Patent application title: MUTANT LUCIFERASE
Inventors:
David J. Squirrell (Salisbury, GB)
Melenie J. Murphy (Salisbury, GB)
Rachel L. Price (Salisbury, GB)
Christopher R. Lowe (Cambridge, GB)
Peter J. White (Cambridge, GB)
Laurence C. Tisi (Ely, GB)
James A. H. Murray (Penarth, GB)
Assignees:
PROMEGA CORPORATION
IPC8 Class: AC12N902FI
USPC Class:
435 8
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving luciferase
Publication date: 2014-06-19
Patent application number: 20140170687
Abstract:
An isolated recombinant luciferase having luciferase activity. The
recombinant luciferase has an amino acid sequence which differs from the
wild-type luciferase from Photinus pyralis, Luciola mingrelica, Luciola
cruciata, Luciola lateralis, Hotaria parvula, Pyrophorus
plagiophthalamus, Lampyris noctiluca, Pyrocoelia miyako or Photinus
pennsylvanica. In the sequence of the recombinant luciferase, the amino
acid residue corresponding to phenylalanine 295 in Photinus pyralis
wild-type luciferase or to leucine 297 in Luciola mingrelica, Luciola
cruciata or Luciola lateralis wild-type luciferases, is mutated compared
to the corresponding amino acid which appears in the corresponding
wild-type luciferase sequence. The recombinant luciferase has increased
thermostability compared to the corresponding wild-type luciferase.Claims:
1. An isolated recombinant luciferase having luciferase activity and
comprising a variant of wild-type Photinus pyralis luciferase of SEQ ID
NO: 37, wherein the amino acid sequence of said recombinant luciferase
has no more than 50 amino acid differences as compared to the amino acid
sequence of SEQ ID NO: 37, wherein the recombinant luciferase has an
amino acid substitution at the residue corresponding to position 35 of
SEQ ID NO:37, and wherein the recombinant luciferase has increased
thermostability as compared to the wild-type Photinus pyralis luciferase
of SEQ ID NO:37.
2. The recombinant luciferase of claim 1, wherein the amino acid residue corresponding to position 35 of SEQ ID NO:37 is alanine, valine, phenylalanine, isoleucine, proline, methionine or tryptophan.
3. The recombinant luciferase of claim 1, wherein the amino acid residue corresponding to position 35 of SEQ ID NO:37 is alanine.
4. An isolated nucleic acid which encodes the recombinant luciferase of claim 1.
5. A vector comprising the nucleic acid of claim 4.
6. An isolated cell transformed with the vector of claim 5.
7. A bioluminescent assay comprising the steps of contacting the recombinant luciferase of claim 1 with luciferin and detecting bioluminescence.
8. A kit comprising the recombinant luciferase of claim 1.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser. No. 13/023,704, filed Feb. 9, 2011, now U.S. Pat. No. ______, which is a divisional of U.S. application Ser. No. 09/763,824, filed Feb. 27, 2001, now U.S. Pat. No. 7,906,298, which is a national stage filing under 35 USC 371 of International Application No. PCT/GB99/03538, filed Oct. 26, 1999, which claims priority benefits to United Kingdom Patent Application No. 9823468.5, filed Oct. 28, 1998. These applications are incorporated herein by reference in their entirety.
SUMMARY
[0002] The present invention relates to novel proteins, in particular mutant luciferase enzymes having increased thermostability as compared to the corresponding wild type enzyme, to the use of these enzymes in assays and to test kits containing them.
[0003] Firefly luciferase catalyses the oxidation of luciferin in the presence of ATP, Mg2+ and molecular oxygen with the resultant production of light. This reaction has a quantum yield of about 0.88. The light emitting property has led to its use in a wide variety of luminometric assays where ATP levels are being measured. Examples of such assays include those which are based upon the described in EP-B-680515 and WO 96/02665.
[0004] Luciferase is obtainable directly from the bodies of insects, in particular beetles such as fireflies or glow-worms. Particular species from which luciferases have been obtained include the Japanese GENJI or KEIKE fireflies, Luciola cruciata and Luciola lateralis, the East European firefly Luciola mingrelica, the North American firefly Photinus pyralis and the glow-worm Lampyris noctiluca. Other species from which luciferase can be obtained are listed in Ye et al., Biochimica et Biophysica Acta, 1339 (1997) 39-52. Yet a further species is Phrixothrix (railroad-worms), as described by Viviani et al. Biochemistry, 38, (1999) 8271-8279.
[0005] However, since many of the genes encoding these enzymes have been cloned and sequenced, they may also be produced using recombinant DNA technology. Recombinant DNA sequences encoding the enzymes are used to transform microorganisms such as E. coli which then express the desired enzyme product.
[0006] The heat stability of wild and recombinant type luciferases is such that they lose activity quite rapidly when exposed to temperatures in excess of about 30° C., particularly over 35° C. This instability causes problems when the enzyme is used or stored at high ambient temperature, or if the assay is effected under high temperature reaction conditions, for example in order to increase reaction rate.
[0007] Mutant luciferases having increased thermostability are known from EP-A-524448 and WO95/25798. The first of these describes a mutant luciferase having a mutation at position 217 in the Japanese firefly luciferase, in particular by replacing a threonine residue with an isoleucine residue. The latter describes mutant luciferases having over 60% similarity to luciferase from Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis but in which the amino acid residue corresponding to residue 354 of Photinus pyralis or 356 of the Luciola species is mutated such that it is other than glutamate.
[0008] The applicants have found yet further mutants which can bring about increased thermostability and which may complement the mutations already known in the art.
[0009] The present invention provides a protein having luciferase activity and at least 60% similarity to luciferase from Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis, Hotaria paroula, Pyrophorus plagiophthalamus Lampyris noctiluca, Pyrocoelia nayako, Photinus pennsylanvanica or Phrixothrix, wherein in the sequence of the enzyme, at least one of
[0010] (a) the amino acid residue corresponding to residue 214 in Photinus pyralis luciferase or to residue 216 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase;
[0011] (b) the amino acid residue corresponding to residue 232 in Photinus pyralis luciferase or to residue 234 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase;
[0012] (c) the amino acid residue corresponding to residue 295 in Photinus pyralis luciferase or to residue 297 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase;
[0013] (d) the amino acid residue corresponding to amino acid 14 of the Photinus pyralis luciferase or to residue 16 of Luciola mingrelica, & residue 17 of Luciola cruciata or Luciola lateralis;
[0014] (e) the amino acid residue corresponding to amino acid 35 of the Photinus pyralis luciferase or to residue 37 of Luciola mingrelica 38 of Luciola cruciata or Luciola lateralis;
[0015] (f) the amino acid residue corresponding to amino acid residue 105 of the Photinus pyralis luciferase or to residue 106 of Luciola mingrelica, 107 of Luciola cruciata or Luciola lateralis or 108 of Luciola lateralis gene;
[0016] (g) the amino acid residue corresponding to amino acid residue 234 of the Photinus pyralis luciferase or to residue 236 of Luciola mingrelica, Luciola cruciata or Luciola lateralis;
[0017] (h) the amino acid residue corresponding to amino acid residue 420 of the Photinus pyralis luciferase or to residue 422 of Luciola mingrelica, Luciola cruciata or Luciola lateralis;
[0018] (i) the amino acid residue corresponding to amino acid residue 310 of the Photinus pyralis luciferase or to residue 312 of Luciola mingrelica, Luciola cruciata or Luciola lateralis; is different to the amino acid which appears in the corresponding wild type sequence and wherein the luciferase enzyme possesses has increased thermostability as compared to an enzyme having the amino acid of the corresponding wild-type, luciferase of a particular species at this position.
[0019] Preferably, the protein has luciferase activity and at least 60% similarity to luciferase from Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis, Hotaria paroula, Pyrophorus plagiophthalamus Lampyris noctiluca, Pyrocoelia nayako, or Photinus pennsylanvanica.
[0020] In particular, the protein is a recombinant protein which has luciferase activity and substantially the sequence of a wild-type luciferase, for example of Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis, Hotaria paroula, Pyrophorus plagiophthalamus (Green-Luc GR), Pyrophorus plagiophthalamus (Yellow-Green Luc YG), Pyrophorus plagiophthalamus (Yellow-Luc YE), Pyrophorus plagiophthalamus (Orange-Luc OR), Lampyris noctiluca, Pyrocelia nayako Photinus pennsylanvanica LY, Photinus pennsylanvanica KW, Photinus pennsylanvanica J19, or Phrixothrix green (PvGR) or red (PhRE) but which may include one or more, for example up to 100 amino acid residues, preferably no more than 50 amino acids and more preferably no more than 30 amino acids, which have been engineered to be different to that of the wild type enzyme.
[0021] In particular, bioluminescent enzymes from species that can use the substrate D-luciferin (4,5-dihydro-2-(6-hydroxy-2-benzothiazolyl)-4-thiazole carboxylic acid) to produce light emission may form the basis of the mutant enzymes of the invention.
[0022] By way of example, where the protein has substantially the sequence of luciferase of Photinus pyralis, in accordance with the invention, at least one of
[0023] (a) the amino acid residue corresponding to residue 214 in Photinus pyralis luciferase has been changed to be other than threonine;
[0024] (b) the amino acid residue corresponding to residue 232 in Photinus pyralis luciferase has been changed to be other than isoleucine;
[0025] (c) the amino acid residue corresponding to residue 295 in Photinus pyralis luciferase has been changed to be other than phenylalanine;
[0026] (d) the amino acid residue corresponding to amino acid 14 of the Photinus pyralis luciferase has been changed to be other than phenylalanine;
[0027] (e) the amino acid residue corresponding to amino acid 35 of the Photinus pyralis luciferase has been changed to be other than leucine;
[0028] (f) the amino acid residue corresponding to amino acid residue 105 of the Photinus pyralis luciferase has been changed to be other than alanine;
[0029] (g) the amino acid residue corresponding to amino acid residue 234 of the Photinus pyralis luciferase has been changed to be other than aspartic acid;
[0030] (h) the amino acid residue corresponding to amino acid residue 420 of the Photinus pyralis luciferase has been changed to be other than serine;
[0031] (i) the amino acid residue corresponding to amino acid residue 310 of the Photinus pyralis luciferase has been changed to be other than histidine.
[0032] Where the protein has substantially the sequence of Luciola mingrelica, Luciola cruciata or Luciola lateralis enzyme, in accordance with the invention, at least cane of
[0033] (a) the amino acid residue corresponding to residue 216 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is other than glycine (for Luciola mingrelica based sequences) or asparagine (for Luciola cruciata or Luciola lateralis) based sequences;
[0034] (b) the amino acid residue corresponding to residue 234 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is other than serine;
[0035] (c) amino acid residue corresponding to residue 297 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is other than leucine;
[0036] (d) amino acid residue corresponding to amino acid 16 of Luciola mingrelica, or to amino acid 17 of Luciola cruciata or Luciola lateralis is other than phenylalanine;
[0037] (e) amino acid residue corresponding to residue 37 of Luciola mingrelica, or 38 of Luciola cruciata or Luciola lateralis is other than lysine;
[0038] (f) amino acid residue corresponding to amino acid residue 106 of Luciola mingrelica, or to amino acid 107 of Luciola cruciata or Luciola lateralis or to amino acid 108 of Luciola lateralis gene is other than glycine;
[0039] (g) amino acid residue corresponding to amino acid residue 236 of Luciola mingrelica, Luciola cruciata or Luciola lateralis is other than glycine;
[0040] (h) amino acid residue corresponding to residue 422 of Luciola mingrelica, Luciola cruciata or Luciola lateralis is other than threonine
[0041] (i) amino acid residue corresponding to amino acid residue 312 of Luciola mingrelica, Luciola cruciata or Luciola lateralis is other than threonine (for Luciola mingrelica based sequences) or valine (for Luciola cruciata or Luciola lateralis) based sequences.
[0042] The particular substituted amino acids in any case which give rise to enhanced thermostability can be determined by routine methods as illustrated hereinafter. In each case, different substitutions may result in enhanced thermostability. Substitution may be effected by site-directed mutagenesis of DNA encoding native or suitable mutant proteins as would be understood by the skilled person. The invention in this case is associated with the identification of the positions which are associated with thermostability.
[0043] In general however, it may be desirable to consider substituting an amino acid of different properties to the wild type amino acid. Thus hydrophilic amino acid residues may, in some cases be preferably substituted with hydrophobic amino acid residues and vice versa. Similarly, acidic amino acid residues may be substituted with basic residues.
[0044] For instance, the protein may comprise a protein having luciferase activity and at least 60% similarity to Luciferase from Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis enzyme wherein in the sequence of the enzyme, at least one of
[0045] (a) the amino acid residue corresponding to residue 214 in Photinus pyralis luciferase and to residue 216 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is mutated and is other than threonine in the case of Photinus pyralis luciferase; or
[0046] (b) the amino acid residue corresponding to residue 232 in Photinus pyralis luciferase and to residue 234 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is mutated and is other than isoleucine in the case of Photinus pyralis luciferase; or
[0047] (c) amino acid residue corresponding to residue 295 in Photinus pyralis luciferase and to residue 297 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is mutated and is for example, other than phenylalanine in the case of Photinus pyralis luciferase;
[0048] and the luciferase enzyme has increased thermostability as compared to the wild-type luciferase.
[0049] The sequences of all the various luciferases show that they are highly conserved having a significant degree of similarity between them. This means that corresponding regions among the enzyme sequences are readily determinable by examination of the sequences to detect the most similar regions, although if necessary commercially available software (e.g. "Bestfit" from the University of Wisconsin Genetics Computer Group; see Devereux et al (1984) Nucleic Acid Research 12: 387-395) can be used in order to determine corresponding regions or particular amino acids between the various sequences. Alternatively or additionally, corresponding acids can be determined by reference to L. Ye et al., Biochim. Biophys Acta 1339 (1997) 39-52. The numbering system used in this reference forms the basis of the numbering system used in the present application.
[0050] With respect to the possible change of the amino acid residue corresponding to residue 214 in Photinus pyralis luciferase, the polar amino acid threonine is suitably replaced with a non polar amino acid such as alanine, glycine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan or cysteine. A particularly preferred substitution for the threonine residue corresponding to residue 214 in Photinus pyralis is alanine. A more preferred substitution is cysteine. However, different polar residues such as asparagine at this position may also enhance the thermostability of the corresponding enzyme having threonine at this position.
[0051] Other amino acids which appear at this position in wild-type luciferase enzymes include glycine (Luciola mingrelica, Hotaria paroula), asparagine (Pyrophorus plagiophthalamus, GR, YC, YE and OR, Luciola cruciata, Luciola lateralis, Lampyris noctiluca, Pyrocelia nayako Photinus pennsylanvanica LY, KW, J19) and serine (position 211 in Phrixothrix luciferase). These may advantageously be substituted with non-polar or different non-polar side chains such as alanine and cysteine.
