Patent application title: COMPOSITIONS AND METHODS FOR 3-HYDROXYPROPIONATE BIO-PRODUCTION FROM BIOMASS
Inventors:
Michael D. Lynch (Boulder, CO, US)
Michael D. Lynch (Boulder, CO, US)
Assignees:
OPX Biotechnologies, Inc.
IPC8 Class: AC12P740FI
USPC Class:
562598
Class name: Carboxylic acids and salts thereof acyclic unsaturated
Publication date: 2014-05-15
Patent application number: 20140135526
Abstract:
Methods of obtaining mutant nucleic acid sequences that demonstrate
elevated oxaloacetate a-decarboxylase activity are provided.
Compositions, such as genetically modified microorganisms that comprise
such mutant nucleic acid sequences, are described, as are methods to
obtain the same.Claims:
1. A method for producing an acrylic acid-based consumer product, said
method comprising i) combining a carbon source and a microorganism cell
culture to produce 3-hydroxypropionic acid; ii) converting said
3-hydroxypropionic acid to acrylic acid; and iii) processing said acrylic
acid into a consumer product.
2. The method of claim 1, wherein said cell culture comprises a genetically modified microorganism.
3. The method of claim 2, wherein said microorganism is modified for increased tolerance to 3-hydroxypropionic acid.
4. The method of claim 3, wherein said modification modulates one or more components of the chorismate superpathway.
5. The method of claim 2, wherein said microorganism is modified for increased production of 3-hydroxypropionic acid.
6. The method of claim 5, wherein said modification comprises reduction in activity of one or more enzymes selected from pyruvate kinase, phosphofructokinase, lactate dehydrogenase, phosphate acetyltransferase, pyruvate oxidase, pyruvate-formate lyase, and homologs thereof.
7. The method of claim 6, wherein said pyruvate kinase is selected from pykA and pykF, said phosphofructokinase is selected from pfkA and pfkB, said lactate dehydrogenase is selected from ldhA, said phosphate acetyltransferase is selected from pta, said pyruvate oxidase is selected from poxB, said pyruvate-formate lyase is selected from pflB, and homologs thereof.
8. The method of claim 5, wherein said modification comprises increase in activity of one or more enzymes selected from phosphoenolpyruvate carboxykinase, malonyl-CoA reductase, 3-hydroxypropionate dehydrogenase, malonate semialdehyde dehydrogenase A, alpha-ketoglutarate decarboxylase, oxaloacetate alpha-oxo-decarboxylase, and homologs thereof.
9. The method of claim 8, wherein said phosphoenolpyruvate carboxykinase is selected from pck, said malonyl-CoA reductase is selected from mer, said malonate semialdehyde dehydrogenase A is selected from mmsA, said 3-hydroxypropionic acid dehydrogenase is selected from mmsB, said alpha-ketoglutarate decarboxylase is selected from kgd, said oxaloacetate alpha-oxo-decarboxylase is selected from oad, and homologs thereof.
10. The method of claim 8, wherein said modification comprises an increase in activity in a malonyl-CoA reductase enzyme.
11. The method of claim 8, wherein said modification comprises an increase in activity in an oxaloacetate alpha-oxo-decarboxylase enzyme.
12. The method of claim 2, wherein said microorganism is modified for increased tolerance to 3-hydroxypropionic acid, and wherein said microorganism is modified for increased production of 3-hydroxypropionic acid.
13. A method for producing an acrylic acid-based consumer product, said method comprising i) combining a carbon source and a genetically modified microorganism in cell culture to produce 3-hydroxypropionic acid; ii) converting said 3-hydroxypropionic acid to acrylic acid; and iii) processing said acrylic acid into a consumer product; wherein said microorganism is modified for increased production of 3-hydroxypropionic acid via an increase in activity in an oxaloacetate alpha decarboxylase enzyme or homolog thereof.
14. A method for producing acrylic acid, said method comprising i) combining a carbon source and a microorganism cell culture to produce 3-hydroxypropionic acid in a concentration of at least 10 g/L; and ii) converting said 3-hydroxypropionic acid to acrylic acid.
15. The method of claim 14, wherein the combining comprises combining a carbon source and a microorganism cell culture comprising a microorganism genetically modified to increase activity of one or more enzymes selected from phosphoenolpyruvate carboxykinase, malonyl-CoA reductase, malonate semialdehyde dehydrogenase A, 3-HP dehydrogenase, alpha-ketoglutarate decarboxylase, oxaloacetate alpha-oxo-decarboxylase, and homologs thereof.
16. The method of claim 15, wherein said phosphoenolpyruvate carboxykinase is selected from pck, said malonyl-CoA reductase is selected from mer, said malonate semialdehyde dehydrogenase A is selected from mmsA, said 3-hydroxypropionic acid dehydrogenase is selected from mmsB, said alpha-ketoglutarate decarboxylase is selected from kgd, said oxaloacetate alpha-oxo-decarboxylase is selected from oad, and homologs thereof.
17. The method of claim 14, wherein the combining comprises combining a carbon source and a microorganism cell culture comprising a microorganism genetically modified to increase activity of malonyl-CoA reductase enzyme increasing production of 3-hydroxypropionic acid.
18. The method of claim 14, wherein the combining comprises combining a carbon source and a microorganism cell culture comprising a microorganism genetically modified to increase activity of an oxaloacetate alpha-oxo-decarboxylase enzyme, increasing production of 3-hydroxypropionic acid.
19. Biologically-produced acrylic acid, wherein said acrylic acid is produced according to claim 14.
20. A consumer product produced with acrylic acid according to claim 19.
Description:
RELATED APPLICATIONS
[0001] This application is a continuation application which claims priority under 35 USC 120 to U.S. patent application Ser. No. 13/284,337, filed Oct. 28, 2011, which is a continuation of Ser. No. 12/328,588, filed Dec. 4, 2008, and this application also claims priority under 35 USC 119 to U.S. Provisional Patent Application No. 60/992,290, filed Dec. 4, 2007. Both referenced patent applications are incorporated by reference in their respective entireties herewith.
REFERENCE TO A SEQUENCE LISTING
[0002] An electronically filed sequence listing is provided herewith which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Dec. 27, 2013, is named 34246-703.302_SL.txt and is 72,182 bytes in size.
FIELD OF THE INVENTION
[0003] The present invention relates to methods, systems and compositions, including genetically modified microorganisms, i.e., recombinant microorganisms, adapted to exhibit elevated oxaloacetate alpha-oxo decarboxylase activity (also referred to herein as oxaloacetate alpha-decarboxylase activity).
BACKGROUND OF THE INVENTION
[0004] 3-hydroxypropionate ("3-HP", CAS No. 503-66-2) has been identified as a highly attractive potential chemical feedstock for the production of many large market commodity chemicals that are currently derived from petroleum derivatives. For example, commodity products that can be readily produced using 3-HP include acrylic acid, 1,3-propanediol, methyl-acrylate, and acrylamide, as shown in FIG. 1. The sum value of these commodity chemicals is currently estimated to exceed several billions of dollars annually in the US. However, the current petrochemical manufacturing techniques for these commodities adverse impact the environment via the pollutants generated and the energy used in their production. Manufacture of these same commodities via the clean, cost-effective, production of 3-HP from biomass will simultaneously reduce toxic waste and substitute renewable feed stocks for non-renewable resources. In addition to the environmental benefits associated with bio-based production of 3-HP, if the production cost of the derived commodities is substantially reduced relative to petroleum-based production, this would make a biorefining industry not only environmentally beneficial but also a very attractive investment.
[0005] Previous attempts to produce 3-HP via biological pathways provide product titers which have been low and these processes have required the use of expensive, rich media. Both of these factors limit commercial feasibility and profitability. The use of rich media was necessary due to the toxicity of 3-HP when fermented with the more economical minimal media. For example, in wild type E. coli, metabolic activity is significantly inhibited at levels of 3-HP that are 5-10 times lower than the approximate 100 g/L titer needed for economic feasibility using the more economical minimal media. In fact, toxic effects have also been observed in rich media at product titers which are approximately two times lower than desired titers for commercial feasibility (Refer to FIG. 2). Further, the fermentative pathways reported by other investigators have not addressed and resolved the toxicity mechanisms of 3-HP to the host organisms. Further to issues related to commodity chemical production, which largely relies on petroleum-based starting materials, there is an increasing need to reduce the domestic usage of petroleum and natural gas. The numerous motivating factors for this increasing need include, but are not limited to: pollutant reduction (such as greenhouse gases), environmental protection, and reducing the dependence on foreign oil. These issues not only impact fuel markets, but also the markets of numerous other products that are currently derived from oil. Biorefining promises the development of efficient biological processes allowing for the conversion of renewable sources of carbon and energy into large volume commodity chemicals.
[0006] A biosynthetic route to 3-HP as a platform chemical would be of benefit to the public, not only in terms of reduced dependence on petroleum, but also by a reduction in the amount of pollutants that are generated by current non-biosynthetic processes. Because 3-HP is not currently used as a building block for the aforementioned commodity chemicals, technical hurdles must be surmounted to achieve low cost biological routes to 3-HP. These hurdles include the development of a new organism that not only has a metabolic pathway enabling the production of 3-HP, but is also tolerant to the toxic effects of 3-HP thus enabling the sustained production of 3-HP at economically desired levels.
[0007] There are numerous motivating factors to reduce the domestic usage of petroleum. These factors include, but are not limited to: 1) the negative environmental impacts of petroleum refining such as production of greenhouse gases and the emission of a wide variety of pollutants; 2) the national security issues that are associated with the current dependence on foreign oil such as price instability and future availability; and 3) the long term economic concerns with the ever-increasing price of crude oil. These issues not only impact fuel markets, but also the multi-billion dollar commodity petro-chemical market
[0008] One potential method to alleviate these issues is the implementation of bioprocessing for the conversion of renewable feed stocks (e.g. agricultural wastes) to large volume commodity chemicals. It has been estimated that such bioprocesses already account for 5% of the 1.2 trillion dollar US chemical market. Furthermore, some experts are projecting that up to 50% of the total US chemical market will ultimately be generated through biological means.
[0009] While the attractiveness of such bioprocesses has been recognized for some time, recent advances in biological engineering, including several bio-refining success stories, have accelerated interest in the large scale production of chemicals through biological routes. However, many challenges still remain for the economical bio-production of commodity chemicals. These challenges include the need to convert biomass into usable feed stocks, the engineering of microbes to produce relevant chemicals at high titers and productivities, the improvement of the microbes' tolerance to the desired product, and the need to minimize the generation of byproducts that might affect downstream processes. Finally, the product must be economically competitive in the marketplace.
[0010] The contributions of bioprocessing are expected to grow in the future as existing biological methods become more efficient and as new bioprocesses are developed. A recent analysis by the U.S. Department of Energy identified a list of the Top Value Added Chemicals from Biomass that are good candidates for biosynthetic production. Eight of the top value added chemicals were organic acids, including 3-hydroxypropionic acid (3-HP). As depicted in FIG. 1, 3-HP is considered to be a platform chemical, capable of yielding valuable derivative commodity chemicals including acrylic acid and acrylic acid polymers, acrylate esters, acrylate polymers (plastics), acrylamide, and 1,3-propanediol. Presently, these high value chemicals are produced from petroleum.
[0011] One method to efficiently generate 3-HP by a bioprocess approach would be the microbial biosynthesis of renewable biomass sugars to 3-HP. According to the DOE Report (Werpy, T.; Petersen, G. Volume 1: Results of Screening for Potential Candidates from Sugars and Synthetic Gas. Oak Ridge, Tenn., U.S. Department of Energy; 2004. Top Value Added Chemicals from Biomass), a number of factors will need to be addressed, including: identifying the appropriate biosynthetic pathway, improving the reactions to reduce other acid co-products, increasing microbial yields and productivities, reducing the unwanted salts, and scale-up and integration of the system. Additionally, as noted above, it is critical to engineer the microbial organism to be tolerant to the potential toxicity of the desired product at commercially significant concentrations.
[0012] The production of acrylic acid from 3-HP is of particular interest because of the high market value of acrylic acid and its numerous derivatives. In 2005, the estimated annual production capacity for acrylic acid was approximately 4.2 million metric tons, which places it among the top 25 organic chemical products. Also, this figure is increasing annually. The demand for acrylic acid may exceed $2 billion by 2010. The primary application of acrylic acid is the synthesis of acrylic esters, such as methyl, butyl or ethyl acrylate. When polymerized, these acrylates are ingredients in numerous consumer products, such as paints, coatings, plastics, adhesives, dispersives and binders for paper, textiles and leather. Acrylates account for 55% of the world demand for acrylic acid products, with butyl acrylate and ethyl acrylate having the highest production volumes. The other key use of the acrylic acid is through polymerization to polyacrylic acid, which is used in hygiene products, detergents, and waste water treatment chemicals. Acrylic acid polymers can also be converted into super absorbent materials (which account for 32% of worldwide acrylic acid demand) or developed into replacement materials for phosphates in detergents. Both of these are fast growing applications for acrylic acid.
[0013] Today, acrylic acid is made in a two step catalytic oxidation of propylene (a petroleum product) to acrolein, and acrolein to acrylic acid, using a molybdenum/vanadium based catalyst, with optimized yields of approximately 90%. It should be noted that several commercial manufacturers of acrylic acid are exploring the use of propane instead of propylene. The use of propane is projected to be more environmentally friendly by reducing energy consumption during production. However, propane is petroleum based, and while its use is a step in the right direction from an energy consumption standpoint, it does not offer the benefits afforded by the bioprocessing route.
[0014] In addition to acrylic acid, acrylates, and acrylic acid polymers, another emerging high value derivative of 3-HP is 1,3-propanediol (1,3-PD). 1,3-PD has recently been used in carpet fiber production for carpets. Further applications of 1,3-PD are expected to include cosmetics, liquid detergents, and anti-freeze. The market for 1,3-PD is expected to grow rapidly as it becomes more routinely used in commercial products.
[0015] Pursuing a cleaner, renewable carbon source route to commodity chemicals through 3-HP will require downstream optimization of the chemical reactions, depending on the desired end product. 3-HP production through bioprocesses directly, or through reaction routes to the high-value chemical derivatives of 3-HP will provide for large scale manufacture of acrylic acid, as well reduction of environmental pollution, the reduction in dependence on foreign oil, and the improvement in the domestic usage of clean methods of manufacturing. Furthermore, the products produced will be of the same quality but at a competitive cost and purity compared to the current petroleum based product.
[0016] Thus, notwithstanding various advances in the art, there remains a need for methods that identify and/or provide, and compositions directed to recombinant microorganisms that have improved 3-HP production capabilities, so that increased 3-HP titers are achieved.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 depicts how biomass derived 3-HP can serve as a chemical feedstock to many major chemical commodities worth billions of dollars. (Adapted from Werpy et al. US Dept. Energy, 2004).
[0018] FIG. 2 depicts 3-hydroxpropionate toxicity in E. coli K12. The minimum concentration of 3-HP that is required to inhibit visible growth after 24 hrs in minimal media is shown for wild type E. coli K12 grown in both minimal media and rich media which contains more complex nutrients.
[0019] FIG. 3 is an overview of SCALEs. (a) Genomic DNA is fragmented to several specific sizes and ligated into vectors creating libraries with defined insert sizes. (b) These libraries are individually transformed into the host cell line used for selections. (c) The pools of transformants are mixed and subjected to selection. Clones bearing inserts with increasing fitness in a given selection have a growth advantage. (d) Enriched plasmids are purified from the selected population, prepared for hybridization, and applied to a microarray. (e) The processed microarray signal is analyzed as a function of genomic sequence position. (f) A nonlinear multi-scale analysis decomposition gives signal not only as a function of position but as a function of scale or library size. (g) Data are visualized and analyzed as a function of genomic position and scale. (for the circular chromosome of E. coli shown, genomic position correlates to position around the circle and scale is represented by color. The height of the peak above the circle correlates to population frequency or fitness of a given scale at a given position.)
[0020] FIGS. 4A-4C-2 depict the SCALEs data identifying the chorismate superpathway as a 3-HP target. (A) Fitness data for positions and scales conferring increased fitness of E. coli in the presence of 3-HP. Genomic position correlates to position around the circle and scale is represented by color (red=500-1000 bp, yellow=1000-2000 bp, green=4000-8000 bp, blue=8000-10000 bp). The height of the peak above the circle correlates to the fitness of a given scale at a given position. Peaks corresponding to genes involved in the chorismate superpathway are numbered. (B) List of genes in the chorismate superpathway identified in (A). (C) The fitness of each gene identified in (A) is color coded and identified in the chorismate superpathway.
[0021] FIG. 5A This figure depicts the natural metabolic pathways utilize by E. coli during bio-production which results in the natural products lactate, formate and acetate FIG. 5B. The proposed metabolic pathway to produce 3-HP as a bio-production product. Arrows represent enzymatic activities. The non natural enzymatic function to be evolved in this Phase I project is colored in red. Enzyme activities are as follows [i] glucokinase, [ii] phosphoglucose isomerase, [iii] 6-phosphofructose kinase, [iv] fructose bisphosphate aldolase, [v] triose-phosphate isomerase, [vi] glyceraldehydes 3-phosphate dehydrogenase, [vii] phosphoglycerate kinase, [viii] phosphoglycerate mutase, [ix] enolase, [xi]pyruvate kinase, [xi] lactate dehydrogenase, [xii]pyruvate oxidase, [xiii]pyruvate-formate lyase, [xiv] phosphate acetyltransferase, [xv]acetate kinase, [xvi] phosphoenolpyruvate carboxykinase [xvii] the proposed oxaloacetate alpha-oxo decarboxylase, [xviii] 3-hydropxypropionate dehydrogenase and [xix] malonate semialdehyde dehydrogenase
[0022] FIG. 6 This figure depicts the chemical reaction performed by 2-oxo acid decarboxylases. R can be any group.
[0023] FIG. 7A This figure depicts the chemical reaction performed by alpha-ketoglutarate decarboxylase encoded by the kgd gene from M. tuberculosis. FIG. 7B depicts the proposed reaction performed by the newly evolved enzyme, oxaloacetate alpha-oxo-decarboxylase. The proposed enzyme will be encoded by the oad-2 gene which will be evolved by mutation from the kgd gene.
[0024] FIG. 8 This figure depicts an overview of the methods to select a diverse library of 2-oxo acid decarboxylases for oxaloacetate alpha-oxo-decarboxylase activity. [i] A natural2-oxo acid decarboxylase is mutated to create a variant library, [ii] this library is introduced into a microbial host that will not survive in a given environment without the presence of the product of the alpha-oxo-decarboxylase, malonate semialdehyde. [iii]. Positive mutants are identified by growth under selective conditions.
[0025] FIG. 9A depicts the proposed selection of the metabolism of E. coli strain NZN111 is shown in the left box. The pflB gene is disrupted blocking the formation of acetyl-coA in anaerobic conditions. The lack of acetyl-coA formation severely inhibits growth. The proposed additional enzymatic path to acetyl-coA is outlined in the right box. The characterized mmsA gene can supply acetyl-coA under anaerobic conditions if it is supplied with malonate semialdehyde by an oxaloacetate alpha-oxo decarboxylase. Kgd mutants with this activity will allow the strain to grow under anaerobic conditions.
[0026] FIG. 9B depicts the proposed selection of the relevant metabolism of E. coli strain AB354 is summarized in the left box. The panD gene is mutated blocking the synthesis of beta-alanine, an essential precursor for pantothenate (coA). The lack of pantothenate formation abolishes growth on minimal media. The proposed additional enzymatic path to beta-alanine is outlined in the right box. The characterized R. norvegicus beta-alanine aminotransferase gene (gab T) can supply beta-alanine if it is supplied with malonate semialdehyde as a substrate. An active oxaloacetate alpha-decarboxylase will supply this substrate and enable growth on minimal media. Kgd mutants with this activity will allow the strain to grow on minimal media.
[0027] FIG. 10A depicts the anticipated Selection Results of mutant colonies expressing the desired oxaloacetate alpha-oxo-decarboxylase will grow under anaerobic conditions when expressed in E. coli NZN111 expressing mmsA. No growth will be observed under these conditions in the E. coli NZN111, E. coli NZN111+mmsA controls. Or in mutants not expressing the desired activity.
[0028] FIG. 10B depicts the anticipated Selection Results of mutant colonies expressing the desired oxaloacetate alpha-decarboxylase will grow on minimal media when expressed in E. coli AB354 expressing gabT. No growth will be observed under these conditions in the E. coli AB354, E. coli AB354+gabT controls, or in kgd mutants not expressing the desired activity.
[0029] FIG. 11 depicts the screening Protocol. Purified enzyme will be mixed in vitro with the appropriate substrate and reagents. A) The control reaction for the native alpha-ketoglutarate decarboxylase. B) Predicted results for the native alpha-ketoglutarate decarboxylase with oxaloacetate as a substrate. C) Predicted results for kgd mutants, both positive and negative, for oxaloacetate alpha-decarboxylase activity.
[0030] FIG. 12 Expression and Purification results of pKK223-Cterm-5×His-kgd (`5×His` disclosed as SEQ ID NO: 24). Lane 1=marker; lane 2=uninduced culture; lane 3=induced culture; lane 4=native lysate; lane 5=flowthrough; lane 6=first wash (wash 1); lane 7=last wash (wash 3); lane 8=first elution; lane 9=second elution, purified kg; lane 10=pelleted cell debris. The arrow points to the band comprising purified alpha-ketoglutarate decarboxylase.
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
[0031] Generally the invention is directed to compositions and methods for production of target chemical compounds in an organism. Various aspects of the invention are directed to providing altered/modified proteins having different enzymatic activity/function as compared to the unaltered protein. Further aspects, of the invention are directed to recombinant organisms comprising altered/modified pathways which are enhanced for production of a target compound (e.g., 3-HP). In some embodiments, a recombinant organism of the invention is a microorganism or algae. In further embodiments, a recombinant organism is a bacterium (e.g., E. coli). In one aspect of the invention, an organism is modified to include one or more genes encoding a protein involved in biosynthesis to enhance production of a target chemical compound (e.g., 3-HP). In further embodiments, such one or more genes encode one or more proteins which enhance the capability of the organism to produce a target chemical compound in culture. In one embodiment, such a chemical compound is 3-HP. In yet a further embodiment, the organism comprises at least one recombinant gene resulting in pyruvate, oxalocetate and acetyl-coA production without committed formate production.
[0032] In another embodiment, the recombinant organism comprises acetyl-coA that is produced via the intermediate malonate semialdehyde. In yet another embodiment, acetyl-coA is produced via the intermediate pyruvate through pyruvate synthase.
[0033] Another aspect of the invention is directed to a method for producing 3-HP comprising growing a recombinant organism of the invention, where the organism comprises an enzyme which converts oxaloacetate to malonate semialdehyde. In further embodiments, the recombinant organism is engineered to delete or substantially reduce activity of one or more genes, where the gene(s) include but are not limited to pfkA, pfkB, ldhA, pta, poxB, pflB or a combination thereof. In yet a further embodiment, the recombinant organism is modified to enhance the activity (such as by increasing expression or improving the relevant functioning) of one or more enzymes including but not limited to pck, mmsA, mmsB, oad-2, homologs thereof, or any combination thereof.
[0034] In one embodiment, a method is provided for producing 3-HP comprising growing an organism under a condition which enhance said 3-HP production, wherein said condition is selected from acetyl-coA production via malonate semialdehyde, acetyal-coA production via pyruvate by pyrvuate synthase, without committed production of formate, homologs thereof and any combination thereof.
[0035] In a further aspect of the invention a recombinant microorganism is provided capable of producing 3-HP at quantities greater than about 10, 15, 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140 145 or 150 g/L. In one embodiment, the recombinant organism is capable of producing 3-HP from about 30 to about 100 g/L of biomass/culture.
[0036] In a further aspect of the invention, a bio-production mixture is provided for producing 3HP, said mixture comprising a recombinant microorganism; one or more products selected from a group consisting tyrosine, phenylalanine, para-aminobenzoate, para-hydroxy-benzoate, 2,3,-dihydrobenzoate and shikimate.
[0037] In further embodiments, the mixture comprises a microorganism which is engineered to produce pck, mmsA, mmsB, oad-2, homologs thereof, or a combination thereof. In further embodiments, the microorganism does not produce enzymes selected from a group consisting of pfkA, pfkB, ldhA, pta, poxB, pflB, homologs thereof and a combination thereof. In various embodiments, the microorganism is E. coli.
[0038] In one aspect of the invention, an isolated polypeptide is provided possessing oxaloacetate alpha oxo-decarboxylase activity, converting oxaloacetate to malonate semialdehyde. Furthermore, a nucleic acid encoding the polypeptide is provided. In yet a further embodiments, a functional variant for the polypeptide or nucleic acid sequence is provided which is homologous to the reference polypeptide and/or nucleic acid and functions as an oxaloacetate alpha oxo-decarboxylase. In some embodiments such a functional variant has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96, 97, 98, or 99% identity with alpha-ketoglutarate decarboxylase.
