatatctgg
agcagccaga agccatcgat tacaaacgtt 2280gaagcggccg ctcgagtcta gcagatcctg
ggaaaactgg acctagaggg cccgtttaaa 2340cccgctgatc agcctcgact gtgccttcta
gttgccagcc atctgttgtt tgcccctccc 2400ccgtgccttc cttgaccctg gaaggtgcca
ctcccactgt cctttcctaa taaaatgagg 2460aaattgcatc gcattgtctg agtaggtgtc
attctattct ggggggtggg gtggggcagg 2520acagcaaggg ggaggattgg gaagacaata
gcaggcatgc tggggatgcg gtgggctcta 2580tggcttctga ggcggaaaga accagctggg
gctctagggg gtatccccac gcgccctgta 2640gcggcgcatt aagcgcggcg ggtgtggtgg
ttacgcgcag cgtgaccgct acacttgcca 2700gcgccctagc gcccgctcct ttcgctttct
tcccttcctt tctcgccacg ttcgccggct 2760ttccccgtca agctctaaat cgggggctcc
ctttagggtt ccgatttagt gctttacggc 2820acctcgaccc caaaaaactt gattagggtg
atggttcacg tagtgggcca tcgccctgat 2880agacggtttt tcgccctttg acgttggagt
ccacgttctt taatagtgga ctcttgttcc 2940aaactggaac aacactcaac cctatctcgg
tctattcttt tgatttataa gggattttgc 3000cgatttcggc ctattggtta aaaaatgagc
tgatttaaca aaaatttaac gcgaattaat 3060tctgtggaat gtgtgtcagt tagggtgtgg
aaagtcccca ggctccccag caggcagaag 3120tatgcaaagc atgcatctca attagtcagc
aaccaggtgt ggaaagtccc caggctcccc 3180agcaggcaga agtatgcaaa gcatgcatct
caattagtca gcaaccatag tcccgcccct 3240aactccgccc atcccgcccc taactccgcc
cagttccgcc cattctccgc cccatggctg 3300actaattttt tttatttatg cagaggccga
ggccgcctct gcctctgagc tattccagaa 3360gtagtgagga ggcttttttg gaggcctagg
cttttgcaaa aagctcccgg gagcttgtat 3420atccattttc ggatctgatc aagagacagg
atgaggatcg tttcgcatga ttgaacaaga 3480tggattgcac gcaggttctc cggccgcttg
ggtggagagg ctattcggct atgactgggc 3540acaacagaca atcggctgct ctgatgccgc
cgtgttccgg ctgtcagcgc aggggcgccc 3600ggttcttttt gtcaagaccg acctgtccgg
tgccctgaat gaactgcagg acgaggcagc 3660gcggctatcg tggctggcca cgacgggcgt
tccttgcgca gctgtgctcg acgttgtcac 3720tgaagcggga agggactggc tgctattggg
cgaagtgccg gggcaggatc tcctgtcatc 3780tcaccttgct cctgccgaga aagtatccat
catggctgat gcaatgcggc ggctgcatac 3840gcttgatccg gctacctgcc cattcgacca
ccaagcgaaa catcgcatcg agcgagcacg 3900tactcggatg gaagccggtc ttgtcgatca
ggatgatctg gacgaagagc atcaggggct 3960cgcgccagcc gaactgttcg ccaggctcaa
ggcgcgcatg cccgacggcg aggatctcgt 4020cgtgacccat ggcgatgcct gcttgccgaa
tatcatggtg gaaaatggcc gcttttctgg 4080attcatcgac tgtggccggc tgggtgtggc
ggaccgctat caggacatag cgttggctac 4140ccgtgatatt gctgaagagc ttggcggcga
atgggctgac cgcttcctcg tgctttacgg 4200tatcgccgct cccgattcgc agcgcatcgc
cttctatcgc cttcttgacg agttcttctg 4260agcgggactc tggggttcga aatgaccgac
caagcgacgc ccaacctgcc atcacgagat 4320ttcgattcca ccgccgcctt ctatgaaagg
ttgggcttcg gaatcgtttt ccgggacgcc 4380ggctggatga tcctccagcg cggggatctc
atgctggagt tcttcgccca ccccaacttg 4440tttattgcag cttataatgg ttacaaataa
agcaatagca tcacaaattt cacaaataaa 4500gcattttttt cactgcattc tagttgtggt
ttgtccaaac tcatcaatgt atcttatcat 4560gtctgtatac cgtcgacctc tagctagagc
ttggcgtaat catggtcata gctgtttcct 4620gtgtgaaatt gttatccgct cacaattcca
cacaacatac gagccggaag cataaagtgt 4680aaagcctggg gtgcctaatg agtgagctaa
ctcacattaa ttgcgttgcg ctcactgccc 4740gctttccagt cgggaaacct gtcgtgccag
ctgcattaat gaatcggcca acgcgcgggg 4800agaggcggtt tgcgtattgg gcgctcttcc
gcttcctcgc tcactgactc gctgcgctcg 4860gtcgttcggc tgcggcgagc ggtatcagct
cactcaaagg cggtaatacg gttatccaca 4920gaatcagggg ataacgcagg aaagaacatg