[0052] As regards the possible change of the amino acid residue corresponding to residue 232 in Photinus pyralis luciferase, the nonpolar amino acid isoleucine is suitably replaced with a different non polar amino acid such as alanine, glycine, valine, leucine, proline, phenylalanine, methionine, tryptophan or cysteine. Other amino acids appearing at this position in wild type sequences include serine and asparagine (as well as valine or alanine at corresponding position 229 in Phritothix green and red respectively). Suitably, these polar residues are substituted by non-polar residues such as those outlined above. A particularly preferred substitution for the residue corresponding to residue 232 in Photinus pyralis luciferase and to residue 234 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase is alanine, where this represents a change of amino acid over the wild-type sequence. Changes of the amino acid residue corresponding to residue 295 in Photinus pyralis luciferase and to residue 297 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase, may also affect the thermostability of the protein. (This corresponds to position 292 in Phrixothix luciferase.) In general, the amino acid at this position is a non-polar amino acid phenylalanine or leucine. These are suitably changed for different non-polar amino acids. For example, in Photinus pyralis, the non-polar amino acid phenylalanine is suitably replaced with a different non polar amino acid, such as alanine, leucine, glycine, valine, isoleucine, proline, methionine, tryptophan or cysteine. A particularly preferred substitution for the phenylalanine residue corresponding to residue 214 in Photinus pyralis luciferase is leucine.
[0053] Mutation at the amino acid residue corresponding to amino acid 14 of the Photinus pyralis luciferase or to amino acid 16 in Luciola luciferase, (13 in Phrixothrix luciferase) is also possible. This amino acid residue (which is usually phenylalanine, but may also be leucine, serine, arginine or in some instances tyrosine) is suitably changed to a different amino acid, in particular to a different nonpolar amino acid such as alanine, valine, leucine, isoleucine, proline, methionine or tryptophan, preferably alanine.
[0054] Mutation at the amino acid residue corresponding to amino acid 35 of the Photinus pyralis luciferase or to amino acid residue 37 in Luciola mingrelica luciferase (corresponding to amino acid 36 in other Luciola spp. And in Phrixothrix) may also be effective. This amino acid varies amongst wild type enzymes, which may include leucine (Photinus pyralis) but also lysine, histidine, glycine, alanine, glutamine and aspartic acid at this position. Suitably the amino residue at this position is substituted with a non-polar amino acid residue or a different non-polar amino acid such as such as alanine, valine, phenylalanine, isoleucine, proline, methionine or tryptophan. A preferred amino acid at this position is alanine, where this is different to the wild-type enzyme.
[0055] Mutations at the amino acid corresponding to position 14 of the Photinus pyralis sequence and/or mutation at the amino acid residue corresponding to amino acid 35 of the Photinus pyralis luciferase are preferably not the only mutation in the enzyme.
[0056] They are suitably accompanied by others of the mutations defined above, in particular those at positions corresponding to positions 214, 395 or 232 of Photinus pyralis luciferase.
[0057] Changes of the amino acid residue corresponding to residue 105 in Photinus pyralis luciferase and to residue 106 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase, (102 in Phrixothrix) may also affect the thermostability of the protein. In general, the amino acid at this position is a non-polar amino acid alanine or glycine, or serine in Phrixothrix. These are suitably changed for different non-polar amino acids. For example, in Photinus pyralis, the non-polar amino acid alanine is suitably replaced With a different non polar amino acid, such as phenylalanine, leucine, glycine, valine, isoleucine, proline, methionine or tryptophan. A particularly preferred substitution for the alanine residue corresponding to residue 105 in Photinus pyralis luciferase is valine.
[0058] Changes of the amino acid residue corresponding to residue 234 in Photinus pyralis luciferase and to residue 236 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase (231 in Phrixothrix), may also affect the thermostability of the protein. In general, the amino acid at this position is aspartic acid or glycine and in some cases, glutamine or threonine. These are suitably changed for non-polar or different non-polar amino acids as appropriate. For example, in Photinus pyralis, the amino acid residue is aspartic acid is suitably replaced with a non polar amino acid, such as alanine, leucine, glycine, valine, isoleucine, proline, methionine or tryptophan. A particularly preferred substitution for the phenylalanine residue corresponding to residue 234 in Photinus pyralis luciferase is glycine. Where a non-polar amino acid residue such as glycine is present at this position (for example in Luciola luciferase), this may be substituted with a different non-polar amino acid.
[0059] Changes of the amino acid residue corresponding to residue 420 in Photinus pyralis luciferase and to residue 422 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase (417 in Phrixothrix green and 418 in Phrixothrix red), may also affect the thermostability of the protein. In general, the amino acid at this position is an uncharged polar amino acid serine or threonine or glycine. These are suitably changed for different uncharged polar amino acids. For example, in Photinus pyralis, the serine may be replaced with asparagine, glutamine, threonine or tyrosine, and in particular threonine.
[0060] Changes of the amino acid residue corresponding to residue 310 in Photinus pyralis luciferase and to residue 312 of Luciola mingrelica, Luciola cruciata or Luciola lateralis luciferase, may also affect the thermostability of the protein. The amino acid residue at this position varies amongst the known luciferase proteins, being histidine in Photinus pyralis, Pyrocelia nayako, Lampyris noctiluca and some forms of Photinus pennsylanvanica luciferase, threonine in Luciola mingrelica, Hotaria paroula and Phrixothix (where it is amino acid 307) luciferase, valine in Luciola cruciata and Luciola lateralis, and asparagine in some Pyrophorus plagiophthalamus luciferase. Thus, in general, the amino acid at this position is hydrophilic amino acid which may be changed for a different amino acid residue which increases thermostability of the enzyme. A particularly preferred substitution for the histidine residue corresponding to residue 310 in Photinus pyralis luciferase is arginine.
[0061] Other mutations may also be present in the enzyme. For example, in a preferred embodiment, the protein also has the amino acid at position corresponding to amino acid 354 of the Photinus pyralis luciferase (356 in Luciola luciferase and 351 in Phrixothrix) changed from glutamate, in particular to an amino acid other than glycine, proline or aspartic acid. Suitably, the amino acid at this position is tryptophan, valine, leucine, isoleucine are asparagine, but most preferably is lysine or arginine. This mutation is described in WO 95/25798.
[0062] In an alternative preferred embodiment, the protein also has the amino acid at the position corresponding to amino acid 217 in Luciola luciferase (215 in Photinus pyralis) changed to a hydrophobic amino acid in particular to isoleucine, leucine or valine as described in EP-A-052448.
[0063] The proteins may contain further mutations in the sequence provided the luciferase activity of the protein is not unduly compromised. The mutations suitably enhance the properties of the enzyme or better suit it for the intended purpose in some way. This may mean that they result in enhanced thermostability and/or colour shift properties, and/or the Km for ATP of the enzymes. Examples of mutations which give rise to colour shifts are described in WO95/18853. Mutations which affect Kmvalues are described for example in WO 96/22376 and International Patent Application No. PCT/G98/01026 which are incorporated herein by reference.
[0064] Proteins of the invention suitably have more than one such mutation, and preferably all three of the mutations described above.
[0065] Proteins of the invention include both wild-type and recombinant luciferase enzymes. They have at least 60% similarity to the sequences of Photinus pyralis, Luciola mingrelica, Luciola cruciata or Luciola lateralis or other luciferase enzymes as discussed above in the sense that at least 60% of the amino acids present in the wild-type enzymes are present in the proteins of the invention. Such proteins can have a greater degree of similarity, in particular at least 70%, more preferably at least 80% and most preferably at least 90% to the wild-type enzymes listed above. Similar proteins of this type include allelic variants, proteins from other insect species as well as recombinantly produced enzymes.
[0066] They may be identified for example, in that they are encoded by nucleic acids which hybridise with sequences which encode wild-type enzymes under stringent hybridisation conditions, preferably high stringency conditions. Such conditions would be well understood by the person skilled in the art, and are exemplified for example in Sambrook et al. (1989) Molecular Cloning, Cold Spring Harbor Laboratory Press). In general terms, low stringency conditions can be defined as 3×SCC at about ambient temperature to about 65° C., and high stringency conditions as 0.1×SSC at about 65° C. SSC is the name of a buffer of 0.15M NaCl, 0.015M trisodium citrate. 3×SSC is three times as strong as SSC and so on.
[0067] In particular, the similarity of a particular sequence to the sequences of the invention may be assessed using the multiple alignment method described by Lipman and Pearson, (Lipman, D. J. & Pearson, W. R. (1985) Rapid and Sensitive Protein Similarity Searches, Science, vol 227, pp 1435-1441). The "optimised" percentage score should be calculated with the following parameters for the Lipman-Pearson algorithm: ktup=1, gap penalty=4 and gap penalty length=12. The sequence for which similarity is to be assessed should be used as the "test sequence" which means that the base sequence for the comparison, such as the sequence of Photinus pyralis or any of the other sequences, listed above,as recorded in Ye et al., supra., or in the case of Phrixotrix, as described in Biochemistry, 1999, 38, 8271-8279, should be entered first into the algorithm. Generally, Photinus pyralis will be used as the reference sequence.
[0068] Particular examples of proteins of the invention are wild-type luciferase sequence with the mutations as outlined above. The proteins have at least one and preferably more than one such mutation.
[0069] The invention further provides nucleic acids which encode the luciferases as described above. Suitably, the nucleic acids are based upon wild-type sequences which are well known in the art. Suitable mutation to effect the desired mutation in the amino acid sequence would be readily apparent, based upon a knowledge of the genetic code.
[0070] The nucleic acids of the invention are suitably incorporated into an expression vector such as a plasmid under the control of control elements such as promoters, enhancers, terminators etc. These vectors can then be used to transform a host cell, for example a prokaryotic or eukaryotic cell such as a plant or animal cell, but in particular a prokaryotic cell such as E. coli so that the cell expresses the desired luciferase enzyme. Culture of the thus transformed cells using conditions which are well known in the art will result in the production of the luciferase enzyme which can then be separated from the culture medium. Where the cells are plant or animal cells, plants or animals may be propagated from said cells. The protein may then be extracted from the plants, or in the case of transgenic animals, the proteins may be recovered from milk. Vectors, transformed cells, transgenic plants and animals and methods of producing enzyme by culturing these cells all form further aspects of the invention.
[0071] The Photinus pyralis T214A mutant luciferase was created by random mutagenesis as described hereinafter. It was found that the T214A single point mutation has greater thermostability than wild type luciferase.
[0072] Two new triple mutant luciferases: E354K/T214A/A215L and E354K/T214A/I232A were also prepared and these also have exhibited greater thermostability.
[0073] Particular examples of mutant enzymes of Photinus pyralis which fall within the scope of the invention include the following:
[0074] I232A/E354K
[0075] T214A/I232A/E354K
[0076] A215L/I232A/E354K
[0077] T214A/I232A/E354K/A215L
[0078] I232A/E354K/T214A/F295L
[0079] I232A/E354K/T214A F295L/F14A/L35A
[0080] I232A/E354K/T214A/F295L/F14A/L35A/A215L
[0081] A105V
[0082] T214A
[0083] T214C
[0084] T214N
[0085] T295L
[0086] I232A
[0087] F14A
[0088] L35A
[0089] D234G
[0090] S420T
[0091] H310R
or equivalents of any of these when derived from the luciferases of other species.
[0092] The mutations for the creation of the triple mutant were introduced to the luciferase gene on plasmid pET23 by site-directed mutagenesis, (PCR). The oligonucleotides added to the PCR reaction in order to effect the relevant mutations are given in the Examples below.
[0093] It has been reported previously that the effect of point mutations at the 354 and 215 positions are additive. This invention provides the possibility of combining three or more such mutations to provide still greater thermostability.
[0094] Thermostable luciferase of the invention will advantageously be employed in any bioluminescent assay which utilises the luciferase/luciferin reaction as a signaling means. There are many such assays known in the literature. The proteins may therefore be included in kits prepared with a view to performing such assays, optionally with luciferin and any other reagents required to perform the particular assay.
BRIEF DESCRIPTION OF THE DRAWINGS
[0095] The invention will now be particularly described by way of example with reference to the accompanying diagrammatic drawings in which:
[0096] FIGS. 1A and 1B illustrate the plasmids used in the production of mutants in accordance with the invention;
[0097] FIG. 2 shows the results of heat inactivation studies on luciferases including luciferases of the invention;
[0098] FIGS. 3A-3H show the results of thermostability experiments on various luciferase mutants;
[0099] FIG. 4 shows the results of thermostability experiments on ether luciferase mutants; and
[0100] FIG. 5 shows ologonuoleotides (SEQ ID NOs: 1-10, 11/36 and 12-33) used in the preparation of mutant enzymes of the invention.
EXAMPLE 1
[0101] Identification of Thermostable Mutant Luciferase
[0102] The error-prone PCR was based on the protocol devised by Fromant et al., Analytical Biochemistry, 224, 347-353 (1995).
[0103] The dTTP mix in this reaction was:
[0104] 35 mM dTTP
[0105] 12.5 mM dGTP
[0106] 22.5 mM dCTP
[0107] 14 mM dATP
[0108] The PCR conditions were:
[0109] 0.5 μl (50 ng) plasmid pPW601a J54*
[0110] 5.0 μl 10× KCl reaction buffer
[0111] 1 μl each of W56 and W57* (60 pmoles of each primer)
[0112] 1 μl BIOTAQ (thermostable) DNA polymerase (5U)
[0113] 2 μl dNTPs (see above)
[0114] 1.76 μl MgCl2 (50 mM stock)
[0115] 1 μl mNCl2 (25 mM stock) [final concentration in reaction=3.26 mM]
[0116] 36.7 μl dH2O
[0117] *Plasmid pPW601aJ54 is a mutated version of pPW601a (WO 95/25795) where an NdeI site has been created within the 3 bases prior to the ATG start codon. This allows for easy cloning from pPW601a into the pET23 vector.
[0118] +Primer Sequences:
TABLE-US-00001 W56: (SEQ ID NO: 34) 5'-AAACAGGGACCCATATGGAAGACGC-3' W57 (SEQ ID NO: 35) 5'-AATTAACTCGAGGAATTTCGTCATCGCTGATAACAG-3')
[0119] Cycling parameters were:
[0120] 94° C.-5 min
[0121] Then 12× cycles of: 94° C.-30 s
[0122] 55° C.-30 s
[0123] 72° C.-5 min
[0124] 72° C-10 min
[0125] The PCR products were purified from the reaction mix using a Clontech ADVANTAGE PCR-pure kit. An aliquot of the purified products was then digested with the restriction enzymes NdeI and XhoI. The digested PCR products were then "cleaned up" with the ADVANTAGE kit and ligated into the vector pET23a which had been digested with the same enzymes.
[0126] Ligation Conditions:
[0127] 4 μl pET23a (56 ng)
[0128] 5 μl PCR products (200 ng)
[0129] 3 μl 5× Gibco BRL ligase reaction buffer
[0130] 1 μl Gibco BRL ligase (10U)
[0131] 2 μl dH20
[0132] The ligation was carried out overnight at 16° C.
[0133] The ligated DNAs were then purified using the ADVANTAGE kit and then electroporated into electrocompetent E. coli HB101 cells (1 mm cuvettes, 1.8 Kv).
[0134] Eleven electroporations were performed and the cells were then added to 40 ml of TY broth containing 50 μg/ml ampicillin. The cells were then grown overnight at 37° C. The entire 50 ml of culture grown overnight was used to purify plasmid DNA. This is the library.
[0135] Screening the Library
[0136] An aliquot of the plasmid library was used to electroporate E. coli BL21 DE3 cells. These cells were then plated onto LB agar containing 50 μg/ml ampicillin and grown overnight at 37° C.
[0137] The next day, colonies were picked and patched onto nylon filters on LB agar+amp plates and growth continued overnight at 37° C. The next day, filters were overlaid with a solution of luciferin--500 μM in 100 mM sodium citrate pH5.0. The patches were then viewed in a darkroom. One colony/patch was picked from 200 for further analysis.
[0138] Characterisation of the Thermostable Mutant
[0139] The E. coli clone harbouring the mutant plasmid was isolated. Plasmid DNA was prepared for ABI sequencing. The entire open reading frame encoding luciferase was sequenced using 4 different oligonucleotide primers. Sequencing revealed a single point mutation at nt 640 (A→G). Giving a codon change of ACT (T) to GCT (A) at amino acid position 214.
EXAMPLE 2
[0140] Preparation of Triple Mutant Enzyme
[0141] A mutagenic oligonucleotide was then used to create this same mutation in pMOD1 (A215L/E354K) to create a triple mutant pMOD2 (A215L/E354K/T214A). This mutation also creates a unique SacI/SstI site in pMODl.
EXAMPLE 3
[0142] Preparation of Further Triple Mutant Enzyme
[0143] The following primers were used to create the triple mutant T214A/I232A/E354K using a standard PCR reaction and with the pET23 plasmid with the T214A mutation as template:
TABLE-US-00002 (SEQ ID NO: 26) CTGATTACACCCAAGGGGGATG E354K-sense (SEQ ID NO: 27) CATCCCCCTTGGGTGTAATCAG E354K-antisense (SEQ ID NO: 30) GCAATCAAATCGCTCCGGATACTGC I232A-sense (SEQ ID NO: 31) GCAGTATCCGGAGCGATTTGATTGC I232A-antisense
EXAMPLE 4
[0144] Identification of Thermostable 295 Mutant
[0145] The F295 mutant was created using the error-prone PCR method described by Fromant et al., Analytical Biochemistry, vol 224, 347-353 (1995). The PCR conditions used were as follows:
[0146] 0.5 μl (50 ng) plasmid pET23
[0147] 5.0 μl 10× KCI reaction buffer
[0148] 1 μl primer 1-60 pmoles of each primer
[0149] 1 μl primer 2
[0150] 1 μl BIOTAQ (thermostable)DNA polymerase (5U)
[0151] 2 μl dNTPs, in mixture 35 mM dTTP, 12.5 mM dGTP, 22.5 mM dCTP, 14 mM dATP
[0152] 1.76 μl MgCl2 (50 mM stock)
[0153] 1 μl MnCl2 (25 mM stock) [final concentration in reaction=3.26 mm]
[0154] 36.7 μl dH2O
TABLE-US-00003 Primer 1 = 5'-AAACAGGGACCCATATGGAAGACGC-3' (SEQ ID NO: 34) Primer 2 = 5'-AATTAACTCGAGGAATTTCGTCATCGCTGAATACAG-3' (SEQ ID NO: 35)
[0155] The cycling parameters were
[0156] 94° C. for 5 min
[0157] 15 cycles of: 30 s @ 94° C.
[0158] 30 s @ 55° C.
[0159] 5 min @ 72° C. then 10 min at 72° C.
[0160] The PCR products were purified from the reaction mix using a Clontech ADVANTAGE PCR-Pure kit. An aliquot of the purified products was then digested with the restriction enzymes Ndel and Xhol. The digested PCR products were then "cleaned up" with the ADVANTAGE kit and ligated into the vector pET23a, which had been digested with the same enzymes.
[0161] The ligation conditions were as follows:
[0162] 56 ng pET23a
[0163] 200 ng PCR products
[0164] 3 μl 5× Gibco BRL ligase reaction buffer
[0165] 1 μl Gibco BRL ligase (100)
[0166] volume made up to 10 μl with dH2O
[0167] The ligation was carried out overnight at 16° C.
[0168] The ligated DNAs were then purified using the Advantage® kit and then electroporated into electrocompetent Escherichia coli DH5α cells (1 mm cuvettes, 1.8 kV). 1 ml of SOC broth was added to each electroporation and the cells allowed to recover and express antibiotic resistance genes encoded by the plasmid. Aliquots of the library were inoculated onto LB agar containing 50 μg/ml ampicillin and the bacteria were grown overnight at 37° C. Nylon filter discs were then overlaid onto the agar plates and the colonies transferred to fresh plates. The original plates were left at room temperature for the colonies to re-grow. The plates with the nylon filters were incubated at 42° C. for 2 h before plates were sprayed with 500 μM luciferin in 100 mM citrate buffer pH5.0 and viewed in a darkroom.
[0169] Three thermostable colonies were selected on the basis that they still glowed after 2 h at 42° C. Plasmid DNA was isolated from these clones and sequenced, and this revealed the F295L mutation in each case.
EXAMPLE 5
[0170] Other mutants of the invention were produced by PCR using appropriate combinations of the oligonucleotides listed above as well as the following:
TABLE-US-00004 GAAAGGCCCGGCACCAGCCTATCCTCTAGAGG (SEQ ID NO: 5) F14A-sense CCTCTAGCGGATAGGCTGGTGCCGGGCCTTTC (SEQ ID NO: 6) F14A-antisense GAGATACGCCGCGGTTCCTGG (SEQ ID NO: 9) L35A-sense CCAGGAACCGCGGCGTATCTC (SEQ ID NO: 10) L35A-antisense
EXAMPLE 6
[0171] Purification of Luciferase and Heat Inactivation Studies.
[0172] Cells expressing the recombinant mutant luciferases were cultured, disrupted and extracted as described in WO 95/25798 to yield cell free extracts of luciferase.
[0173] Eppendorf tubes containing the cell free extracts were incubated generally at 40° C. unless otherwise stated. Purified preparations of wild type luciferases (for comparative purposes were incubated in thermostability buffer comprising 50 mM potassium phosphate buffer pH7.8 containing 10% saturated ammonium sulphate, 1 mM dithiothreitol and 0.2% bovine serum albumin (BSA). At set times a tube was removed and cooled in an ice/water bath prior to assay with remaining assayed activity being calculated as a percentage of the initial activity or relative bioluminesce.
[0174] The results are illustrated in FIGS. 2 and 3 hereinafter. It can be seen from FIG. 2 that luciferase mutants of the invention have improved thermostability compared with the previously known mutants.
[0175] The dramatic increase in stability over wild-type luciferase (RWT) is clear from FIG. 3.
EXAMPLE 7
[0176] Investigations into the Activity of 214 Mutants
[0177] A library of 214 mutants was prepared using site-directed mutagenesis using cassette oligos (FIG. 5) and thermostable mutants selected and tested as described in Example 1. Three particularly thermostable mutants were characterised by sequencing as described in Example 1 as T214A, T214C and T214N.
[0178] O/N cultures of E. coli XL1-Blue harbouring plasmids encoding T214, T214A, T214C and T214N were lysed using the Promega lysis buffer. 50 μl of liquid extracts were then heat inactivated at 37° C. and 40° C. over various time points. Aliquots 10 μl of heated extract were then tested in the Promega live assay buffer (100 μl).
[0179] The results are shown in the following Tables
TABLE-US-00005 0 4 min 8 min 22 min (37° C.) rwt T214 11074 5561 2555 343 RLU T214C 106449 92471 90515 78816 RLU T214A 63829 52017 45864 35883 RLU T214N 60679 49144 41736 29488 RLU
TABLE-US-00006 % remaining activity 37° C. rwt T214 100 50.2 23.1 3.1 T214C 100 86.9 85.0 74.0 T214A 100 81.5 71.8 56.2 T214N 100 81.0 68.8 48.6
[0180] The experiment was repeated at 40° C. with the 3 mutants
TABLE-US-00007 0 4 min 8 min 16 min T214C 104830 79365 72088 56863 RLU T214A 64187 43521 28691 14547 RLU T214N 60938 38359 25100 12835 RLU % remaining activity 40° C. 0 4 min 8 min 16 min T214C 100 73.7 68.8 54.2 T214A 100 67.8 44.7 22.7 T214N 100 63.0 41.2 21.1
[0181] These results indicate that T214C is significantly more thermostable than either r-wt or T214A or N. This change in properties is unexpected as it is usually expected that the more cysteine residues that are present, the worse the thermostability.
EXAMPLE 8
[0182] Investigation of Other Point Mutations
[0183] A series of other Photinus pyralis mutants with single point mutations were prepared using random error-prone PCR (FIG. 5). Following, screening and sequencing of the mutants generated, the sequencing was checked using site-directed mutagenesis followed by further sequencing. These were D234G, A105V and F295L. The thermostability of these mutants as well as recombinant wild-type Photinus pyralis luciferase was tested. Protein samples in Promega lysis buffer were incubated at 37° C. for 10 minutes and their activity assayed after 2, 5 and 10 minutes. The results, showing that each mutation produced enhanced thermostability over wild type, is shown in FIG. 4.
Sequence CWU
1
1
42123DNAArtificial SequenceDescription of Artificial Sequence Primer
1cgccggtgag ctccccgccg ccg
23223DNAArtificial SequenceDescription of Artificial Sequence Primer
2cggcggcggg gagctcaccg gcg
23351DNAArtificial SequenceDescription of Artificial Sequence Primer
3cgaacacttc ttcatcgttg accgccttaa gtctttaatt aaatacaaag g
51451DNAArtificial SequenceDescription of Artificial Sequence Primer
4cctttgtatt taattaaaga cttaaggcgg tcaactatga agaagtgttc g
51532DNAArtificial SequenceDescription of Artificial Sequence Primer
5gaaaggcccg gcaccagcct atcctctaga gg
32632DNAArtificial SequenceDescription of Artificial Sequence Primer
6cctctagcgg ataggctggt gccgggcctt tc
32736DNAArtificial SequenceDescription of Artificial Sequence Primer
7ccataaattt accgaattcg tcgacttcga tcgagg
36818DNAArtificial SequenceDescription of Artificial Sequence Primer
8gtgtggaatt gtgagcgg
18921DNAArtificial SequenceDescription of Artificial Sequence Primer
9gagatacgcc gcggttcctg g
211021DNAArtificial SequenceDescription of Artificial Sequence Primer
10ccaggaaccg cggcgtatct c
211130DNAArtificial SequenceDescription of Artificial Sequence Primer
11ccctattttc attcctggcc aaaagcactc
301230DNAArtificial SequenceDescription of Artificial Sequence Primer
12gagtgctttt ggccaggaat gaaaataggg
301327DNAArtificial SequenceDescription of Artificial Sequence Primer
13ccgcatagag ctctctgcgt cagattc
271427DNAArtificial SequenceDescription of Artificial Sequence Primer
14gaatctgacg cagagagctc tatgcgg
271530DNAArtificial SequenceDescription of Artificial Sequence Primer
15gttgaccgct tgggatcctt aattaaatac
301622DNAArtificial SequenceDescription of Artificial Sequence Primer
16gtatagattt gaaaaagagc tg
221722DNAArtificial SequenceDescription of Artificial Sequence Primer
17cagctctttt tcaaatctat ac
221822DNAArtificial SequenceDescription of Artificial Sequence Primer
18ggctacatac tggagacata gc
221922DNAArtificial SequenceDescription of Artificial Sequence Primer
19gctatgtctc cagtatgtag cc
222021DNAArtificial SequenceDescription of Artificial Sequence Primer
20gcagttgcgc ccgtgaacga c
212121DNAArtificial SequenceDescription of Artificial Sequence Primer
21gtcgttcacg ggcgcaactg c
212229DNAArtificial SequenceDescription of Artificial Sequence Primer
22caaatcattc cgggtactgc gattttaag
292329DNAArtificial SequenceDescription of Artificial Sequence Primer
23cttaaaatcg cagtacccgg aatgatttg
292427DNAArtificial SequenceDescription of Artificial Sequence Primer
24ccgcatagaa ctctctgcgt cagattc
272527DNAArtificial SequenceDescription of Artificial Sequence Primer
25gaatctgacg cagagagttc tatgcgc
272622DNAArtificial SequenceDescription of Artificial Sequence Primer
26ctgattacac ccaaggggga tg
222722DNAArtificial SequenceDescription of Artificial Sequence Primer
27catccccctt gggtgtaatc ag
222829DNAArtificial SequenceDescription of Artificial Sequence Primer
28cccttccgca tagannngcc tgcgtcagt
292929DNAArtificial SequenceDescription of Artificial Sequence Primer
29actgacgcag gcnnntctat gcggaaggg
293025DNAArtificial SequenceDescription of Artificial Sequence Primer
30gcaatcaaat cgctccggat actgc
253125DNAArtificial SequenceDescription of Artificial Sequence Primer
31gcagtatccg gagcgatttg attgc
253220DNAArtificial SequenceDescription of Artificial Sequence Primer
32ccattccatc aaggttttgg
203320DNAArtificial SequenceDescription of Artificial Sequence Primer
33ccaaaacctt gatggaatgg
203425DNAArtificial SequenceDescription of Artificial Sequence Primer
34aaacagggac ccatatggaa gacgc
253536DNAArtificial SequenceDescription of Artificial Sequence Primer
35aattaactcg aggaatttcg tcatcgctga atacag
363630DNAArtificial SequenceDescription of Artificial Sequence Primer
36ccctattttc attcctggcc aaaagcactg
3037550PRTPhotinus pyralis 37Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro
Ala Pro Phe Tyr Pro1 5 10
15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg
20 25 30Tyr Ala Leu Val Pro Gly Thr
Ile Ala Phe Thr Asp Ala His Ile Glu 35 40
45Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu
Ala 50 55 60Glu Ala Met Lys Arg Tyr
Gly Leu Asn Thr Asn His Arg Ile Val Val65 70
75 80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro
Val Leu Gly Ala Leu 85 90
95Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg
100 105 110Glu Leu Leu Asn Ser Met Asn
Ile Ser Gln Pro Thr Val Val Phe Val 115 120
125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu
Pro 130 135 140Ile Ile Gln Lys Ile Ile
Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly145 150
155 160Phe Gln Ser Met Tyr Thr Phe Val Thr Ser His
Leu Pro Pro Gly Phe 165 170
175Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile
180 185 190Ala Leu Ile Met Asn Ser
Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195 200
205Ala Leu Pro His Arg Thr Ala Cys Val Arg Phe Ser His Ala
Arg Asp 210 215 220Pro Ile Phe Gly Asn
Gln Ile Ile Pro Asp Thr Ala Ile Leu Ser Val225 230
235 240Val Pro Phe His His Gly Phe Gly Met Phe
Thr Thr Leu Gly Tyr Leu 245 250
255Ile Cys Gly Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu
260 265 270Phe Leu Arg Ser Leu
Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val 275
280 285Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu
Ile Asp Lys Tyr 290 295 300Asp Leu Ser
Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser305
310 315 320Lys Glu Val Gly Glu Ala Val
Ala Lys Arg Phe His Leu Pro Gly Ile 325
330 335Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala
Ile Leu Ile Thr 340 345 350Pro
Glu Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe 355
360 365Phe Glu Ala Lys Val Val Asp Leu Asp
Thr Gly Lys Thr Leu Gly Val 370 375
380Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly385
390 395 400Tyr Val Asn Asn
Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly 405
410 415Trp Leu His Ser Gly Asp Ile Ala Tyr Trp
Asp Glu Asp Glu His Phe 420 425
430Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln
435 440 445Val Ala Pro Ala Glu Leu Glu
Ser Ile Leu Leu Gln His Pro Asn Ile 450 455
460Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu
Leu465 470 475 480Pro Ala
Ala Val Val Val Leu Glu His Gly Lys Thr Met Thr Glu Lys
485 490 495Glu Ile Val Asp Tyr Val Ala
Ser Gln Val Thr Thr Ala Lys Lys Leu 500 505
510Arg Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu
Thr Gly 515 520 525Lys Leu Asp Ala
Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys 530
535 540Gly Gly Lys Ser Lys Leu545
55038550PRTPhotinus pyralisVARIANT(214)xaa=an amino acid other than Thr
38Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro1
5 10 15Leu Glu Asp Gly Thr Ala
Gly Glu Gln Leu His Lys Ala Met Lys Arg 20 25
30Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala
His Ile Glu 35 40 45Val Asn Ile
Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu Ala 50
55 60Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His
Arg Ile Val Val65 70 75
80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu
85 90 95Phe Ile Gly Val Ala Val
Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg 100
105 110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr
Val Val Phe Val 115 120 125Ser Lys
Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro 130
135 140Ile Ile Gln Lys Ile Ile Ile Met Asp Ser Lys
Thr Asp Tyr Gln Gly145 150 155
160Phe Gln Ser Met Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe
165 170 175Asn Glu Tyr Asp
Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile 180
185 190Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly
Leu Pro Lys Gly Val 195 200 205Ala
Leu Pro His Arg Xaa Ala Cys Val Arg Phe Ser His Ala Arg Asp 210
215 220Pro Ile Phe Gly Asn Gln Ile Ile Pro Asp
Thr Ala Ile Leu Ser Val225 230 235
240Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr
Leu 245 250 255Ile Cys Gly
Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu 260
265 270Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile
Gln Ser Ala Leu Leu Val 275 280
285Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr 290
295 300Asp Leu Ser Asn Leu His Glu Ile
Ala Ser Gly Gly Ala Pro Leu Ser305 310
315 320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His
Leu Pro Gly Ile 325 330
335Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr
340 345 350Pro Glu Gly Asp Asp Lys
Pro Gly Ala Val Gly Lys Val Val Pro Phe 355 360
365Phe Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu
Gly Val 370 375 380Asn Gln Arg Gly Glu
Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly385 390
395 400Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala
Leu Ile Asp Lys Asp Gly 405 410
415Trp Leu His Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe
420 425 430Phe Ile Val Asp Arg
Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln 435
440 445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln
His Pro Asn Ile 450 455 460Phe Asp Ala
Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu465
470 475 480Pro Ala Ala Val Val Val Leu
Glu His Gly Lys Thr Met Thr Glu Lys 485
490 495Glu Ile Val Asp Tyr Val Ala Ser Gln Val Thr Thr
Ala Lys Lys Leu 500 505 510Arg
Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly 515
520 525Lys Leu Asp Ala Arg Lys Ile Arg Glu
Ile Leu Ile Lys Ala Lys Lys 530 535
540Gly Gly Lys Ser Lys Leu545 55039550PRTPhotinus
pyralisVARIANT(214)Xaa=Cys, Ala or Asn 39Met Glu Asp Ala Lys Asn Ile Lys
Lys Gly Pro Ala Pro Phe Tyr Pro1 5 10
15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met
Lys Arg 20 25 30Tyr Ala Leu
Val Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu 35
40 45Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met
Ser Val Arg Leu Ala 50 55 60Glu Ala
Met Lys Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val65
70 75 80Cys Ser Glu Asn Ser Leu Gln
Phe Phe Met Pro Val Leu Gly Ala Leu 85 90
95Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr
Asn Glu Arg 100 105 110Glu Leu
Leu Asn Ser Met Asn Ile Ser Gln Pro Thr Val Val Phe Val 115
120 125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn
Val Gln Lys Lys Leu Pro 130 135 140Ile
Ile Gln Lys Ile Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly145
150 155 160Phe Gln Ser Met Tyr Thr
Phe Val Thr Ser His Leu Pro Pro Gly Phe 165
170 175Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg
Asp Lys Thr Ile 180 185 190Ala
Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195
200 205Ala Leu Pro His Arg Xaa Ala Cys Val
Arg Phe Ser His Ala Arg Asp 210 215
220Pro Ile Phe Gly Asn Gln Ile Ile Pro Asp Thr Ala Ile Leu Ser Val225
230 235 240Val Pro Phe His
His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu 245
250 255Ile Cys Gly Phe Arg Val Val Leu Met Tyr
Arg Phe Glu Glu Glu Leu 260 265
270Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val
275 280 285Pro Thr Leu Phe Ser Phe Phe
Ala Lys Ser Thr Leu Ile Asp Lys Tyr 290 295
300Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu
Ser305 310 315 320Lys Glu
Val Gly Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile
325 330 335Arg Gln Gly Tyr Gly Leu Thr
Glu Thr Thr Ser Ala Ile Leu Ile Thr 340 345
350Pro Glu Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val
Pro Phe 355 360 365Phe Glu Ala Lys
Val Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val 370
375 380Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met
Ile Met Ser Gly385 390 395
400Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly
405 410 415Trp Leu His Ser Gly
Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe 420
425 430Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr
Lys Gly Tyr Gln 435 440 445Val Ala
Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile 450
455 460Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp
Asp Ala Gly Glu Leu465 470 475
480Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr Met Thr Glu Lys
485 490 495Glu Ile Val Asp
Tyr Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu 500
505 510Arg Gly Gly Val Val Phe Val Asp Glu Val Pro
Lys Gly Leu Thr Gly 515 520 525Lys
Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys 530
535 540Gly Gly Lys Ser Lys Leu545
55040550PRTPhotinus pyralisVARIANT(214)Xaa=Ala 40Met Glu Asp Ala Lys Asn
Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro1 5
10 15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys
Ala Met Lys Arg 20 25 30Tyr
Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu 35
40 45Val Asn Ile Thr Tyr Ala Glu Tyr Phe
Glu Met Ser Val Arg Leu Ala 50 55
60Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val65
70 75 80Cys Ser Glu Asn Ser
Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu 85
90 95Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp
Ile Tyr Asn Glu Arg 100 105
110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr Val Val Phe Val
115 120 125Ser Lys Lys Gly Leu Gln Lys
Ile Leu Asn Val Gln Lys Lys Leu Pro 130 135
140Ile Ile Gln Lys Ile Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln
Gly145 150 155 160Phe Gln
Ser Met Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe
165 170 175Asn Glu Tyr Asp Phe Val Pro
Glu Ser Phe Asp Arg Asp Lys Thr Ile 180 185
190Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys
Gly Val 195 200 205Ala Leu Pro His
Arg Xaa Ala Cys Val Arg Phe Ser His Ala Arg Asp 210
215 220Pro Ile Phe Gly Asn Gln Ile Ile Pro Asp Thr Ala
Ile Leu Ser Val225 230 235
240Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu
245 250 255Ile Cys Gly Phe Arg
Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu 260
265 270Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln Ser
Ala Leu Leu Val 275 280 285Pro Thr
Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr 290
295 300Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly
Gly Ala Pro Leu Ser305 310 315
320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile
325 330 335Arg Gln Gly Tyr
Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr 340
345 350Pro Xaa Gly Asp Asp Lys Pro Gly Ala Val Gly
Lys Val Val Pro Phe 355 360 365Phe
Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val 370
375 380Asn Gln Arg Gly Glu Leu Cys Val Arg Gly
Pro Met Ile Met Ser Gly385 390 395
400Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp
Gly 405 410 415Trp Leu His
Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe 420
425 430Phe Ile Val Asp Arg Leu Lys Ser Leu Ile
Lys Tyr Lys Gly Tyr Gln 435 440
445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile 450
455 460Phe Asp Ala Gly Val Ala Gly Leu
Pro Asp Asp Asp Ala Gly Glu Leu465 470
475 480Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr
Met Thr Glu Lys 485 490
495Glu Ile Val Asp Tyr Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu
500 505 510Arg Gly Gly Val Val Phe
Val Asp Glu Val Pro Lys Gly Leu Thr Gly 515 520
525Lys Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala
Lys Lys 530 535 540Gly Gly Lys Ser Lys
Leu545 55041550PRTPhotinus pyralisVARIANT(214)Xaa=Ala
41Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro1
5 10 15Leu Glu Asp Gly Thr Ala
Gly Glu Gln Leu His Lys Ala Met Lys Arg 20 25
30Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala
His Ile Glu 35 40 45Val Asn Ile
Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu Ala 50
55 60Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His
Arg Ile Val Val65 70 75
80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu
85 90 95Phe Ile Gly Val Ala Val
Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg 100
105 110Glu Leu Leu Asn Ser Met Asn Ile Ser Gln Pro Thr
Val Val Phe Val 115 120 125Ser Lys
Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro 130
135 140Ile Ile Gln Lys Ile Ile Ile Met Asp Ser Lys
Thr Asp Tyr Gln Gly145 150 155
160Phe Gln Ser Met Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe
165 170 175Asn Glu Tyr Asp
Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile 180
185 190Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly
Leu Pro Lys Gly Val 195 200 205Ala
Leu Pro His Arg Xaa Ala Cys Val Arg Phe Ser His Ala Arg Asp 210
215 220Pro Ile Phe Gly Asn Gln Ile Xaa Pro Asp
Thr Ala Ile Leu Ser Val225 230 235
240Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr
Leu 245 250 255Ile Cys Gly
Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu 260
265 270Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile
Gln Ser Ala Leu Leu Val 275 280
285Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr 290
295 300Asp Leu Ser Asn Leu His Glu Ile
Ala Ser Gly Gly Ala Pro Leu Ser305 310
315 320Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His
Leu Pro Gly Ile 325 330
335Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr
340 345 350Pro Xaa Gly Asp Asp Lys
Pro Gly Ala Val Gly Lys Val Val Pro Phe 355 360
365Phe Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu
Gly Val 370 375 380Asn Gln Arg Gly Glu
Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly385 390
395 400Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala
Leu Ile Asp Lys Asp Gly 405 410
415Trp Leu His Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe
420 425 430Phe Ile Val Asp Arg
Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln 435
440 445Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln
His Pro Asn Ile 450 455 460Phe Asp Ala
Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu465
470 475 480Pro Ala Ala Val Val Val Leu
Glu His Gly Lys Thr Met Thr Glu Lys 485
490 495Glu Ile Val Asp Tyr Val Ala Ser Gln Val Thr Thr
Ala Lys Lys Leu 500 505 510Arg
Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly 515
520 525Lys Leu Asp Ala Arg Lys Ile Arg Glu
Ile Leu Ile Lys Ala Lys Lys 530 535
540Gly Gly Lys Ser Lys Leu545 55042550PRTPhotinus
pyralisVARIANT(214)Xaa=Ala 42Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro
Ala Pro Phe Tyr Pro1 5 10
15Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg
20 25 30Tyr Ala Leu Val Pro Gly Thr
Ile Ala Phe Thr Asp Ala His Ile Glu 35 40
45 Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu
Ala 50 55 60Glu Ala Met Lys Arg Tyr
Gly Leu Asn Thr Asn His Arg Ile Val Val65 70
75 80Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro
Val Leu Gly Ala Leu 85 90
95Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg
100 105 110Glu Leu Leu Asn Ser Met
Asn Ile Ser Gln Pro Thr Val Val Phe Val 115 120
125Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys
Leu Pro 130 135 140Ile Ile Gln Lys Ile
Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly145 150
155 160Phe Gln Ser Met Tyr Thr Phe Val Thr Ser
His Leu Pro Pro Gly Phe 165 170
175Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile
180 185 190Ala Leu Ile Met Asn
Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195
200 205Ala Leu Pro His Arg Xaa Xaa Cys Val Arg Phe Ser
His Ala Arg Asp 210 215 220Pro Ile Phe
Gly Asn Gln Ile Xaa Pro Asp Thr Ala Ile Leu Ser Val225
230 235 240Val Pro Phe His His Gly Phe
Gly Met Phe Thr Thr Leu Gly Tyr Leu 245
250 255Ile Cys Gly Phe Arg Val Val Leu Met Tyr Arg Phe
Glu Glu Glu Leu 260 265 270Phe
Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val 275
280 285Pro Thr Leu Phe Ser Phe Phe Ala Lys
Ser Thr Leu Ile Asp Lys Tyr 290 295
300Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser305
310 315 320Lys Glu Val Gly
Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile 325
330 335Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr
Ser Ala Ile Leu Ile Thr 340 345
350Pro Xaa Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe
355 360 365Phe Glu Ala Lys Val Val Asp
Leu Asp Thr Gly Lys Thr Leu Gly Val 370 375
380Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser
Gly385 390 395 400Tyr Val
Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly
405 410 415Trp Leu His Ser Gly Asp Ile
Ala Tyr Trp Asp Glu Asp Glu His Phe 420 425
430Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly
Tyr Gln 435 440 445Val Ala Pro Ala
Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile 450
455 460Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp
Ala Gly Glu Leu465 470 475
480Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr Met Thr Glu Lys
485 490 495Glu Ile Val Asp Tyr
Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu 500
505 510Arg Gly Gly Val Val Phe Val Asp Glu Val Pro Lys
Gly Leu Thr Gly 515 520 525Lys Leu
Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys 530
535 540Gly Gly Lys Ser Lys Leu545
550
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20150034574 | REINFORCED SHELVES FOR METAL SHELVING UNITS, FOR SUPPORTING ON THEIR FRONT ELECTRONIC LABELS AND/OR OTHER PERIPHERALS AND RELATED MANUFACTURING PROCESS |
20150034573 | WALL-MOUNTED BICYCLE RACK |
20150034572 | MAGNETIC POSITIONING FRAME FOR SOCKET BITS |
20150034571 | Rack for drying articles. |
20150034570 | SEPARATOR APPARATUS FOR GAS-WATER-OIL MIXTURES, AND SEPARATION PROCESS |