[0039] Accordingly, in various aspects of the invention improved methods for biomass production of 3-HP at higher concentrations are disclosed. With this development, it is feasible to construct E. coli strains that are highly tolerant to 3-HP and that will maintain robust metabolic activity in the presence of higher concentrations of 3-HP. In various embodiments, metabolic pathways which support the bio-production of 3-HP are manipulated to increase 3-HP production. In some embodiments, such metabolic pathways do not rely upon or are not affected by metabolic processes that are themselves inhibited by 3-HP.
[0040] Utilizing processes for identification of a 3-HP insensitive bio-production pathway (infra, under "Metabolic Toxicity of 3-HP"), in various embodiments of the invention a bio-production pathway is characterized for the synthesis of 3-HP in E. coli. In a further embodiment, an altered 2-oxo acid decarboxylase is utilized in a bio-production pathway to produce 3-HP. In yet further embodiments, a bio-production pathway is utilized incorporating previously characterized and sequenced enzymes that have been reported in the literature, as discussed below under "Previously Characterized Enzymes".
[0041] In various embodiments, a bio-production pathway (shown in FIG. 6) relies directly or indirectly on the metabolite oxaloacetate through the intermediate malonate semialdehyde. The desired enzymatic activity carries out the conversion of oxaloacetate to malonate semialdehyde. This can be accomplished via a decarboxylation reaction not previously reported by a particular enzyme. More specifically, the decarboxylation of 2-oxo acids, such as oxaloacetate, is accomplished by a well understood set of thiamine pyrophosphate dependant decarboxylases, including pyruvate decarboxylases and branched chain 2-oxo acid decarboxylases. A more recently characterized enzyme from M. tuberculosis, alpha ketoglutarate decarboxylase, coded by the kgd gene, possesses catalytic activity with a primary substrate very similar to oxaloacetate, decarboxylating the metabolite alpha-ketoglutarate to succinate semialdehyde. As described in greater detail below, an alpha-ketoglutarate decarboxylase from M. tuberculosis is modified into an oxaloacetate alpha-oxo-decarboxylase or a functional variant thereof. In various embodiments, any 2-oxo acid decarboxylase including but not limited to pyruvate decarboxylases form various sources or branched chain 2-oxo acid decarboxylases are modified into an oxaloacetate alpha-oxo decarboxylase or a functional variant thereof. In various embodiments, a "functional variant" is a protein encoded by a sequence having about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99 percent identity with the nucleic acid sequence encoding the modified/altered oxaloacetate alpha-oxo-decarboxylase. In further embodiments, sequence identity can be on the amino acid sequence level, where a functional variant has a sequence identity with the reference sequence of about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99. For example, a functional variant can have sequence identity that is 90 percent, or 95 percent, but where the enzyme still functions as an oxaloacetate alpha-oxo-decarboxylase when expressed in an organism (e.g., microorganism, algae, plant), such as E. coli.
[0042] In other embodiments, a microorganism or algae is engineered to follow a preferred 3-HP bio-production pathway and also to enhance tolerance to 3-HP production at commercially viable levels. In some such embodiments, the microorganism is a bacterium, such as E. coli. Thus, as one example an E. coli strain is constructed and optimized for a desired pathway as discussed herein, wherein enhanced tolerance to 3-HP also is established so as to produce commercially viable titers of product. Accordingly, it is within the conception of the present invention that its teachings, methods and compositions may be combined with other teachings, methods and compositions more specifically directed to 3-HP tolerance improvement, including co-owned and/or licensed inventions.
Metabolic Toxicity of 3-HP
[0043] Severe growth inhibition has been observed for extracellular 3-HP levels as low as 10 g/L in minimal media (pH 7.0), which limits the economic feasibility of 3-HP production as a platform chemical. FIG. 2 demonstrates the toxic affects of 3-HP on E. coli when grown in minimal media. These toxic effects have been observed to be far greater when the strains are grown in minimal media as compared to growth in rich media (containing a mixture of all nutrients, amino acids and vitamins). However toxicity at levels below required titers (100 g/L) are still observed in rich media. These data alone indicate that 3-HP may be exerting toxic effects by suppressing central metabolic pathways essential to amino acid metabolism.
Diagnosis of 3-HP Toxicity Mechanisms
[0044] To better understand the toxic effects of 3-HP on E. coli, a genome-wide technology is used (multi-Scale Analysis of Library Enrichments (SCALEs)), such as disclosed in U.S. Patent Application Publication No. 20060084098, with related inventions described in U.S. Patent Application Publication Nos. 20080103060 and 200702185333 (the latter entitled "Enhanced Alcohol Tolerant Microorganism and Methods of Use Thereof,) published Sep. 20, 2007), which are incorporated by reference herein in their entirety for their respective teachings of methods that provide important information which may be analyzed to make a discovery of previously unappreciated metabolic relationships. An overview of the SCALES approach as well as sample data are depicted in FIG. 3.
[0045] This genome-wide approach allows identification of numerous genetic changes that can reduce the toxic effects of 3-HP. The results of our studies (shown in FIG. 4) identified hundreds of genes and other genetic elements that when at increased copy confer varying levels of tolerance to the presence of 3-HP in E. coli. When applied alone, these genetic changes may allow for small increases in tolerance; but when applied together they allow for insight into the 3-HP toxicity mechanisms. By grouping genetic elements that confer tolerance by their metabolic roles key metabolic pathways that are inhibited by 3-HP were identified.
[0046] The data shown in FIG. 4 depict identification of the chorismate superpathway as a target of 3-HP toxicity. In some embodiments, toxicity is alleviated by several processes. For example, the addition of the downstream products of branches of the chorismate superpathway, tyrosine, phenylalanine, para-aminobenzoate (a tetrahydrofolate precursor), para-hydroxy-benzoate (a precursor of ubiquinone) and 2,3-dihydroxybenzoate (an enterobactin precursor) all alleviate toxicity to a degree.
A 3-HP bio-Production Pathway
[0047] The genetic modifications conferring a 3-HP tolerant phenotype can enhance a 3-HP bio-production process utilizing E. coli. In addition, the mechanisms identified indicate that several current pathways under consideration for the production of 3-HP may not be viable routes at high levels of production
[0048] In various embodiments, a bio-production pathway is utilized which uses one or more metabolic pathways not negatively affected by 3-HP. Therefore, in some embodiments one or more traditional fermentation pathways in E. coli as well as pathways involving amino acid intermediates that are currently being explored by others [9,10] are bypassed in order to enhance production. In certain embodiments, a pathway to produce 3-HP is that depicted in FIG. 5. Also, one or more gene deletions in E. coli are effectuated as well as the expression of several enzymatic functions new to E. coli. In some embodiments, the one or more gene deletions are selected genes including but not limited to gene(s) encoding pyruvate kinase (pfkA and pfkB), lactate dehydrogenase (ldhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB) and pyruvate-formate lyase (pflB) enzymes. In further embodiments, any of the one or more deletions in the preceding are combined with one or more enzyme modifications, where the enzymes include but are not limited to phosphoenolpyruvate carboxykinase (pck), malonate semialdehyde dehydrogenase A (mmsA), malonate semialdehyde dehydrogenase B (mmsB) and oxaloacetate alpha-oxo-decarboxylase (oad-2) enzymes are expressed. It should be understood that the term "deletion" in this context does not necessarily require an entire gene deletion, but rather, a modification sufficient to knock out or effectively reduce function.
[0049] The enzymatic activity (oxaloacetate alpha-oxo-decarboxylase) utilized in the proposed pathway has not been reported in the known scientific literature. The enzyme oxaloacetate alpha-oxo-decarboxylase enhances 3-HP production.
[0050] In various embodiments, a pathway having features valuable for bio-production of organic acids in general and can be viewed as a metabolic starting point for numerous other products and in various different organisms (e.g., bacteria, yeast, algae). In various embodiments, such a pathway enhancer allows intracellular production of the key intermediate acetyl-coA without the committed production of the fermentative byproduct formate normally produced in microorganisms (e.g., E. coli) with acetyl-coA under fermentative conditions.
Previously Characterized Enzymes
[0051] In various embodiments, an engineered pathway of the invention comprises several genetic modifications to wild type microorganisms (e.g., E. coli), in addition to the expression of the oxaloacetate alpha-oxo decarboxylase. For example, one or more mutations in a microorganism (e.g., E. coli) can include but not limited to genes: pykA, pykF, ldhA, pflB, pta and poxB genes. Standard methodologies can be used to generate these gene deletions and such methods are routine in the art (See, for example, Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third Edition 2001 (volumes 1-3), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., hereinafter "Sambrook and Russell").
[0052] In addition to these one or more genetic deletions, the following enzymatic activities can be expressed to enhance 3-HP production (e.g., in E. coli): phosphoenolpyruvate carboxykinase and malonate semialdehyde dehydrogenase. In a further embodiment, the mmsA gene is expressed (e.g., mmsA from Rattus norvegicus which has been shown to possess malonate semialdehyde dehydrogenase activity and converts malonate semialdehyde to acetyl-coA). In yet a further embodiment, the mmsB gene is expressed (e.g., mmsB gene from Pseudomonas aeruginosa which has been shown to have 3-hydropxypropionate dehydrogenase activity). In another further embodiment, a GDP dependant phosphoenolpyruvate carboxykinase is expressed (e.g., gene from Alcaligenes eutrophus which has been characterized with kinetics favoring the desired direction producing oxaloacetate). Any genes disclosed herein can be readily synthesized using standard methodologies.
2-Oxo Acid Decarboxylases.
[0053] Several 2-oxo decarboxylases (also referred to as 2-keto acid decarboxylases, alpha-oxo decarboxylases, or alpha-keto acid decarboxylases) with a broad substrate range have been previously characterized, including several pyruvate and branched chain 2-keto-acid decarboxylases. In various embodiments, enzymes from this class of decarboxylases are utilized. The reaction carried out by these enzymes is depicted in FIG. 6. Of additional interest is that a convenient colorimetric method has been developed to assay this enzymatic activity by detection of the products of this enzyme class which are all aldehydes. In one embodiment, a previously characterized enzyme, alpha ketoglutarate decarboxylase, encoded by the kgd gene from Mycobacterium tuberculosis is used. The enzymatic reaction performed by this enzyme is depicted in FIG. 7A, which is very similar to the desired enzymatic activity, the decarboxylation of oxaloacetate to malonate semialdehyde depicted in FIG. 7B.
Altered Enzyme Activity
[0054] In one embodiment, clones comprising enhanced oxaloacetate alpha-oxo-decarboxylase activity are obtained by mutation of a gene encoding an enzyme having a similar catalytic activity, namely 2-oxo acid decarboxylases. For example, mutant libraries of a 2-oxo acid decarboxylase gene are constructed. Oxaloacetate alpha-oxo-decarboxylase activity is selected from a mutant library of a 2-oxo acid decarboxylase genes and in one embodiment from a mutant library of the kgd gene encoding an alpha-ketoglutarate decarboxylase. In further embodiments, mutant genes encoding enzymes that modulate or enhance the desired activity are identified.
Overview
[0055] To obtain the desired altered enzyme, a mutant library of a 2-oxo acid decarboxylase gene is constructed, which will be used for selections. In various embodiments, various 2-oxo acid decarboxylase genes are cloned into an appropriate expression system for E. coli. Several 2-keto acid decarboxylases with a broad substrate range have been previously characterized (Pohl, M., Sprenger, G. A., Muller, M., A new perspective on thiamine catalysis. Current Opinion in Biotechnology, 15(4), 335-342 (2004)). Of particular interest is an enzyme from M. tuberculosis, alpha-ketoglutarate decarboxylase, kgd, which has been purified and characterized (Tian, J Bryk, R. ltoh, M., Suematsu, M., and Carl Nathan, C. Variant tricarboxylic acid cycle in Mycobacterium tuberculosis: Identification of alpha-ketoglutarate decarboxylase. PNAS. Jul. 26, 2005 vol. 102(30): 10670-10677; Stephanopoulos, G., Challenges in engineering microbes forbiofuels production. Science, 2007. 315(5813):801-804). Numerous 2-oxo acid decarboxylase genes are known in the art, including but limited to pyruvate decarboxylases from several sources, branched-chain 2-keto acid decarboxylases from various sources, benzylformate decarboxylases from various sources and phenylpyruvate decarboxylases from several sources (refer to www.metacyc.org for a more complete list). In one embodiment, the kgd gene, encoding and alpha-ketoglutarate decarboxylase from M. tuberculosis is cloned into an appropriate expression system for E. coli. Subsequently, this expression clone is mutated to create a library of mutant clones.
Cloning an 2-Oxo Acid Decarboxylase Gene
[0056] Cloning and expression of any 2 oxo-acid decarboxylase gene including but limited to the kgd gene is performed via gene synthesis supplied from a commercial supplier using standard or conventional techniques. Therefore, no culturing or manipulating of M. tuberculosis is required in the case of kgd. In addition, gene synthesis allows for codon optimization for a particular host. Once obtained using standard methodology, the gene is cloned into an expression system using standard techniques.
Construction of a 2-Oxo Acid Decarboxylase Gene Library
[0057] The plasmid containing the cloned 2-oxo acid decarboxylase gene, including but limited to the kgd gene is mutated by standard methods resulting in a large library of mutants. Generally, any of a number of well-known standard methods may be used (See, for example, chapters 1-19 of Directed Evolution Library Creation Methods and Protocols, F. H. Arnold & G. Georgiou, Eds., Methods in Molecular Biology, Vol. 231, Humana Press (2003)). The mutant sequences are introduced into a new host cell line, generating a final library for subsequent selection.
Selection of Altered Activity
[0058] A selection based approach such as described herein can result in the rapid identification of a t-oxo acid decarboxylase mutant with oxaloacetate alpha-oxo-decarboxylase activity. In one example, an available strain of E. coli, strain NZN111 is utilized as a host for the selection. This E. coli strain has deletions in both the ldhA and pflB genes resulting in severely limited growth (-10 hr doubling time) under anaerobic conditions (See right side of FIG. 5). This growth limitation is due in part to the inability to produce the necessary metabolite acetyl-coA under these conditions. (See FIG. 9A below.) A strain of E. coli NZN111 expressing mmsA (E. coli NZN111+mmsA) in addition to a mutant 2-oxo acid decarboxylase gene, including but limited to the kgd gene, having oxaloacetate alpha-oxo-decarboxylase activity is capable of producing the metabolite acetyl-coA from the metabolic intermediate malonate semialdehyde in media supplemented with tartrate (tartate can be used as a supplement and is readily converted to oxaloacetate in E. coli.). This proposed strain has increased growth under anaerobic conditions when compared to both E. coli NZN111 and E. coli NZN11+mmsA, controls. For example, such a selection is depicted in FIG. 10A. In one embodiment, E. coli NZN111 is constructed to express an acetylating malonate semialdehyde dehydrogenase.
[0059] Similar to the 2-oxo acid decarboxylase gene, an acetylating malonate semialdehyde dehydrogenase gene, including but not limited to mmsA, from Pseudomonas aeruginosa PAOJ, is obtained via gene synthesis from the commercial provider. It is subsequently be cloned into an expression plasmid.
[0060] In another example, an available strain of E. coli, strain AB354 is utilized as a host for the selection. This E. coli strain has a mutation in the panD genes resulting in severely limited growth in minimal media conditions, without the supplementation of beta-alanine (See right side of FIG. 5). This growth limitation is due to the inability to produce beta-alanine under these conditions. (See FIG. 9B below.) A strain of E. coli AB354 expressing a beta alanine aminotransferase (E. coli AB354+beta alanine aminotransferase) in addition to a mutant 2-oxo acid decarboxylase gene, including but limited to the kgd gene, having oxaloacetate alpha-oxo-decarboxylase activity is capable of producing the metabolite beta-alanine from the metabolic intermediate malonate semialdehyde in minimal media. This proposed strain has a recovered ability to grow in minimal media with supplementation of beta-alanine. For example, such a selection is depicted in FIG. 10B. In one embodiment, E. coli AB354 is constructed to express a beta-alanine pyruvate aminotransferase.
[0061] Similar to the 2-oxo acid decarboxylase gene, a beta-alanine pyruvate aminotransferase gene, including but not limited to PA0132 from Pseudomonas aeruginosa PAOJ, is obtained via gene synthesis from the commercial provider. It is subsequently be cloned into an expression plasmid.
Selection of Oxaloacetate Alpha-Oxo-Decarboxylase Activity
[0062] The mutant library of kgd genes is introduced into E. coli strain NZN111 expressing the mmsA gene. This population is grown under anaerobic conditions in media supplemented with oxaloacetate. Individual mutants expressing the desired oxaloacetate alpha-oxo-decarboxylase activity show increased growth rates compared to the control strains. These clones are isolated and the mutant protein they express subsequently screened for oxaloacetate alpha-oxo-decarboxylase activity as described above.
Colorimetric Confirmation of Decarboxylase Activity
[0063] A colorimetric approach is taken from current standard methodologies. This approach necessitates the expression and purification of the mutant enzymes and reaction with the purified enzyme, its cofactor (thiamin pyrophosphate) and the appropriate substrate. Protein expression and purification are performed with standard methodologies.
[0064] The above description of an approach using NZN111 is meant to be exemplary and not limiting. Its teachings may be applied to other microorganism systems to achieve the desired results. For example, and also not meant to be limiting, use of metabolic features of another E. coli strain, AB354, is explained in some of the examples below.
Examples Section
[0065] The following examples disclose specific methods for providing an E. coli cell with heterologous nucleic acid sequences that encode for enzymes or other polypeptides that confer increased tolerance to 3-HP. Where there is a method to achieve a certain result that is commonly practiced in two or more specific examples (or for other reasons), that method may be provided in a separate Common Methods section that follows the examples. Each such common method is incorporated by reference into the respective specific example that so refers to it. Also, where supplier information is not complete in a particular example, additional manufacturer information may be found in a separate Summary of Suppliers section that may also include product code, catalog number, or other information. This information is intended to be incorporated in respective specific examples that refer to such supplier and/or product. In the following examples, efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless indicated otherwise, temperature is in degrees Celsius and pressure is at or near atmospheric pressure at approximately 5340 feet (1628 meters) above sea level. It is noted that work done at external analytical and synthetic facilities was not conducted at or near atmospheric pressure at approximately 5340 feet (1628 meters) above sea level. All reagents, unless otherwise indicated, were obtained commercially.
[0066] The meaning of abbreviations is as follows: "C" means Celsius or degrees Celsius, as is clear from its usage, "s" means second(s), "min" means minute(s), "h," "hr," or "hrs" means hour(s), "psi" means pounds per square inch, "nm" means nanometers, "d" means day(s), "μ.LL" or "uL" or "ul" means microliter(s), "mL" means milliliter(s), "L" means liter(s), "mm" means millimeter(s), "nm" means nanometers, "mM" means millimolar, "μ.LM" or "uM" means micromolar, "M" means molar, "mmol" means millimole(s), "flmol" or "uMol" means micromole(s)", "g" means gram(s), "μ.Lg" or "ug" means microgram(s) and "ng" means nanogram(s), "PCR" means polymerase chain reaction, "OD" means optical density, "OD600" means the optical density measured at a wavelength of 600 nm, "kDa" means kilodaltons, "g" means the gravitation constant, "bp" means base pair(s), "kbp" means kilobase pair(s), "% w/v" means weight/volume percent, % v/v'' means volume/volume percent, "IPTG" means is opropyl-μ.L-D-thiogalactopyranoiside, "RBS" means ribosome binding site, "rpm" means revolutions per minute, "HPLC" means high performance liquid chromatography, and "GC" means gas chromatography. Also, 10 5 and the like are taken to mean 105 and the like.
Example 1
Development of a Plasmid Comprising Kgd
[0067] The nucleic acid sequence for the alpha-ketoglutarate decarboxylase (kgd) from M. tuberculosis was codon optimized for E. coli according to a service from DNA 2.0 (Menlo Park, Calif. USA), a commercial DNA gene synthesis provider. The nucleic acid sequence was synthesized with an eight amino acid N-terminal tag to enable affinity based protein purification. This nucleic acid sequence incorporated an Nco1 restriction site overlapping the gene start codon and was followed by a HindIII restriction site. In addition a Shine Delgarno sequence (i.e., a ribosomal binding site) was placed in front of the start codon preceded by an Ecor1 restriction site. This codon optimized kgd nucleic acid sequence construct (SEQ ID NO: 1), which is designed to encode for the native kgd protein (SEQ ID NO: 2) was synthesized by DNA 2.0 and then provided in a pJ206 vector backbone (SEQ ID NO: 3).
[0068] A circular plasmid based cloning vector termed pKK223-kgd for expression of the alpha-ketoglutarate decarboxylase in E. coli was constructed as follows. The kgd gene in the pJ206 vector was amplified via a polymerase chain reaction with the forward primer being TTTTTTTGTATACCATGGATCGTAAATTTCGTGATGATC (SEQ ID NO: 4) containing a Nco1 site that incorporates the start methionine for the protein sequence, and the reverse primer being CCCGGTGAGATCTAGATCCGAACGCTTCGTCCAAGATTTCTT (SEQ ID NO: 5) containing a Xba1 site and a Bg111 site that replaces the stop codon of the kgd gene with an in-30 frame protein linker sequence SRS. Also, these primers effectively removed the eight amino acid N-terminal tag. The amplified kgd nucleic acid sequence was subjected to enzymatic restriction digestion with the enzymes Nco1 and Bg111 obtained from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture was separated by agarose gel electrophoresis, and visualized under UV transillumination as described in Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the amplified kgd nucleic acid sequence was cut from the gel and the DNA recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions.
[0069] An E. coli cloning strain bearing pKK223-3 was grown by standard methodologies and plasmid DNA was prepared by a commercial miniprep column from Qiagen.
[0070] A new DNA vector was created by amplifying a pKK223-3 template by polymerase chain reaction with a forward primer being CGGATCTAGATCTCACCATCACCACCATTAGTCGACCTGCAGCCAAG(SEQ ID NO: 6) and a reverse primer being TGAGATCTAGATCCGTTATGTCCCATGGTTCTGTTTCCTGTGTG (SEQ ID NO: 7). The product was prepared by a commercial PCR-purification column from Qiagen. Both primers contain Xba1 restriction sites that allowed for the linear polymerase chain reaction product to be circularized after restriction digestion with Xba1 with enzymes obtained from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions, and subsequent self-ligation. The new vector, named pKK223-ct-his (SEQ ID NO: 8), contained a multiple cloning region containing the a protein coding cassette under control of a IPTG-inducible promoter with an Nco1 site that incorporate the start methionine and with a Xba1 site and a Bglii site that code for the in-frame protein sequence SRSHHHHH (SEQ ID NO: 9), a multi-histidine tag that allows for metal-affinity protein purification of the expressed protein.
[0071] To insert the gene of interest, kgd, this vector was prepared by restriction digestion with the enzymes Nco1 and Bg111 obtained from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture was separated by agarose gel electrophoresis, and visualized under UV transillumination as described under Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the amplified kgd gene product was cut from the gel and the DNA recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions. Pieces of purified DNA corresponding to the amplified kgd gene product and the pKK223-cterm-5×his vector backbone (`5×his` disclosed as SEQ ID NO: 24) were ligated and the ligation product was transformed and electroporated according to manufacturer's instructions. The sequence of the resulting vector, termed pKK223-cterm-5×his-kgd (SEQ ID NO: 10, and simply pKK223-kgd such as in the electronic sequence listing, `5×his` disclosed as SEQ ID NO: 24), was confirmed by routine sequencing performed by the commercial service provided by Macrogen (USA). pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) confers resistance to beta-lactamase and contains the kgd gene of M. tuberculosis under control of a ptac promoter inducible in E. coli hosts by IPTG.
Example 2
Development of a Plasmid Comprising Mer (Partial Prophetic)
[0072] The nucleic acid sequence for the malonyl-coA reductase gene (mer) from Chloroflexus auranticus was codon optimized for E. coli according to a service from DNA 2.0 (Menlo Park, Calif. USA), a commercial DNA gene synthesis provider. Attached and extending beyond the ends of this codon optimized mer nucleic acid sequence (SEQ ID NO: 11) were an EcoRI restriction site before the start codon and a Hind111 restriction site. In addition a Shine Delgamo sequence (i.e., a ribosomal binding site) was placed in front of the start codon preceded by an EcoRI restriction site. This gene construct was synthesized by DNA 2.0 and provided in a pJ206 vector backbone.
[0073] A circular plasmid based cloning vector termed pKK223-mcr for expression of the malonyl-CoA reductase in E. coli was constructed as follows. The mer gene in the pJ206 vector was amplified via a polymerase chain reaction with the forward primer being TCGTACCAACCATGGCCGGTACGGGTCGTTTGGCTGGTAAAATTG (SEQ ID NO: 12) containing a Nco1 site that incorporates the start methionine for the protein sequence, and the reverse primer being CGGTGTGAGATCTAGATCCGACGGTAATCGCACGACCGCGGT ID NO: 13) containing a Xba1 site and a Bg111 site that replaces the stop codon of the mcr gene with an in-frame protein linker sequence SRS. The amplified mer nucleic acid sequence was subjected to enzymatic restriction digestion with the enzymes Nco1 and Xba1 obtained from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture was separated by agarose gel electrophoresis, and visualized under UV transillumination as described under Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the amplified mer nucleic acid sequence was cut from the gel and the DNA recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions.
[0074] An E. coli cloning strain bearing pKK223-3 was grown by standard methodologies and plasmid DNA was prepared by a commercial miniprep column from Qiagen.
[0075] As described in Example 1 above, a new DNA vector was created by amplifying a pKK223-3 template by polymerase chain reaction with a forward primer being CGGATCTAGATCTCACCATCACCACCATTAGTCGACCTGCAGCCAAG (SEQ JD NO: 6) and a reverse primer being TGAGATCTAGATCCGTTATGTCCCATGGTTCTGTTTCCTGTGTG (SEQ ID NO: 7). The product was prepared by a commercial PCR-purification column from Qiagen. Both primers contain Xba1 restriction sites that allowed for the linear polymerase chain reaction product to be circularized after restriction digestion with Xba1 and subsequent self-ligation with enzymes obtained from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The vector, named pKK223-ct-his (SEQ ID NO: 8), contained a multiple cloning region containing the a protein coding cassette under control of a IPTG-inducible promoter with an Nco1 site that incorporates the start methionine and with a Xba1 site and a Bg111 site that codes for the in-frame protein sequence SRSHHHHH (SEQ ID NO: 9). The latter multi-histidine sequence allows for metal-affinity protein purification of the expressed protein.
[0076] To insert the gene of interest, mer, this vector was prepared by restriction digestion with the enzymes Nco1 and Xba1 obtained from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture was separated by agarose gel electrophoresis, and visualized under UV transillumination as described under Subsection II of the Common Methods Section.
[0077] Pieces of purified DNA corresponding to the amplified codon optimized mer nucleic acid sequence and the pKK223-ct-his vector backbone were ligated and the ligation product was transformed and electroporated according to manufacturer's instructions. The sequence of the resulting vector termed pKK223-mcr (SEQ ID NO: 14) is confirmed by routine sequencing performed by the commercial service provided by Macrogen(USA). pKK223-mcr confers resistance to beta-lactamase and contains the mer gene of M. tuberculosis under control of a ptac promoter inducible in E. coli hosts by IPTG.
Example 3
Development of a Plasmid Comprising a Beta Alanine-Pyruvate Aminotransferase Gene (Prophetic)
[0078] Introduction of a gene, such as the beta alanine pyruvate aminotransferase gene, into bacterial cells requires the addition of transcriptional (promoters) and translational (ribosome binding site) elements for controlled expression and production of proteins encoded by the gene. A nucleic acid sequence for a gene, whether obtained by gene synthesis or by amplification by polymerase chain reaction from genomic sources, can be ligated to nucleic acid sequences defining these transcriptional and translational elements. The present example discloses the addition of an E. coli minimal promoter and ribosome binding site properly oriented in the nucleic acid sequence before a gene of interest.
[0079] The beta alanine pyruvate aminotransferase gene from Pseudomonas aeruginosa PAO1 (locus_tag="PA0132") is amplified by polymerase chain reaction from a genomic DNA template with the forward primer being GGGTTTCCATGGACCAGCCGCTCAACGTGG (SEQ ID NO: 15) and the reverse primer being GGGTTTTCAGGCGATGCCGTTGAGCGCTTCGCC (SEQ ID NO: 16). The forward primer incorporates an Nco1 restriction site at the start methionine codon of the gene and the reverse primer includes a stop codon for the gene. The amplified nucleic acid sequence is subjected to enzymatic restriction digestion with the restriction enzyme Nco1 from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture is separated by agarose gel electrophoresis, and is visualized under UV transillumination as described under Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the restricted nucleic acid sequence is cut from the gel and the DNA is recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions. An E. coli tpiA promoter and ribosome binding site is produced by polymerase chain reaction using a forward primer GGGAACGGCGGGGAAAAACAAACGTT (SEQ ID NO: 17) and a reverse primer GGTCCATGGTAATTCTCCACGCTTATAAGC (SEQ ID NO: 18). Using genomic E. Coli K12 DNA as the template, a PCR reaction was conducted using these primers.
[0080] The forward primer is complimentary to the nucleic acid sequence upstream of the minimal tpiA promoter region (SEQ ID NO: 19), which is the minimal promoter sequence of the E. coli K12 tpi gene. The reverse primer is located just downstream of the minimal promoter region and includes an NcoI restriction site at the location of the start methionine and also includes a ribosome binding site. The PCR-amplified nucleic acid sequence is subjected to enzymatic restriction digestion with the restriction enzyme Nco1 from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture is separated by agarose gel electrophoresis, and is visualized under UV transillumination as described in Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the restricted nucleic acid sequence is cut from the gel and the DNA is recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions. The restricted, purified nucleic acid piece containing the transcriptional and translational elements is ligated to the recovered DNA containing the gene of interest. The ligation product is used as a template for a subsequent polymerase chain reaction using the forward primer GGGAACGGCGGGGAAAAACAAACGTT (SEQ ID NO: 20). Alternatively, any other forward primer may be use so long as it includes sufficient nucleic acid sequences upstream of the minimal tpiA promoter sequence (SEQ ID NO: 19). In the present specific example, the reverse primer is GGGTTTTCAGGCGATGCCGTTGAGCGCTTCGCC (SEQ ID NO: 21). The amplified nucleic acid product is separated by agarose gel electrophoresis, and is visualized under UV transillumination as described in Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the restricted nucleic acid sequence is cut from the gel and the DNA is recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions.
[0081] The resulting nucleic acid piece then is ligated into a suitable plasmid or other vector or transposon or other system, for example pSMART (Lucigen Corp, Middleton, Wis., USA), StrataClone (Stratagene, La Jolla, Calif., USA) or pCR2.1-TOPO TA (Invitrogen Corp, Carlsbad, Calif., USA) according to manufacturer's instructions. These methods also are described in the Subsection II of the Common Methods Section. Accordingly, the resulting nucleic acid piece can be restriction digested and purified andre-ligated into any other vector as is standard in the art. A similar method can be used to combine any gene with any transcriptional and translational elements with variation of restriction sites and primers.
[0082] The resulting nucleic acid is cloned using standard methodologies into the multiple cloning site of plasmid pBT-3, resulting in pBT-3-BAAT. This plasmid expresses the beta-alanine aminotransferase has a replicon compatible with pKK223 based vectors and confers chloramphenicol resistance.
Example 4
Development of a Plasmid Comprising an Acetylating Malonate Semialdehyde Dehydrogenase (Prophetic)
[0083] Introduction of a gene, such as an acetylating malonate semialdehyde dehydrogenase gene, into bacterial cells requires the addition of transcriptional (promoters) and translational (ribosome binding site) elements for controlled expression and production of proteins encoded by the gene. A nucleic acid sequence for a gene, whether obtained by gene synthesis or by amplification by polymerase chain reaction from genomic sources, can be ligated to nucleic acid sequences defining these transcriptional and translational elements. The present example discloses the addition of an E. coli minimal promoter and ribosome binding site properly oriented in the nucleic acid sequence before a gene of interest.
[0084] The acetylating malonate semialdehyde dehydrogenase gene, such as is readily available from several sources (e.g., http://ca.expasy.org/cgi-bin/nicezyme.pl?1.2.1.18) is amplified by polymerase chain reaction from a genomic DNA template by standard PCR methodology. The forward primer incorporates an NcoI restriction site at the start methionine codon of the gene and the reverse primer includes a stop codon for the gene. The amplified nucleic acid sequence is subjected to enzymatic restriction digestion with the restriction enzyme Nco1 from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture is separated by agarose gel electrophoresis, and is visualized under UV transillumination as described under Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the restricted nucleic acid sequence is cut from the gel and the DNA is recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions.
[0085] An E. coli tpiA promoter and ribosome binding site is produced by polymerase chain reaction using a forward primer GGGAACGGCGGGGAAAAACAAACGTT (SEQ ID NO: 17) and a reverse primer GGTCCATGGTAATTCTCCACGCTTATAAGC (SEQ ID NO: 18). Using genomic E. Coli K12 DNA as the template, a PCR reaction was conducted using these primers. The forward primer is complimentary to the nucleic acid sequence upstream of the minimal tpiA promoter region (SEQ ID NO: 19). The reverse primer is located just downstream of the minimal promoter region and includes an NcoI restriction site at the location of the start methionine and also includes a ribosome binding site. The PCR-amplified nucleic acid sequence is subjected to enzymatic restriction digestion with the restriction enzyme Nco1 from New England BioLabs (Ipswich, Mass. USA) according to manufacturer's instructions. The digestion mixture is separated by agarose gel electrophoresis, and is visualized under UV transillumination as described in Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the restricted nucleic acid sequence is cut from the gel and the DNA is recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions.
[0086] The restricted, purified nucleic acid piece containing the transcriptional and translational elements is ligated to the recovered DNA containing the gene of interest. The ligation product is used as a template for a subsequent polymerase chain reaction using the forward primer GGGAACGGCGGGGAAAAACAAACGTT (SEQ ID NO: 17). Alternatively, any other forward primer may be use so long as it includes sufficient nucleic acid sequences upstream of the minimal tpiA promoter sequence (SEQ ID NO: 19). In the present specific example, the reverse primer is GGGTTTTCAGGCGATGCCGTTGAGCGCTTCGCC (SEQ ID NO: 21). The amplified nucleic acid product is separated by agarose gel electrophoresis, and is visualized under UV transillumination as described in Subsection II of the Common Methods Section. An agarose gel slice containing a DNA piece corresponding to the restricted nucleic acid sequence is cut from the gel and the DNA is recovered with a standard gel extraction protocol and components from Qiagen according to manufacturer's instructions.
[0087] The resulting nucleic acid piece then is ligated into a suitable plasmid or other vector or transposon or other system, for example pSMART (Lucigen Corp, Middleton, Wis., USA), StrataClone (Stratagene, La Jolla, Calif., USA) or pCR2.1-TOPO TA (Invitrogen Corp, Carlsbad, Calif., USA) according to manufacturer's instructions. These methods also are described in the Subsection II of the Common Methods Section. Accordingly, the resulting nucleic acid piece can be restriction digested and purified andre-ligated into any other vector as is standard in the art. A similar method can be used to combine any gene with any transcriptional and translational elements with variation of restriction sites and primers.
[0088] The resulting nucleic acid is cloned using standard methodologies into the multiple cloning site of plasmid pBT-3, resulting in pBT-3-mmsA. This plasmid expresses an acetylating malonate semialdehyde dehydrogenase has a replicon compatible with pKK223 based vectors and confers chloramphenicol resistance.
Example 5
Development of a Plasmid Comprising a Pyruvate Decarboxylase. Evolution of Pyruvate Decarboxylase Enzymes for the Enzymatic Conversion of Oxaloacetate to Malonate Semialdehyde (Prophetic)
[0089] Similarly to alpha-ketoglutarate dehydrogenase from Mycobacterium tuberculosis, the pyruvate decarboxylase from Zymomonas mobilis can be evolved to perform the conversion of oxaloacetate to malonate semialdehyde. The pyruvate decarboxylase enzyme is a thiamine diphosphate-dependent enzyme that decarboxylates 2-keto acids and has been shown to prefer short aliphatic substrates (Siegert P et al. (2005). Exchanging the substrate specificities of pyruvate decarboxylase from Zymomonas mobilis and benzoylformate decarboxylase from Pseudomonas putida. Protein Eng Des Sel 18, 345-357). Additionally, this enzyme does not require substrate activation by pyruvamide (Hoppner, T. C. & Doelle, H. W. (19S3). Purification and kinetic characteristics of pyruvate decarboxylase and ethanol dehydrogenase from Zymomonas mobilis in relation to ethanol production. Eur J Appl Microbial Biotechnol 17, 152-157), and a structure of the protein characterized by x-ray crystallography shows the residues responsible for formation of the substrate and cofactor binding pockets (Dobritzsch D et al. (199S). High resolution crystal structure of pyruvate decarboxylase from Zymomonas mobilis. Implications for substrate activation in pyruvate decarboxylases. J Biol Chem 273, 20196-20204). Furthermore, alteration of the substrate specificity of this enzyme by specific amino acid changes have previously been reported (Siegert P etal. (2005). Exchanging the substrate specificities of pyruvate decarboxylase from Zymomonas mobilis and benzoylformate decarboxylase from Pseudomonas putida. Protein Eng Des SellS, 345-357). An example of a process for randomly mutating specific amino acid regions of this protein follows.
[0090] To evolve the binding pocket of the protein for performing the oxaloacetate to malonate semialdehyde conversion, specific regions of the nucleic acid sequence comprising regions of the protein's amino acid sequence will be mutated. Identification of specific amino acid regions within the protein that are involved in the binding pocket interactions is performed by examining the previously determined crystal structure and also by comparing the protein sequence of the Zymomonas mobilis pyruvate decarboxylase with pyruvate decarboxylase from other species showing strong sequence similarity. Using this information, the nucleotide sequence of the gene is examined in order to place restriction sites within the nucleotide sequence at the boundaries of the corresponding amino acid regions identified previously. Form this nucleotide sequence, the Zymomonas mobilis pyruvate decarboxylase gene with these restrictions sites is codon optimized for E. coli according to a service from DNA 2.0 (Menlo Park, Calif. USA), a commercial DNA gene synthesis provider (SEQ ID NO: 22). This gene construct is synthesized by DNA 2.0 and provided in a pJ206 vector backbone. Additionally, the protein sequence includes the addition of a hepta-histidine purification tag (SEQ ID NO: 25), which can be easily removed by restriction digestion of the plasmid with HindIII followed by self-ligation. The protein for which SEQ ID NO: 22 encodes is provided as SEQ ID NO: 23.
[0091] To specifically mutate amino acids in the pyruvate decarboxylase protein, the plasmid containing the codon-optimized sequence is cut at regions of interest via the incorporated restriction sites. Nucleotide sequences is synthesized or produced by polymerase chain reaction with oligonucleotides designed to incorporate specific or random changes at these regions of interest. These nucleotide sequences will incorporate restriction sites or overhanging ends complimentary to the restriction sites used to cut the plasmid such that the new sequences are ligated into the plasmid to create the desired changes in the protein. These changes can be performed singly or multiply. If these changes are performed multiply, the resulting plasmids are transformed into a panD deleted E. coli strain and screened in a manner such as depicted in FIGS. 10A and 10B. Additionally, the protein produced by these changes may be assayed in a manner such as depicted in FIG. 11.
Example 6
Development of a Nucleic Acid Sequence Encoding a Protein Sequence Demonstrating Elevated Oxaloacetate Alpha-Decarboxylase Activity (Partial Prophetic)
[0092] Oxaloacetate alpha-decarboxylase activity is selected from a pool of alpha-ketoglutarate decarboxylase (kgd) mutants by selection in an E. coli AB354 host expressing a beta-alanine pyruvate aminotransferase. pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) encoding the kgd gene was constructed as described above. Confirmation of alpha-ketoglutarate decarboxylase protein expression and enzymatic activity with appropriate controls were as follows. E. Cloni 10GF' electrocompetent cells (Lucigen, Cat.#60061-1) were transformed with the pKK223-Cterm-5×His-kgd (`5×His` disclosed as SEQ ID NO: 24), plasmid containing sequence for 5×HIS-tagged kgd protein (`5×HIS` disclosed as SEQ ID NO: 24) behind a pTAC promoter. Trans formants were confirmed using restriction digest and DNA sequencing (Macrogen, Korea). Expression and purification of his-tagged-kgd was performed as described in Subsection III of the Common Methods Section. SDS-PAGE results of expression and purification are show in FIG. 12.
[0093] E. coli AB354 (Δ panD) was transformed with the vector controls, pKK223, pKK223-Cterm-5×his (`5×His` disclosed as SEQ ID NO: 24), as well as the test vectors pKK223-mcr and pKK223-Cterm-5×His-kgd (`5×His` disclosed as SEQ ID NO: 24), according to standard methods described below. Each of the strains were grown overnight in LB rich media supplemented with 200 mg/L ampicillin (according to standard protocols). Following overnight growth, cells twice were harvested by centrifugation and washed by resuspension in M9 minimal media (standard protocol), diluted 1:10,000 and plated on M9 minimal media plates with 0.05 g/L threonine, 0.1 g/L leucine, 0.067 g/L thiamine, with the additional appropriate supplements, where indicated at the following concentrations (10 g/L beta-alanine (Sigma Aldrich, St. Louis, Mo.), 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 0.2 g/L putrescine (MPBiomedicals, Santa Ana, Calif.), 200 mg/L ampicillin (Research Products International Corp., Mt. Prospect, Ill.) After plating, agarose plates were incubated at 37 C overnight by standard methods. Table 1 depicts the results of these selection controls. A plus (+) indicates growth on a plate, minus (-) indicates no growth. These data confirm the absence of growth in the selection hosts. Putrescine is known to induce the expression of gamma-aminobutyrate transaminase in E. coli. This enzyme has been shown in some species including Rattus norvegicus to also have beta-alanine aminotransferase activity. The mer gene encoding the malonyl-coA reductase, has been shown to produce malonate semialdehyde. The lack of growth on the strain expressing malonyl-coA reductase in the presence of putrescine indicates the need for the co-expression of a beta-alanine aminotransferase in E. coli AB354 for the selection.
TABLE-US-00001 TABLE 1 Supplements Amp + β- Amp + β- IPTG + AMP + IPTG + Strain None alanine Amp alanine Amp Put Put K12 + + - - - - - AB354 (ΔpanD) - + - - - - - AB354 (ΔpanD) + pKK223 - + - + - - - AB354 (ΔpanD) + - + - + - - - pKK223-mer AB354 (ΔpanD) + - + - + - - - pKK223-kgd
[0094] Mutant libraries of pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) were constructed as follows. Plasmid DNA of pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) was purified by standard methods and transformed in the mutator strain E. coli XL1-Red (Stratagene, La Jolla, Calif.) according to manufacturer's protocols. Cells were harvested according to manufacturer's protocols and mutated plasmid DNA purified by standard methods.
[0095] Mutant pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) DNA is used to transform an E. coli host, AB354+pBT-3-BAAT, described above. Greater than 10 5 transformants are collected from LB ampicillin (200 g/L), Chloramphenicol (40 g/L) agarose plates. Cells are washed in M9 minimal media, diluted 1:10,000 and plated on M9 minimal media plates with 0.05 g/L threonine, 0.1 g/L leucine,
[0096] 0.067 g/L thiamine, with 1 mM Isopropyl-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 200 g/L ampicillin and 40 g/L chloramphenicol. Plates are incubated at 37 C for several days. Colonies that grow are individually collected as positives clones bearing oxaloacetate alpha-decarboxylase activity.
Example 7
Development of a Nucleic Acid Sequence Encoding a Protein Sequence Demonstrating Elevated Oxaloacetate Alpha-Decarboxylase Activity (Prophetic)
[0097] Oxaloacetate alpha-decarboxylase activity is selected from a pool of pyruvate decarboxylase (pdc) mutants by selection in an E. coli AB354 host expressing a beta-alanine pyruvate aminotransferase. pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) encoding the pdc gene is constructed as described above. Confirmation of pyruvate decarboxylase protein expression and enzymatic activity with appropriate controls are as follows. E. Cloni 10GF' electrocompetent cells (Lucigen, Cat.#60061-1) are transformed with the pKK223-Cterm-5×His-pdc (`5×His` disclosed as SEQ ID NO: 24), plasmid containing sequence for 5×HIS-tagged pdc protein (`5×His` disclosed as SEQ ID NO: 24) behind a pTAC promoter. Transformants are confirmed using restriction digest and DNA sequencing (Macrogen, Korea). Expression and purification of his-tagged-pdc are performed as described in Subsection III of the Common Methods Section.
[0098] E. coli AB354 (panD) is transformed with the vector controls, pKK223, pKK223-Cterm-5×his (`5×His` disclosed as SEQ ID NO: 24), as well as the test vectors pKK223-mcr and pKK223-Cterm-5×His-pdc (`5×His` disclosed as SEQ ID NO: 24), according to standard methods described below. Each of the strains is grown overnight in LB rich media supplemented with 200 mg/L ampicillin (according to standard protocols). Following overnight growth, cells twice are harvested by centrifugation and washed by resuspension in M9 minimal media (standard protocol), diluted 1:10,000 and plated on M9 minimal media plates with 0.05 g/L threonine, 0.1 g/L leucine, 0.067 g/L thiamine, with the additional appropriate supplements, where indicated at the following concentrations (10 g/L beta-alanine (Sigma Aldrich, St. Louis, Mo.), 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 0.2 g/L putrescine (MPBiomedicals, Santa Ana, Calif.), 200 mg/L ampicillin (Research Products International Corp., Mt. Prospect, Ill.) After plating, agarose plates were incubated at 37 C overnight by standard methods. Putrescine is known to induce the expression of gamma-aminobutyrate transaminase in E. coli. This enzyme has been shown in some species including Rattus norvegicus to also have beta-alanine aminotransferase activity. The mer gene encoding the malonyl-coA reductase, has been shown to produce malonate semialdehyde. The lack of growth on the strain expressing malonyl-coA reductase in the presence of putrescine indicates the need for the co-expression of a beta-alanine aminotransferase in E. coli AB354 for the selection.
[0099] Mutant libraries of pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) are constructed as follows. Plasmid DNA of pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) are purified by standard methods and transformed in the mutator strain E. coli XL1-Red (Stratagene, La Jolla, Calif.) according to manufacturer's protocols. Cells are harvested according to manufacturer's protocols and mutated plasmid DNA purified by standard methods.
[0100] Mutant pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) DNA is used to transform an E. coli host, AB354+pBT-3-BAAT, described above. Greater than 10 5 transformants are collected from LB ampicillin (200 g/L), Chloramphenicol (40 g/L) agarose plates. Cells are washed in M9 minimal media, diluted 1:10,000 and plated on M9 minimal media plates with 0.05 g/L threonine, 0.1 g/L leucine,
[0101] 0.067 g/L thiamine, with 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 200 g/L ampicillin and 40 g/L chloramphenicol. Plates are incubated at 37 C for several days. Colonies that grow are individually collected as positives clones bearing oxaloacetate alpha-decarboxylase activity.
Example 8
Development of a Nucleic Acid Sequence Encoding a Protein Sequence Demonstrating Elevated Oxaloacetate Alpha-Decarboxylase Activity (Partial Prophetic)
[0102] Oxaloacetate alpha-decarboxylase activity is selected from a pool of alpha-ketoglutarate decarboxylase (kgd) mutants by selection in an E. coli NZN111 host expressing an acetylating malonate semialdehyde dehydrogenase. pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) encoding the kgd gene was constructed as described above. Confirmation of alpha-ketoglutarate decarboxylase protein expression and enzymatic activity with appropriate controls were as follows. E. Cloni 10GF' electrocompetent cells (Lucigen, Cat.#60061-1) were transformed with the pKK223-Cterm-5×His-kgd (`5×His` disclosed as SEQ ID NO: 24), plasmid containing sequence for 5×HIS-tagged kgd protein (`5×HIS` disclosed as SEQ ID NO: 24) behind a pTAC promoter. Transformants were confirmed using restriction digest and DNA sequencing (Macrogen, Korea). Expression and purification of his-tagged-kgd were performed as described in Subsection III of the Common Methods Section.
[0103] E. coli NZN111 is transformed with the vector controls, pKK223, pKK223-Cterm-5×his (`5×His` disclosed as SEQ ID NO: 24), as well as the test vectors pKK223-mcr and pKK223-Cterm-5×His-kgd (`5×His` disclosed as SEQ ID NO: 24), according to standard methods described below. Each of the strains is grown overnight in LB rich media supplemented with 200 mg/L ampicillin (according to standard protocols). Following overnight growth, cells twice are harvested by centrifugation and washed by resuspension in LB media (standard protocol), diluted 1:10,000 and plated on LB media plates with the additional appropriate supplements, where indicated at the following concentrations 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 200 mg/L ampicillin (Research Products International Corp., Mt. Prospect, Ill.) After plating, agarose plates are incubated at 37 C overnight anaerobically in BD type A Bio-Bags according to manufacturer's instructions (BD Biosciences, Franklin Lakes, N.J., Catalog #261214). The mer gene encoding the malonyl-coA reductase, has been shown to produce malonate semialdehyde. The presence of growth of the strain expressing malonyl-coA reductase in the presence of the co expressed acetylating malonate semialdehyde dehydrogenase in E. coli NZN111 serves as a positive control for the selection.