tgagcaaaag gccagcaaaa ggccaggaac 4980cgtaaaaagg ccgcgttgct ggcgtttttc
cataggctcc gcccccctga cgagcatcac 5040aaaaatcgac gctcaagtca gaggtggcga
aacccgacag gactataaag ataccaggcg 5100tttccccctg gaagctccct cgtgcgctct
cctgttccga ccctgccgct taccggatac 5160ctgtccgcct ttctcccttc gggaagcgtg
gcgctttctc atagctcacg ctgtaggtat 5220ctcagttcgg tgtaggtcgt tcgctccaag
ctgggctgtg tgcacgaacc ccccgttcag 5280cccgaccgct gcgccttatc cggtaactat
cgtcttgagt ccaacccggt aagacacgac 5340ttatcgccac tggcagcagc cactggtaac
aggattagca gagcgaggta tgtaggcggt 5400gctacagagt tcttgaagtg gtggcctaac
tacggctaca ctagaagaac agtatttggt 5460atctgcgctc tgctgaagcc agttaccttc
ggaaaaagag ttggtagctc ttgatccggc 5520aaacaaacca ccgctggtag cggttttttt
gtttgcaagc agcagattac gcgcagaaaa 5580aaaggatctc aagaagatcc tttgatcttt
tctacggggt ctgacgctca gtggaacgaa 5640aactcacgtt aagggatttt ggtcatgaga
ttatcaaaaa ggatcttcac ctagatcctt 5700ttaaattaaa aatgaagttt taaatcaatc
taaagtatat atgagtaaac ttggtctgac 5760agttaccaat gcttaatcag tgaggcacct
atctcagcga tctgtctatt tcgttcatcc 5820atagttgcct gactccccgt cgtgtagata
actacgatac gggagggctt accatctggc 5880cccagtgctg caatgatacc gcgagaccca
cgctcaccgg ctccagattt atcagcaata 5940aaccagccag ccggaagggc cgagcgcaga
agtggtcctg caactttatc cgcctccatc 6000cagtctatta attgttgccg ggaagctaga
gtaagtagtt cgccagttaa tagtttgcgc 6060aacgttgttg ccattgctac aggcatcgtg
gtgtcacgct cgtcgtttgg tatggcttca 6120ttcagctccg gttcccaacg atcaaggcga
gttacatgat cccccatgtt gtgcaaaaaa 6180gcggttagct ccttcggtcc tccgatcgtt
gtcagaagta agttggccgc agtgttatca 6240ctcatggtta tggcagcact gcataattct
cttactgtca tgccatccgt aagatgcttt 6300tctgtgactg gtgagtactc aaccaagtca
ttctgagaat agtgtatgcg gcgaccgagt 6360tgctcttgcc cggcgtcaat acgggataat
accgcgccac atagcagaac tttaaaagtg 6420ctcatcattg gaaaacgttc ttcggggcga
aaactctcaa ggatcttacc gctgttgaga 6480tccagttcga tgtaacccac tcgtgcaccc
aactgatctt cagcatcttt tactttcacc 6540agcgtttctg ggtgagcaaa aacaggaagg
caaaatgccg caaaaaaggg aataagggcg 6600acacggaaat gttgaatact catactcttc
ctttttcaat attattgaag catttatcag 6660ggttattgtc tcatgagcgg atacatattt
gaatgtattt agaaaaataa acaaataggg 6720gttccgcgca catttccccg aaaagtgcca
cctgacgtc 675916064RNAHomo sapiens 160ccccgcgacg
agccccucgc acaaaccgga ccugagcguu uuguucguuc ggcucgcgug 60aggc
6416122RNAHomo
sapiens 161uuuguucguu cggcucgcgu ga
22162110RNAHomo sapiens 162ccugugcaga gauuauuuuu uaaaagguca
caaucaacau ucauugcugu cgguggguug 60aacugugugg acaagcucac ugaacaauga
augcaacugu ggccccgcuu 11016322RNAHomo sapiens 163aacauucauu
gcugucggug gg 2216422RNAHomo
sapiens 164ucacgcgagc cgaacgaaca aa
2216522RNAHomo sapiens 165cccaccgaca gcaaugaaug uu
2216687RNAHomo sapiens 166ugagggcccc
ucugcguguu cacagcggac cuugauuuaa ugucuauaca auuaaggcac 60gcggugaaug
ccaagagagg cgccucc 8716722RNAHomo
sapiens 167uuaaggcacg cggugaaugc ca
2216887RNAHomo sapiens 168ggaagcgagu uguuaucuuu gguuaucuag
cuguaugagu guauuggucu ucauaaagcu 60agauaaccga aaguaaaaac uccuuca
8716923RNAHomo sapiens 169ucuuugguua
ucuagcugua uga 2317022RNAHomo
sapiens 170uggcauucac cgcgugccuu aa
2217123RNAHomo sapiens 171ucauacagcu agauaaccaa aga
23
User Contributions:
Comment about this patent or add new information about this topic: