Patent application title: USE OF SERINE PROTEASE INHIBITORS IN THE TREATMENT OF SKIN DISEASES
Inventors:
David Deperthes (Geneva, CH)
Christoph Kundig (Lausanne 25, CH)
Alain Hovnanian (Paris, FR)
Celine Deraison (Toulouse, FR)
IPC8 Class: AA61K3849FI
USPC Class:
424 9464
Class name: Hydrolases (3. ) (e.g., urease, lipase, asparaginase, muramidase, etc.) acting on peptide bonds (3.4) (e.g., urokinease, etc.) serine proteinases (3.4.21) (e.g., trypsin, chymotrypsin, plasmin, thrombin, elastase, kallikrein, fibrinolysin, streptokinease, etc.)
Publication date: 2014-11-20
Patent application number: 20140341881
Abstract:
This invention relates to therapeutic compounds which are inhibitors of
serine proteases, to pharmaceutical compositions thereof and to their use
in the treatment of the human or animal body. More specifically, the
present invention relates to a method for the treatment, diagnosis or
prognosis of skin diseases comprising the administration to a subject in
need thereof of a therapeutically effective amount of a Serine protease
inhibitor.Claims:
1. A method for treating or preventing a skin disease in a patient
comprising the steps of: (a) providing a recombinant serine protease
inhibitor, the inhibitor inhibiting a serine protease, wherein the
inhibitor is selected from the group consisting of SEQ ID No 2, SEQ ID No
4, SEQ ID No 6, SEQ ID No 8, SEQ ID No 10, SEQ ID No 12, SEQ ID No 14,
SEQ ID No 39, SEQ ID No 40, SEQ ID No 41, SEQ ID No 42, SEQ ID No 43, SEQ
ID No 44, SEQ ID No 45, SEQ ID No 46, SEQ ID No 47, SEQ ID No 49, SEQ ID
No 50, SEQ ID No 51, SEQ ID No 52, SEQ ID No 53, SEQ ID No 54, SEQ ID No
55, SEQ ID No 56, SEQ ID No 57, SEQ ID No 58 and SEQ ID No 59, or a
biologically active fragment thereof having a serine protease inhibitor
activity, the biologically active fragment sharing at least 80% amino
acids in length with the respective sequence of a substrate active site
and exhibiting the same properties as the native sequence from which the
inhibitor derives; and (b) administering a pharmaceutically effective
amount of the recombinant serine protease inhibitor to the patient,
thereby treating the skin disease.
2. The method of claim 1, wherein the serine protease is selected from the group consisting of kallikrein, plasmin, chymotrypsin (Chtr), urokinase (uPA), tryptase and neutrophile elastase (HNE) enzymes and/or a combination thereof.
3. The method of claim 2, wherein the kallikrein is selected from the group consisting of human kallikrein 2 (hK2), human kallikrein 3 (hK3), human kallikrein 4 (hK4), human kallikrein 5 (hK5), human kallikrein 6 (hK6), human kallikrein 7 (hK7), human kallikrein 8 (hK8), human kallikrein 9 (hK9), human kallikrein 10 (hK10), human kallikrein 11 (hK11), human kallikrein 12 (hK12), human kallikrein 13 (hK13), human kallikrein 14 (hK14) or human kallikrein 15 (hK15) and/or a combination thereof.
4. The method of claim 3, wherein the kallikrein is hK2, hK5, hK7, or hK14 or a combination thereof.
5. The method of claim 1, wherein the skin disease is Netherton syndrome, atopic dermatitis, psoriasis or peeling skin syndrome.
6. A kit for the treatment or prevention of a skin disease comprising a recombinant serine protease inhibitor selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 6, SEQ ID No 8, SEQ ID No 10, SEQ ID No 12, SEQ ID No 14, SEQ ID No 39, SEQ ID No 40, SEQ ID No 41, SEQ ID No 42, SEQ ID No 43, SEQ ID No 44, SEQ ID No 45, SEQ ID No 46, SEQ ID No 47, SEQ ID No 49, SEQ ID No 50, SEQ ID No 51, SEQ ID No 52, SEQ ID No 53, SEQ ID No 54, SEQ ID No 55, SEQ ID No 56, SEQ ID No 57, SEQ ID No 58 and SEQ ID No 59, or a biologically active fragment thereof having a serine protease inhibitor activity, the biologically active fragment sharing at least 80% amino acids in length with the respective sequence of a substrate active site and exhibiting the same properties as the native sequence from which the inhibitor derives.
7. A composition comprising a pharmaceutically effective amount of a recombinant serine protease inhibitor, the inhibitor inhibiting a serine protease, wherein the inhibitor is selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 6, SEQ ID No 8, SEQ ID No 10, SEQ ID No 12, SEQ ID No 14, SEQ ID No 39, SEQ ID No 40, SEQ ID No 41, SEQ ID No 42, SEQ ID No 43, SEQ ID No 44, SEQ ID No 45, SEQ ID No 46, SEQ ID No 47, SEQ ID No 49, SEQ ID No 50, SEQ ID No 51, SEQ ID No 52, SEQ ID No 53, SEQ ID No 54, SEQ ID No 55, SEQ ID No 56, SEQ ID No 57, SEQ ID No 58 and SEQ ID No 59, or a biologically active fragment thereof having a serine protease inhibitor activity, the biologically active fragment sharing at least 80% amino acids in length with the respective sequence of a substrate active site and exhibiting the same properties as the native sequence from which the inhibitor derives.
8. The composition according to claim 7, wherein the serine protease is selected from the group consisting of kallikrein, plasmin, chymotrypsin (Chtr), urokinase (uPA), tryptase and neutrophile elastase (HNE) enzymes and/or a combination thereof.
9. The composition according to claim 8, wherein the kallikrein is selected from the group consisting of human kallikrein 2 (hK2), human kallikrein 3 (hK3), human kallikrein 4 (hK4), human kallikrein 5 (hK5), human kallikrein 6 (hK6), human kallikrein 7 (hK7), human kallikrein 8 (hK8), human kallikrein 9 (hK9), human kallikrein 10 (hK10), human kallikrein 11 (hK11), human kallikrein 12 (hK12), human kallikrein 13 (hK13), human kallikrein 14 (hK14) or human kallikrein 15 (hK15) and/or a combination thereof.
10. A method for improving an undesirable skin condition in a patient comprising the steps of: (a) providing a recombinant serine protease inhibitor selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 6, SEQ ID No 8, SEQ ID No 10, SEQ ID No 12, SEQ ID No 14, SEQ ID No 39, SEQ ID No 40, SEQ ID No 41, SEQ ID No 42, SEQ ID No 43, SEQ ID No 44, SEQ ID No 45, SEQ ID No 46, SEQ ID No 47, SEQ ID No 49, SEQ ID No 50, SEQ ID No 51, SEQ ID No 52, SEQ ID No 53, SEQ ID No 54, SEQ ID No 55, SEQ ID No 56, SEQ ID No 57, SEQ ID No 58 and SEQ ID No 59, or a biologically active fragment thereof having a serine protease inhibitor activity, the biologically active fragment sharing at least 80% amino acids in length with the respective sequence of a substrate active site and exhibiting the same properties as the native sequence from which the inhibitor derives; and (b) administering a pharmaceutically effective amount of the recombinant serine protease inhibitor to the patient, thereby improving the undesirable skin condition.
11. A detection assay for the diagnosis or prognosis of a skin disease in a tissue sample comprising the steps of: contacting the tissue sample with a recombinant serine protease inhibitor selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 6, SEQ ID No 8, SEQ ID No 10, SEQ ID No 12, SEQ ID No 14, SEQ ID No 39, SEQ ID No 40, SEQ ID No 41, SEQ ID No 42, SEQ ID No 43, SEQ ID No 44, SEQ ID No 45, SEQ ID No 46, SEQ ID No 47, SEQ ID No 49, SEQ ID No 50, SEQ ID No 51, SEQ ID No 52, SEQ ID No 53, SEQ ID No 54, SEQ ID No 55, SEQ ID No 56, SEQ ID No 57, SEQ ID No 58 and SEQ ID No 59 and having a detected label; determining and measuring the amount of said detected label; and correlating this amount to the presence or absence of a skin disease in said tissue sample.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a national stage application under 35 U.S.C. §371 of PCT Application No. PCT/IB2009/000089, filed Jan. 21, 2009, which claims priority to and the benefit of U.S. provisional patent application Ser. No. 61/022,386, filed Jan. 21, 2008 and Ser. No. 61/006,576, filed Jan. 22, 2008, each of which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] This invention relates to therapeutic compounds which are inhibitors of serine proteases, to pharmaceutical compositions thereof and to their use in the treatment of the human or animal body. More specifically, the present invention relates to a method for the treatment, diagnosis or prognosis of skin diseases comprising the administration to a subject in need thereof of a therapeutically effective amount of a Serine protease inhibitor.
BACKGROUND OF THE INVENTION
[0003] Proteases or proteolytic enzymes are essential in organisms, from bacteria and viruses to mammals. Proteases digest and degrade proteins by hydrolyzing peptide bonds. Serine proteases (EC. 3.4.21) have common features in the active site, primarily an active serine residue. There are two main types of serine proteases; the chymotrypsin/trypsin/elastase-like and subtilisin-like, which have an identical spatial arrangement of catalytic His, Asp, and Ser but in quite different protein scaffolds. However, over twenty families (S1-S27) of serine proteases have been identified that are grouped into 6 clans on the basis of structural similarity and other functional evidence, SA, SB, SC, SE, SF & SG. The family of chymotrypsin/trypsin/elastase-like serine proteases have been subdivided into two classes. The "large" class (ca 230 residues) includes mostly mammalian enzymes such as trypsin, chymotrypsin, elastase, kallikrein, and thrombin. The "small" class (ca 190 residues) includes the bacterial enzymes.
[0004] The catalytic His, Asp and Ser are flanked by substrate amino acid side chain residue binding pockets termed S1', S2', S3' etc on the C-terminal or `prime` side of the substrate and S1, S2, S3 etc on the N-terminal side. This nomenclature is as described in Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding, Alan Fersht, 1999 (W.H. Freeman and Company) pages 40-43 and Brik et al, Org. Biomol. Chem., 2003, 1, 5-14. The chymotrypsin/trypsin/elastase-like serine proteases can also be further subdivided by the residues present in the S1 pocket as described in Introduction to Protein Structure, Carl Branden and John Tooze, 1991 (Garland Publishing Inc) pages 231-241. The subdivisions are chymotrypsin-like (Gly-226, Ser-189 and Gly-216 in S1 pocket), trypsin-like (Gly-226, Asp-189 and Gly-216 in S1) and elastase-like (Val-226 and Thr-216 in S1) where the residues numbering is taken from the standard chymotrypsin numbering. The trypsin-like serine proteases prefer substrates which place either Lys or Arg in the S1 pocket.
[0005] The serine proteases have a common catalytic mechanism characterized by a particularly reactive Ser residue at position 195 using the chymotrypsin numbering system. Examples of serine proteases include trypsin, tryptase, chymotrypsin, elastase, thrombin, plasmin, kallikrein, Complement Cl, acrosomal protease, lysosomal protease, cocoonase, α-lytic protease, protease A, protease B, serine carboxypeptidase π, subtilisin, urokinase (uPA), Factor Vila, Factor IXa, and Factor Xa. The serine proteases have been investigated extensively for many years and are a major focus of research as a drug target due to their role in regulating a wide variety of physiological processes.
[0006] Processes involving serine proteases include coagulation, fibrinolysis, fertilization, development, malignancy, neuromuscular patterning and inflammation. It is well known that these compounds inhibit a variety of circulating proteases as well as proteases that are activated or released in tissue. It is also known that serine protease inhibitors inhibit critical cellular processes, such as adhesion, migration, free radical production and apoptosis. In addition, animal experiments indicate that intravenously administered serine protease inhibitors, variants or cells expressing serine protease inhibitors, provide protection against tissue damage.