[0104] Mutant libraries of pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) were constructed as follows. Plasmid DNA of pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) were purified by standard methods and transformed into the mutator strain E. coli XL1-Red (Stratagene, La Jolla, Calif.) according to manufacturer's protocols. Cells were harvested according to manufacturer's protocols and mutated plasmid DNA purified by standard methods.
[0105] Mutant pKK223-cterm-5×his-kgd (`5×his` disclosed as SEQ ID NO: 24) DNA is used to transform an E. coli host, NZN111+pBT-3-mmsA, described above. Greater than 10''5 transformants are collected from LB ampicillin (200 g/L), Chloramphenicol (40 g/L) agarose plates. Cells are washed in LB media, diluted 1:10,000 and plated on LB media plates with 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 200 g/L ampicillin and 40 g/L chloramphenicol. Plates are incubated at 37 C for several days anaerobically in BD type A Bio-Bags according to manufacturer's instructions (BD Biosciences, Franklin Lakes, N.J., Catalog #261214). Colonies that grow are individually collected as positives clones bearing oxaloacetate alpha-decarboxylase activity.
Example 9
Development of a Nucleic Acid Sequence Encoding a Protein Sequence Demonstrating Elevated Oxaloacetate Alpha-Decarboxylase Activity (Prophetic)
[0106] Oxaloacetate alpha-decarboxylase activity is selected from a pool of pyruvate decarboxylase (pdc) mutants by selection in an E. coli NZN111 host expressing an acetylating malonate semialdehyde dehydrogenase. pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) encoding the pdc gene is constructed as described above. Confirmation of pyruvate decarboxylase protein expression and enzymatic activity with appropriate controls are as follows. E. Cloni 10GF' electrocompetent cells (Lucigen, Cat.#60061-1) are transformed with the pKK223-Cterm-5×His-pdc (`5×His` disclosed as SEQ ID NO: 24), plasmid containing sequence for 5×HIS-tagged pdc protein (`5×His` disclosed as SEQ ID NO: 24) behind a pTAC promoter. Transformants are confirmed using restriction digest and DNA sequencing (Macrogen, Korea). Expression and purification of his-tagged-pdc are performed as described in Subsection III of the Common Methods Section. E. coli NZN111 and E. coli NZN111+pBT3-mmsA is transformed with the vector controls, pKK223, pKK223-Cterm-5×his (`5×His` disclosed as SEQ ID NO: 24), as well as the test vectors pKK223-mcr and pKK223-Cterm-5×His-pdc (`5×His` disclosed as SEQ ID NO: 24), according to standard methods described below. Each of the strains is grown overnight in LB rich media supplemented with 200 mg/L ampicillin (according to standard protocols). Following overnight growth, cells twice are harvested by centrifugation and washed by resuspension in LB media (standard protocol), diluted 1:10,000 and plated on LB media plates with the additional appropriate supplements, where indicated at the following concentrations 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 200 mg/L ampicillin (Research Products International Corp., Mt. Prospect, Ill.) After plating, agarose plates were incubated at 37 C overnight anaerobically in BD type A Bio-Bags according to manufacturer's instructions (BD Biosciences, Franklin Lakes, N.J., Catalog #261214). The mcr gene encoding the malonyl-coA reductase, has been shown to produce malonate semialdehyde. The presence of growth of the strain expressing malonyl-coA reductase in the presence of the co-expressed acetylating malonate semialdehyde in E. coli NZN111 serves as a positive control for the selection.
[0107] Mutant libraries of pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) are constructed as follows. Plasmid DNA of pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) are purified by standard methods and transformed into the mutator strain E. coli XL1-Red (Stratagene, La Jolla, Calif.) according to manufacturer's protocols. Cells are harvested according to manufacturer's protocols and mutated plasmid DNA purified by standard methods. Mutant pKK223-cterm-5×his-pdc (`5×his` disclosed as SEQ ID NO: 24) DNA is used to transform an E. coli host, NZN111+pBT-3-mmsA, described above. Greater than 10 5 transformants are collected from LB ampicillin (200 g/L), chloramphenicol (40 g/L) agarose plates. Cells are washed in LB media, diluted 1:10,000 and plated on LB media plates with 1 mM Isopropyl β-D-1-thiogalactopyranoside (Thermo Fisher Scientific, Fairlawn, N.J.), 200 g/L ampicillin and 40 g/L chloramphenicol. Plates are incubated at 37 C for several days anaerobically in BD type A Bio-Bags according to manufacturer's instructions (BD Biosciences, Franklin Lakes, N.J., Catalog #261214). Colonies that grow are individually collected as positives clones bearing oxaloacetate alpha-decarboxylase activity.
Example 10
Confirmation of Oxaloacetate Alpha-Decarboxylase Activity (Partial Prophetic)
[0108] The colorimetric to confirm enzymatic decarboxylation of 2-oxo-acid substrates is adapted from current standard methodologies and is illustrated below in FIG. 11. This approach necessitates the expression and purification of the mutant enzymes and reaction with the purified enzyme, its cofactor (thiamin pyrophosphate) and the appropriate substrate. Protein expression and purification are performed with standard methodologies. This colorimetric screening method will be used both to conduct broad screening for positive oxaloacetate alpha-decarboxylase mutants, and also to conduct confirmatory testing of the positive clones identified in a selection method described above.
[0109] Transformants containing a gene cloned into the pKK223-Cterm-5×his expression vector (`5×his` disclosed as SEQ ID NO: 24) are grown overnight in LB+0.2% glucose+200 ug/mL Ampicillin, diluted 1:20 and grown (LB+0.2% glucose+200 ug/mL Ampicillin) to OD600 of 0.4. IPTG is added at 1 mM final concentration to induce protein expression. Cultures are then allowed to grow at 37 degrees C. for four hours. Cells were harvested by centrifugation at 4 degrees C. for 10 minutes at 4000 rpm. Pellets are resuspended and concentrated 50× (e.g. 500 mL culture resuspended in 10 mL buffer) in Qiagen Ni-NTA Lysis Buffer (50 mM Na2HP04, 300 mM NaCl, 10 mM imidazole, pH 8.0)+1 mM PMSF. Lysozyme is added to a final concentration of 1 mg/mL; cells are incubated on ice for 30 minutes. Cells are lysed using a French Press (cell pressure=2000 psi) three times. Lysates are cleared by centrifugation at 4 degrees C. for 20 minutes, applied to Qiagen Ni-NTA columns, washed and eluted as specified by Qiagen (cat.#31314). Samples are analyzed by SDS-PAGE by routine protocols.
[0110] 100 uL reaction mixtures contain 50 mM Potassium phosphate (pH 7.0), 0.2 mM TPP, 1 mM MgCh, 10 mM of the appropriate substrate. 300 pg of purified enzyme is added to the reaction and incubated 16 hours at 37 degrees C. After 16 hours at 37 degrees C., 100 uL of Purpald colorimetric indicator (as per Sigma-Aldrich, cat.#162892) is added to each well in order to detect formation of corresponding aldehyde product. After addition of the Purpald, reactions are incubated at room temperature for 1 hour and read at a wavelength of 540 nm in a Thermomax Microplate Reader (Molecular Devices) using SOFTMax Pro Microplate Reader software, Ver. 4.0. Absorbances greater than control reactions without substrate are used to determine the presence of decarboxylation.
Common Methods Section
[0111] All methods in this Section are provided for incorporation into the above methods where so referenced therein and/or below.
[0112] Subsection I. Bacterial Growth Methods:
[0113] Bacterial growth culture methods, and associated materials and conditions, are disclosed for respective species that may be utilized as needed, as follows:
[0114] Escherichia coli K12 is a gift from the Gill lab (University of Colorado at Boulder) and is obtained as an actively growing culture. Serial dilutions of the actively growing E. coli K12 culture are made into Luria Broth (RPI Corp, Mt. Prospect, Ill., USA) and are allowed to grow for aerobically for 24 hours at 37° C. at 250 rpm until saturated.
[0115] Pseudomonas aeruginosa genomic DNA is a gift from the Gill lab (University of Colorado at Boulder).
[0116] Subsection II: Gel Preparation, DNA Separation, Extraction, Ligation, and Transformation Methods:
[0117] Molecular biology grade agarose (RPI Corp, Mt. Prospect, Ill., USA) is added to 1×TAE to make a 1% Agarose: TAE solution. To obtain 50×TAE add the following to 900 mL of distilled water: add the following to 900 ml distilled H2O: 242 g Tris base (RPI Corp, Mt. Prospect, Ill., USA), 57.1 ml Glacial Acetic Acid (Sigma-Aldrich, St. Louis, Mo., USA) and 18.6 g EDTA (Fisher Scientific, Pittsburgh, Pa. USA) and adjust volume to 1 L with additional distilled water. To obtain 1×TAE, add 20 mL of 50×TAE to 980 mL of distilled water. The agarose-TAE solution is then heated until boiling occurred and the agarose is fully dissolved. The solution is allowed to cool to 50° C. before 10 mg/mL ethidium bromide (Acros Organics, Morris Plains, N.J., USA) is added at a concentration of 5 ul per 100 mL of 1% agarose solution. Once the ethidium bromide is added, the solution is briefly mixed and poured into a gel casting tray with the appropriate number of combs (Idea Scientific Co., Minneapolis, Minn., USA) per sample analysis. DNA samples are then mixed accordingly with 5×TAE loading buffer. 5×TAE loading buffer consists of 5×TAE(diluted from SOXTAE as described above), 20% glycerol (Acros Organics, Morris Plains, N.J., USA), 0.125% Bromophenol Blue (Alfa Aesar, Ward Hill, Mass., USA), and adjust volume to 50 mL with distilled water. Loaded gels are then run in gel rigs (Idea Scientific Co., Minneapolis, Minn., USA) filled with 1×TAE at a constant voltage of 125 volts for 25-30 minutes. At this point, the gels are removed from the gel boxes with voltage and visualized under a UV transilluminator (FOTODYNE Inc., Hartland, Wis., USA).
[0118] The DNA isolated through gel extraction is then extracted using the QIAquick Gel Extraction Kit following manufacturer's instructions (Qiagen (Valencia Calif. USA)). Similar methods are known to those skilled in the art.
[0119] The thus-extracted DNA then may be ligated into pSMART (Lucigen Corp, Middleton, Wis., USA), StrataClone (Stratagene, La Jolla, Calif., USA) or pCR2.1-TOPO TA (Invitrogen Corp, Carlsbad, Calif., USA) according to manufacturer's instructions. These methods are described in the next subsection of Common Methods.
Ligation Methods:
[0120] For Ligations into pSMART Vectors:
[0121] Gel extracted DNA is blunted using PCRTerminator (Lucigen Corp, Middleton, Wis., USA) according to manufacturer's instructions. Then 500 ng of DNA is added to 2.5 uL 4× CloneSmart vector premix, 1 ul CloneSmart DNA ligase (Lucigen Corp, Middleton, Wis., USA) and distilled water is added for a total volume of 10 ul. The reaction is then allowed to sit at room temperature for 30 minutes and then heat inactivated at 70° C. for 15 minutes and then placed on ice. E. cloni 10G Chemically Competent cells (Lucigen Corp, Middleton, Wis., USA) are thawed for 20 minutes on ice. 40 ul of chemically competent cells are placed into a microcentrifuge tube and 1 ul of heat inactivated CloneSmart Ligation is added to the tube. The whole reaction is stirred briefly with a pipette tip. The ligation and cells are incubated on ice for 30 minutes and then the cells are heat shocked for 45 seconds at 42° C. and then put back onto ice for 2 minutes. 960 ul of room temperature Recovery media (Lucigen Corp, Middleton, Wis., USA) and places into microcentrifuge tubes. Shake tubes at 250 rpm for 1 hour at 37° C. Plate 100 ul of transformed cells on Luria Broth plates (RPI Corp, Mt. Prospect, Ill., USA) plus appropriate antibiotics depending on the pSMART vector used. Incubate plates overnight at 37° C.
For Ligations into StrataClone:
[0122] Gel extracted DNA is blunted using PCRTerminator (Lucigen Corp, Middleton, Wis., USA) according to manufacturer's instructions. Then 2 ul of DNA is added to 3 ul StrataClone Blunt Cloning buffer and 1 ul StrataClone Blunt vector mix amp/kan (Stratagene, La Jolla, Calif., USA) for a total of 6 ul. Mix the reaction by gently pipeting up at down and incubate the reaction at room temperature for 30 minutes then place onto ice. Thaw a tube of StrataClone chemically competent cells (Stratagene, La Jolla, Calif., USA) on ice for 20 minutes. Add 1 ul of the cloning reaction to the tube of chemically competent cells and gently mix with a pipette tip and incubate on ice for 20 minutes. Heat shock the transformation at 42° C. for 45 seconds then put on ice for 2 minutes. Add 250 ul pre-warmed Luria Broth (RPI Corp, Mt. Prospect, Ill., USA) and shake at 250 rpm for 37° C. for 2 hour. Plate 100 ul of the transformation mixture onto Luria Broth plates (RPI Corp, Mt. Prospect, Ill., USA) plus appropriate antibiotics. Incubate plates overnight at 37° C.
For Ligations into pCR2.1-TOPO TA:
[0123] Add 1 ul TOPO vector, 1 ul Salt Solution (Invitrogen Corp, Carlsbad, Calif., USA) and 3 ul gel extracted DNA into a microcentrifuge tube. Allow the tube to incubate at room temperature for 30 minutes then place the reaction on ice. Thaw one tube of TOPlOF' chemically competent cells (Invitrogen Corp, Carlsbad, Calif., USA) per reaction. Add 1 ul of reaction mixture into the thawed TOPlOF' cells and mix gently by swirling the cells with a pipette tip and incubate on ice for 20 minutes. Heat shock the transformation at 42° C. for 45 seconds then put on ice for 2 minutes. Add 250 ul pre-warmed SOC media (Invitrogen Corp, Carlsbad, Calif., USA) and shake at 250 rpm for 37° C. for 1 hour. Plate 100 ul of the transformation mixture onto Luria Broth plates (RPI Corp, Mt. Prospect, Ill., USA) plus appropriate antibiotics. Incubate plates overnight at 37° C.
General Transformation and Related Culture Methodologies:
[0124] Chemically competent transformation protocols are carried out according to the manufactures instructions or according to the literature contained in Molecular Cloning (Sambrook and Russell). Generally, plasmid DNA or ligation products are chilled on ice for 5 to 30 min. in solution with chemically competent cells. Chemically competent cells are a widely used product in the field of biotechnology and are available from multiple vendors, such as those indicated above in this Subsection. Following the chilling period cells generally are heat-shocked for 30 seconds at 42° C. without shaking, re-chilled and combined with 250 microliters of rich media, such as S.O.C. Cells are then incubated at 37° C. while shaking at 250 rpm for 1 hour. Finally, the cells are screened for successful transformations by plating on media containing the appropriate antibiotics.
[0125] The choice of an E. coli host strain for plasmid transformation is determined by considering factors such as plasmid stability, plasmid compatibility, plasmid screening methods and protein expression. Strain backgrounds can be changed by simply purifying plasmid DNA as described above and transforming the plasmid into a desired or otherwise appropriate E. coli host strain such as determined by experimental necessities, such as any commonly used cloning strain (e.g., DH5a, Top lOP', E. doni 10G, etc.).
To Make 1 L M9 Minimal Media:
[0126] M9 minimal media was made by combining 5×M9 salts, 1M MgS04, 20% glucose, 1M CaCl2 and sterile deionized water. The 5×M9 salts are made by dissolving the following salts in deionized water to a final volume of 1 L: 64 g Na2HP04. 7H20, 15 g KH2P04, 2.5 g NaCl, 5.0 g NH4Cl. The salt solution was divided into 200 mL aliquots and sterilized by autoclaving for 15 minutes at 15 psi on the liquid cycle. A 1M solution of MgSO4 and 1M CaCl2 were made separately, then sterilized by autoclaving. The glucose was filter sterilized by passing it thought a 0.22 μm filter. All of the components are combined as follows to make 1 L of M9: 750 mL sterile water, 200 mL 5×M9 salts, 2 mL of 1M MgS04, 20 mL 20% glucose, 0.1 mL CaCl2, Q.S. to a final volume of 1 L.
To Make EZ Rich Media:
[0127] All media components were obtained from TEKnova (Hollister Calif. USA) and combined in the following volumes. 100 mL 10×MOPS mixture, 10 mL 0.132M K2 HP04, 100 mL 10×ACGU, 200 mL 5× Supplement EZ, 10 mL 20% glucose, 580 mL sterile water.
Subsection III. Additional Methods Related to Enzyme Evaluation Expression and Purification of Proteins Expressed in pKK223-Cterm-5×his .English Pound.`5×his` Disclosed as SEQ ID NO: 24) by Expression Plasmids
[0128] Transformants containing a gene cloned into the pKK223-Cterm-5×his (`5×his` disclosed as SEQ ID NO: 24) expression vector were grown overnight in LB+0.2% glucose+200 ug/mL Ampicillin, diluted 1:20 and grown (LB+0.2% glucose+200 ug/mL Ampicillin) to OD600 of 0.4. IPTG was added at 1 mM final concentration to induce protein expression. Cultures were then allowed to grow at 37 degrees C. for four hours. Cells were harvested by centrifugation at 4 degrees C. for 10 minutes at 4000 rpm. Pellets were resuspended and concentrated 50× (e.g. pellet from 500 mL culture resuspended in 10 mL buffer) in Qiagen Ni-NTA Lysis Buffer (50 mM Na2HP04, 300 mM NaCl, 10 mM imidazole, pH 8.0)+1 mM PMSF. Lysozyme was added to a final concentration of 1 mg/mL; cells were incubated on ice for 30 minutes. Cells were lysed using a French Press (cell pressure=2000 psi) three times. Lysates were cleared by centrifugation at 4 degrees C. for 20 minutes, applied to Qiagen Ni-NTA columns, washed and eluted as specified by Qiagen (cat.#31314). Samples were analyzed by SDS-PAGE by routine protocols.
Decarboxylation Enzyme Reactions:
[0129] 100 uL reaction mixtures were added to microwells. Each 100 uL of reaction mixture contained 50 mM Potassium Phosphate (pH 7.0), 0.2 mM TPP, 1 mM MgCl2, and 10 mM of the appropriate substrate. 300 pg of purified enzyme was added to a respective microwell and incubated 16 hours at 37 degrees C. After 16 hours at 37 degrees C., 100 uL of Purpald® colorimetric indicator (Sigma-Aldrich, cat.#162892), prepared per manufacturer's instructions, was added to each microwell in order to detect formation of corresponding aldehyde product. After addition of the Purpald®, the microwells were incubated at room temperature for 1 hour and read at a wavelength of 540 nm in a Thermomax Microplate Reader (Molecular Devices) using SOFTMax Pro Microplate Reader software, Ver. 4.0.
Summary of Suppliers Section
[0130] The names and city addresses of major suppliers are provided in the methods above. In addition, as to Qiagen products, the DNeasy® Blood and Tissue Kit, Cat. No. 69506, is used in the methods for genomic DNA preparation; the QIAprep® Spin ("mini prep"), Cat. No. 27106, is used for plasmid DNA purification, and the QIAquick® Gel Extraction Kit, Cat. No. 28706, is used for gel extractions as described above.
Bio-Production Media
[0131] Bio-production media, which is used in the present invention with recombinant microorganisms having a biosynthetic pathway for 3-HP (and optionally products further downstream of 3-HP), must contain suitable carbon substrates. Suitable substrates may include, but are not limited to, monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feed stocks such as cheese whey permeate, comsteep liquor, sugar beet molasses, and barley malt. Additionally the carbon substrate may also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates methylotrophic organisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth Cl Compd., [Int. Symp.], 7th (1993), 415-32. Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Suiter et al., Arch. Microbial. 153:485-489 (1990)). Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism. Although it is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention as a carbon source, common carbon substrates used as carbon sources are glucose, fructose, and sucrose, as well as mixtures of any of these sugars. Sucrose may be obtained from feed stocks such as sugar cane, sugar beets, cassava, and sweet sorghum. Glucose and dextrose may be obtained through saccharification of starch based feed stocks including grains such as corn, wheat, rye, barley, and oats.
[0132] In addition, sugars may be obtained from cellulosic and lignocellulosic biomass through processes of pretreatment and saccharification, as described, for example, in US patent application US20070031918A1, which is herein incorporated by reference. Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass may also comprise additional components, such as protein and/or lipid. Biomass may be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass could comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves. Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste. Examples of biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure. Any such biomass may be used in a bio-production method or system to provide a carbon source. In addition to an appropriate carbon source, such as selected from one of the above-disclosed types, bio-production media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for 3-HP (and optionally products further downstream of 3-HP) production.
Culture Conditions
[0133] Typically cells are grown at a temperature in the range of about 25° C. to about 40° C. in an appropriate medium. Suitable growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, M9 minimal media, Sabouraud Dextrose (SD) broth, Yeast medium (YM) broth or (Ymin) yeast synthetic minimal media. Other defined or synthetic growth media may also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or bio-production science.
[0134] Suitable pH ranges for the bio-production are between pH 5.0 to pH 9.0, where pH 6.0 to pH 8.0 is a typical pH range for the initial condition.
[0135] Bio-productions may be performed under aerobic, microaerobic, or anaerobic conditions, with or without agitation.
[0136] The amount of 3-HP (and optionally products further downstream of 3-HP) produced in a bio-production media generally can be determined using a number of methods known in the art, for example, high performance liquid chromatography (HPLC) or gas chromatography (GC). Specific HPLC methods for the specific examples are provided herein.
Bio-Production Reactors and Systems:
[0137] Any of the recombinant microorganisms as described and/or referred to above may be introduced into an industrial bio-production system where the microorganisms convert a carbon source into 3-HP (and optionally products further downstream of 3-HP) in a commercially viable operation. The bio-production system includes the introduction of such a recombinant microorganism into a bioreactor vessel, with a carbon source substrate and bio-production media suitable for growing the recombinant microorganism, and maintaining the bio-production system within a suitable temperature range (and dissolved oxygen concentration range if the reaction is aerobic or microaerobic) for a suitable time to obtain a desired conversion of a portion of the substrate molecules to 3-HP (and optionally products further downstream of 3-HP). Industrial bio-production systems and their operation are well-known to those skilled in the arts of chemical engineering and bioprocess engineering. The following paragraphs provide an overview of the methods and aspects of industrial systems that may be used for the bio-production of 3-HP (and optionally products further downstream of 3-HP).
[0138] In various embodiments, any of a wide range of sugars, including, but not limited to sucrose, glucose, xylose, cellulose or hemicellulose, are provided to a microorganism, such as in an industrial system comprising a reactor vessel in which a defined media (such as a minimal salts media including but not limited to M9 minimal media, potassium sulfate minimal media, yeast synthetic minimal media and many others or variations of these), an inoculum of a microorganism providing one or more of the 3-HP (and optionally products further downstream of 3-HP) biosynthetic pathway alternatives, and the a carbon source may be combined. The carbon source enters the cell and is catabolized by well-known and common metabolic pathways to yield common metabolic intermediates, including phosphoenolpyruvate (PEP). (See Molecular Biology of the Cell, 3rd Ed., B. Alberts et al. Garland Publishing, New York, 1994, pp. 42-45, 66-74, incorporated by reference for the teachings of basic metabolic catabolic pathways for sugars; Principles of Biochemistry, 3rd Ed., D. L. Nelson & M. M. Cox, Worth Publishers, New York, 2000, pp 527-658, incorporated by reference for the teachings of major metabolic pathways; and Biochemistry, 4th Ed., L. Stryer, W. H. Freeman and Co., New York, 1995, pp. 463-650, also incorporated by reference for the teachings of major metabolic pathways.). Further to types of industrial bio-production, various embodiments of the present invention may employ a batch type of industrial bioreactor. A classical batch bioreactor system is considered "closed" meaning that the composition of the medium is established at the beginning of a respective bio-production event and not subject to artificial alterations and additions during the time period ending substantially with the end of the bio-production event. Thus, at the beginning of the bio-production event the medium is inoculated with the desired organism or organisms, and bio-production is permitted to occur without adding anything to the system. Typically, however, a "batch" type of bio-production event is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the bio-production event is stopped. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of a desired end product or intermediate.
[0139] A variation on the standard batch system is the Fed-Batch system. Fed-Batch bio-production processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the bio-production progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems may be measured directly, such as by sample analysis at different times, or estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2 Batch and Fed-Batch approaches are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36:227, (1992), and Biochemical Engineering Fundamentals, 2nd Ed. J. E. Bailey and D. F. Ollis, McGraw Hill, New York, 1986, herein incorporated by reference for general instruction on bio-production, which as used herein may be aerobic, microaerobic, or anaerobic. Although the present invention may be performed in batch mode, as provided in Example 8, or in fed-batch mode, it is contemplated that the method would be adaptable to continuous bio-production methods. Continuous bio-production is considered an "open" system where a defined bio-production medium is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous bio-production generally maintains the cultures within a controlled density range where cells are primarily in log phase growth. Two types of continuous bioreactor operation include: 1) Chemostat--where fresh media is fed to the vessel while simultaneously removing an equal rate of the vessel contents. The limitation of this approach is that cells are lost and high cell density generally is not achievable. In fact, typically one can obtain much higher cell density with a fed-batch process. 2) Perfusion culture, which is similar to the chemostat approach except that the stream that is removed from the vessel is subjected to a separation technique which recycles viable cells back to the vessel. This type of continuous bioreactor operation has been shown to yield significantly higher cell densities than fed-batch and can be operated continuously. Continuous bio-production is particularly advantageous for industrial operations because it has less down time associated with draining, cleaning and preparing the equipment for the next bio-production event. Furthermore, it is typically more economical to continuously operate downstream unit operations, such as distillation, than to run them in batch mode.
[0140] Continuous bio-production allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to the medium being drawn off must be balanced against the cell growth rate in the bio-production. Methods of modulating nutrients and growth factors for continuous bio-production processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.
[0141] It is contemplated that embodiments of the present invention may be practiced using either batch, fed-batch or continuous processes and that any known mode of bio-production would be suitable. Additionally, it is contemplated that cells may be immobilized on an inert scaffold as whole cell catalysts and subjected to suitable bio-production conditions for 3-HP (and optionally products further downstream of 3-HP) production.
[0142] The following published resources are incorporated by reference herein for their respective teachings to indicate the level of skill in these relevant arts, and as needed to support a disclosure that teaches how to make and use methods of industrial bio-production of 3-HP (and optionally products further downstream of 3-HP) from sugar sources, and also industrial systems that may be used to achieve such conversion with any of the recombinant microorganisms of the present invention (Biochemical Engineering Fundamentals, 2nd Ed. J. E. Bailey and D. F. 011 is, McGraw Hill, New York, 1986, entire book for purposes indicated and Chapter 9, pages 533-657 in particular for biological reactor design; Unit Operations of Chemical Engineering, 5th Ed., W. L. McCabe et al., McGraw Hill, New York 1993, entire book for purposes indicated, and particularly for process and separation technologies analyses; Equilibrium Staged Separations, P. C. Wankat, Prentice Hall, Englewood Cliffs, N.J. USA, 1988, entire book for separation technologies teachings).
[0143] The scope of the present invention is not meant to be limited to the exact sequences provided herein. It is appreciated that a range of modifications to nucleic acid and to amino acid sequences may be made and still provide a desired functionality. The following discussion is provided to more clearly define ranges of variation that may be practiced and still remain within the scope of the present invention.
[0144] It is recognized in the art that some amino acid sequences of the present invention can be varied without significant effect of the structure or function of the proteins disclosed herein. Variants included can constitute deletions, insertions, inversions, repeats, and type substitutions so long as the indicated enzyme activity is not significantly affected. Guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J. U., et Al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990).
[0145] In various embodiments polypeptides obtained by the expression of the polynucleotide molecules of the present invention may have at least approximately 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to one or more amino acid sequences encoded by the genes and/or nucleic acid sequences described herein for the 3-HP (and optionally products further downstream of 3-HP) biosynthesis pathways. A truncated respective polypeptide has at least about 90% of the full length of a polypeptide encoded by a nucleic acid sequence encoding the respective native enzyme, and more particularly at least 95% of the full length of a polypeptide encoded by a nucleic acid sequence encoding the respective native enzyme. By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a polypeptide is intended that the amino acid sequence of the claimed polypeptide is identical to the reference sequence except that the claimed polypeptide sequence can include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence can be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence can be inserted into the reference sequence. These alterations of the reference sequence can occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
[0146] As a practical matter, whether any particular polypeptide is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any reference amino acid sequence of any polypeptide described herein (which may correspond with a particular nucleic acid sequence described herein), such particular polypeptide sequence can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed. For example, in a specific embodiment the identity between a reference sequence (query sequence, a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, may be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)). Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20, Randomization Group Length=O, Cutoff Score=1, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter. According to this embodiment, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction is made to the results to take into consideration the fact that the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. A determination of whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of this embodiment. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for.
[0147] The above descriptions and methods for sequence homology are intended to be exemplary and it is recognized that this concept is well-understood in the art. Further, it is appreciated that nucleic acid sequences may be varied and still provide a functional enzyme, and such variations are within the scope of the present invention. Nucleic acid sequences that encode polypeptides that provide the indicated functions for 3-HP (and optionally products further downstream of 3-HP) that increase tolerance or production are considered within the scope of the present invention. These may be further defined by the stringency of hybridization, described below, but this is not meant to be limiting when a function of an encoded polypeptide matches a specified 3-HP (and optionally products further downstream of 3-HP) tolerance-related or biosynthesis pathway enzyme activity.
[0148] Further to nucleic acid sequences, "hybridization" refers to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide. The term "hybridization" may also refer to triple-stranded hybridization. The resulting (usually) double-stranded polynucleotide is a "hybrid" or "duplex." "Hybridization conditions" will typically include salt concentrations of less than about 1M, more usually less than about 500 mM and less than about 200 mM. Hybridization temperatures can be as low as 5° C., but are typically greater than 22° C., more typically greater than about 30° C., and often are in excess of about 37° C. Hybridizations are usually performed under stringent conditions, i.e. conditions under which a probe will hybridize to its target subsequence. Stringent conditions are sequence-dependent and are different in different circumstances. Longer fragments may require higher hybridization temperatures for specific hybridization. As other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, the combination of parameters is more important than the absolute measure of any one alone. Generally, stringent conditions are selected to be about 5° C. lower than the T. for the specific sequence at a defined ionic strength and pH. Exemplary stringent conditions include salt concentration of at least 0.01 M to no more than 1M Na ion concentration (or other salts) at a pH 7.0 to 8.3 and a temperature of at least 25° C. For example, conditions of 5×SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30° C. are suitable for allele-specific probe hybridizations. For stringent conditions, see for example, Sambrook and Russell and Anderson "Nucleic Acid Hybridization" 1st Ed., BIOS Scientific Publishers Limited (1999), which are hereby incorporated by reference for hybridization protocols. "Hybridizing specifically to" or "specifically hybridizing to" or like expressions refer to the binding, duplexing, or hybridizing of a molecule substantially to or only to a particular nucleotide sequence or sequences under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
[0149] Having so described the present invention and provided examples, and further discussion, and in view of the above paragraphs, it is appreciated that various non-limiting aspects of the present invention may include:
[0150] A genetically modified (recombinant) microorganism comprising a nucleic acid sequence that encodes a polypeptide with at least 85% amino acid sequence identity to any of the enzymes of any of 3-HP tolerance-related or biosynthetic pathways, wherein the polypeptide has enzymatic activity effective to perform the enzymatic reaction of the respective 3-HP biosynthetic pathway enzyme, and the recombinant microorganism exhibits greater 3-H tolerance and/or 3-HP bio-production.
[0151] A genetically modified (recombinant) microorganism comprising a nucleic acid sequence that encodes a polypeptide with at least 90% amino acid sequence identity to any of the enzymes of any of 3-HP tolerance-related or biosynthetic pathways, wherein the polypeptide has enzymatic activity effective to perform the enzymatic reaction of the respective 3-HP tolerance-related or biosynthetic pathway enzyme, and the recombinant microorganism exhibits greater 3-HP tolerance and/or 3-HP bio-production.
[0152] A genetically modified (recombinant) microorganism comprising a nucleic acid sequence that encodes a polypeptide with at least 95% amino acid sequence identity to any of the enzymes of any of 3-HP tolerance-related or biosynthetic pathways, wherein the polypeptide has enzymatic activity effective to perform the enzymatic reaction of the respective 3-HP tolerance-related or biosynthetic pathway enzyme, and the recombinant microorganism exhibits greater 3-HP tolerance and/or 3-HP bio-production.
[0153] The above paragraphs are meant to indicate modifications in the nucleic acid sequences may be made and a respective polypeptide encoded there from remains functional so as to perform an enzymatic catalysis along one of the 3-HP tolerance-related and/or biosynthetic pathways described above.
[0154] The term "heterologous DNA," "heterologous nucleic acid sequence," and the like as used herein refers to a nucleic acid sequence wherein at least one of the following is true: (a) the sequence of nucleic acids is foreign to (i.e., not naturally found in) a given host microorganism; (b) the sequence may be naturally found in a given host microorganism, but in an unnatural (e.g., greater than expected) amount; or (c) the sequence of nucleic acids comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, regarding instance (c), a heterologous nucleic acid sequence that is recombinantly produced will have two or more sequences from unrelated genes arranged to make a new functional nucleic acid. Embodiments of the present invention may result from introduction of an expression vector into a host microorganism, wherein the expression vector contains a nucleic acid sequence coding for an enzyme that is, or is not, normally found in a host microorganism. With reference to the host microorganism's genome, then, the nucleic acid sequence that codes for the enzyme is heterologous.
[0155] Also, and more generally, in accordance with examples and embodiments herein, there may be employed conventional molecular biology, cellular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. (See, e.g., Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third Edition 2001 (volumes 1-3), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Animal Cell Culture, R. I. Freshney, ed., 1986). These published resources are incorporated by reference herein for their respective teachings of standard laboratory methods found therein. Further, all patents, patent applications, patent publications, and other publications referenced herein (collectively, "published resource(s)") are hereby incorporated by reference in this application. Such incorporation, at a minimum, is for the specific teaching and/or other purpose that may be noted when citing the reference herein. If a specific teaching and/or other purpose is not so noted, then the published resource is specifically incorporated for the teaching(s) indicated by one or more of the title, abstract, and/or summary of the reference. If no such specifically identified teaching and/or other purpose may be so relevant, then the published resource is incorporated in order to more fully describe the state of the art to which the present invention pertains, and/or to provide such teachings as are generally known to those skilled in the art, as may be applicable. However, it is specifically stated that a citation of a published resource herein shall not be construed as an admission that such is prior art to the present invention.
[0156] Thus, based on the above disclosure, it is appreciated that within the scope of the present invention are methods for selection and identification of mutant polynucleotides comprising nucleic acid sequences that encode mutant polypeptides that demonstrate elevated activity of oxaloacetate alpha-oxo decarboxylase activity (also referred to herein as oxaloacetate alpha-decarboxylase activity). Also within the scope of the present invention may be compositions that comprise such identified mutant polynucleotides and polypeptides. In various embodiments, these methods are directed for the specific purpose of obtaining recombinant microorganisms that have capacity for increased bio-production of 3-HP. Although specific genes, enzymes, plasmids and other constructs are described in the above examples, these are not meant to limit the scope of the invention, particularly in view of the level of skill in the art.
[0157] Thus, while various embodiments of the present invention have been shown and described herein, it will be obvious that such embodiments are provided by way of example only. Numerous variations, changes and substitutions may be made without departing from the invention herein in its various embodiments. Specifically, and for whatever reason, for any grouping of compounds, nucleic acid sequences, polypeptides including specific proteins including functional enzymes, metabolic pathway enzymes or intermediates, elements, or other compositions, or concentrations stated or otherwise presented herein in a list, table, or other grouping (such as metabolic pathway enzymes shown in a figure), unless clearly stated otherwise, it is intended that each such grouping provides the basis for and serves to identify various subset embodiments, the subset embodiments in their broadest scope comprising every subset of such grouping by exclusion of one or more members (or subsets) of the respective stated grouping. Moreover, when any range is described herein, unless clearly stated otherwise, that range includes all values therein and all sub-ranges therein. Accordingly, it is intended that the invention be limited only by the spirit and scope of appended claims, and of later claims, and of either such claims as they may be amended during prosecution of this or a later application claiming priority hereto.
Sequence CWU
1
1
2513736DNAArtificial SequenceDescription of Artificial Sequence Synthetic
Codon optimized kgd gene sequence with customized ends 1ttgacggata
tcaagcttct attaaccgaa cgcttcgtcc aagatttctt gctgctccac 60ggcatgaacc
ttcgaggaac cgctgctcgg cgcagacatc gcgcgacggg agatacgctt 120gatgcccgcc
aacttgtccg gcagcaactc cggcaactcc aaaccgaaac gcggccaggc 180gccctggttc
gctggttcct cctggaccca aaagaactct ttgacatttt cgtaacgatc 240cagggtttca
cgcagacgac gacgcggcaa cggcgccagt tgctccagac gcacaattgc 300cagatcatta
cggttgtctt tcgccttgcg tgccgccaat tcataataca acttaccgga 360ggtcaacaga
atacggctaa ctttattgcg gtcgccgata ccatcctcgt aggtcggttc 420ctccaggacg
ctacggaatt taatctcggt aaaatcctta atctccgaaa ccgccgcctt 480gtggcgcagc
atggatttcg gggtaaacac gatcaacgga cgttggatgc cgtccaacgc 540gtggcggcgc
agcaagtgaa agtaattgga cggggtgctc ggcatcgcga tcgtcatgct 600accctcagcc
cacagctgca aaaagcgctc aatgcgcgcc gacgtgtggt ccgggccctg 660accctcgtgg
ccgtgtggca gcaacagaac aacgttggac agctgacccc atttcgcttc 720gcccgagctg
atgaactcgt caatgatcga ctgggcacca ttaacaaagt cgccgaattg 780cgcctcccac
agcacaaccg cgtctggatt gccaacggta taaccgtact caaaacccac 840agccgcgtat
tccgacaacg gcgaatcata aaccaggaac ttaccaccgg tcgggctgcc 900gtcgctgtta
gtcgccagca gctgcagcgg ggtgaactcc tcgccggtgt gacggtcgat 960cagcacagaa
tgacgctggc taaaggtgcc acgacgagag tcttgaccgc tcagacggac 1020cagcttgccc
tcagcaacca ggctgcccag cgccagcaac tcaccaaacg cccagtcaat 1080cttaccctca
tacgccatct cacgacgctt ttccagcacc ggctgaacgc gcgggtgtgc 1140cgtgaaaccg
ttaggcagcg ccaggaaggc atcaccgata cgtgccagca gggatttgtc 1200aacagcggtc
gccaggcccg ctgggatcat ttggtccgac tcgacgctct ccgacggttg 1260gacgccgtgc
ttctccagtt cgcgcacttc gttgaacaca cgctccagtt ggccctggta 1320atcgcgcagc
gcatcctccg cctctttcat gctgatgtcg ccacgaccga tcagagcctc 1380ggtgtaggat
ttacgggcgc cacgcttggt gtccacgacg tcatagacat acggattggt 1440catagatgga
tcgtcaccct cattatgacc acgacgacga tagcacagca tgtcaataac 1500aacgtccttt
ttaaagcgtt ggcggaagtc aactgccaaa cgcgcaaccc agacacacgc 1560ttctggatcg
tcgccgttca cgtggaagat tggcgcaccg atcatcttcg ccacatccgt 1620gcagtactcg
ctcgaacgag agtattccgg agcggtggtg aagccgattt ggttgttcac 1680aatgatgtga
atcgtaccac ccacacgata gccaggcaga tttgccagat tcagcgtctc 1740cgcaacaacg
ccttgacccg cgaaggccgc atcaccgtgc agcatcaacg gaacgacgga 1800gaatgcacgt
tggccgtcgg agtcaatgga accgtggtcc agcaggtctt gcttcgcacg 1860caccaaacct
tccagcactg gatcgaccgc ttccaaatgg gacggatttg ccgtcaggga 1920aacctgaata
tcgttatcgc caaacatttg cagatacaga cccgtcgcac ccaggtggta 1980cttgacatcg
ccggaaccgt gagcctggga cgggttcaga ttgccttcaa actccgtaaa 2040gatttgcgaa
tacggtttgc ccacgatgtt cgccaggaca ttcaagcgac cacggtgcgg 2100catgccaatg
accacttcat ccaaaccatg ctcggcacat tggtcaatcg ccgcgtccat 2160cattggaata
acagattccg caccctccag gctaaaacgc ttttggccca catacttggt 2220ttgcaggaag
gtttcaaacg cctccgctgc gttcagtttc gacaagatgt acttttgttg 2280agcaacggtc
ggtttgacgt gcttcgtctc gacacgctgc tccagccact ccttttgttc 2340cgggtccaga
atgtgcgcgt actcaacacc gatgtgacgg cagtacgcgt cgcgcagcaa 2400acccagcacg
tcacgcagct ttttgtattg agcacccgcg aaaccgtcaa ccttaaagac 2460gcggtccagg
tcccacagag tcaggccatg cgtcaacacc tccaaatccg gatgcgaacg 2520aaagcgcgcc
ttatccaagc gcaacgggtc ggtgtccgcc atcagatggc cgcggttgcg 2580ataggccgcg
atcaggttca tcacacgtgc gttcttgtca acgatcgagt ccggattatc 2640ggtgctccaa
cgcactggca ggtacgggat gctcagctcg cggaagacct catcccagaa 2700gccatcagac
aacagcagtt catgaatggt acgcaggaag tcaccgcttt ccgcaccttg 2760aatgatacgg
tggtcgtagg tagaagtcag ggtaatcagt ttgccaatac ccagctcagc 2820gatgcgttcc
tcggacgcgc cttggaactc cgccggatat tccatcgcac cgacaccgat 2880gatagcacct
tgacctggca tcaggcgtgg cacagagtgc accgtgccaa tcgtgcccgg 2940attcgtcagc
gaaatcgtaa cgccagcgaa gtcctcggtg gtcagtttac catcacgagc 3000acgacggacg
atgtcctcgt acgcggtaac gaactgcgcg aagcgcatcg tctcgcaacg 3060tttgataccg
gccaccacca gagagcgctt gccatcttta ccttgcaggt caatagccag 3120acccagattg
gtgtgcgcag gagtaaccgc cgtcggctta ccgtccacct ccgtgtagtg 3180gcgattcata
ttcgggaact tcttaaccgc ctgaaccaga gcataaccca gcaaatgggt 3240aaagctgatt
ttaccaccac gcgtgcgttt caactgatta ttgatcacga tacgattatc 3300gatcaacaat
ttcgctggca cagcacgcac cgaggtcgcc gtaggcactt ccagcgacgc 3360gctcatgttc
ttcacgacag cagccgccgc accacgcagg acagcaactt catcgccttc 3420ggctggcgga
ggcaccgcgg tcttggcggc cagagccgcc acgacaccgt tgcccgctgc 3480ggccgtgtcg
gccggtttcg gcggcgcttg cggagccgcc gctgccgcac gctcagcgac 3540caaagggctg
gtcacacgag tcggctcagc agccggttgg gaagtcggct ccgggctata 3600gtccaccaga
aactcatgcc agcttgggtc aacggaagac ggatcatcac gaaatttacg 3660atacatacca
acacgagacg ggtcctgagt caccatggat atatctcctt cttaaagaat 3720tcgatatctc
agcgac
373621224PRTMycobacterium tuberculosis 2Met Val Thr Gln Asp Pro Ser Arg
Val Gly Met Tyr Arg Lys Phe Arg 1 5 10
15 Asp Asp Pro Ser Ser Val Asp Pro Ser Trp His Glu Phe
Leu Val Asp 20 25 30
Tyr Ser Pro Glu Pro Thr Ser Gln Pro Ala Ala Glu Pro Thr Arg Val
35 40 45 Thr Ser Pro Leu
Val Ala Glu Arg Ala Ala Ala Ala Ala Pro Gln Ala 50
55 60 Pro Pro Lys Pro Ala Asp Thr Ala
Ala Ala Gly Asn Gly Val Val Ala 65 70
75 80 Ala Leu Ala Ala Lys Thr Ala Val Pro Pro Pro Ala
Glu Gly Asp Glu 85 90
95 Val Ala Val Leu Arg Gly Ala Ala Ala Ala Val Val Lys Asn Met Ser
100 105 110 Ala Ser Leu
Glu Val Pro Thr Ala Thr Ser Val Arg Ala Val Pro Ala 115
120 125 Lys Leu Leu Ile Asp Asn Arg Ile
Val Ile Asn Asn Gln Leu Lys Arg 130 135
140 Thr Arg Gly Gly Lys Ile Ser Phe Thr His Leu Leu Gly
Tyr Ala Leu 145 150 155
160 Val Gln Ala Val Lys Lys Phe Pro Asn Met Asn Arg His Tyr Thr Glu
165 170 175 Val Asp Gly Lys
Pro Thr Ala Val Thr Pro Ala His Thr Asn Leu Gly 180
185 190 Leu Ala Ile Asp Leu Gln Gly Lys Asp
Gly Lys Arg Ser Leu Val Val 195 200
205 Ala Gly Ile Lys Arg Cys Glu Thr Met Arg Phe Ala Gln Phe
Val Thr 210 215 220
Ala Tyr Glu Asp Ile Val Arg Arg Ala Arg Asp Gly Lys Leu Thr Thr 225
230 235 240 Glu Asp Phe Ala Gly
Val Thr Ile Ser Leu Thr Asn Pro Gly Thr Ile 245
250 255 Gly Thr Val His Ser Val Pro Arg Leu Met
Pro Gly Gln Gly Ala Ile 260 265
270 Ile Gly Val Gly Ala Met Glu Tyr Pro Ala Glu Phe Gln Gly Ala
Ser 275 280 285 Glu
Glu Arg Ile Ala Glu Leu Gly Ile Gly Lys Leu Ile Thr Leu Thr 290
295 300 Ser Thr Tyr Asp His Arg
Ile Ile Gln Gly Ala Glu Ser Gly Asp Phe 305 310
315 320 Leu Arg Thr Ile His Glu Leu Leu Leu Ser Asp
Gly Phe Trp Asp Glu 325 330
335 Val Phe Arg Glu Leu Ser Ile Pro Tyr Leu Pro Val Arg Trp Ser Thr
340 345 350 Asp Asn
Pro Asp Ser Ile Val Asp Lys Asn Ala Arg Val Met Asn Leu 355
360 365 Ile Ala Ala Tyr Arg Asn Arg
Gly His Leu Met Ala Asp Thr Asp Pro 370 375
380 Leu Arg Leu Asp Lys Ala Arg Phe Arg Ser His Pro
Asp Leu Glu Val 385 390 395
400 Leu Thr His Gly Leu Thr Leu Trp Asp Leu Asp Arg Val Phe Lys Val
405 410 415 Asp Gly Phe
Ala Gly Ala Gln Tyr Lys Lys Leu Arg Asp Val Leu Gly 420
425 430 Leu Leu Arg Asp Ala Tyr Cys Arg
His Ile Gly Val Glu Tyr Ala His 435 440
445 Ile Leu Asp Pro Glu Gln Lys Glu Trp Leu Glu Gln Arg
Val Glu Thr 450 455 460
Lys His Val Lys Pro Thr Val Ala Gln Gln Lys Tyr Ile Leu Ser Lys 465
470 475 480 Leu Asn Ala Ala
Glu Ala Phe Glu Thr Phe Leu Gln Thr Lys Tyr Val 485
490 495 Gly Gln Lys Arg Phe Ser Leu Glu Gly
Ala Glu Ser Val Ile Pro Met 500 505
510 Met Asp Ala Ala Ile Asp Gln Cys Ala Glu His Gly Leu Asp
Glu Val 515 520 525
Val Ile Gly Met Pro His Arg Gly Arg Leu Asn Val Leu Ala Asn Ile 530
535 540 Val Gly Lys Pro Tyr
Ser Gln Ile Phe Thr Glu Phe Glu Gly Asn Leu 545 550
555 560 Asn Pro Ser Gln Ala His Gly Ser Gly Asp
Val Lys Tyr His Leu Gly 565 570
575 Ala Thr Gly Leu Tyr Leu Gln Met Phe Gly Asp Asn Asp Ile Gln
Val 580 585 590 Ser
Leu Thr Ala Asn Pro Ser His Leu Glu Ala Val Asp Pro Val Leu 595
600 605 Glu Gly Leu Val Arg Ala
Lys Gln Asp Leu Leu Asp His Gly Ser Ile 610 615
620 Asp Ser Asp Gly Gln Arg Ala Phe Ser Val Val
Pro Leu Met Leu His 625 630 635
640 Gly Asp Ala Ala Phe Ala Gly Gln Gly Val Val Ala Glu Thr Leu Asn
645 650 655 Leu Ala
Asn Leu Pro Gly Tyr Arg Val Gly Gly Thr Ile His Ile Ile 660
665 670 Val Asn Asn Gln Ile Gly Phe
Thr Thr Ala Pro Glu Tyr Ser Arg Ser 675 680
685 Ser Glu Tyr Cys Thr Asp Val Ala Lys Met Ile Gly
Ala Pro Ile Phe 690 695 700
His Val Asn Gly Asp Asp Pro Glu Ala Cys Val Trp Val Ala Arg Leu 705
710 715 720 Ala Val Asp
Phe Arg Gln Arg Phe Lys Lys Asp Val Val Ile Asp Met 725
730 735 Leu Cys Tyr Arg Arg Arg Gly His
Asn Glu Gly Asp Asp Pro Ser Met 740 745
750 Thr Asn Pro Tyr Val Tyr Asp Val Val Asp Thr Lys Arg
Gly Ala Arg 755 760 765
Lys Ser Tyr Thr Glu Ala Leu Ile Gly Arg Gly Asp Ile Ser Met Lys 770
775 780 Glu Ala Glu Asp
Ala Leu Arg Asp Tyr Gln Gly Gln Leu Glu Arg Val 785 790
795 800 Phe Asn Glu Val Arg Glu Leu Glu Lys
His Gly Val Gln Pro Ser Glu 805 810
815 Ser Val Glu Ser Asp Gln Met Ile Pro Ala Gly Leu Ala Thr
Ala Val 820 825 830
Asp Lys Ser Leu Leu Ala Arg Ile Gly Asp Ala Phe Leu Ala Leu Pro
835 840 845 Asn Gly Phe Thr
Ala His Pro Arg Val Gln Pro Val Leu Glu Lys Arg 850
855 860 Arg Glu Met Ala Tyr Glu Gly Lys
Ile Asp Trp Ala Phe Gly Glu Leu 865 870
875 880 Leu Ala Leu Gly Ser Leu Val Ala Glu Gly Lys Leu
Val Arg Leu Ser 885 890
895 Gly Gln Asp Ser Arg Arg Gly Thr Phe Ser Gln Arg His Ser Val Leu
900 905 910 Ile Asp Arg
His Thr Gly Glu Glu Phe Thr Pro Leu Gln Leu Leu Ala 915
920 925 Thr Asn Ser Asp Gly Ser Pro Thr
Gly Gly Lys Phe Leu Val Tyr Asp 930 935
940 Ser Pro Leu Ser Glu Tyr Ala Ala Val Gly Phe Glu Tyr
Gly Tyr Thr 945 950 955
960 Val Gly Asn Pro Asp Ala Val Val Leu Trp Glu Ala Gln Phe Gly Asp
965 970 975 Phe Val Asn Gly
Ala Gln Ser Ile Ile Asp Glu Phe Ile Ser Ser Gly 980
985 990 Glu Ala Lys Trp Gly Gln Leu Ser
Asn Val Val Leu Leu Leu Pro His 995 1000
1005 Gly His Glu Gly Gln Gly Pro Asp His Thr Ser
Ala Arg Ile Glu 1010 1015 1020
Arg Phe Leu Gln Leu Trp Ala Glu Gly Ser Met Thr Ile Ala Met
1025 1030 1035 Pro Ser Thr
Pro Ser Asn Tyr Phe His Leu Leu Arg Arg His Ala 1040
1045 1050 Leu Asp Gly Ile Gln Arg Pro Leu
Ile Val Phe Thr Pro Lys Ser 1055 1060
1065 Met Leu Arg His Lys Ala Ala Val Ser Glu Ile Lys Asp
Phe Thr 1070 1075 1080
Glu Ile Lys Phe Arg Ser Val Leu Glu Glu Pro Thr Tyr Glu Asp 1085
1090 1095 Gly Ile Gly Asp Arg
Asn Lys Val Ser Arg Ile Leu Leu Thr Ser 1100 1105
1110 Gly Lys Leu Tyr Tyr Glu Leu Ala Ala Arg
Lys Ala Lys Asp Asn 1115 1120 1125
Arg Asn Asp Leu Ala Ile Val Arg Leu Glu Gln Leu Ala Pro Leu
1130 1135 1140 Pro Arg
Arg Arg Leu Arg Glu Thr Leu Asp Arg Tyr Glu Asn Val 1145
1150 1155 Lys Glu Phe Phe Trp Val Gln
Glu Glu Pro Ala Asn Gln Gly Ala 1160 1165
1170 Trp Pro Arg Phe Gly Leu Glu Leu Pro Glu Leu Leu
Pro Asp Lys 1175 1180 1185
Leu Ala Gly Ile Lys Arg Ile Ser Arg Arg Ala Met Ser Ala Pro 1190
1195 1200 Ser Ser Gly Ser Ser
Lys Val His Ala Val Glu Gln Gln Glu Ile 1205 1210
1215 Leu Asp Glu Ala Phe Gly 1220
38621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic p206 plasmid with codon optimized kgd gene nucleic
acid sequence and softag 3ggtggcggta cttgggtcga tatcaaagtg catcacttct
tcccgtatgc ccaactttgt 60atagagagcc actgcgggat cgtcaccgta atctgcttgc
acgtagatca cataagcacc 120aagcgcgttg gcctcatgct tgaggagatt gatgagcgcg
gtggcaatgc cctgcctccg 180gtgctcgccg gagactgcga gatcatagat atagatctca
ctacgcggct gctcaaactt 240gggcagaacg taagccgcga gagcgccaac aaccgcttct
tggtcgaagg cagcaagcgc 300gatgaatgtc ttactacgga gcaagttccc gaggtaatcg
gagtccggct gatgttggga 360gtaggtggct acgtcaccga actcacgacc gaaaagatca
agagcagccc gcatggattt 420gacttggtca gggccgagcc tacatgtgcg aatgatgccc
atacttgagc cacctaactt 480tgttttaggg cgactgccct gctgcgtaac atcgttgctg
ctccataaca tcaaacatcg 540acccacggcg taacgcgctt gctgcttgga tgcccgaggc
atagactgta caaaaaaaca 600gtcataacaa gccatgaaaa ccgccactgc gccgttacca
ccgctgcgtt cggtcaaggt 660tctggaccag ttgcgtgagc gcattttttt ttcctcctcg
gcgtttacgc cccgccctgc 720cactcatcgc agtactgttg taattcatta agcattctgc
cgacatggaa gccatcacag 780acggcatgat gaacctgaat cgccagcggc atcagcacct
tgtcgccttg cgtataatat 840ttgcccatag tgaaaacggg ggcgaagaag ttgtccatat
tggccacgtt taaatcaaaa 900ctggtgaaac tcacccaggg attggcgctg acgaaaaaca
tattctcaat aaacccttta 960gggaaatagg ccaggttttc accgtaacac gccacatctt
gcgaatatat gtgtagaaac 1020tgccggaaat cgtcgtggta ttcactccag agcgatgaaa
acgtttcagt ttgctcatgg 1080aaaacggtgt aacaagggtg aacactatcc catatcacca
gctcaccgtc tttcattgcc 1140atacggaact ccggatgagc attcatcagg cgggcaagaa
tgtgaataaa ggccggataa 1200aacttgtgct tatttttctt tacggtcttt aaaaaggccg
taatatccag ctgaacggtc 1260tggttatagg tacattgagc aactgactga aatgcctcaa
aatgttcttt acgatgccat 1320tgggatatat caacggtggt atatccagtg atttttttct
ccattttttt ttcctccttt 1380agaaaaactc atcgagcatc aaatgaaact gcaatttatt
catatcagga ttatcaatac 1440catatttttg aaaaagccgt ttctgtaatg aaggagaaaa
ctcaccgagg cagttccata 1500ggatggcaag atcctggtat cggtctgcga ttccgactcg
tccaacatca atacaaccta 1560ttaatttccc ctcgtcaaaa ataaggttat caagtgagaa
atcaccatga gtgacgactg 1620aatccggtga gaatggcaaa agtttatgca tttctttcca
gacttgttca acaggccagc 1680cattacgctc gtcatcaaaa tcactcgcat caaccaaacc
gttattcatt cgtgattgcg 1740cctgagcgag gcgaaatacg cgatcgctgt taaaaggaca
attacaaaca ggaatcgagt 1800gcaaccggcg caggaacact gccagcgcat caacaatatt
ttcacctgaa tcaggatatt 1860cttctaatac ctggaacgct gtttttccgg ggatcgcagt
ggtgagtaac catgcatcat 1920caggagtacg gataaaatgc ttgatggtcg gaagtggcat
aaattccgtc agccagttta 1980gtctgaccat ctcatctgta acatcattgg caacgctacc
tttgccatgt ttcagaaaca 2040actctggcgc atcgggcttc ccatacaagc gatagattgt
cgcacctgat tgcccgacat 2100tatcgcgagc ccatttatac ccatataaat cagcatccat
gttggaattt aatcgcggcc 2160tcgacgtttc ccgttgaata tggctcattt ttttttcctc
ctttaccaat gcttaatcag 2220tgaggcacct atctcagcga tctgtctatt tcgttcatcc
atagttgcct gactccccgt 2280cgtgtagata actacgatac gggagggctt accatctggc
cccagcgctg cgatgatacc 2340gcgagaacca cgctcaccgg ctccggattt atcagcaata
aaccagccag ccggaagggc 2400cgagcgcaga agtggtcctg caactttatc cgcctccatc
cagtctatta attgttgccg 2460ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc
aacgttgttg ccatcgctac 2520aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca
ttcagctccg gttcccaacg 2580atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa
gcggttagct ccttcggtcc 2640tccgatcgtt gtcagaagta agttggccgc agtgttatca
ctcatggtta tggcagcact 2700gcataattct cttactgtca tgccatccgt aagatgcttt
tctgtgactg gtgagtactc 2760aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt
tgctcttgcc cggcgtcaat 2820acgggataat accgcgccac atagcagaac tttaaaagtg
ctcatcattg gaaaacgttc 2880ttcggggcga aaactctcaa ggatcttacc gctgttgaga
tccagttcga tgtaacccac 2940tcgtgcaccc aactgatctt cagcatcttt tactttcacc
agcgtttctg ggtgagcaaa 3000aacaggaagg caaaatgccg caaaaaaggg aataagggcg
acacggaaat gttgaatact 3060catattcttc ctttttcaat attattgaag catttatcag
ggttattgtc tcatgagcgg 3120atacatattt gaatgtattt agaaaaataa acaaataggg
gtcagtgtta caaccaatta 3180accaattctg aacattatcg cgagcccatt tatacctgaa
tatggctcat aacacccctt 3240gtttgcctgg cggcagtagc gcggtggtcc cacctgaccc
catgccgaac tcagaagtga 3300aacgccgtag cgccgatggt agtgtgggga ctccccatgc
gagagtaggg aactgccagg 3360catcaaataa aacgaaaggc tcagtcgaaa gactgggcct
ttcgcccggg ctaattgagg 3420ggtgtcgccc ttttgacgga tatcaagctt ctattaaccg
aacgcttcgt ccaagatttc 3480ttgctgctcc acggcatgaa ccttcgagga accgctgctc
ggcgcagaca tcgcgcgacg 3540ggagatacgc ttgatgcccg ccaacttgtc cggcagcaac
tccggcaact ccaaaccgaa 3600acgcggccag gcgccctggt tcgctggttc ctcctggacc
caaaagaact ctttgacatt 3660ttcgtaacga tccagggttt cacgcagacg acgacgcggc
aacggcgcca gttgctccag 3720acgcacaatt gccagatcat tacggttgtc tttcgccttg
cgtgccgcca attcataata 3780caacttaccg gaggtcaaca gaatacggct aactttattg
cggtcgccga taccatcctc 3840gtaggtcggt tcctccagga cgctacggaa tttaatctcg
gtaaaatcct taatctccga 3900aaccgccgcc ttgtggcgca gcatggattt cggggtaaac
acgatcaacg gacgttggat 3960gccgtccaac gcgtggcggc gcagcaagtg aaagtaattg
gacggggtgc tcggcatcgc 4020gatcgtcatg ctaccctcag cccacagctg caaaaagcgc
tcaatgcgcg ccgacgtgtg 4080gtccgggccc tgaccctcgt ggccgtgtgg cagcaacaga
acaacgttgg acagctgacc 4140ccatttcgct tcgcccgagc tgatgaactc gtcaatgatc
gactgggcac cattaacaaa 4200gtcgccgaat tgcgcctccc acagcacaac cgcgtctgga
ttgccaacgg tataaccgta 4260ctcaaaaccc acagccgcgt attccgacaa cggcgaatca
taaaccagga acttaccacc 4320ggtcgggctg ccgtcgctgt tagtcgccag cagctgcagc
ggggtgaact cctcgccggt 4380gtgacggtcg atcagcacag aatgacgctg gctaaaggtg
ccacgacgag agtcttgacc 4440gctcagacgg accagcttgc cctcagcaac caggctgccc
agcgccagca actcaccaaa 4500cgcccagtca atcttaccct catacgccat ctcacgacgc
ttttccagca ccggctgaac 4560gcgcgggtgt gccgtgaaac cgttaggcag cgccaggaag
gcatcaccga tacgtgccag 4620cagggatttg tcaacagcgg tcgccaggcc cgctgggatc
atttggtccg actcgacgct 4680ctccgacggt tggacgccgt gcttctccag ttcgcgcact
tcgttgaaca cacgctccag 4740ttggccctgg taatcgcgca gcgcatcctc cgcctctttc
atgctgatgt cgccacgacc 4800gatcagagcc tcggtgtagg atttacgggc gccacgcttg
gtgtccacga cgtcatagac 4860atacggattg gtcatagatg gatcgtcacc ctcattatga
ccacgacgac gatagcacag 4920catgtcaata acaacgtcct ttttaaagcg ttggcggaag
tcaactgcca aacgcgcaac 4980ccagacacac gcttctggat cgtcgccgtt cacgtggaag
attggcgcac cgatcatctt 5040cgccacatcc gtgcagtact cgctcgaacg agagtattcc
ggagcggtgg tgaagccgat 5100ttggttgttc acaatgatgt gaatcgtacc acccacacga
tagccaggca gatttgccag 5160attcagcgtc tccgcaacaa cgccttgacc cgcgaaggcc
gcatcaccgt gcagcatcaa 5220cggaacgacg gagaatgcac gttggccgtc ggagtcaatg
gaaccgtggt ccagcaggtc 5280ttgcttcgca cgcaccaaac cttccagcac tggatcgacc
gcttccaaat gggacggatt 5340tgccgtcagg gaaacctgaa tatcgttatc gccaaacatt
tgcagataca gacccgtcgc 5400acccaggtgg tacttgacat cgccggaacc gtgagcctgg
gacgggttca gattgccttc 5460aaactccgta aagatttgcg aatacggttt gcccacgatg
ttcgccagga cattcaagcg 5520accacggtgc ggcatgccaa tgaccacttc atccaaacca
tgctcggcac attggtcaat 5580cgccgcgtcc atcattggaa taacagattc cgcaccctcc
aggctaaaac gcttttggcc 5640cacatacttg gtttgcagga aggtttcaaa cgcctccgct
gcgttcagtt tcgacaagat 5700gtacttttgt tgagcaacgg tcggtttgac gtgcttcgtc
tcgacacgct gctccagcca 5760ctccttttgt tccgggtcca gaatgtgcgc gtactcaaca
ccgatgtgac ggcagtacgc 5820gtcgcgcagc aaacccagca cgtcacgcag ctttttgtat
tgagcacccg cgaaaccgtc 5880aaccttaaag acgcggtcca ggtcccacag agtcaggcca
tgcgtcaaca cctccaaatc 5940cggatgcgaa cgaaagcgcg ccttatccaa gcgcaacggg
tcggtgtccg ccatcagatg 6000gccgcggttg cgataggccg cgatcaggtt catcacacgt
gcgttcttgt caacgatcga 6060gtccggatta tcggtgctcc aacgcactgg caggtacggg
atgctcagct cgcggaagac 6120ctcatcccag aagccatcag acaacagcag ttcatgaatg
gtacgcagga agtcaccgct 6180ttccgcacct tgaatgatac ggtggtcgta ggtagaagtc
agggtaatca gtttgccaat 6240acccagctca gcgatgcgtt cctcggacgc gccttggaac
tccgccggat attccatcgc 6300accgacaccg atgatagcac cttgacctgg catcaggcgt
ggcacagagt gcaccgtgcc 6360aatcgtgccc ggattcgtca gcgaaatcgt aacgccagcg
aagtcctcgg tggtcagttt 6420accatcacga gcacgacgga cgatgtcctc gtacgcggta
acgaactgcg cgaagcgcat 6480cgtctcgcaa cgtttgatac cggccaccac cagagagcgc
ttgccatctt taccttgcag 6540gtcaatagcc agacccagat tggtgtgcgc aggagtaacc
gccgtcggct taccgtccac 6600ctccgtgtag tggcgattca tattcgggaa cttcttaacc
gcctgaacca gagcataacc 6660cagcaaatgg gtaaagctga ttttaccacc acgcgtgcgt
ttcaactgat tattgatcac 6720gatacgatta tcgatcaaca atttcgctgg cacagcacgc
accgaggtcg ccgtaggcac 6780ttccagcgac gcgctcatgt tcttcacgac agcagccgcc
gcaccacgca ggacagcaac 6840ttcatcgcct tcggctggcg gaggcaccgc ggtcttggcg
gccagagccg ccacgacacc 6900gttgcccgct gcggccgtgt cggccggttt cggcggcgct
tgcggagccg ccgctgccgc 6960acgctcagcg accaaagggc tggtcacacg agtcggctca
gcagccggtt gggaagtcgg 7020ctccgggcta tagtccacca gaaactcatg ccagcttggg
tcaacggaag acggatcatc 7080acgaaattta cgatacatac caacacgaga cgggtcctga
gtcaccatgg atatatctcc 7140ttcttaaaga attcgatatc tcagcgacaa gggcgacaca
aaatttattc taaatgcata 7200ataaatactg ataacatctt atagtttgta ttatattttg
tattatcgtt gacatgtata 7260attttgatat caaaaactga ttttcccttt attattttcg
agatttattt tcttaattct 7320ctttaacaaa ctagaaatat tgtatataca aaaaatcata
aataatagat gaatagttta 7380attataggtg ttcatcaatc gaaaaagcaa cgtatcttat
ttaaagtgcg ttgctttttt 7440ctcatttata aggttaaata attctcatat atcaagcaaa
gtgacaggcg cccttaaata 7500ttctgacaaa tgctctttcc ctaaactccc cccataaaaa
aacccgccga agcgggtttt 7560tacgttattt gcggattaac gattactcgt tatcagaacc
gcccaggggg cccgagctta 7620agactggccg tcgttttaca acacagaaag agtttgtaga
aacgcaaaaa ggccatccgt 7680caggggcctt ctgcttagtt tgatgcctgg cagttcccta
ctctcgcctt ccgcttcctc 7740gctcactgac tcgctgcgct cggtcgttcg gctgcggcga
gcggtatcag ctcactcaaa 7800ggcggtaata cggttatcca cagaatcagg ggataacgca
ggaaagaaca tgtgagcaaa 7860aggccagcaa aaggccagga accgtaaaaa ggccgcgttg
ctggcgtttt tccataggct 7920ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
cagaggtggc gaaacccgac 7980aggactataa agataccagg cgtttccccc tggaagctcc
ctcgtgcgct ctcctgttcc 8040gaccctgccg cttaccggat acctgtccgc ctttctccct
tcgggaagcg tggcgctttc 8100tcatagctca cgctgtaggt atctcagttc ggtgtaggtc
gttcgctcca agctgggctg 8160tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
tccggtaact atcgtcttga 8220gtccaacccg gtaagacacg acttatcgcc actggcagca
gccactggta acaggattag 8280cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
tggtgggcta actacggcta 8340cactagaaga acagtatttg gtatctgcgc tctgctgaag
ccagttacct tcggaaaaag 8400agttggtagc tcttgatccg gcaaacaaac caccgctggt
agcggtggtt tttttgtttg 8460caagcagcag attacgcgca gaaaaaaagg atctcaagaa
gatcctttga tcttttctac 8520ggggtctgac gctcagtgga acgacgcgcg cgtaactcac
gttaagggat tttggtcatg 8580agcttgcgcc gtcccgtcaa gtcagcgtaa tgctctgctt a
8621439DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Forward primer for PCR amplification
of codon optimized kgd nucleic acid sequence 4tttttttgta taccatggat
cgtaaatttc gtgatgatc 39542DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Reverse primer
for PCR amplification of codon optimized kgd nucleic acid sequence
5cccggtgaga tctagatccg aacgcttcgt ccaagatttc tt
42647DNAArtificial SequenceDescription of Artificial Sequence Synthetic
Forward primer for PCR amplification of pKK223-3 template 6cggatctaga
tctcaccatc accaccatta gtcgacctgc agccaag
47744DNAArtificial SequenceDescription of Artificial Sequence Synthetic
Reverse primer for PCR amplification of pKK223-3 template 7tgagatctag
atccgttatg tcccatggtt ctgtttcctg tgtg
4484614DNAArtificial SequenceDescription of Artificial Sequence Synthetic
pKK223-ct-his vector sequence 8ttgacaatta atcatcggct cgtataatgt
gtggaattgt gagcggataa caatttcaca 60caggaaacag aaccatggga cataacggat
ctagatctca ccatcaccac cattagtcga 120cctgcagcca agcttggctg ttttggcgga
tgagagaaga ttttcagcct gatacagatt 180aaatcagaac gcagaagcgg tctgataaaa
cagaatttgc ctggcggcag tagcgcggtg 240gtcccacctg accccatgcc gaactcagaa
gtgaaacgcc gtagcgccga tggtagtgtg 300gggtctcccc atgcgagagt agggaactgc
caggcatcaa ataaaacgaa aggctcagtc 360gaaagactgg gcctttcgtt ttatctgttg
tttgtcggtg aacgctctcc tgagtaggac 420aaatccgccg ggagcggatt tgaacgttgc
gaagcaacgg cccggagggt ggcgggcagg 480acgcccgcca taaactgcca ggcatcaaat
taagcagaag gccatcctga cggatggcct 540ttttgcgttt ctacaaactc ttttgtttat
ttttctaaat acattcaaat atgtatccgc 600tcatgagaca ataaccctga taaatgcttc
aataatattg aaaaaggaag agtatgagta 660ttcaacattt ccgtgtcgcc cttattccct
tttttgcggc attttgcctt cctgtttttg 720ctcacccaga aacgctggtg aaagtaaaag
atgctgaaga tcagttgggt gcacgagtgg 780gttacatcga actggatctc aacagcggta
agatccttga gagttttcgc cccgaagaac 840gttttccaat gatgagcact tttaaagttc
tgctatgtgg cgcggtatta tcccgtgttg 900acgccgggca agagcaactc ggtcgccgca
tacactattc tcagaatgac ttggttgagt 960actcaccagt cacagaaaag catcttacgg
atggcatgac agtaagagaa ttatgcagtg 1020ctgccataac catgagtgat aacactgcgg
ccaacttact tctgacaacg atcggaggac 1080cgaaggagct aaccgctttt ttgcacaaca
tgggggatca tgtaactcgc cttgatcgtt 1140gggaaccgga gctgaatgaa gccataccaa
acgacgagcg tgacaccacg atgctgtagc 1200aatggcaaca acgttgcgca aactattaac
tggcgaacta cttactctag cttcccggca 1260acaattaata gactggatgg aggcggataa
agttgcagga ccacttctgc gctcggccct 1320tccggctggc tggtttattg ctgataaatc
tggagccggt gagcgtgggt ctcgcggtat 1380cattgcagca ctggggccag atggtaagcc
ctcccgtatc gtagttatct acacgacggg 1440gagtcaggca actatggatg aacgaaatag
acagatcgct gagataggtg cctcactgat 1500taagcattgg taactgtcag accaagttta
ctcatatata ctttagattg atttaaaact 1560tcatttttaa tttaaaagga tctaggtgaa
gatccttttt gataatctca tgaccaaaat 1620cccttaacgt gagttttcgt tccactgagc
gtcagacccc gtagaaaaga tcaaaggatc 1680ttcttgagat cctttttttc tgcgcgtaat
ctgctgcttg caaacaaaaa aaccaccgct 1740accagcggtg gtttgtttgc cggatcaaga
gctaccaact ctttttccga aggtaactgg 1800cttcagcaga gcgcagatac caaatactgt
ccttctagtg tagccgtagt taggccacca 1860cttcaagaac tctgtagcac cgcctacata
cctcgctctg ctaatcctgt taccagtggc 1920tgctgccagt ggcgataagt cgtgtcttac
cgggttggac tcaagacgat agttaccgga 1980taaggcgcag cggtcgggct gaacgggggg
ttcgtgcaca cagcccagct tggagcgaac 2040gacctacacc gaactgagat acctacagcg
tgagcattga gaaagcgcca cgcttcccga 2100agggagaaag gcggacaggt atccggtaag
cggcagggtc ggaacaggag agcgcacgag 2160ggagcttcca gggggaaacg cctggtatct
ttatagtcct gtcgggtttc gccacctctg 2220acttgagcgt cgatttttgt gatgctcgtc
aggggggcgg agcctatgga aaaacgccag 2280caacgcggcc tttttacggt tcctggcctt
ttgctggcct tttgctcaca tgttctttcc 2340tgcgttatcc cctgattctg tggataaccg
tattaccgcc tttgagtgag ctgataccgc 2400tcgccgcagc cgaacgaccg agcgcagcga
gtcagtgagc gaggaagcgg aagagcgcct 2460gatgcggtat tttctcctta cgcatctgtg
cggtatttca caccgcatat ggtgcactct 2520cagtacaatc tgctctgatg ccgcatagtt
aagccagtat acactccgct atcgctacgt 2580gactgggtca tggctgcgcc ccgacacccg
ccaacacccg ctgacgcgcc ctgacgggct 2640tgtctgctcc cggcatccgc ttacagacaa
gctgtgaccg tctccgggag ctgcatgtgt 2700cagaggtttt caccgtcatc accgaaacgc
gcgaggcagc tgcggtaaag ctcatcagcg 2760tggtcgtgaa gcgattcaca gatgtctgcc
tgttcatccg cgtccagctc gttgagtttc 2820tccagaagcg ttaatgtctg gcttctgata
aagcgggcca tgttaagggc ggttttttcc 2880tgtttggtca ctgatgcctc cgtgtaaggg
ggatttctgt tcatgggggt aatgataccg 2940atgaaacgag agaggatgct cacgatacgg
gttactgatg atgaacatgc ccggttactg 3000gaacgttgtg agggtaaaca actggcggta
tggatgcggc gggaccagag aaaaatcact 3060cagggtcaat gccagcgctt cgttaataca
gatgtaggtg ttccacaggg tagccagcag 3120catcctgcga tgcagatccg gaacataatg
gtgcagggcg ctgacttccg cgtttccaga 3180ctttacgaaa cacggaaacc gaagaccatt
catgttgttg ctcaggtcgc agacgttttg 3240cagcagcagt cgcttcacgt tcgctcgcgt
atcggtgatt cattctgcta accagtaagg 3300caaccccgcc agcctagccg ggtcctcaac
gacaggagca cgatcatgcg cacccgtggc 3360caggacccaa cgctgcccga gatgcgccgc
gtgcggctgc tggagatggc ggacgcgatg 3420gatatgttct gccaagggtt ggtttgcgca
ttcacagttc tccgcaagaa ttgattggct 3480ccaattcttg gagtggtgaa tccgttagcg
aggtgccgcc ggcttccatt caggtcgagg 3540tggcccggct ccatgcaccg cgacgcaacg
cggggaggca gacaaggtat agggcggcgc 3600ctacaatcca tgccaacccg ttccatgtgc
tcgccgaggc ggcataaatc gccgtgacga 3660tcagcggtcc agtgatcgaa gttaggctgg
taagagccgc gagcgatcct tgaagctgtc 3720cctgatggtc gtcatctacc tgcctggaca
gcatggcctg caacgcgggc atcccgatgc 3780cgccggaagc gagaagaatc ataatgggga
aggccatcca gcctcgcgtc gcgaacgcca 3840gcaagacgta gcccagcgcg tcggccgcca
tgccggcgat aatggcctgc ttctcgccga 3900aacgtttggt ggcgggacca gtgacgaagg
cttgagcgag ggcgtgcaag attccgaata 3960ccgcaagcga caggccgatc atcgtcgcgc
tccagcgaaa gcggtcctcg ccgaaaatga 4020cccagagcgc tgccggcacc tgtcctacga
gttgcatgat aaagaagaca gtcataagtg 4080cggcgacgat agtcatgccc cgcgcccacc
ggaaggagct gactgggttg aaggctctca 4140agggcatcgg tcgacgctct cccttatgcg
actcctgcat taggaagcag cccagtagta 4200ggttgaggcc gttgagcacc gccgccgcaa
ggaatggtgc atgcaaggag atggcgccca 4260acagtccccc ggccacgggg cctgccacca
tacccacgcc gaaacaagcg ctcatgagcc 4320cgaagtggcg agcccgatct tccccatcgg
tgatgtcggc gatataggcg ccagcaaccg 4380cacctgtggc gccggtgatg ccggccacga
tgcgtccggc gtagaggatc cgggcttatc 4440gactgcacgg tgcaccaatg cttctggcgt
caggcagcca tcggaagctg tggtatggct 4500gtgcaggtcg taaatcactg cataattcgt
gtcgctcaag gcgcactccc gttctggata 4560atgttttttg cgccgacatc ataacggttc
tggcaaatat tctgaaatga gctg 461498PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Histidine tag
peptide sequence 9Ser Arg Ser His His His His His 1 5
108241DNAArtificial SequenceDescription of Artificial Sequence
Synthetic pKK223-kgd plasmid with codon optimized kgd gene nucleic
acid sequence 10ttgacaatta atcatcggct cgtataatgt gtggaattgt
gagcggataa caatttcaca 60caggaaacag aaccatggat cgtaaatttc gtgatgatcc
gtcttccgtt gacccaagct 120ggcatgagtt tctggtggac tatagcccgg agccgacttc
ccaaccggct gctgagccga 180ctcgtgtgac cagccctttg gtcgctgagc gtgcggcagc
ggcggctccg caagcgccgc 240cgaaaccggc cgacacggcc gcagcgggca acggtgtcgt
ggcggctctg gccgccaaga 300ccgcggtgcc tccgccagcc gaaggcgatg aagttgctgt
cctgcgtggt gcggcggctg 360ctgtcgtgaa gaacatgagc gcgtcgctgg aagtgcctac
ggcgacctcg gtgcgtgctg 420tgccagcgaa attgttgatc gataatcgta tcgtgatcaa
taatcagttg aaacgcacgc 480gtggtggtaa aatcagcttt acccatttgc tgggttatgc
tctggttcag gcggttaaga 540agttcccgaa tatgaatcgc cactacacgg aggtggacgg
taagccgacg gcggttactc 600ctgcgcacac caatctgggt ctggctattg acctgcaagg
taaagatggc aagcgctctc 660tggtggtggc cggtatcaaa cgttgcgaga cgatgcgctt
cgcgcagttc gttaccgcgt 720acgaggacat cgtccgtcgt gctcgtgatg gtaaactgac
caccgaggac ttcgctggcg 780ttacgatttc gctgacgaat ccgggcacga ttggcacggt
gcactctgtg ccacgcctga 840tgccaggtca aggtgctatc atcggtgtcg gtgcgatgga
atatccggcg gagttccaag 900gcgcgtccga ggaacgcatc gctgagctgg gtattggcaa
actgattacc ctgacttcta 960cctacgacca ccgtatcatt caaggtgcgg aaagcggtga
cttcctgcgt accattcatg 1020aactgctgtt gtctgatggc ttctgggatg aggtcttccg
cgagctgagc atcccgtacc 1080tgccagtgcg ttggagcacc gataatccgg actcgatcgt
tgacaagaac gcacgtgtga 1140tgaacctgat cgcggcctat cgcaaccgcg gccatctgat
ggcggacacc gacccgttgc 1200gcttggataa ggcgcgcttt cgttcgcatc cggatttgga
ggtgttgacg catggcctga 1260ctctgtggga cctggaccgc gtctttaagg ttgacggttt
cgcgggtgct caatacaaaa 1320agctgcgtga cgtgctgggt ttgctgcgcg acgcgtactg
ccgtcacatc ggtgttgagt 1380acgcgcacat tctggacccg gaacaaaagg agtggctgga
gcagcgtgtc gagacgaagc 1440acgtcaaacc gaccgttgct caacaaaagt acatcttgtc
gaaactgaac gcagcggagg 1500cgtttgaaac cttcctgcaa accaagtatg tgggccaaaa
gcgttttagc ctggagggtg 1560cggaatctgt tattccaatg atggacgcgg cgattgacca
atgtgccgag catggtttgg 1620atgaagtggt cattggcatg ccgcaccgtg gtcgcttgaa
tgtcctggcg aacatcgtgg 1680gcaaaccgta ttcgcaaatc tttacggagt ttgaaggcaa
tctgaacccg tcccaggctc 1740acggttccgg cgatgtcaag taccacctgg gtgcgacggg
tctgtatctg caaatgtttg 1800gcgataacga tattcaggtt tccctgacgg caaatccgtc
ccatttggaa gcggtcgatc 1860cagtgctgga aggtttggtg cgtgcgaagc aagacctgct
ggaccacggt tccattgact 1920ccgacggcca acgtgcattc tccgtcgttc cgttgatgct
gcacggtgat gcggccttcg 1980cgggtcaagg cgttgttgcg gagacgctga atctggcaaa
tctgcctggc tatcgtgtgg 2040gtggtacgat tcacatcatt gtgaacaacc aaatcggctt
caccaccgct ccggaatact 2100ctcgttcgag cgagtactgc acggatgtgg cgaagatgat
cggtgcgcca atcttccacg 2160tgaacggcga cgatccagaa gcgtgtgtct gggttgcgcg
tttggcagtt gacttccgcc 2220aacgctttaa aaaggacgtt gttattgaca tgctgtgcta
tcgtcgtcgt ggtcataatg 2280agggtgacga tccatctatg accaatccgt atgtctatga
cgtcgtggac accaagcgtg 2340gcgcccgtaa atcctacacc gaggctctga tcggtcgtgg
cgacatcagc atgaaagagg 2400cggaggatgc gctgcgcgat taccagggcc aactggagcg
tgtgttcaac gaagtgcgcg 2460aactggagaa gcacggcgtc caaccgtcgg agagcgtcga
gtcggaccaa atgatcccag 2520cgggcctggc gaccgctgtt gacaaatccc tgctggcacg
tatcggtgat gccttcctgg 2580cgctgcctaa cggtttcacg gcacacccgc gcgttcagcc
ggtgctggaa aagcgtcgtg 2640agatggcgta tgagggtaag attgactggg cgtttggtga
gttgctggcg ctgggcagcc 2700tggttgctga gggcaagctg gtccgtctga gcggtcaaga
ctctcgtcgt ggcaccttta 2760gccagcgtca ttctgtgctg atcgaccgtc acaccggcga
ggagttcacc ccgctgcagc 2820tgctggcgac taacagcgac ggcagcccga ccggtggtaa
gttcctggtt tatgattcgc 2880cgttgtcgga atacgcggct gtgggttttg agtacggtta
taccgttggc aatccagacg 2940cggttgtgct gtgggaggcg caattcggcg actttgttaa
tggtgcccag tcgatcattg 3000acgagttcat cagctcgggc gaagcgaaat ggggtcagct
gtccaacgtt gttctgttgc 3060tgccacacgg ccacgagggt cagggcccgg accacacgtc
ggcgcgcatt gagcgctttt 3120tgcagctgtg ggctgagggt agcatgacga tcgcgatgcc
gagcaccccg tccaattact 3180ttcacttgct gcgccgccac gcgttggacg gcatccaacg
tccgttgatc gtgtttaccc 3240cgaaatccat gctgcgccac aaggcggcgg tttcggagat
taaggatttt accgagatta 3300aattccgtag cgtcctggag gaaccgacct acgaggatgg
tatcggcgac cgcaataaag 3360ttagccgtat tctgttgacc tccggtaagt tgtattatga
attggcggca cgcaaggcga 3420aagacaaccg taatgatctg gcaattgtgc gtctggagca
actggcgccg ttgccgcgtc 3480gtcgtctgcg tgaaaccctg gatcgttacg aaaatgtcaa
agagttcttt tgggtccagg 3540aggaaccagc gaaccagggc gcctggccgc gtttcggttt
ggagttgccg gagttgctgc 3600cggacaagtt ggcgggcatc aagcgtatct cccgtcgcgc
gatgtctgcg ccgagcagcg 3660gttcctcgaa ggttcatgcc gtggagcagc aagaaatctt
ggacgaagcg ttcggatcta 3720gatctcacca tcaccaccat tagtcgacct gcagccaagc
ttggctgttt tggcggatga 3780gagaagattt tcagcctgat acagattaaa tcagaacgca
gaagcggtct gataaaacag 3840aatttgcctg gcggcagtag cgcggtggtc ccacctgacc
ccatgccgaa ctcagaagtg 3900aaacgccgta gcgccgatgg tagtgtgggg tctccccatg
cgagagtagg gaactgccag 3960gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc
tttcgtttta tctgttgttt 4020gtcggtgaac gctctcctga gtaggacaaa tccgccggga
gcggatttga acgttgcgaa 4080gcaacggccc ggagggtggc gggcaggacg cccgccataa
actgccaggc atcaaattaa 4140gcagaaggcc atcctgacgg atggcctttt tgcgtttcta
caaactcttt tgtttatttt 4200tctaaataca ttcaaatatg tatccgctca tgagacaata
accctgataa atgcttcaat 4260aatattgaaa aaggaagagt atgagtattc aacatttccg
tgtcgccctt attccctttt 4320ttgcggcatt ttgccttcct gtttttgctc acccagaaac
gctggtgaaa gtaaaagatg 4380ctgaagatca gttgggtgca cgagtgggtt acatcgaact
ggatctcaac agcggtaaga 4440tccttgagag ttttcgcccc gaagaacgtt ttccaatgat
gagcactttt aaagttctgc 4500tatgtggcgc ggtattatcc cgtgttgacg ccgggcaaga
gcaactcggt cgccgcatac 4560actattctca gaatgacttg gttgagtact caccagtcac
agaaaagcat cttacggatg 4620gcatgacagt aagagaatta tgcagtgctg ccataaccat
gagtgataac actgcggcca 4680acttacttct gacaacgatc ggaggaccga aggagctaac
cgcttttttg cacaacatgg 4740gggatcatgt aactcgcctt gatcgttggg aaccggagct
gaatgaagcc ataccaaacg 4800acgagcgtga caccacgatg ctgtagcaat ggcaacaacg
ttgcgcaaac tattaactgg 4860cgaactactt actctagctt cccggcaaca attaatagac
tggatggagg cggataaagt 4920tgcaggacca cttctgcgct cggcccttcc ggctggctgg
tttattgctg ataaatctgg 4980agccggtgag cgtgggtctc gcggtatcat tgcagcactg
gggccagatg gtaagccctc 5040ccgtatcgta gttatctaca cgacggggag tcaggcaact
atggatgaac gaaatagaca 5100gatcgctgag ataggtgcct cactgattaa gcattggtaa
ctgtcagacc aagtttactc 5160atatatactt tagattgatt taaaacttca tttttaattt
aaaaggatct aggtgaagat 5220cctttttgat aatctcatga ccaaaatccc ttaacgtgag
ttttcgttcc actgagcgtc 5280agaccccgta gaaaagatca aaggatcttc ttgagatcct
ttttttctgc gcgtaatctg 5340ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt
tgtttgccgg atcaagagct 5400accaactctt tttccgaagg taactggctt cagcagagcg
cagataccaa atactgtcct 5460tctagtgtag ccgtagttag gccaccactt caagaactct
gtagcaccgc ctacatacct 5520cgctctgcta atcctgttac cagtggctgc tgccagtggc
gataagtcgt gtcttaccgg 5580gttggactca agacgatagt taccggataa ggcgcagcgg
tcgggctgaa cggggggttc 5640gtgcacacag cccagcttgg agcgaacgac ctacaccgaa
ctgagatacc tacagcgtga 5700gcattgagaa agcgccacgc ttcccgaagg gagaaaggcg
gacaggtatc cggtaagcgg 5760cagggtcgga acaggagagc gcacgaggga gcttccaggg
ggaaacgcct ggtatcttta 5820tagtcctgtc gggtttcgcc acctctgact tgagcgtcga
tttttgtgat gctcgtcagg 5880ggggcggagc ctatggaaaa acgccagcaa cgcggccttt
ttacggttcc tggccttttg 5940ctggcctttt gctcacatgt tctttcctgc gttatcccct
gattctgtgg ataaccgtat 6000taccgccttt gagtgagctg ataccgctcg ccgcagccga
acgaccgagc gcagcgagtc 6060agtgagcgag gaagcggaag agcgcctgat gcggtatttt
ctccttacgc atctgtgcgg 6120tatttcacac cgcatatggt gcactctcag tacaatctgc
tctgatgccg catagttaag 6180ccagtataca ctccgctatc gctacgtgac tgggtcatgg
ctgcgccccg acacccgcca 6240acacccgctg acgcgccctg acgggcttgt ctgctcccgg
catccgctta cagacaagct 6300gtgaccgtct ccgggagctg catgtgtcag aggttttcac
cgtcatcacc gaaacgcgcg 6360aggcagctgc ggtaaagctc atcagcgtgg tcgtgaagcg
attcacagat gtctgcctgt 6420tcatccgcgt ccagctcgtt gagtttctcc agaagcgtta
atgtctggct tctgataaag 6480cgggccatgt taagggcggt tttttcctgt ttggtcactg
atgcctccgt gtaaggggga 6540tttctgttca tgggggtaat gataccgatg aaacgagaga
ggatgctcac gatacgggtt 6600actgatgatg aacatgcccg gttactggaa cgttgtgagg
gtaaacaact ggcggtatgg 6660atgcggcggg accagagaaa aatcactcag ggtcaatgcc
agcgcttcgt taatacagat 6720gtaggtgttc cacagggtag ccagcagcat cctgcgatgc
agatccggaa cataatggtg 6780cagggcgctg acttccgcgt ttccagactt tacgaaacac
ggaaaccgaa gaccattcat 6840gttgttgctc aggtcgcaga cgttttgcag cagcagtcgc
ttcacgttcg ctcgcgtatc 6900ggtgattcat tctgctaacc agtaaggcaa ccccgccagc
ctagccgggt cctcaacgac 6960aggagcacga tcatgcgcac ccgtggccag gacccaacgc
tgcccgagat gcgccgcgtg 7020cggctgctgg agatggcgga cgcgatggat atgttctgcc
aagggttggt ttgcgcattc 7080acagttctcc gcaagaattg attggctcca attcttggag
tggtgaatcc gttagcgagg 7140tgccgccggc ttccattcag gtcgaggtgg cccggctcca
tgcaccgcga cgcaacgcgg 7200ggaggcagac aaggtatagg gcggcgccta caatccatgc
caacccgttc catgtgctcg 7260ccgaggcggc ataaatcgcc gtgacgatca gcggtccagt
gatcgaagtt aggctggtaa 7320gagccgcgag cgatccttga agctgtccct gatggtcgtc
atctacctgc ctggacagca 7380tggcctgcaa cgcgggcatc ccgatgccgc cggaagcgag
aagaatcata atggggaagg 7440ccatccagcc tcgcgtcgcg aacgccagca agacgtagcc
cagcgcgtcg gccgccatgc 7500cggcgataat ggcctgcttc tcgccgaaac gtttggtggc
gggaccagtg acgaaggctt 7560gagcgagggc gtgcaagatt ccgaataccg caagcgacag
gccgatcatc gtcgcgctcc 7620agcgaaagcg gtcctcgccg aaaatgaccc agagcgctgc
cggcacctgt cctacgagtt 7680gcatgataaa gaagacagtc ataagtgcgg cgacgatagt
catgccccgc gcccaccgga 7740aggagctgac tgggttgaag gctctcaagg gcatcggtcg
acgctctccc ttatgcgact 7800cctgcattag gaagcagccc agtagtaggt tgaggccgtt
gagcaccgcc gccgcaagga 7860atggtgcatg caaggagatg gcgcccaaca gtcccccggc
cacggggcct gccaccatac 7920ccacgccgaa acaagcgctc atgagcccga agtggcgagc
ccgatcttcc ccatcggtga 7980tgtcggcgat ataggcgcca gcaaccgcac ctgtggcgcc
ggtgatgccg gccacgatgc 8040gtccggcgta gaggatccgg gcttatcgac tgcacggtgc
accaatgctt ctggcgtcag 8100gcagccatcg gaagctgtgg tatggctgtg caggtcgtaa
atcactgcat aattcgtgtc 8160gctcaaggcg cactcccgtt ctggataatg ttttttgcgc
cgacatcata acggttctgg 8220caaatattct gaaatgagct g
8241113716DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Codon-optimized mcr nucleic acid
sequence 11gatatcgaat tccgctagca ggagctaagg aagctaaaat gtccggtacg
ggtcgtttgg 60ctggtaaaat tgcattgatc accggtggtg ctggtaacat tggttccgag
ctgacccgcc 120gttttctggc cgagggtgcg acggttatta tcagcggccg taaccgtgcg
aagctgaccg 180cgctggccga gcgcatgcaa gccgaggccg gcgtgccggc caagcgcatt
gatttggagg 240tgatggatgg ttccgaccct gtggctgtcc gtgccggtat cgaggcaatc
gtcgctcgcc 300acggtcagat tgacattctg gttaacaacg cgggctccgc cggtgcccaa
cgtcgcttgg 360cggaaattcc gctgacggag gcagaattgg gtccgggtgc ggaggagact
ttgcacgctt 420cgatcgcgaa tctgttgggc atgggttggc acctgatgcg tattgcggct
ccgcacatgc 480cagttggctc cgcagttatc aacgtttcga ctattttctc gcgcgcagag
tactatggtc 540gcattccgta cgttaccccg aaggcagcgc tgaacgcttt gtcccagctg
gctgcccgcg 600agctgggcgc tcgtggcatc cgcgttaaca ctattttccc aggtcctatt
gagtccgacc 660gcatccgtac cgtgtttcaa cgtatggatc aactgaaggg tcgcccggag
ggcgacaccg 720cccatcactt tttgaacacc atgcgcctgt gccgcgcaaa cgaccaaggc
gctttggaac 780gccgctttcc gtccgttggc gatgttgctg atgcggctgt gtttctggct
tctgctgaga 840gcgcggcact gtcgggtgag acgattgagg tcacccacgg tatggaactg
ccggcgtgta 900gcgaaacctc cttgttggcg cgtaccgatc tgcgtaccat cgacgcgagc
ggtcgcacta 960ccctgatttg cgctggcgat caaattgaag aagttatggc cctgacgggc
atgctgcgta 1020cgtgcggtag cgaagtgatt atcggcttcc gttctgcggc tgccctggcg
caatttgagc 1080aggcagtgaa tgaatctcgc cgtctggcag gtgcggattt caccccgccg
atcgctttgc 1140cgttggaccc acgtgacccg gccaccattg atgcggtttt cgattggggc
gcaggcgaga 1200atacgggtgg catccatgcg gcggtcattc tgccggcaac ctcccacgaa
ccggctccgt 1260gcgtgattga agtcgatgac gaacgcgtcc tgaatttcct ggccgatgaa
attaccggca 1320ccatcgttat tgcgagccgt ttggcgcgct attggcaatc ccaacgcctg
accccgggtg 1380cccgtgcccg cggtccgcgt gttatctttc tgagcaacgg tgccgatcaa
aatggtaatg 1440tttacggtcg tattcaatct gcggcgatcg gtcaattgat tcgcgtttgg
cgtcacgagg 1500cggagttgga ctatcaacgt gcatccgccg caggcgatca cgttctgccg
ccggtttggg 1560cgaaccagat tgtccgtttc gctaaccgct ccctggaagg tctggagttc
gcgtgcgcgt 1620ggaccgcaca gctgctgcac agccaacgtc atattaacga aattacgctg
aacattccag 1680ccaatattag cgcgaccacg ggcgcacgtt ccgccagcgt cggctgggcc
gagtccttga 1740ttggtctgca cctgggcaag gtggctctga ttaccggtgg ttcggcgggc
atcggtggtc 1800aaatcggtcg tctgctggcc ttgtctggcg cgcgtgtgat gctggccgct
cgcgatcgcc 1860ataaattgga acagatgcaa gccatgattc aaagcgaatt ggcggaggtt
ggttataccg 1920atgtggagga ccgtgtgcac atcgctccgg gttgcgatgt gagcagcgag
gcgcagctgg 1980cagatctggt ggaacgtacg ctgtccgcat tcggtaccgt ggattatttg
attaataacg 2040ccggtattgc gggcgtggag gagatggtga tcgacatgcc ggtggaaggc
tggcgtcaca 2100ccctgtttgc caacctgatt tcgaattatt cgctgatgcg caagttggcg
ccgctgatga 2160agaagcaagg tagcggttac atcctgaacg tttcttccta ttttggcggt
gagaaggacg 2220cggcgattcc ttatccgaac cgcgccgact acgccgtctc caaggctggc
caacgcgcga 2280tggcggaagt gttcgctcgt ttcctgggtc cagagattca gatcaatgct
attgccccag 2340gtccggttga aggcgaccgc ctgcgtggta ccggtgagcg tccgggcctg
tttgctcgtc 2400gcgcccgtct gatcttggag aataaacgcc tgaacgaatt gcacgcggct
ttgattgctg 2460cggcccgcac cgatgagcgc tcgatgcacg agttggttga attgttgctg
ccgaacgacg 2520tggccgcgtt ggagcagaac ccagcggccc ctaccgcgct gcgtgagctg
gcacgccgct 2580tccgtagcga aggtgatccg gcggcaagct cctcgtccgc cttgctgaat
cgctccatcg 2640ctgccaagct gttggctcgc ttgcataacg gtggctatgt gctgccggcg
gatatttttg 2700caaatctgcc taatccgccg gacccgttct ttacccgtgc gcaaattgac
cgcgaagctc 2760gcaaggtgcg tgatggtatt atgggtatgc tgtatctgca gcgtatgcca
accgagtttg 2820acgtcgctat ggcaaccgtg tactatctgg ccgatcgtaa cgtgagcggc
gaaactttcc 2880atccgtctgg tggtttgcgc tacgagcgta ccccgaccgg tggcgagctg
ttcggcctgc 2940catcgccgga acgtctggcg gagctggttg gtagcacggt gtacctgatc
ggtgaacacc 3000tgaccgagca cctgaacctg ctggctcgtg cctatttgga gcgctacggt
gcccgtcaag 3060tggtgatgat tgttgagacg gaaaccggtg cggaaaccat gcgtcgtctg
ttgcatgatc 3120acgtcgaggc aggtcgcctg atgactattg tggcaggtga tcagattgag
gcagcgattg 3180accaagcgat cacgcgctat ggccgtccgg gtccggtggt gtgcactcca
ttccgtccac 3240tgccaaccgt tccgctggtc ggtcgtaaag actccgattg gagcaccgtt
ttgagcgagg 3300cggaatttgc ggaactgtgt gagcatcagc tgacccacca tttccgtgtt
gctcgtaaga 3360tcgccttgtc ggatggcgcg tcgctggcgt tggttacccc ggaaacgact
gcgactagca 3420ccacggagca atttgctctg gcgaacttca tcaagaccac cctgcacgcg
ttcaccgcga 3480ccatcggtgt tgagtcggag cgcaccgcgc aacgtattct gattaaccag
gttgatctga 3540cgcgccgcgc ccgtgcggaa gagccgcgtg acccgcacga gcgtcagcag
gaattggaac 3600gcttcattga agccgttctg ctggttaccg ctccgctgcc tcctgaggca
gacacgcgct 3660acgcaggccg tattcaccgc ggtcgtgcga ttaccgtcta atagaagctt
gatatc 37161245DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 12tcgtaccaac catggccggt acgggtcgtt
tggctggtaa aattg 451342DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
13cggtgtgaga tctagatccg acggtaatcg cacgaccgcg gt
42148262DNAArtificial SequenceDescription of Artificial Sequence
Synthetic pkk223 plasmid comprising codon-optimized mcr nucleic acid
sequence 14ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcggataa
caatttcaca 60caggaaacag aaccatggcc ggtacgggtc gtttggctgg taaaattgca
ttgatcaccg 120gtggtgctgg taacattggt tccgagctga cccgccgttt tctggccgag
ggtgcgacgg 180ttattatcag cggccgtaac cgtgcgaagc tgaccgcgct ggccgagcgc
atgcaagccg 240aggccggcgt gccggccaag cgcattgatt tggaggtgat ggatggttcc
gaccctgtgg 300ctgtccgtgc cggtatcgag gcaatcgtcg ctcgccacgg tcagattgac
attctggtta 360acaacgcggg ctccgccggt gcccaacgtc gcttggcgga aattccgctg
acggaggcag 420aattgggtcc gggtgcggag gagactttgc acgcttcgat cgcgaatctg
ttgggcatgg 480gttggcacct gatgcgtatt gcggctccgc acatgccagt tggctccgca
gttatcaacg 540tttcgactat tttctcgcgc gcagagtact atggtcgcat tccgtacgtt
accccgaagg 600cagcgctgaa cgctttgtcc cagctggctg cccgcgagct gggcgctcgt
ggcatccgcg 660ttaacactat tttcccaggt cctattgagt ccgaccgcat ccgtaccgtg
tttcaacgta 720tggatcaact gaagggtcgc ccggagggcg acaccgccca tcactttttg
aacaccatgc 780gcctgtgccg cgcaaacgac caaggcgctt tggaacgccg ctttccgtcc
gttggcgatg 840ttgctgatgc ggctgtgttt ctggcttctg ctgagagcgc ggcactgtcg
ggtgagacga 900ttgaggtcac ccacggtatg gaactgccgg cgtgtagcga aacctccttg
ttggcgcgta 960ccgatctgcg taccatcgac gcgagcggtc gcactaccct gatttgcgct
ggcgatcaaa 1020ttgaagaagt tatggccctg acgggcatgc tgcgtacgtg cggtagcgaa
gtgattatcg 1080gcttccgttc tgcggctgcc ctggcgcaat ttgagcaggc agtgaatgaa
tctcgccgtc 1140tggcaggtgc ggatttcacc ccgccgatcg ctttgccgtt ggacccacgt
gacccggcca 1200ccattgatgc ggttttcgat tggggcgcag gcgagaatac gggtggcatc
catgcggcgg 1260tcattctgcc ggcaacctcc cacgaaccgg ctccgtgcgt gattgaagtc
gatgacgaac 1320gcgtcctgaa tttcctggcc gatgaaatta ccggcaccat cgttattgcg
agccgtttgg 1380cgcgctattg gcaatcccaa cgcctgaccc cgggtgcccg tgcccgcggt
ccgcgtgtta 1440tctttctgag caacggtgcc gatcaaaatg gtaatgttta cggtcgtatt
caatctgcgg 1500cgatcggtca attgattcgc gtttggcgtc acgaggcgga gttggactat
caacgtgcat 1560ccgccgcagg cgatcacgtt ctgccgccgg tttgggcgaa ccagattgtc
cgtttcgcta 1620accgctccct ggaaggtctg gagttcgcgt gcgcgtggac cgcacagctg
ctgcacagcc 1680aacgtcatat taacgaaatt acgctgaaca ttccagccaa tattagcgcg
accacgggcg 1740cacgttccgc cagcgtcggc tgggccgagt ccttgattgg tctgcacctg
ggcaaggtgg 1800ctctgattac cggtggttcg gcgggcatcg gtggtcaaat cggtcgtctg
ctggccttgt 1860ctggcgcgcg tgtgatgctg gccgctcgcg atcgccataa attggaacag
atgcaagcca 1920tgattcaaag cgaattggcg gaggttggtt ataccgatgt ggaggaccgt
gtgcacatcg 1980ctccgggttg cgatgtgagc agcgaggcgc agctggcaga tctggtggaa
cgtacgctgt 2040ccgcattcgg taccgtggat tatttgatta ataacgccgg tattgcgggc
gtggaggaga 2100tggtgatcga catgccggtg gaaggctggc gtcacaccct gtttgccaac
ctgatttcga 2160attattcgct gatgcgcaag ttggcgccgc tgatgaagaa gcaaggtagc
ggttacatcc 2220tgaacgtttc ttcctatttt ggcggtgaga aggacgcggc gattccttat
ccgaaccgcg 2280ccgactacgc cgtctccaag gctggccaac gcgcgatggc ggaagtgttc
gctcgtttcc 2340tgggtccaga gattcagatc aatgctattg ccccaggtcc ggttgaaggc
gaccgcctgc 2400gtggtaccgg tgagcgtccg ggcctgtttg ctcgtcgcgc ccgtctgatc
ttggagaata 2460aacgcctgaa cgaattgcac gcggctttga ttgctgcggc ccgcaccgat
gagcgctcga 2520tgcacgagtt ggttgaattg ttgctgccga acgacgtggc cgcgttggag
cagaacccag 2580cggcccctac cgcgctgcgt gagctggcac gccgcttccg tagcgaaggt
gatccggcgg 2640caagctcctc gtccgccttg ctgaatcgct ccatcgctgc caagctgttg
gctcgcttgc 2700ataacggtgg ctatgtgctg ccggcggata tttttgcaaa tctgcctaat
ccgccggacc 2760cgttctttac ccgtgcgcaa attgaccgcg aagctcgcaa ggtgcgtgat
ggtattatgg 2820gtatgctgta tctgcagcgt atgccaaccg agtttgacgt cgctatggca
accgtgtact 2880atctggccga tcgtaacgtg agcggcgaaa ctttccatcc gtctggtggt
ttgcgctacg 2940agcgtacccc gaccggtggc gagctgttcg gcctgccatc gccggaacgt
ctggcggagc 3000tggttggtag cacggtgtac ctgatcggtg aacacctgac cgagcacctg
aacctgctgg 3060ctcgtgccta tttggagcgc tacggtgccc gtcaagtggt gatgattgtt
gagacggaaa 3120ccggtgcgga aaccatgcgt cgtctgttgc atgatcacgt cgaggcaggt
cgcctgatga 3180ctattgtggc aggtgatcag attgaggcag cgattgacca agcgatcacg
cgctatggcc 3240gtccgggtcc ggtggtgtgc actccattcc gtccactgcc aaccgttccg
ctggtcggtc 3300gtaaagactc cgattggagc accgttttga gcgaggcgga atttgcggaa
ctgtgtgagc 3360atcagctgac ccaccatttc cgtgttgctc gtaagatcgc cttgtcggat
ggcgcgtcgc 3420tggcgttggt taccccggaa acgactgcga ctagcaccac ggagcaattt
gctctggcga 3480acttcatcaa gaccaccctg cacgcgttca ccgcgaccat cggtgttgag
tcggagcgca 3540ccgcgcaacg tattctgatt aaccaggttg atctgacgcg ccgcgcccgt
gcggaagagc 3600cgcgtgaccc gcacgagcgt cagcaggaat tggaacgctt cattgaagcc
gttctgctgg 3660ttaccgctcc gctgcctcct gaggcagaca cgcgctacgc aggccgtatt
caccgcggtc 3720gtgcgattac cgtcggatct agatctcacc atcaccacca ttagtcgacc
tgcagccaag 3780cttggctgtt ttggcggatg agagaagatt ttcagcctga tacagattaa
atcagaacgc 3840agaagcggtc tgataaaaca gaatttgcct ggcggcagta gcgcggtggt
cccacctgac 3900cccatgccga actcagaagt gaaacgccgt agcgccgatg gtagtgtggg
gtctccccat 3960gcgagagtag ggaactgcca ggcatcaaat aaaacgaaag gctcagtcga
aagactgggc 4020ctttcgtttt atctgttgtt tgtcggtgaa cgctctcctg agtaggacaa
atccgccggg 4080agcggatttg aacgttgcga agcaacggcc cggagggtgg cgggcaggac
gcccgccata 4140aactgccagg catcaaatta agcagaaggc catcctgacg gatggccttt
ttgcgtttct 4200acaaactctt ttgtttattt ttctaaatac attcaaatat gtatccgctc
atgagacaat 4260aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt
caacatttcc 4320gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct
cacccagaaa 4380cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt
tacatcgaac 4440tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt
tttccaatga 4500tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtgttgac
gccgggcaag 4560agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac
tcaccagtca 4620cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct
gccataacca 4680tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg
aaggagctaa 4740ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg
gaaccggagc 4800tgaatgaagc cataccaaac gacgagcgtg acaccacgat gctgtagcaa
tggcaacaac 4860gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac
aattaataga 4920ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc
cggctggctg 4980gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca
ttgcagcact 5040ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga
gtcaggcaac 5100tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta
agcattggta 5160actgtcagac caagtttact catatatact ttagattgat ttaaaacttc
atttttaatt 5220taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc
cttaacgtga 5280gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt
cttgagatcc 5340tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac
cagcggtggt 5400ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct
tcagcagagc 5460gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact
tcaagaactc 5520tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg
ctgccagtgg 5580cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata
aggcgcagcg 5640gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga
cctacaccga 5700actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag
ggagaaaggc 5760ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg
agcttccagg 5820gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac
ttgagcgtcg 5880atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca
acgcggcctt 5940tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg
cgttatcccc 6000tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc
gccgcagccg 6060aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcctga
tgcggtattt 6120tctccttacg catctgtgcg gtatttcaca ccgcatatgg tgcactctca
gtacaatctg 6180ctctgatgcc gcatagttaa gccagtatac actccgctat cgctacgtga
ctgggtcatg 6240gctgcgcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg
tctgctcccg 6300gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca
gaggttttca 6360ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct catcagcgtg
gtcgtgaagc 6420gattcacaga tgtctgcctg ttcatccgcg tccagctcgt tgagtttctc
cagaagcgtt 6480aatgtctggc ttctgataaa gcgggccatg ttaagggcgg ttttttcctg
tttggtcact 6540gatgcctccg tgtaaggggg atttctgttc atgggggtaa tgataccgat
gaaacgagag 6600aggatgctca cgatacgggt tactgatgat gaacatgccc ggttactgga
acgttgtgag 6660ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa aaatcactca
gggtcaatgc 6720cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta gccagcagca
tcctgcgatg 6780cagatccgga acataatggt gcagggcgct gacttccgcg tttccagact
ttacgaaaca 6840cggaaaccga agaccattca tgttgttgct caggtcgcag acgttttgca
gcagcagtcg 6900cttcacgttc gctcgcgtat cggtgattca ttctgctaac cagtaaggca
accccgccag 6960cctagccggg tcctcaacga caggagcacg atcatgcgca cccgtggcca
ggacccaacg 7020ctgcccgaga tgcgccgcgt gcggctgctg gagatggcgg acgcgatgga
tatgttctgc 7080caagggttgg tttgcgcatt cacagttctc cgcaagaatt gattggctcc
aattcttgga 7140gtggtgaatc cgttagcgag gtgccgccgg cttccattca ggtcgaggtg
gcccggctcc 7200atgcaccgcg acgcaacgcg gggaggcaga caaggtatag ggcggcgcct
acaatccatg 7260ccaacccgtt ccatgtgctc gccgaggcgg cataaatcgc cgtgacgatc
agcggtccag 7320tgatcgaagt taggctggta agagccgcga gcgatccttg aagctgtccc
tgatggtcgt 7380catctacctg cctggacagc atggcctgca acgcgggcat cccgatgccg
ccggaagcga 7440gaagaatcat aatggggaag gccatccagc ctcgcgtcgc gaacgccagc
aagacgtagc 7500ccagcgcgtc ggccgccatg ccggcgataa tggcctgctt ctcgccgaaa
cgtttggtgg 7560cgggaccagt gacgaaggct tgagcgaggg cgtgcaagat tccgaatacc
gcaagcgaca 7620ggccgatcat cgtcgcgctc cagcgaaagc ggtcctcgcc gaaaatgacc
cagagcgctg 7680ccggcacctg tcctacgagt tgcatgataa agaagacagt cataagtgcg
gcgacgatag 7740tcatgccccg cgcccaccgg aaggagctga ctgggttgaa ggctctcaag
ggcatcggtc 7800gacgctctcc cttatgcgac tcctgcatta ggaagcagcc cagtagtagg
ttgaggccgt 7860tgagcaccgc cgccgcaagg aatggtgcat gcaaggagat ggcgcccaac
agtcccccgg 7920ccacggggcc tgccaccata cccacgccga aacaagcgct catgagcccg
aagtggcgag 7980cccgatcttc cccatcggtg atgtcggcga tataggcgcc agcaaccgca
cctgtggcgc 8040cggtgatgcc ggccacgatg cgtccggcgt agaggatccg ggcttatcga
ctgcacggtg 8100caccaatgct tctggcgtca ggcagccatc ggaagctgtg gtatggctgt
gcaggtcgta 8160aatcactgca taattcgtgt cgctcaaggc gcactcccgt tctggataat
gttttttgcg 8220ccgacatcat aacggttctg gcaaatattc tgaaatgagc tg
82621530DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 15gggtttccat ggaccagccg ctcaacgtgg
301633DNAArtificial SequenceDescription
of Artificial Sequence Synthetic PCR primer 16gggttttcag gcgatgccgt
tgagcgcttc gcc 331726DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
17gggaacggcg gggaaaaaca aacgtt
261830DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 18ggtccatggt aattctccac gcttataagc
301985DNAEscherichia coli 19ggtttgaata aatgacaaaa agcaaagcct
ttgtgccgat gaatctctat actgtttcac 60agacctgctg ccctgcgggg cggcc
852026DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
20gggaacggcg gggaaaaaca aacgtt
262133DNAArtificial SequenceDescription of Artificial Sequence Synthetic
PCR primer 21gggttttcag gcgatgccgt tgagcgcttc gcc
33221754DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Codon-optimized pyruvate decarboxylase DNA
sequence based on gene of Zymomonas mobilis 22catatgtcct acactgttgg
tacttatctg gctgaacgtc tggttcaaat tggtctgaag 60catcactttg cggtagcggg
cgattacaac ctggtgctgc tggataatct gctgctgaac 120aaaaacatgg aacaggtcta
ctgttgtaac gaactgaact gcggcttctc tgctgaaggt 180tatgcccggg ccaaaggcgc
agctgcggcc gtagtgacct actccgttgg tgctctgtcc 240gcatttgatg caattggtgg
cgcctacgca gaaaacctgc cggtaattct gatctctggc 300gctccgaaca acaacgatca
cgcagctggt cacgtgctgc accatgcgct gggcaaaact 360gattatcatt accagctgga
aatggcgaag aacatcactg ccgcagcaga agctatctat 420actccagaag aagcgccggc
aaaaatcgat catgtaatca aaacggccct gcgtgagaag 480aaaccggtgt atctggaaat
tgcttgtaat atcgcgtcta tgccgtgtgc ggccccaggc 540ccagcatctg ctctgtttaa
cgatgaagct agcgatgaag cctctctgaa cgcagctgtg 600gaagaaaccc tgaaattcat
tgcaaaccgt gacaaagttg cggtactggt tggctctaaa 660ctgcgtgccg cgggtgcaga
agaagcggcg gttaaattcg ctgacgccct gggtggtgct 720gtggccacca tggctgcggc
taaatccttt ttcccggaag aaaatccgca ttacatcggt 780acttcctggg gcgaggtttc
ttacccaggt gtcgagaaaa ccatgaagga agctgacgcg 840gtgatcgccc tggccccggt
tttcaatgac tactccacta ctggttggac cgacatcccg 900gacccaaaga aactggttct
ggcagagccg cgctccgttg ttgttaacgg tattcgcttt 960ccgtccgtac acctgaagga
ttatctgact cgtctggcgc agaaagtgag caagaaaacc 1020ggcgctctgg atttctttaa
atctctgaat gcgggtgagc tgaagaaagc cgcaccggcg 1080gacccttctg ctccgctggt
taacgccgaa attgcgcgcc aggtagaagc gctgctgact 1140ccgaatacta ccgtaattgc
ggagactggc gattcctggt tcaacgcaca acgtatgaag 1200ctgcctaacg gcgctcgagt
tgaatacgaa atgcagtggg gccacatcgg ctggtctgtt 1260cctgcagcct tcggctacgc
cgtaggtgct ccggaacgtc gtaacatcct gatggtcggt 1320gacggctctt tccaactgac
cgcgcaggaa gtagcacaga tggttcgtct gaaactgccg 1380gtaatcatct tcctgattaa
caactacggc tataccattg aggtcatgat tcatgatggt 1440ccgtataata acatcaaaaa
ctgggattat gctggtctga tggaagtttt caacggcaac 1500ggcggctacg attctggtgc
tggtaaaggc ctgaaagcaa agacgggtgg cgagctcgca 1560gaagcgatca aggttgctct
ggctaacacc gatggtccga ctctgatcga atgttttatc 1620ggtcgtgaag attgcactga
ggaactggtg aagtggggta agcgtgtggc tgccgcgaat 1680tcccgtaaac cggtaaataa
gcttctcggc catcaccatc accatcacta gaagcttctc 1740tagagaacta tttc
175423575PRTZymomonas mobilis
23Met Ser Tyr Thr Val Gly Thr Tyr Leu Ala Glu Arg Leu Val Gln Ile 1
5 10 15 Gly Leu Lys His
His Phe Ala Val Ala Gly Asp Tyr Asn Leu Val Leu 20
25 30 Leu Asp Asn Leu Leu Leu Asn Lys Asn
Met Glu Gln Val Tyr Cys Cys 35 40
45 Asn Glu Leu Asn Cys Gly Phe Ser Ala Glu Gly Tyr Ala Arg
Ala Lys 50 55 60
Gly Ala Ala Ala Ala Val Val Thr Tyr Ser Val Gly Ala Leu Ser Ala 65
70 75 80 Phe Asp Ala Ile Gly
Gly Ala Tyr Ala Glu Asn Leu Pro Val Ile Leu 85
90 95 Ile Ser Gly Ala Pro Asn Asn Asn Asp His
Ala Ala Gly His Val Leu 100 105
110 His His Ala Leu Gly Lys Thr Asp Tyr His Tyr Gln Leu Glu Met
Ala 115 120 125 Lys
Asn Ile Thr Ala Ala Ala Glu Ala Ile Tyr Thr Pro Glu Glu Ala 130
135 140 Pro Ala Lys Ile Asp His
Val Ile Lys Thr Ala Leu Arg Glu Lys Lys 145 150
155 160 Pro Val Tyr Leu Glu Ile Ala Cys Asn Ile Ala
Ser Met Pro Cys Ala 165 170
175 Ala Pro Gly Pro Ala Ser Ala Leu Phe Asn Asp Glu Ala Ser Asp Glu
180 185 190 Ala Ser
Leu Asn Ala Ala Val Glu Glu Thr Leu Lys Phe Ile Ala Asn 195
200 205 Arg Asp Lys Val Ala Val Leu
Val Gly Ser Lys Leu Arg Ala Ala Gly 210 215
220 Ala Glu Glu Ala Ala Val Lys Phe Ala Asp Ala Leu
Gly Gly Ala Val 225 230 235
240 Ala Thr Met Ala Ala Ala Lys Ser Phe Phe Pro Glu Glu Asn Pro His
245 250 255 Tyr Ile Gly
Thr Ser Trp Gly Glu Val Ser Tyr Pro Gly Val Glu Lys 260
265 270 Thr Met Lys Glu Ala Asp Ala Val
Ile Ala Leu Ala Pro Val Phe Asn 275 280
285 Asp Tyr Ser Thr Thr Gly Trp Thr Asp Ile Pro Asp Pro
Lys Lys Leu 290 295 300
Val Leu Ala Glu Pro Arg Ser Val Val Val Asn Gly Ile Arg Phe Pro 305
310 315 320 Ser Val His Leu
Lys Asp Tyr Leu Thr Arg Leu Ala Gln Lys Val Ser 325
330 335 Lys Lys Thr Gly Ala Leu Asp Phe Phe
Lys Ser Leu Asn Ala Gly Glu 340 345
350 Leu Lys Lys Ala Ala Pro Ala Asp Pro Ser Ala Pro Leu Val
Asn Ala 355 360 365
Glu Ile Ala Arg Gln Val Glu Ala Leu Leu Thr Pro Asn Thr Thr Val 370
375 380 Ile Ala Glu Thr Gly
Asp Ser Trp Phe Asn Ala Gln Arg Met Lys Leu 385 390
395 400 Pro Asn Gly Ala Arg Val Glu Tyr Glu Met
Gln Trp Gly His Ile Gly 405 410
415 Trp Ser Val Pro Ala Ala Phe Gly Tyr Ala Val Gly Ala Pro Glu
Arg 420 425 430 Arg
Asn Ile Leu Met Val Gly Asp Gly Ser Phe Gln Leu Thr Ala Gln 435
440 445 Glu Val Ala Gln Met Val
Arg Leu Lys Leu Pro Val Ile Ile Phe Leu 450 455
460 Ile Asn Asn Tyr Gly Tyr Thr Ile Glu Val Met
Ile His Asp Gly Pro 465 470 475
480 Tyr Asn Asn Ile Lys Asn Trp Asp Tyr Ala Gly Leu Met Glu Val Phe
485 490 495 Asn Gly
Asn Gly Gly Tyr Asp Ser Gly Ala Gly Lys Gly Leu Lys Ala 500
505 510 Lys Thr Gly Gly Glu Leu Ala
Glu Ala Ile Lys Val Ala Leu Ala Asn 515 520
525 Thr Asp Gly Pro Thr Leu Ile Glu Cys Phe Ile Gly
Arg Glu Asp Cys 530 535 540
Thr Glu Glu Leu Val Lys Trp Gly Lys Arg Val Ala Ala Ala Asn Ser 545
550 555 560 Arg Lys Pro
Val Asn Lys Leu Leu Gly His His His His His His 565
570 575 245PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Histidine tag peptide sequence 24His
His His His His 1 5 257PRTArtificial SequenceDescription
of Artificial Sequence Synthetic Histidine tag peptide sequence
25His His His His His His His 1 5
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20160318183 | ROBOT CONTROL DEVICE AND ROBOT |
20160318182 | METHOD OF TEACHING ROBOT AND ROBOT |
20160318181 | AIRCRAFT PART WITH ROBOT ARM |
20160318180 | ROBOT |
20160318179 | ROBOT SYSTEM |