[0007] The serine proteases Kallikreins (KLK) are shown to play an essential role in the normal physiology of skin. KLK5 and 7 were originally isolated and cloned from the stratum corneum (Hansson et al., 1994; Brattsand and Egelrud, 1999) and were shown to be involved in skin desquamation through processing of extracellular adhesive proteins of the corneodesmosomes, i.e. corneodesmosin (CDSN), desmoglein 1 (DSG1), and desmocollin 1 (DSC1) (Caubet et al., 2004; Descargues et al., 2005). KLK5 was shown to cleave all three components, while KLK7 was able to digest only CDSN and DSC1 (Caubet et al., 2004). Further IHC studies supported the proposed role of KLK7 in desquamation (Sondell et al., 1995). In-vitro studies demonstrated an potential activation mechanism of KLK7 through a proteolytic cascade, involving KLK5, and 14 (Brattsand et al., 2005). Also, varying levels of KLKs 1, 6, 8, 10, 11, and 13 have been reported in SC (Komatsu et al., 2005; Borgono et al., 2006) and KLK1, 5, 6, and 14 are believed to be involved in skin desquamation through DSG1 processing (Borgono et al., 2006). KLK14 is believed to play a major role in skin remodeling as it contributes to approximately half of the total trypsin-like proteolytic activity in the SC layer (Stefansson et al., 2006). KLK8 is suggested to play an overlapping function in skin desquamation processing DSG1 and CDSN (Kishibe et al., 2006). An additional antimicrobial function KLKs in skin through the regulation of cathelicidin peptides was shown in vitro and in vivo (Yamasaki et al., 2006).
[0008] Imbalances in the proteolytic activity of KLKs, through gene over-expression or dysregulation of activity is reported in a large number of skin disorders, including chronic itchy dermatitis, peeling skin syndrome, psoriasis, atopic dermatitis, and Netherton syndrome (Komatsu et al., 2005b; Descargues et al., 2005; Hachem et al., 2006; Komatsu et al., 2006; Hansson et al., 2002; Ekholm and Egelrud, 1999). The expression of multiple KLKs is significantly upregulated in psoriasis, atopic dermatitis, peeling skin syndrome type-B, and chronic lesions of atopic dermatitis (Komatsu et al., 2005b; Komatsu et al., 2006; Hansson et al., 2002). Patients with Netherton syndrome, an autosomal recessive skin disorder, have shown frame shifts and non-sense mutations in the SPINK5 gene encoding for LEKTI (Chavanas et al., 2000; Komatsu et al., 2002; Chavanas et al., 2000; Sprecher et al., 2001), LEKTI being a serine protease inhibitor with activity against several KLKs, including KLK5, 6, 7, 13, and 14 (Borgono et al., 2006; Egelrud et al., 2005; Deraison et al., 2007). Such genetic defects lead to loss of inhibitory domains (Chavanas et al., 2000; Sprecher et al., 2001).
[0009] Also of interest is the potential involvement of kallikreins in the skin inflammation aspect of desquamation type disorders through activation of protease activated receptors (PARs). PARs 1-4 are G protein-coupled receptors, activated by various proteases including kallikreins. PAR2 is of special interest, as it is activated by trypsin cleavage and is co-localized with tissue kallikreins in skin tissue. In skin lesions from atopic dermatitis and Netherton syndrome patients, PAR2 receptors were found overexpressed and co-localized with human tissue kallikreins (Descargues et al., 2006). This lead to the hypothesis that such a KLK-PAR pathway is involved in the pathogenesis of these diseases and that KLKs induce inflammation in these skin disorders via PAR2 activation.
[0010] Recent in vitro and in vivo work by Oikonomopoulou et al. (2006) has demonstrated that PAR activity may be targeted by active KLK5, 6, and 14. KLK5 and KLK6 were shown to activate PAR2, whereas KLK14 was reported to inactivate PAR1 and activate PAR2 and PAR4. Other reports showed activation of either PAR1 or PAR2 by KLK1, 2, 4, 5, 6 and 14 in different cell ltypes (Mize et al., 2008; Stefansson et al., 2008; Vandell et al., 2008)
[0011] PAR2 receptors are attractive research targets for dermatologists and cosmeticians due to implication in skin inflammation, cell proliferation, tumor suppression, skin pigmentation, and skin moisture. As activators of PAR2 receptors, kallikreins are of increasing interest to researchers investigating the above-mentioned skin processes. Natural non-denatured soybean-derived trypsin inhibitors are used as ingredients of cosmetic products targeting skin pigmentation, UV exposure, and skin moisture. Soybean-derived soy seeds and soymilk contain soybean trypsin inhibitor (STI) and Bowman-Birk inhibitor (BBI), respectively (Paine et al., 2001). The desired effects of these products are attributed to trypsin inhibition leading to blockade of PAR2 activation. KLK5 and KLK7 have been shown to be overexpressed under UVB irradiation concomitantly to a decrease of LEKTI expression, suggesting a contribution of these skin kallikreins in stratum corneum desquamation under UVB stress (Nin M et al., 2008).
[0012] It has been suggested that STI reduces UV light-induced skin cancer, as topical application of STI halts tumor progression in mice exposed to UVB for long periods (Huang et al., 2004). It is suggested that products containing natural soybean extracts block PAR2 activation by kallikrein inhibition. STI has been proven to inhibit trypsin-like KLK5 and 14 with high efficiency (Brattsand et al., 2005). Reduced KLK5 and 7 expression in the upper SC of dry skin and elevated KLK activity following UV radiation have been reported (Voegeli et al., 2007).
[0013] Serine protease inhibitors have also been predicted to have potential beneficial uses in the treatment of disease a wide variety of clinical areas such as oncology, neurology, hematology, pulmonary medicine, immunology, inflammation and infectious disease. Serine protease inhibitors may also be beneficial in the treatment of thrombotic diseases, asthma, emphysema, cirrhosis, arthritis, carcinoma, melanoma, restenosis, atheroma, trauma, shock and reperfusion injury. A useful review is found in Expert Opin. Ther. Patents (2002), 12(8). Serine protease inhibitors are disclosed in US published patent application US 2003/0100089 and 2004/0180371 and in U.S. Pat. Nos. 6,784,182, 6,656,911, 6,656,910, 6,608,175, 6,534,495 and 6,472,393.
[0014] Skin diseases such as contact hypersensitivity, atopic dermatitis, rare genetic skin diseases (e.g. Netherton syndrome) and psoriasis are characterized by hyperproliferative and inflammatory skin reactions. A large population suffers from these diseases. For example, atopic dermatitis, a hereditary chronic disease of the skin, affects approximately 8 million adults and children in the United States. It is believed that a combination of multiple factors including genetic, environmental, and immunological factors may cause skin diseases. Although most skin diseases are not fatal, they significantly affect quality of life of those who suffer from the diseases.
[0015] Commonly used steroid-containing ointment or anti-histamine agents for treating skin diseases frequently cause considerable side effects. For example, steroids of external or oral application make the skin layer thin, cause osteoporosis, and inhibit growth in children upon long-term use. It was also observed that the termination of steroid application is often followed by lesion recurrence.
[0016] Therefore is a need to develop improved non-steroid agents for therapeutic, prophylactic or diagnostic approaches for the treatment of skin diseases. The present invention provides an improved and reliable method for the treatment, diagnosis or prophylaxis of skin diseases comprising the administration to a subject in need thereof of a therapeutically effective amount of a Serine protease inhibitor.
[0017] These and other objects as will be apparent from the foregoing have been achieved by the present invention.
SUMMARY OF THE INVENTION
[0018] The present invention concerns a method of treating or preventing as skin disease comprising administering to a mammal a pharmaceutical composition comprising a recombinant Serine protease inhibitor.
[0019] Also disclosed is the use of a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease.
[0020] Another object of the invention is a kit for treating or preventing as skin disease comprising a pharmaceutical composition of a recombinant Serine protease inhibitor.
[0021] Other objects and advantages will become apparent to those skilled in the art from a review of the ensuing detailed description, which proceeds with reference to the following illustrative drawings, and the attendant claims.
BRIEF OF THE FIGURES
[0022] FIG. 1 represents the DNA and protein sequences of hK2 protease inhibitor MD 820
[0023] FIG. 2 represents the DNA and protein sequences of hK2 protease inhibitor MD 62
[0024] FIG. 3 represents the DNA and protein sequences of hK2 protease inhibitor MD 83
[0025] FIG. 4 represents the DNA and protein sequences of hK2 protease inhibitor MD 67
[0026] FIG. 5 represents the DNA and protein sequences of hK2 protease inhibitor MD 61
[0027] FIG. 6 represents the DNA and protein sequences of hK2 protease inhibitor MD 518
[0028] FIG. 7 represents the DNA and protein sequences of hK2 protease inhibitor MDCI
[0029] FIG. 8 represents the DNA and protein sequences of ACT-wildtype.
[0030] FIG. 9 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G1.
[0031] FIG. 10 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G1G
[0032] FIG. 11 represents the DNA and protein sequences of hK14 protease inhibitor ACT-C11.
[0033] FIG. 12 represents the DNA and protein sequences of hK14 protease inhibitor ACT-C11G.
[0034] FIG. 13 represents the DNA and protein sequences of hK14 protease inhibitor ACT-E5.
[0035] FIG. 14 represents the DNA and protein sequences of hK14 protease inhibitor ACT-E8.
[0036] FIG. 15 represents the DNA and protein sequences of hK14 protease inhibitor ACT-F11.
[0037] FIG. 16 represents the DNA and protein sequences of hK14 protease inhibitor ACT-F3.
[0038] FIG. 17 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G9.
[0039] FIG. 18 represents the DNA and protein sequences of AAT-wildtype.
[0040] FIG. 19 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1.
[0041] FIG. 20 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1G
[0042] FIG. 21 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11.
[0043] FIG. 22 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11G.
[0044] FIG. 23 represents the DNA and protein sequences of hK14 protease inhibitor AAT-E5.
[0045] FIG. 24 represents the DNA and protein sequences of hK14 protease inhibitor AAT-E8.
[0046] FIG. 25 represents the DNA and protein sequences of hK14 protease inhibitor AAT-F11.
[0047] FIG. 26 represents the DNA and protein sequences of hK14 protease inhibitor AAT-F3.
[0048] FIG. 27 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G9.
[0049] FIG. 28 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1V.
[0050] FIG. 29 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11D.
[0051] FIG. 30 shows the grading system for skin lesions on transgeninc hKLKS mouse Netherton Model.
[0052] FIG. 31 shows the skin lesion size development on Netherton Syndrome mouse model. Monitoring of lesion sizes and lesion grade after 1, 15 and 28 days of topical application of 2% NATROSOL® (hydroxyethylcellulose (HEC)) (group 1, control) or MDPK67b in 2% NATROSOL® (hydroxyethylcellulose (HEC)) (group 2).
DETAILED DESCRIPTION OF THE INVENTION
[0053] The present invention relates to the use of a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease. Biologically active fragments of a Serine protease inhibitor are also useful in the preparation of said medicament.
[0054] Some of the serine proteases of the chymotrypsin superfamily, including t-PA, plasmin, u-PA and the proteases of the blood coagulation cascade are large molecules that contain, in addition to the serine protease catalytic domain, other structural domains responsible in part for regulation of their activity (Barrett, 1986; Gerard et al, 1986; Blasi et al., 1986). Among important serine proteases are trypsin-like enzymes, such as trypsin, tryptase, thrombin, kallikrein, and factor Xa. The serine protease targets are associated with processes such as blood clotting; complement mediated lysis, the immune response, glomerulonephritis, pain sensing, inflammation, pancreatitis, cancer, regulating fertilization, bacterial infection and viral maturation. By inhibiting serine proteases which have high specificity for a particular target, one can inhibit in vivo numerous biological processes, which may have dramatic effects on a host.
[0055] Serine proteinase inhibitors (serpins) comprise a diverse group of proteins that form a superfamily already including more than 100 members, from such diverse organisms as viruses, plants and humans. Serpins have evolved over 500 million years and diverged phylogenetically into proteins with inhibitory function and non-inhibitory function (Hunt and Dayhoff, 1980). Non-inhibitory serpins such as ovalbumin lack protease inhibitory activity (Remold-O'Donnell, 1993). The primary function of serpin family members appears to be neutralizing overexpressed serine proteinase activity (Potempa et al., 1994). Serpins play a role in extracellular matrix remodeling, modulation of inflammatory response and cell migration (Potempa et al., 1994).
[0056] Serine protease inhibitors are divided into the following families: the bovine pancreatic trypsin inhibitor (Kunitz) family, also known as basic protease inhibitor (Ketcham et al., 1978); the Kazal family; the Streptomyces subtilisin inhibitor family; the serpin family; the soybean trypsin inhibitor (Kunitz) family; the potato inhibitor family; and the Bowman-Birk family (Laskowski et al., 1980; Read et al., 1986; Laskowski et al., 1987). Serine protease inhibitors belonging to the serpin family include the plasminogen activator inhibitors PAI-1, PAI-2 and PAI-3, C1 esterase inhibitor, alpha-2-antiplasmin, contrapsin, alpha-1-antitrypsin, antithrombin III, protease nexin I, alpha-1-antichymotrypsin, protein C inhibitor, heparin cofactor II and growth hormone regulated protein (Carrell et al., 1987; Sommer et al., 1987; Suzuki et al., 1987; Stump et al., 1986).
[0057] Many of the serine protease inhibitors have a broad specificity and are able to inhibit both the chymotrypsin superfamily of proteases, including the blood coagulation serine proteases, and the Streptomyces subtilisin superfamily of serine proteases (Laskowski et al., 1980). The inhibition of serine proteases by serpins has been reviewed in Travis et al. (1983); Carrell et al. (1985); and Sprengers et al. (1987). Crystallographic data are available for a number of intact inhibitors including members of the BPTI, Kazal, SSI, soybean trypsin and potato inhibitor families, and for a cleaved form of the serpin alpha-1-antitrypsin (Read et al., 1986). Despite the fact that these serine protease inhibitors are proteins of diverse size and sequence, the intact inhibitors studied to date all have in common a characteristic loop, termed the reactive site loop, extending from the surface of the molecule that contains the recognition sequence for the active site of the cognate serine protease (Levin et al., 1983). The structural similarity of the loops in the different serine protease inhibitors is remarkable (Papamokos et al., 1982). The specificity of each inhibitor is thought to be determined primarily by the identity of the amino acid that is immediately amino-terminal to the site of potential cleavage of the inhibitor by the serine protease. This amino acid, known as the Pi site residue, is thought to form an acyl bond with the serine in the active site of the serine protease (Laskowski et al., 1980). Whether or not a serpin possesses inhibitory function depends strongly on the consensus sequence located in the hinge region of the reactive site loop near the carboxy-terminus of the coding region. Outside of the reactive site loop, the serine protease inhibitors of different families are generally unrelated structurally, although the Kazal family and Streptomyces subtilisin family of inhibitors display some structural and sequence similarity.
[0058] As used herein, the following definitions are supplied in order to facilitate the understanding of the present invention.
[0059] "A" or "an" means "at least one" or "one or more."
[0060] The term "comprise" is generally used in the sense of include, that is to say permitting the presence of one or more features or components.
[0061] As used herein, the terms "protein", "polypeptide", "polypeptidic", "peptide" and "peptidic" or "peptidic chain" are used interchangeably herein to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
[0062] Preferably, the Serine protease inhibitor is a recombinant Serine protease inhibitor and is selected from the group comprising the SEQ ID No 2, 4, 6, 8, 10, 12 and 14 or a biologically active fragment thereof having a Serine protease inhibitor activity.
[0063] Preferably also the recombinant Serine protease inhibitor is selected from the group comprising the SEQ ID No 39 to 59 or a biologically active fragment thereof having a Serine protease inhibitor activity.
[0064] "Amino acid residue" means any amino acid residue known to those skilled in the art. This encompasses naturally occurring amino acids (including for instance, using the three-letter code, Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Be, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val), as well as rare and/or synthetic amino acids and derivatives thereof (including for instance Aad, Abu, Acp, Ahe, Aib, Apm, Dbu, Des, Dpm, Hyl, McLys, McVal, Nva, and the like).
[0065] Said amino acid residue or derivative thereof can be any isomer, especially any chiral isomer, e.g. the L- or D-isoform.
[0066] By amino acid derivative, we hereby mean any amino acid derivative as known in the art. For instance, amino acid derivatives include residues derivable from natural amino acids bearing additional side chains, e.g. alkyl side chains, and/or heteroatom substitutions.
[0067] "Biologically active fragments" refer to sequences sharing at least 40% amino acids in length with the respective sequence of the substrate active site. These sequences can be used as long as they exhibit the same properties as the native sequence from which they derive. Preferably these sequences share more than 70%, preferably more than 80%, in particular more than 90% amino acids in length with the respective sequence the substrate active site.
[0068] The present invention also includes variants of a Serine protease inhibitor sequence. The term "variants" refer to polypeptides having amino acid sequences that differ to some extent from a native sequence polypeptide that is amino acid sequences that vary from the native sequence by conservative amino acid substitutions, whereby one or more amino acids are substituted by another with same characteristics and conformational roles. The amino acid sequence variants possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence of the native amino acid sequence. Conservative amino acid substitutions are herein defined as exchanges within one of the following five groups:
I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly II. Polar, positively charged residues: His, Arg, Lys III. Polar, negatively charged residues: and their amides: Asp, Asn, Glu, Gln IV. Large, aromatic residues: Phe, Tyr, Trp V. Large, aliphatic, nonpolar residues: Met, Leu, Ile, Val, Cys.
[0069] "Administering", as it applies in the present invention, refers to contact of a pharmaceutical, therapeutic, diagnostic agent or composition, to the subject, preferably a human.
[0070] The term "kallikrein" relates to glandular or tissue kallikreins. Glandular or tissue kallikreins are a sub-family of serine proteases, with a high degree of substrate specificity and diverse expression in various tissues and biological fluids. The term "kallikrein" appeared in the literature for the first time in the 1930s, when large amounts of protease enzymes were found in pancreas isolates (pancreas is "Kallikreas" in Greek) (Kraut et al. 1930, Werle 1934). Nowadays kallikrein enzymes are divided into two groups, plasma and tissue kallikreins, which differ significantly in their molecular weight, substrate specificity, immunological characteristics, gene structure, and type of the kinin released.
[0071] Kallikreins comprise a family of 15 homologous single chain, secreted serine endopeptidases of ˜25-30 kDa, with orthologues present in species from at least six mammalian orders. These kallikreins are hK2, hK3, hK2, hK5, hK6, hK7, hK8, hK9 hK10, hK11, hK12, hK13, hK14 and hK15. Preferably, kallikreins to be inhibited are selected from the group comprising hK2, hK5, hK7, and hK14.
[0072] "Disease", as used herein, refers to a pathological condition of a part, organ, or system of an organism resulting from various causes, such as infection, genetic defect, or environmental stress, and characterized by an identifiable group of signs or symptoms.
[0073] The epidermis has been shown to express several serine proteases including kallikrein, urokinase, plasmin, typtase-like and neutrophile elastase enzymes. These serine proteases are involved in multiple activities in the skin including epidermal cell proliferation, cell differentiation, skin and lipid barrier homeostasis and tissue remodelling. Most importantly, proteolysis of stratum corneum (SC) corneodesmosomes by serine proteases together with other enzymes is a crucial event prior to shedding of the outermost skin layer, called desquamation. Furthermore, increased protease activity, including kallikrein, plasmin and urokinase enzymes are implicated in inflammatory reactions of the skin. A list with inflammatory skin diseases is shown in TABLE XX.
[0074] Increased protease activity was also observed as stress response to various stimuli including environmental factors as ultraviolet radiation exposure and temperature changes or as reaction to different surfactants.
[0075] Several kallikreins, notably hK5, hK7 and hK14 have been implicated in the proteolytic cascade in skin desquamation. This proteolytic process is controlled through a complex inhibition and activation process and its deregulation can cause serious skin disorders. Rare genetic diseases (Netherton Syndrome, peeling skin syndrome) as well as more common skin diseases like atopic dermatitis or psoriasis are characterized by increased desquamation of the skin caused at least in part by an increased kallikrein activity.
[0076] The present invention also relates to the use of a Serine protease in the preparation of a cosmetic or cosmeceutical agent for the treatment or improvement of an undesirable skin condition. Biologically active fragments of a Serine protease inhibitor are also useful in the preparation of said cosmetic or cosmeceutical agent.
[0077] "An undesirable skin condition" refers, in the present invention, to a problem affecting the skin or the appearance of the skin which might not always be considered as a disease.
[0078] As used herein "Cosmetics" are compositions used to enhance or protect the appearance of the human skin. Cosmetics include skin-care creams, lotions, powders, perfumes, lipsticks, fingernail and toenail polishes, eye and facial makeup, permanent waves, hair colors, hair sprays and gels, deodorants, baby products, bath oils, bubble baths, bath salts, butters and many other types of products.
[0079] "Cosmeceuticals" are cosmetic products that are thought to have drug-like benefits. Examples of products typically labeled as cosmeceuticals include anti-aging creams and moisturizers. Cosmeceuticals may contain purported active ingredients such as vitamins, phytochemicals, enzymes, antioxidants, and essential oils.
[0080] As used herein, "Skin disease" relates to conditions affecting the skin. Usually, the skin disease is selected from Table XX. Preferably, the invention is suitable for treatment of skin diseases, such as atopic dermatitis, contact dermatitis (allergy), contact dermatitis (irritant), eczema, psoriasis, acne, epidermal hyperkeratosis, acanthosis, epidermal inflammation, dermal inflammation or pruritus, rosacea, netherton syndrome, peeling skin syndrome type A and B, hereditary ichtyosis, hidradenitis suppurativa and erythroderma (generalized exfoliative dermatitis). Most preferably, the skin disease is selected from the group comprising Netherton syndrome, Atopic dermatitis, Psoriasis and Peeling Skin Syndrome.
[0081] Netherton syndrome (NS) is a rare autosomal recessive genodermatosis caused by mutations in SPINK5 (LEKTI) one of the major inhibitor of the skin kallikrein cascade. Increased kallikrein activities have been shown to be causative for its clinical symptoms. NS, a multisystem ichthyosiform syndrome, is characterized by ichthyosis, erythroderma, hair shaft defects and atopic features. Multiple infections due to the seriously impaired barrier function of the skin are very common.
[0082] NS is very rare, but little data on frequency is available, probably in part due to the difficulty to identify NS. Currently, less than 10 cases per million are diagnosed.
[0083] Treatment options are very limited and non-curative. They concentrate mainly on management of the various cutaneous infections and reduction of itching and pain (e.g. corticosteroid).
[0084] Excessive kallikrein activity (hK5, hK7, hK14) was proven causative for symptoms of the skin disorder. Decreased activity of the natural kallikrein inhibitor (LEKTI) could be replaced by alternative kallikrein inhibitors.
[0085] Surprisingly, Applicants have shown, e.g. in exemple 4, that the application of Serine protease inhibitors including MD67 (SEQ ID No 8) mouse model (orthotopic hK5 overexpressing) considerably decreased the severity of the symptoms, which were observed in the untreated skin disease (e.g. NS) models. The symptoms are characterized by severe peeling of the skin, due to premature desmosomal protein degradation resulting in splitting of corneodesmosomes and stratum corneum detachment. This causes a severe loss of skin barrier functions leading to severe dehydratation, erythema and intense scratching.
[0086] Atopic dermatitis (AD) is a pruritic disease of not well defined origin that usually starts in early infancy and is typified by itching, eczematous lesions and dry, thick skin. AD is associatedwith other atopic diseases (eg, asthma, allergic reactions in about 30% of patients) and cutaneous infections are common.
[0087] The pathophysiology of AD is poorly understood. There appears to be a genetic component. An immune defect involving an abnormality of TH2 cells is suggested and a dysregulation of protease activity was found to be involved in the disease. This dysregulation is believed to cause a defective barrier function in the stratum corneum leading to the entry of antigens, which results in the production of various inflammatory cytokines. The prevalence rate in US is 10-12% in children and 0.9% in adults. In other developed countries the prevalence rate is as high as 18% and is rising, especially in developed countries. The disease is chronic, but the majority of patients improve from childhood to adult age.
[0088] No curative treatment is available yet. Depending on the severity of the symptoms topical steroids, antihistamines and immunomodulators or antibiotics, antiviral and antifungal agents are usually prescribed.
[0089] Psoriasis is a chronic disease, it is noncontagious and commonly appears as inflamed, edematous skin lesions, but also occurs on the oral mucosa. Joints (arthritis) also are affected in 10% of patients. Flares are related to various systemic and environmental factors including stress events or infections. There is a genetic predisposition for psoriasis and there is mounting evidence for signs of an autoimmune disorder. Increased protease (e.g. kallikrein) activity is involved in the typical excessive desquamation of the skin. In the US 2 to 3% of the population are affected and over 200'000 new cases occur annually. Approximately 1.5 million people with psoriatic arthritis seek medical care each year and 400 hundred people die annually from psoriasis-related causes. Incidence of psoriasis in other countries is similar but dependent on the climate and genetic heritage of the population. It is less common in the tropics and in dark-skinned persons.
[0090] Currently, there is no curative treatment. Depending on severity of symptoms topical corticosteroids, coal tar, keratolytic agents or retinoids are prescribed.
[0091] "Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, monkeys etc. Preferably, the mammal is human.
[0092] "Treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Hence, the mammal to be treated herein may have been diagnosed as having the disorder or may be predisposed or susceptible to the disorder.
[0093] The term "subject" refers to patients of human or other mammal and includes any individual it is desired to examine or treat using the methods according to the present invention. However, it will be understood that "patient" does not automatically imply that symptoms or diseases are present.
[0094] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
[0095] As used herein, the term "protease" refers to a class of enzymes which recognizes a molecule and cleaves an activation sequence in the molecule. The protease can be an endopeptidase which cleaves internal peptide bonds. Alternatively, the protease can be an exopeptidase which hydrolyzes the peptide bonds from the N-terminal end or the C-terminal end of the polypeptide or protein molecule. The protease folds into a conformation to form a catalytic site which receives and cleaves the activation sequence.
[0096] "Inhibitors" refer to a polypeptide, or a chemical compound, that specifically inhibit the function of a kallikrein or serine protease by, preferably, binding to said kallikrein or serine protease.
[0097] "Reactive Serpin Loop" or "Reactive Site Loop" or RSL refers to an exposed flexible reactive-site loop found in serpin and which is implicated in the interaction with the putative target protease. From the residue on the amino acid side of the scissile bond, and moving away from the bond, residues are conventionally called P1, P2, P3, etc. Residues that follow the scissile bond are called P1', P2', P3', etc. Usually, the RSL is composed of 6 to 12 amino acid residues.
[0098] "Serine protease inhibitors" or serpin according to the invention can be selected from the group comprising the α-1antichymotrypsin (ACT), protein C inhibitor (PCI), α-1antiproteinase (AAT), human α-1antitrypsin-related protein precursor (ATR), α-2-plasmin inhibitor (AAP), human anti-thrombin-III precursor (ATIII), protease inhibitor 10 (PI10), human collagen-binding protein 2 precursor (CBP2), protease inhibitor 7 (PI7), protease inhibitor leuserpin 2 (HLS2), human plasma protease C1 inhibitor (C1 INH), monocyte/neutrophil elastase inhibitor (M/NEI), plasminogen activator inhibitor-3 (PAI3), protease inhibitor 4 (PI4), protease inhibitor 5 (PI5), protease inhibitor 12 (PI12), human plasminogen activator inhibitor-1 precursor endothelial (PAI-1), human plasminogen activator inhibitor-2 placental (PAI2), human pigment epithelium-derived factor precursor (PEDF), protease inhibitor 6 (PI6), protease inhibitor 8 (PI8), protease inhibitor 9 (PI9), human squamous cell carcinoma antigen 1 (SCCA-1), human squamous cell carcinoma antigen 2 (SCCA-2), T4-binding globulin (TBG), Megsin, and protease inhibitor 14 (PI14), fragments thereof, molecular chimeras thereof, combinations thereof and/or variants thereof.
[0099] Since most of these serpins have different names, Applicant includes below a table I summarizing their specifications:
TABLE-US-00001 TABLE I Accession Serpin Number RSL sequence PI or AAT, A1AT_HUMAN ALPHA-1-ANTITRYPSIN PRECURSOR sp|P01009| GTEAAGAMFLEAIPMSIPPE (ALPHA-1 PROTEASE INHIBITOR) (ALPHA-1-ANTIPROTEINASE) SEQ ID NO: 85 PIL or ATR, A1AU_HUMAN ALPHA-1-ANTITRYPSIN-RELATED sp|P20848| GTEATGAPHLEEKAWSKYQT PROTEIN PRECURSOR SEQ ID NO : 86 PLI OR AAP, A2AP_HUMAN ALPHA-2-ANTIPLASMIN sp|P08697| GVEAAAATSIAMSRMSLSSF PRECURSOR (ALPHA-2-PLASMIN INHIBITOR) (ALPHA-2-PI) SEQ ID NO: 87 (ALPHA-2-AP) AACT, AACT_HUMAN ALPHA-1-ANTICHYMOTRYPSIN sp|P01011| GTEASAATAVKITLLSALVE PRECURSOR (ACT) SEQ ID NO : 88 AT3, ANT3_HUMAN ANTITHROMBIN-III PRECURSOR (ATIII) sp|P01008| GSEAAASTAVVIAGRSLNPN SEQ ID NO : 89 PI10 BOMA_HUMAN BOMAPIN (PROTEASE INHIBITOR 10) sp|P48595| GTEAAAGSGSEIDIRIRVPS SEQ ID NO: 90 CBP2, CBP2_HUMAN COLLAGEN-BINDING PROTEIN 2 sp|P50454| GNPFDQDIYGREELRSPKLF PRECURSOR (COLLIGIN 2) SEQ ID NO: 91 PI7 or PN1, GDN_HUMAN GLIA DERIVED NEXIN PRECURSOR sp|P07093| GTKASAATTAILIARSSPPW (GDN) (PROTEASE NEXIN I) (PN-1) (PROTEASE INHIBITOR 7) SEQ ID NO: 92 HCF2, HEP2_HUMAN HEPARIN COFACTOR II PRECURSOR sp|P05546| GTQATTVTTVGFMPLSTQVR (HC-II) (PROTEASE INHIBITOR LEUSERPIN 2) (HLS2) SEQ ID NO: 93 C1NH or C1IN, IC1_HUMAN PLASMA PROTEASE C1 INHIBITOR sp|P05155| GVEAAAASAISVARTLLVFE PRECURSOR (C1 INH) SEQ ID NO : 94 ELANH2 or PI2, ILEU_HUMAN LEUKOCYTE ELASTASE sp|P30740| GTEAAAATAGIATFCMLMPE INHIBITOR (LEI) (MONOCYTE/NEUTROPHIL ELASTASE SEQ ID NO: 95 INHIBITOR) (M/NEI) (EI) PCI or PLANH3 or PROCI, IPSP_HUMAN PLASMA SERINE sp|P05154| GTRAAAATGTIFTFRSARLN PROTEASE INHIBITOR PRECURSOR (PCI) (PROTEIN C SEQ ID NO: 96 INHIBITOR) (PLASMINOGEN ACTIVATOR INHIBITOR-3) (PAI3) PI4 or KST, KAIN_HUMAN KALLISTATIN PRECURSOR sp|P29622| GTEAAAATTFAIKFFSAQTN (KALLIKREIN INHIBITOR) (PROTEASE INHIBITOR 4) SEQ ID NO: 97 PI5, MASP_HUMAN MASPIN PRECURSOR (PROTEASE sp|P36952| GGDSIEVPGARILQHKDELN INHIBITOR 5) SEQ ID NO: 98 P112, NEUS_HUMAN NEUROSERPIN PRECURSOR (PROTEASE sp|Q99574| GSEAAAVSGMIAISRMAVLY INHIBITOR 12) SEQ ID NO: 99 PAI1 or PLANH1, sp|P05121|PA|1_HUMAN PLASMINOGEN sp|P05121| GTVASSSTAVIVSARMAPEE ACTIVATOR INHIBITOR-1 PRECURSOR, ENDOTHELIAL (PAI-1) SEQ ID NO: 100 PAI2 or PLANH2, PAI2_HUMAN PLASMINOGEN ACTIVATOR sp|P05120| GTEAAAGTGGVMTGRTGHGG INHIBITOR-2, PLACENTAL (PAI-2) (MONOCYTE ARG-SERPIN) SEQ ID NO: 101 (UROKINASE INHIBITOR) PEDF, PEDF_HUMAN PIGMENT EPITHELIUM-DERIVED FACTOR sp|P36955| GAGTTPSPGLQPAHLTFPLD PRECURSOR (PEDF) (EPC-1) SEQ ID NO: 102 PI6 or PTI, PTI6_HUMAN PLACENTAL THROMBIN INHIBITOR sp|P35237| GTEAAAATAAIMMMRCARFV (CYTOPLASMIC ANTIPROTEINASE) (CAP) (PROTEASE SEQ ID NO: 103 INHIBITOR 6) PI8, PTI8_HUMAN CYTOPLASMIC ANTIPROTEINASE 2 (CAP2) sp|P50452| GTEAAAATAVVRNSRCSRME (CAP-2) (PROTEASE INHIBITOR 8) SEQ ID NO: 104 PI9, PTI9_HUMAN CYTOPLASMIC ANTIPROTEINASE 3 (CAP3) sp|P50453| GTEAAAASSCFVVAECCMES (CAP-3) (PROTEASE INHIBITOR 9) SEQ ID NO: 105 SCCA1, SCC1_HUMAN SQUAMOUS CELL CARCINOMA sp|P29508| GAEAAAATAVVGFGSSPAST ANTIGEN 1 (SCCA-1) (PROTEIN T4-A) SEQ ID NO: 106 SCCA2, SCC2_HUMAN SQUAMOUS CELL CARCINOMA sp|P48594| GVEAAAATAVVVVELSSPST ANTIGEN 2 (SCCA-2) (LEUPIN) SEQ ID NO: 107 TBG, THBG_HUMAN THYROXINE-BINDING GLOBULIN sp|P05543| GTEAAAVPEVELSDQPENTF PRECURSOR (T4-BINDING GLOBULIN) SEQ ID NO: 108 MEGSIN gi|4505149|ref| GTEATAATGSNIVEKQLPQS NP_003775.1| SEQ ID NO: 109 PI14, pancpin, TSA2004 gi|3724282|dbj| GSEAATSTGIHIPVIMSLAQ BAA33766.1| SEQ ID NO: 110
[0100] Advantageously, the serine protease inhibitor of the invention may be a serine protease trypsin-like enzyme and preferably a Kallikrein inhibitor. Kallikrein inhibitors of the invention are selected amongst hK2, hK3, hK4, hK5, hK6, hK7, hK8, hK9 hK10, hK11, hK12, hK13, hK14 or hK15 inhibitors. Preferably kallikreins inhibitors are selected among hK2, hK5, hK7, and hK14 inhibitors.
[0101] In case the kallikrein inhibitor is an inhibitor directed against hK2, said inhibitor can be selected among those disclosed in International Patent Application PCT/IB2004/001040, which content is incorporated herein by reference in its entirety. Preferably, the kallikrein inhibitor of the invention may be selected from the group comprising MD820, MD62, MD61, MD67 and MDCI. Most preferably this inhibitor is MD67. This application discloses a recombinant inhibitor protein of a protease comprising an inhibiting polypeptidic sequence and at least one polypeptidic sequence of a substrate-enzyme interaction site specific for a protease as well as a method for producing the recombinant inhibitor protein of a protease. Preferably the recombinant Serine protease inhibitor is selected from the group comprising the SEQ ID No 2, 4, 6, 8, 10, 12 and 14 or a biologically active fragment thereof having a Serine protease inhibitor activity.
[0102] As an example of serine protease inhibitor according to the invention, Applicants have surprisingly found 7 new recombinant inhibitor proteins specific for the protease hK2 as resumed below in table II, these inhibitors are:
TABLE-US-00002 TABLE II Recombinant SEQ ID N° inhibitors Other name (protein) rACT8.20 MD820 2 rACT6.2 MD62 4 rACT8.3 MD83 6 rACT6.7 MD67 8 rACT6.1 MD61 10 ACT5.18 MD518 12 ACTPCI MDCI 14
[0103] These inhibitor proteins have been obtained by modifying the RSL of al-antichymotrypsin (rACT), which is known to inhibit a large panel of human enzymes such as chymotrypsin, mast cell chymase, cathepsin G, prostatic kallikreins hK2 and PSA (hK3), in order to change the specificity of this serpin. Peptide sequences, selected as substrates for the enzyme hK2 by phage display technology as explained in International Patent Application PCT/IB2004/001040, have been used to replace the scissile bond and neighbour amino acid residues of the RSL. Usually, recombinant inhibitors were produced in bacteria and purified by affinity chromatography.
[0104] Additionally, Applicants have also found that replacing residues P3-P3' located in RSL structure of rACTWT by substrate pentapeptide coding for the RSL of Protein C inhibitor (PCI) lead to the production of a recombinnat inhibitor (MDCI) which is able to inhibit kallikreins hK2 and hK3.
[0105] In case the kallikrein inhibitor is an inhibitor directed against hK14, then said inhibitor can be selected among those disclosed in the International Patent Application PCT/IB2005/000504, which content is incorporated herein by reference in its entirety. Preferably, said recombinant inhibitor may be selected from the group comprising AATG1, AATG1G, AATC11, AATC11G, AATE5, AATE8, AATF11, AATF3, AATG9, ACTG1, AcTG1G, ACTC11, ACTc11G, ACTE5, ACTE8, ACTF11, ACTF3, ACTG9, ACTG1V, ACTWT and ACTC11D. Preferably, said inhibitor protein of an hK14 protease is AATG1, AATG1G, AATc11, AATc11G, AATE5, AATE8, AATF3, AATG9, ACTG1G, ACTC11, ACTC11G, ACTE5, ACTE8, AGTF11, ACTF3, ACTG9, ACTG1V, or ACTC11D.
[0106] This application discloses a recombinant inhibitor protein of an hK14 protease having an inhibiting polypeptidic sequence and at least a polypeptidic sequence of a substrate-enzyme interaction site specific for said hK14 protease. Preferably, said recombinnat inhibitor protein of an hK14 protease has, under physiological conditions,
[0107] i) a stoechiometry of inhibition (SI) equal or below to 11.7 after at least 4 hours of incubation,
[0108] ii) an association rate (Ka) of at least 7'500 M-1 s-1,
[0109] iii) an inhibitory activity of 100% after at least 30 minutes of incubation.
[0110] In addition, the inhibiting polypeptidic sequence of the protease inhibitor may also be selected from a cysteine protease since there are now a number of well-documented instances of inhibition of cysteine proteases by serpins (Gettins P.G.W., 2002 "Serpin structure, mechanism, and function" in Chem. Rev, 102, 4751-4803). These examples include inhibition of cathepsins K, L and S by the serpin squamous cell carcinoma antigen1, inhibition of prohormone thiol proteinase by the α-1 antichymotrypsin, and inhibition of members of the caspase family, including caspase 1 (interleukine 1β converting enzyme), caspase 3, and caspase 8 by the viral serpin crmA and caspases 1, 4 and 8 by the human serpin PI9.
[0111] Usually, the serine protease inhibitor is a recombinant inhibitor protein. Thus, when recombinant techniques are employed to prepare a Serine protease inhibitor, nucleic acid molecules or fragments thereof encoding the polypeptides are preferably used.
[0112] Therefore the present invention also relates to a purified and isolated DNA sequence encoding the Serine protease inhibitor as described above.
[0113] "A purified and isolated DNA sequence" refers to the state in which the nucleic acid molecule encoding the recombinnat inhibitor protein of a protease of the invention, or nucleic acid encoding such recombinnat inhibitor protein of a protease will be, in accordance with the present invention. Nucleic acid will be free or substantially free of material with which it is naturally associated such as other polypeptides or nucleic acids with which it is found in its natural environment, or the environment in which it is prepared (e. g. cell culture) when such preparation is by recombinant DNA technology practised in vitro or in vivo.
[0114] DNA which can be used herein is any polydeoxynuclotide sequence, including, e.g. double-stranded DNA, single-stranded DNA, double-stranded DNA wherein one or both strands are composed of two or more fragments, double-stranded DNA wherein one or both strands have an uninterrupted phosphodiester backbone, DNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded DNA wherein the DNA strands are fully complementary, double-stranded DNA wherein the DNA strands are only partially complementary, circular DNA, covalently-closed DNA, linear DNA, covalently crosslinked DNA, cDNA, chemically-synthesized DNA, semi-synthetic DNA, biosynthetic DNA, naturally-isolated DNA, enzyme-digested DNA, sheared DNA, labeled DNA, such as radiolabeled DNA and fluorochrome-labeled DNA, DNA containing one or more non-naturally occurring species of nucleic acid.
[0115] DNA sequences that encode the Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity, can be synthesized by standard chemical techniques, for example, the phosphotriester method or via automated synthesis methods and PCR methods.
[0116] The purified and isolated DNA sequence encoding the Serine protease inhibitor according to the invention may also be produced by enzymatic techniques. Thus, restriction enzymes, which cleave nucleic acid molecules at predefined recognition sequences can be used to isolate nucleic acid sequences from larger nucleic acid molecules containing the nucleic acid sequence, such as DNA (or RNA) that codes for the recombinant inhibitor protein or for a fragment thereof.
[0117] Encompassed by the present invention is also a nucleic acid in the form of a polyribonucleotide (RNA), including, e.g., single-stranded RNA, double-stranded RNA, double-stranded RNA wherein one or both strands are composed of two or more fragments, double-stranded RNA wherein one or both strands have an uninterrupted phosphodiester backbone, RNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded RNA wherein the RNA strands are fully complementary, double-stranded RNA wherein the RNA strands are only partially complementary, covalently crosslinked RNA, enzyme-digested RNA, sheared RNA, mRNA, chemically-synthesized RNA, semi-synthetic RNA, biosynthetic RNA, naturally-isolated RNA, labeled RNA, such as radiolabeled RNA and fluorochrome-labeled RNA, RNA containing one or more non-naturally-occurring species of nucleic acid.
[0118] The purified and isolated DNA sequence encoding a Serine protease inhibitor is preferably selected from the group comprising SEQ ID No 1, SEQ ID No 3, SEQ ID No 5, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11, SEQ ID No 13, SEQ ID No 16 to SEQ ID No 37.
[0119] The present invention also includes variants of the aforementioned sequences, that is nucleotide sequences that vary from the reference sequence by conservative nucleotide substitutions, whereby one or more nucleotides are substituted by another with same characteristics.
[0120] Also encompassed in the present invention is the use of a purified and isolated DNA sequence encoding a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease.
[0121] Alternatively, the Kallikrein inhibitors or the serine protease inhibitors of the invention comprise a detectable label or bind to a detectable label to form a detectable complex.
[0122] "Detectable labels" are detectable molecules or detection moiety for diagnostic purposes, such as enzymes or peptides having a particular binding property, e.g. streptavidin or horseradish peroxidase. Detection moiety further includes chemical moieties such as biotin which may be detected via binding to a specific cognate detectable moiety, e. g. labelled avidin.
[0123] Preferably, detectable labels include fluorescent labels and labels used conventionally in the art for MRI-CT imagine. A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow.
[0124] The Kallikrein inhibitors or the serine protease inhibitors of the invention may carry a radioactive label as the detection moiety, such as the isotopes 3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 121I, 124I, 125I, 131I, 111In, 211At, 198Au, 67Cu, 225Ac, 213bu, 99Tc and 186Re. When radioactive labels are used, known currently available counting procedures may be utilized to identify and quantitate the specific binding members.
[0125] In the instance where the label is an enzyme, detection may be accomplished by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques known in the art.
[0126] The radioactive labels are useful in in vitro diagnostics techniques, ex vivo and in in vivo radioimaging techniques. In a further aspect, the radioactive labels are useful in radioimmuno-guided surgery techniques, wherein they can identify and indicate the presence and/or location of cancer cells, precancerous cells, tumor cells, and hyperproliferative cells, prior to, during or following surgery to remove such cells.
[0127] In the instance of in vivo imaging, the labels of the present invention may be conjugated to an imaging agent rather than a radioisotope(s), including but not limited to a magnetic resonance image enhancing agent. Examples of chelating groups include EDTA, porphyrins, polyamines crown ethers and polyoximes.
[0128] Examples of paramagnetic ions include gadolinium, iron, manganese, rhenium, europium, 1anthanium, holmium and erbium.
[0129] The present invention is also directed to a pharmaceutical composition comprising the serine protease inhibitor as described herein as an active agent, optionally in combination with one or more pharmaceutically acceptable carriers.
[0130] Preferably the composition, as a pharmaceutical composition, according to the invention is to be administered to a patient in need of treatment via any suitable route, usually by injection into the bloodstream or CSF, or directly into the site of the disease, or close to this site. The precise dose will depend upon a number of factors, including whether the composition is for diagnosis, prognosis, prophylaxis of or for treatment, the size and location of, for example, desquamation, the precise nature of the composition, and the nature of the detectable or functional label attached to the Kallikrein inhibitor or the serine protease inhibitor.
[0131] The present pharmaceutical composition comprises as an active substance a pharmaceutically effective amount of the composition as described, optionally in combination with pharmaceutically acceptable carriers, diluents and adjuvants.
[0132] "A pharmaceutically effective amount" refers to a chemical material or compound which, when administered to a human or animal organism induces a detectable pharmacological and/or physiologic effect.
[0133] The pharmaceutically effective amount of a dosage unit of the polypeptide usually is in the range of 0.001 ng to 100 μg per kg of body weight of the patient to be treated.
[0134] The pharmaceutical composition may contain one or more pharmaceutically acceptable carriers, diluents and adjuvants.
[0135] Acceptable carriers, diluents and adjuvants which facilitates processing of the active compounds into preparation which can be used pharmaceutically are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl orbenzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, hydroxyethylcellulose (NATROSOL® (hydroxyethylcellulose (HEC)) or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as TWEEN® (polysorbate or polyoxyethylene sorbitol ester), PLURONIC® (polyoxyalkylene ether) or polyethylene glycol (PEG).
[0136] The form of administration of the pharmaceutical composition may be systemic or topical. For example, administration of such a composition may be various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, transdermal, buccal routes or via an implanted device, and may also be delivered by peristaltic means.
[0137] The pharmaceutical composition, as described herein, may also be incorporated or impregnated into a bioabsorbable matrix, with the matrix being administered in the form of a suspension of matrix, a gel or a solid support. In addition the matrix may be comprised of a biopolymer such as NATROSOL® (hydroxyethylcellulose (HEC)).
[0138] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and [gamma] ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT® (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.
[0139] The formulations to be used for in vivo administration must be sterile. This is readily accomplished for example by filtration through sterile filtration membranes.
[0140] It is understood that the suitable dosage of the present composition will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any and the nature of the effect desired.
[0141] The appropriate dosage form will depend on the disease, the inhibitor, and the mode of administration; possibilities include tablets, capsules, lozenges, dental pastes, suppositories, inhalants, solutions, ointments and parenteral depots.
[0142] Since amino acid modifications of the amino acids (of the inhibitor for example) are also encompassed in the present invention, this may be useful for cross-linking the inhibitor to a water-insoluble matrix or the other macromolecular carriers, or to improve the solubility, adsorption, and permeability across the blood brain barrier. Such modifications are well known in the art and may alternatively eliminate or attenuate any possible undesirable side effect of the peptide and the like.
[0143] Another subject matter of the present invention is to provide a kit for the diagnosis, prognosis, prophylaxis or treatment of skin disease in a mammal, said kit comprising a recombinant serine protease, optionally with reagents and/or instructions for use.
[0144] The kit of the present invention may further comprise a separate pharmaceutical dosage form comprising other pharmaceutical compositions and combinations thereof.
[0145] Generally, the Kit comprises a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The label or package insert indicates that the composition is used for treating the condition of choice, such as cancer.
[0146] Alternatively, or additionally, the Kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
[0147] The present invention also discloses the use of the composition of the invention, as a pharmacological tool in the development and standardization of in vitro and in vivo test systems for the diagnosis, prognosis, prophylaxis or treatment of skin diseases in mammals.
[0148] Also encompassed by the present invention is a detection assay for the diagnosis, prognosis, prophylaxis or treatment of skin diseases in a tissue sample comprising contacting the tissue sample with the composition of the invention, determining and measuring the amount of detected label and correlating this amount to the presence or absence of a disease in said tissue sample.
[0149] Yet another object of the present invention is to provide a method for killing a skin cell expressing kallikrein molecules, comprising contacting the cell with the composition of the invention so as to kill the cell, destroying or avoiding the survival of cells expressing kallikrein molecules.
[0150] It is also an object of the present invention to provide a method for inhibiting skin cell expressing serine protease and in particular kallikrein molecules, comprising contacting said skin cell with the composition of the invention.
[0151] Yet another object of the present invention is to provide a cosmetic composition comprising a Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity as described herein as well as the use of this composition for the improvement of an undesirable skin condition.
[0152] Preferably, the Serine protease inhibitor is a recombinant inhibitor protein of the invention.
[0153] Usually, the Serine protease is selected from the group comprising kallikrein, plasmin, chymotrypsin (Chtr), urokinase (uPA), tryptase and neutrophil elastase (HNE) enzymes and/or a combination thereof.
[0154] Preferably, the kallikrein is selected from the group comprising hK2, hK5, hK7, and hK14 and/or a combination thereof.
[0155] The invention also provides the use of a Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity, in the preparation of cosmetic composition for the improvement of an undesirable skin condition.
[0156] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications without departing from the spirit or essential characteristics thereof. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present disclosure is therefore to be considered as in all aspects illustrated and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein.
[0157] Various references are cited throughout this Specification, each of which is incorporated herein by reference in its entirety.
[0158] The foregoing description will be more fully understood with reference to the following Examples. Such Examples, are, however, exemplary of methods of practicing the present invention and are not intended to limit the scope of the invention.
EXAMPLES
Example 1
Development of Recombinant ACT Inhibitors Specific to Human hK2 Using Phage Display Selected Substrates.
[0159] The content of Application PCT/IB2004/001040 (Universite de Lausanne) is incorporated herein by reference in its entirety
Material
[0160] hK2 and hK3 (PSA) were purified from human semen as previously described (Frenette G, Gervais Y, Tremblay R R, Dube J Y. 1998 "Contamination of purified prostate-specific antigen preparations by kallikrein hK2" J Urol 159, 1375-8), anti-hK2 and anti-PSA monoclonal antibodies were a gift from Professor RR Tremblay, Laval University, Canada. Human chymotrypsin (Chtr), urokinase plasminogen activator (uPA), human kallikrein hK1, human plasma kallikrein (PK), human neutrophil elastase (HNE) and commercial ACT (human plasma α-1-antichymotrypsin) were purchased from Calbiochem. Z-Phe-Arg-AMC, Suc-Ala-Ala-Pro-Phe-AMC, Z-Gly-Gly-Arg-AMC, MeOSuc-Ala-Ala-Pro-Val-AMC were purchased from Calbiochem. CFP-TFRSA-YFP (TFRSA SEQ ID NO:137)fluorescent substrate was developed as previously described (Mahajan N P et al. 1999 "Novel mutant green fluorescent protein protease substrates reveal the activation of specific caspases during apoptosis" Chem Biol 6, 401-9). The cDNA for human al-antichymotrypsin (ACT) was a generous gift from Dr. Harvey Rubin (University of Pennsylvania).
Site-directed Mutagenesis
[0161] Following the subcloning of ACT cDNA into pQE-9 expression vector (Qiagen, Germany,) and the introduction of an His6 tag at the N-terminal of rACTWT, two restriction sites Sac II and MluI, were incorporated 18 by upstream and 18 by downstream of P1 codon in RSL domain respectively. These sites were created by silent mutation using oligonucleotides 5'-GTGATTTTGACCGCGGTGGCAGCAG-3' (SEQ ID NO:111) for Sac II and 5'-GCACAATGGTACGCGTC TCCACTAATG-3' (SEQ ID NO:112) for Mlu I site and following the quickchange mutagenesis protocol supplied by Stratagene.
Construction of the Substrate Phage Display Library
[0162] Substrate phage libraries were generated using a modified pH0508b phagemid (Lowman et al. 1991 "Selecting high-affinity binding proteins by monovalent phage display" Biochemistry 12, 10832-8). The construction consists of a His6 tag at either end of a Gly-Gly-Gly-Ser-repeat-rich region that precedes the carboxyl-terminal domain (codons 249-406) of the M13 gene III. The random pentamers were generated by PCR extension of the template oligonucleotides with appropriate restriction sites positioned on both side of the degenerate codons: 5'TGAGCTAGTCTAGATAGGTGGCGGTNNSNNSNNSNNSNNSGGGTCGACGTCGGTCA TAGCAGTCGCTGCA-3' (SEQ ID NO:113) (where N is any nucleotide and S is either G or C) using 5' biotinylated primers corresponding to the flanking regions:
TABLE-US-00003 (SEQ ID No 83) 5'TGAGCTAGTCTAGATAGGTG-3' and (SEQ ID No 84) 5'-TGCAGCGACTGCTATGA-3'.
[0163] PCR templates are digested and purified as described previously (Smith G.P, Scott J.K. 1993 "Libraries of peptides and proteins displayed on filamentous phage" Methods Enzymol. 217, 228-57), inserted into XbaI/SalI digested pH0508b vector, and electroporated into XL1-Blue (F.sup.-). The extent of the library was estimated from the transformation efficiency determined by plating a small portion of the transformed cells onto Luria-Bertani plates containing ampicillin and tetracycline (100 and 15 μgmL-1, respectively). The rest of the transformed cells were used to prepare a phage library by incubating overnight by adding an M13K07 helper phage at a concentration giving a multiplicity of infection of 100 plaque forming units (p.f.u.) per mL. Phages were collected from the supernatant and purified by poly(ethylene glycol) precipitation. Of these, 200 clones were selected arbitrarily for sequencing to verify the randomization of the library.
Phage-Displayed Pentapeptide Library Screening
[0164] This new pentapeptide library was subjected to eight rounds of screening with hK2. One hundred microliters of Ni2+-nitrilotriacetic acid coupled to sepharose beads (Ni2+-nitrilotriacetic acid resin) was washed with 10 mL NaCl/Pi containing 1 mgmL-1 BSA. Phage particles (1011) were added to the equilibrated Ni2+-nitrilotriacetic acid resin and allowed to bind with gentle agitation for 3 h at 4° C. The resin was subsequently washed (NaCl/Pi/BSA 1 mgmL-1, 5 mM imidazole, 0.1% TWEEN® 20 (polysorbate 20 or polyoxyethylene sorbitol ester) to remove unbound phages and then equilibrated in NaCl/Pi. The substrate phage was exposed to 27 nm (final concentration) of hK2 for 45 min at 37° C. A control selection without protease was also performed. The cleaved phages released into the supernatant were amplified using XL1-Blue Escherichia coli and then used for subsequent rounds of selection. After eight rounds of panning, about 15 individual clones were picked from the fifth, sixth and eighth round of selection and plasmid DNA were isolated and sequenced in the region encoding for the substrate.
Construction and Expression of Recombinant Wild Type ACT and its Variants.
[0165] Six variants, which correspond to a change in the reactive site loop in positions between P3 and P3' (see Table III below), were generated by PCR extension of the template oligonucleotides:
TABLE-US-00004 rACT8.20, (SEQ ID No 61) 5'-TACCGCGGTCAAAATCACCCTCCGTTCTCGAGCAGTGGA GACGCGT GA-3'; rACT6.3, ((SEQ ID No 62) 5'-TACCGCGGTCAAAATCACCAGGAGGTCTATCGATGT GGAGACGCGTGA-3'; rACT8.3, (SEQ ID No 63) 5'-TACCGCGGTCAAAATCAGGGGGAGATCTGAGTTAGTG GAGACGCGTGA-3'; rACT6.7, ((SEQ ID No 64) 5'-TACCGCGGTCAAAATCAAGCTTAGAACAACATTAG TGGAGACCGCTGA-3'; rACT6.1, (SEQ ID No 65) 5'-TACCGCGGTCAAAATCATGACAAGATCTAACTTAGT GGAGACGCGTGA-3'; rACT5.18, (SEQ ID NO: 66) 5'-TACCGCGGTCAAAATCACCGAGCGTGTCTCGCCCGTG GAGACGCGTGA-3'
(where underlined sequences encode new cleavage sites in the reactive site loop), using primers corresponding to the flanking regions: 5'-TACCGCGGTCAAAATC-3' (SEQ ID No 67) and 5'-TCACGCGTGTCCAC-3' (SEQ ID No 68). PCR products were digested with Sac II and Mkt I restriction enzymes and then subcloned into digested rACTWT construct. Recombinant serpins were produced in TG1 E. coli strain. Cells were grown at 37° C. in 2×TY media (16 g tryptone, 10 g yeast extract, 5 g NaCl per L) containing 100 μg/ml ampicillin to A600=0.5. Isopropylthio-β-galactoside (IPTG) was then added to a final concentration of 0.5 mM allowing the expression of recombinant serpins for 16 h at 16° C. The cells from 100 ml of culture were harvested by centrifugation, resuspended in cold PBS and then passed through a french press to recover the total soluble cytoplasmic proteins. Cell debris were removed by centrifugation and Ni2+-nitilotriacetic affinity agarose beads were added to supernatant for 90 min at 4° C. to bind recombinant serpins. The resin was subsequently washed with 50 mM Tris pH 8.0, 500 mM NaCl, 25 mM Imidazole and the bound proteins were eluted for 10 min with 50 mM Tris pH 8.0, 500 mM NaCl and 150 mM Imidazole. Once purification was completed, rACT were dialysed against 50 mM Tris pH 8.0, 500 mM NaCl, 0,05% Triton X-100 for 16 h at 4° C. The protein concentration was determined for each purification by Bradford assay and normalized by densitometry of Coomassie Blue-stained SDS-PAGE gels (Laemmli UK. 1970 "Cleavage of structural proteins during the assembly of the head of bacteriophage T4" Nature 227, 680-5).
TABLE-US-00005 TABLE III Alignment of RSL (Reactive Serpin Loop) of recombinant serpin α1-antichymotrypsin (ACT) and its variants. Selecteda Substrate Serpin Peptide P6 P5 P4 P3 P2 P1 P'1 P2 P'3 P'4 P'5 P'6 rACTWT V K I T L L* S A L V E T rACT8.20 LR↓SRA V K I T L R* S R A V E T SEQ ID NO: 157 rACT6.2 RR↓SID V K I T R R* S I D V E T SEQ ID NO: 158 rACT8.3 RGR↓SE V K I R G R* S E L V E T SEQ ID NO: 159 rACT6.7 KLR↓TT V K I K L R* T T L V E T SEQ ID NO: 160 rACT6.1 MTR↓SN V K I M T R* S N A V E T SEQ ID NO: 161 ACT5.18 ER↓VSP V K I T E R* V S P V E T SEQ ID NO: 162 aSubstrate peptides selected by kallikrein hK2 using a phage-displayed random pentapeptide library. Plain type residues are common to rACTWT, bold and underlined residues correspond to substrate peptides relocated in RSL of ACT variants. The scissile bond by hK2 in substrate peptides is designated by ↓ and putative cleavage site in serpins is marked by asterisks between the P1-P1' residues.
Inhibition Assays and Stoichiometry of Inhibition (SI)
[0166] The stoichiometry of inhibition (SI) values were determined for the inhibition of rACTWT and its variants with hK2 and different other enzymes. An initial test was made with a molar excess of rACT (100 fold) over hK2, PSA, hK1, chymotrypsin (Chtr), plasma kallikrein (PK), urokinase (uPA) and human neutrophile elastase (HNE) enzymes. The reaction was carried out for 30 min at 25° C. (90 min at 37° C. for PSA) in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0,05% Triton X-100, 0.01% BSA) and residual enzyme activity was measured by adding fluorescent substrates (Z-Phe-Arg-AMC for hK1, hK2 and PK, Suc-Ala-Ala-Pro-Phe-AMC for Chtr, Z-Gly-Gly-Arg-AMC for uPA, MeOSuc-Ala-Ala-Pro-Val-AMC for HNE, and CFP-TFRSA-YFP (TFRSA SEQ ID NO:137) for PSA). Activity of enzyme in presence of inhibitors was compared to uninhibited reaction. For reactions where an inhibition was observed, SI was determined by incubating different concentrations of recombinant serpins. Using linear regression analysis of fractional activity (velocity of inhibited enzyme reaction/velocity of uninhibited enzyme reaction) versus the molar ratio of the inhibitor to enzyme ([Io]/[Eo]), the stoichiometry of inhibition, corresponding to the abscissa intercept, was obtained.
Kinetics
[0167] The association rate constants for interactions of hK2, chymotrypsin, PK and HNE with different rACTs were determined under pseudo-first order conditions using the progress curve 80% (Morrison J F, Walsh C T. 1988 "The behavior and significance of slow-binding enzyme inhibitors" Adv. Enzymol. Relat. Areas Mol. Biol 61, 201-301). Under these conditions, a fixed amount of enzyme (2 nM) was mixed with different concentrations of inhibitor (0-800 nM) and an excess of substrate (10 μM). Each reaction was made in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0,05% Triton X-100, 0.01% BSA) at 25° C. for 45 min and the rate of product formation was measured using a FL.sub.x800 fluorescence 96-well microplate reader (Biotek, USA). In this model, inhibition is considered to be irreversible over the course of reaction and the progress of enzyme activity is expressed by product formation (P), beginning at a rate (vz) and is inhibited over time (t) at a first-order rate (kobs), rate constant that is dependent only on inhibitor concentration.
P=(vz/kobs)×[1-e.sup.(-kobst.sup.)] eq 1
[0168] For each inhibitor, a kobs was calculated, for four different concentrations of inhibitors, by non linear regression of the data using equation 1. By plotting the kobs versus inhibitor concentration [I], a second-order rate constant, k', equal to the slope of the curve (k'=Δkobs/Δ[I]), was determined. Due to the competition between inhibitor and the substrate, equation 2 below is used to correct the second order rate constant k' by taking in account the substrate concentration [S] and the Km of the enzyme for its substrate, giving the ka.
ka=(1+[S]/Km)×k' eq 2
[0169] The Km of hK2 for Z-FR-AMC, chymotrypsin for Suc-AAPF-AMC (AAPF (SEQ ID NO:135), PK for Z-FR-AMC and HNE for MeOSuc-AAPV-AMC (AAPV SEQ ID NO:136) were 67 μM, 145 μM, 170 μM and 130 μM respectively.
Western Blot Analysis of Complex Formation and Inhibitor Degradation.
[0170] Kallikrein hK2 was incubated 3 hours at 37° C. with different recombinant ACTs at a [I]o: [E]o ratio of 100:1 in 50 mM Tris, 200 mM NaCl, 0,05% Triton X-100. Protein samples were heated at 95° C. for 5 min, separated by SDS-PAGE (12% acrylamide 19:1 T:C ratio) and then electroblotted onto Hybond-ECL (Amersham Pharmacia) nitrocellulose. The free-hK2 and hK2-ACT complexes were detected using a mouse anti-hK2 monoclonal antibody and an alkaline phosphatase-conjugated goat anti-mouse secondary antibody. Western blot was visualized using the ECL detection kit (Amersham Pharmacia Biotech). hK2 was also incubated with ACT8.3 or ACT6.7 30 min at 25° C. (kinetic conditions) at a [I]o:[E]o ratio of 10:1 in 50 mM Tris, 200 mM NaCl, 0,05% Triton X-100. Proteins were detected by western blot, using an anti-His6 monoclonal antibody followed by detection with the secondary antibody and protocol described above.
Production of Soluble Recombinant Wild Type and Variant ACTs
[0171] Wild type serpin α1-antichymotrypsin was used to develop specific inhibitors of the kallikrein hK2. Residues P3-P3' located in RSL structure of rACTWT were replaced by substrate pentapeptides, previously selected by phage display technology as described above. Six variants of rACT shown in table IV, have been designed and constructed. The scissile bond in substrate peptides was aligned according to Leu-358-Ser-359 into RSL of the serpin. rACTWT and its variants were expressed in E. coli TG1 as fusion proteins containing an His tag in N-terminal position. Each of them was produced at low temperature allowing protein accumulation mainly in active soluble form. Purified under native conditions, the level of production varied between 1.0 to 2.5 mg/L. The purity of purified serpins, such as for example Variant 6.1 and wild type ACT, as estimated by SDS-PAGE analysis is more than 98%.
rACT Variants are Mainly Specific to Kallikrein hK2
[0172] A panel of enzymes including human neutrophil elastase, chymotrypsin-like (Chtr, PSA or hK3) and trypsin-like (hK2, hK1, PK, uPA) proteinases have been screened to determine inhibitory specificity of rACT variants (Table IV).
TABLE-US-00006 TABLE IV Inhibitory profile of rACTWT and its variants. ACT8.20 ACT6.2 ACT8.3 ACT6.7 ACT6.1 ACT5.18 (LR↓SRA)a (RR↓SID)a (RGR↓SE)a (KLR↓TT)a (MTR↓SN)a (ER↓VSP)a ACTWT SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID (LL↓SA)a NO: 157 NO: 158 NO: 159 NO: 160 NO: 161 NO: 162 SEQ ID MD 820 MD 62 MD 83 MD 67 MD 61 MD518 NO: 163 Protease INHIBITION %B hK2 95 100 100 100 100 73 0 Chtr 66 0 0 0 0 0 100 PK 54 100 0 36 100 0 0 HNE 30 0 0 0 60 0 15 PSA 45 0 0 0 0 0 80 (hK3) hK1 0 0 0 0 0 0 0 Urokinase 0 0 0 0 0 0 0 aAmino acid sequence cleaved in RSL (Reactive Serpin Loop) of recombinant ACTs corresponding to selected substrate peptide by hK2. BProtease and serpins were incubated for 30 min at 25° C. (90 min at 37° for PSA) at a [I]o/[E]o ratio of 100:1. Percent inhibition correspond to 100 × (1 - (velocity in presence of inhibitor/velocity of uninhibited control)).
[0173] Incubating with an excess of inhibitors ([I]o/[E]o of 100:1) for 30 minutes, hK2 is completely inhibited by rACT6.2, rACT8.3, rACT6.7 and rACT6.1, whereas rACT8.20 and rACT5.18 inhibited 95% and 73% of enzyme activity, respectively. Under this condition, wild type rACT showed no inhibition activity toward hK2. Among these variants, two (rACT8.3 and rACT5.18) are specific to hK2, inhibiting no other tested enzyme. Two other variants, rACT6.7 and rACT6.2, inhibited as well PK at 36% and 100% respectively. As wild-type ACT, variant rACT8.20 inhibited the two chymotrypsin-like proteases Chtr and PSA but additionally also PK and HNE. None of the recombinant serpins showed inhibitory activity against the kallikrein hK1 and uPA.
Stoichiometries of Inhibitory of Variant ACTs for hK2 are Improved Drastically in Comparison to Wild Type ACT
[0174] The determination of the stoichiometry of inhibitory was accomplished under physiological conditions of pH and ionic strength for all enzymes to ensure the most valuable comparison. Recombinant wild type ACT gave a SI value of 2 (table V) with chymotrypsin which is identical to the value obtained with commercial ACT under similar conditions (data not shown).
TABLE-US-00007 TABLE V Comparison of stoichiometry of inhibition values and second-order rate constants (ka) for the reaction of rACTWT and its variants with hK2 and others proteinases. ACT8.20 ACT6.2 ACT8.3 ACT6.7 ACT6.1 ACT5.18 (LR↓SRA) (RR↓SID) (RGR↓SE) (KLR↓TT) (MTR↓SN) (ER↓VSP) ACTWT MD820c MD62c MD83c MD67c MD61c MD518c (LL↓SA)c SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 157 NO: 158 NO: 159 NO: 160 NO: 161 NO: 162 NO: 163 (ka)b kab kab kab kab kab kab Protease SI M-1s-1 SI M-1s-1 SI M-1s-1 SI M-1s-1 SI M-1s-1 SI M-1s-1 SI M-1s-1 hK2 105 1779 25 6261 34 2439 9 8991 19 3442 139 595 -- -- Chtr 134 905 -- -- -- -- -- -- -- -- -- -- 2 61295 PK 150 424 18 6217 -- -- 277 201 16 8024 -- -- -- -- HNE 334 158 -- -- -- -- -- -- 159 1192 -- -- -- -- aSI values reported were determined using linear regression analysis to extrapolate the I/E ratio. bSecond order rate constants for serpin-proteinase reactions were measured under pseudo-first- or second order conditions as described in "Experimental Procedure". cAmino acid sequence of P3-P3' residues in RSL (Reactive Serpin Loop) of recombinant ACT corresponding to selected substrate peptide by hK2 --, No detectable inhibitory activity.
[0175] In order to determine the SI values of all the recombinant variants, Applicants have incubated hK2 (5 nM) with different concentrations (6.25-500 nM) of rACT8.20, rACT6.2, rACT8.3, rACT6.7, rACT6.1, rACT5.18, rACTWT, at 25° C. for 30 min in reaction buffer. Residual activities (velocity) for hK2, were assayed by adding the fluorescent substrate (10 μM) Z-FR-AMC. Fractional velocity corresponds to the ratio of the velocity of inhibited enzyme (vi) to the velocity of the uninhibited control (vo). The SI was determined using linear regression analysis to extrapolate the I/E ratio (i.e. the x intercept).
[0176] All newly constructed variants of ACT showed lower SI values with hK2 than wild type ACT. From these variants rACT6.7, rACT6.1 and rACT6.2 had the lowest stoichiometry of inhibition values for hK2 (9, 19 and 25 respectively). Whereas rACT6.2 and rACT6.1 had also the lowest SI values (18 and 16) for PK, the SI for rACT6.7 was much higher (277). The two recombinant ACTs specific for hK2, rACT8.3 and rACT5.18 had a higher SI ratio of 34 and 139, respectively. The SI value of rACT8.20 inhibitor was superior to 100 for all tested proteases including hK2.
Variant ACTs Form Stable Complexes with hK2 without Degradation of Inhibitors
[0177] hK2 was incubated 3 h at 37° C. with rACT8.20, rACT6.2, rACT8.3, rACT6.7, rACT6.1, rACT5.18 and wild type rACT, at a I:E ratio of 100:1. Western Blot analysis of the reaction products of rACTs with hK2 (rACT8.20), rACT6.2, rACT8.3, rACT6.7, rACT6.1, rACT5.18 and wild type rACT has been done under reducing conditions using a mouse anti-hK2 antibody to determine the fate of inhibitors after the interaction with the enzyme. When hK2 is incubated with ACT variants, free hK2 (E) disappeared completely to form a covalent complex (EI). This covalent complex demonstrated a high stability as it did not break down over a 16 h incubation period (data not shown). Wild type ACT inhibited more slowly hK2, which was mainly uncomplexed after 3 hours of incubation. Elevated SI values measured with hK2 were not due to non-complex forming degradation of ACT variant inhibitors.
[0178] Further on ACT8.3 or ACT6.7 were incubated with hK2 under kinetic conditions (30 min at 25° C.) at a I:E ratio of 10:1. The complex formation was analysed by western blot under reducing conditions using a mouse monoclonal anti-his tag. All inhibitor proteins were either complexed with hK2 or present as uncleaved form, indicating that the possible substrate pathway for the serpin-enzyme interaction is marginal.
Variant ACTs Showed Highest Association Constants with hK2
[0179] The rate of inhibitory reaction with variant ACTs was determined for each protease showing reactivity with these inhibitors. To that end, interaction of hK2 and recombinant serpins was measured under pseudo-first order conditions using progress curve method. hK2 (2 nM) and substrate Z-FR-AMC (1004) were added to varying amounts (20 n-800 nM) of inhibitors rACT8.20, rACT5.18 and inhibitors rACT6.2, rACT8.3, rACT6.7, rACT6.1 (data not shown). Representative progress curves were subjected to non linear regression analysis using eq 1 and the rate (kobs) was plotted against the serpin concentrations. After determination of kobs, association constants (ka) were calculated using Km of the proteases for their corresponding substrates (table VI). The ka value of wild type ACT with chymotrypsin was identical as to published data (Cooley et al. 2001 "The serpin MNEI inhibits elastase-like and chymotrypsin-like serine proteases through efficient reactions at two active sites" Biochemistry 40, 15762-70). The recombinant rACT6.7 showed a highest ka (8991 M-1 s-1) with hK2 whereas that obtained with PK was 45 fold inferior. In contrast, recombinant rACT6.2 gave equivalent ka with hK2 and PK demonstrating a lack of discrimination between the two proteases. ka values of hK2 specific recombinant inhibitors rACT8.3 and rACT5.18 were lower, 2439 and 595 M-1 s-1 respectively, whereas non specific ACT8.20 exhibited a ka of 1779 M-1 s-1, for hK2, superior compared to Chtr, PK and HNE. One of the recombinant serpins, rACT61, was reacting at higher velocity with PK than with hK2.
[0180] Residues P3-P3' located in RSL structure of rACTWT were replaced by substrate pentapeptide coding for the RSL of Protein C Inhibitor (PCI) (Table VI) as described in example 1.
TABLE-US-00008 TABLE VI Alignment of RSL (Reactive Serpin Loop) of recombinant serpins ACT, PCI and ACTPCI. RSL sequences Serpin P6 P5 P4 P3 P2 P1 P'1 P2 P'3 P'4 P'5 P'6 rACTWT Amino acid V K I T L L S A L V E T sequence DNA GTC AAA ATC ACC CTC CTT TCT GCA TTA GTG GAG GTC sequence (codon) rPCIWT Amino acid T I F T F R S A R L N S sequence rACTPCI Amino acid V K I T F R S A L V E T (MD CI) sequence DNA GTC AAA ATC ACC TTT AGA TCT GCA TTA GTG GAG GTC (codon) Plain type residues are common to rACTWT, bold and underlined residues correspond to substrate peptides relocated in RSL of ACT variants. The scissile bond in substrate peptides is designated by ↓ and putative cleavage site in serpins is marked by asterisks between the P1-P1' residues.
[0181] Briefly, to produce the recombinant protein ACTPCI (MDCI), TG1 cells were transformed with the corresponding constructions followed by growth in appropriate culture media. Cells were then induced to an optimal density to express recombinant inhibitors for 16 h at 16° C. Recombinant inhibitor ACTpci was extracted from cytoplasm bacteria and separated by affinity chromatography using Ni-NTA column as described for the previous example.
Analysis of Recombinant ACT Expression by SDS-PAGE.
[0182] The purity of the different inhibitors developed in example 1 and 2 was tested by SDS-PAGE analysis under reducing conditions.
Evaluation of the Inhibitors.
[0183] These inhibitors were further analysed to assess their specificity and affinity to inhibit the human kallikreins hK2 and hK3 and plasma kallikrein, trypsin, urokinase, elastase, thrombin, hK14 and human kallikrein 8 (Table VII). These two enzymes possess different enzymatic specificities (hK2: trypsin-like, hK3: chymotrypsin-like) but are naturally inhibited by ACT. While ACT is considered to be the natural hK3 inhibitor in blood circulation, its inhibition of hK2 is weaker.
[0184] Analysis of the inhibitory reaction between rACTs and the human kallikreins were analysed by Western Blot (data not shown). For each variants of ACT, 1 μg of inhibitor was incubated with 100 ng of either hK2 or hK3 during 1 hour at 37° C. under physiological conditions.
[0185] The amino acid changes within the reactive loop using substrate sequences selected for hK2 specificity transformed ACT into an inhibitor highly specific for hK2 (MD820, MD61, MD62) without inhibiting hK3. These results confirm those previously shown in Table IV. Only MDCI, based on the reactive loop of the inhibitor of the Protein C (PCI) is able to inhibit both kallikreins tested (hK2 and hK3).
[0186] MD61 and MD62 are inhibitors with very high affinity for hK2 inhibiting all hK2 protein in less than 3 minutes (under the same conditions) compared to wild type or commercial α1-antichymotrypsin, which requires more than 12 hours of incubation to inhibit the same amount of hK2 (data not shown).
TABLE-US-00009 TABLE VII Inhibitory profile of MDCI. PROTEASE INHIBITION %B SI ka M-1 s-1 Chymotrypsin 98 1 86216 Plasma Kallikrein 100 4.6 25900 Trypsin 100 1 1126025 Urokinase 0 -- -- Elastase 0 Thrombin 0 hK14 100 3.2 287000 Human Kallikrein 8 ~25 ~180
Example 2
[0187] Development of substrate active sites specific to human hK14.
[0188] The content of Application N+PCT/IB2006/000574 (Universite de Lausanne) is incorporated herein by reference in its entirety.
Materials
[0189] The following materials were obtained from commercial sources: elastase, trypsin, chymotrypsin, and plasma kallikrein (Calbiochem), human laminin 10 & 11 (Chemicon), human collagen IV (Life Technologies), T4 DNA ligase (Invitrogen), T4 polynucleotide kinase (Qbiogene), Ni2+-nitrilotriacetic acid agarose beads (Qiagen), restrictions enzymes (Roche, Amersham Pharmacia, Promega), anti-His antibody (Sigma). Oligonucleotide synthesis was carried out by Invitrogen and DNA sequencing by Synergene Biotech GmbH. Human kallikrein 2 and prostate specific antigen were purified from human seminal plasma as previously described (Frenette et al., 1997; Frenette et al., 1998). Matrilin-4 is a gift from R. Wagener (Cologne, Germany).
Cloning of KLK14 into P. pastoris Expression Vector pPICZαA
[0190] First-strand cDNA synthesis was performed by reverse transcriptase using the SUPERSCRIPT® (reverse transcriptase) preamplification system (Gibco BRL, Gaithersburg, Md.) with 2 μg of total human cerebellum RNA (Clontech, Palo Alto, Calif.) as a template. The final reaction volume was 20 μL. To confirm the efficiency of RT-PCR, 1 μL of cDNA was subsequently amplified by PCR with primers specific for actin, a housekeeping gene (ActinS: 5' ACAATGAGCTGCGTGTGGCT (SEQ ID NO:114), ActinAS: 5' TCTCCTTAATGTCACGCACGA (SEQ ID NO:115)). Actin PCR products with an expected length of 372 base pairs (bp) were visualized on a 2% agarose gel stained with ethidium bromide. PCR amplification of KLK14 cDNA encoding the 227 amino acids of the mature hK14 protein (corresponding to amino acids 25-251 of Genbank accession no. AAK48524) was carried out in a 50 μL reaction mixture containing 1 μL of cerebellum cDNA as a template, 100 ng primers (FPL6: 5' AGG ATG AGG AAT TCA TAA TTG GTG GCC AT (SEQ ID No 69) and RPL6: 5' CCC ACC GTC TAG ACC ATC ATT TGT CCC GC (SEQ ID No 70)), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 20011M deoxynucleoside triphosphates (dNTPs) and 0.75 μL (2.6 U) of Expand Long Template PCR polymerase mix (Roche Diagnostics, Mannheim, Germany), using an Eppendorf master cycler. The PCR conditions were 94° C. for 2 min, followed by 94° C. for 10 s, 52° C. for 30 s, 68° C. for 1 min for 40 cycles, and a final extension at 68° C. for 7 min. Following PCR, amplified KLK14 was visualized with ethidium bromide on 2% agarose gels, extracted, digested with EcoRI/XbaI and ligated into expression vector pPICZaA of the EASYSELECT® Pichia pastoris expression system (Invitrogen, Carlsbad, Calif.) at corresponding restriction enzyme sites using standard techniques (Sambrook et al., 1989). The KLK14 sequence within the construct was confirmed with an automated DNA sequencer using vector-specific primers in both directions.
Protein Production
[0191] PmeI-linearized pPICZaA-KLK14, as well as empty pPICZaA (negative control), were transformed into chemically competent P. pastoris yeast strain X-33 after which they integrated into the yeast genome by homologous recombination. Transformed X-33 cells were then plated on YPDS (1% yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol, 2% agar) plates containing Zeocin®, a selective reagent. A stable yeast transformant was selected as per the manufacturer's recommendations, inoculated in buffered minimal glycerol-complex (BMGY) medium [1% yeast extract, 2% peptone, 100 mM potassium phosphate (pH 6.0), 1.34% yeast nitrogen base, 40 mg/litre biotin, and 1% glycerol] overnight at 30° C. on a plate agitator at 250 rpm, diluted to OD600=1.0 in BMMY (same as BMGY except that 1% glycerol is replaced with 0.5% methanol) and incubated under the same conditions as above for 6 days with a daily supplement of 1% methanol. The supernatant was collected by centrifugation at 4000×g for 20 min
Protein Purification
[0192] Recombinant hK14 was purified from yeast culture supernatant by cation exchange using a 5 mL HiTrap® carboxymethyl (CM) Sepharose Fast Flow column on the AKTAFPLC chromatography system (Amersham Biosciences, Piscataway, N.J.). First, the supernatant was filtered with a 0.22 μm disposable filter and concentrated 50-fold by ultrafiltration with an AMICON® (protein concentrating and desalting, regenerated cellulose, ultrafiltration centrifugal filter) YM10 membrane (Millipore Corporation, Bedford, Mass.). The filtered, concentrated supernatant was then introduced into the injector of the AKTAFPLC system and loaded onto the CM sepharose column, previously equilibrated with 5 mL of 10 mM MES buffer (pH 5.3) at a flow rate of 0.8 ml/min. The column was washed with the aforementioned equilibration buffer and the adsorbed hK14 was eluted with a 150 mL continuous linear KCl gradient from 0 to 1 M in 10 mM MES (pH 5.3) at a flow rate of 3 ml/min. Elution fractions of 5 ml were collected and analyzed. Fractions containing hK14 were pooled and further concentrated 10 times using Biomax-10 Ultrafree®-15 Centrifugal Filter Device (Millipore Corporation, Bedford, Mass.). The protein concentration of the purified hK14 was determined by the bicinchoninic acid method (Smith et al., 1985), which uses bovine serum albumin as calibrator (Pierce Chemical Co., Rockford, Ill.). The purity of the recombinant hK14 protein was analyzed by SDS-PAGE (Laemmli, 1970) followed by Coomassie blue staining and/or Western blot analysis using a previously produced polyclonal rabbit antibody raised against hK14 (Borgono et al., 2003) and its identity was confirmed by tandem mass spectrometry, as described in detail for recombinant hK10 (Luo et al., 2001).
Phage-Displayed Pentapeptide Library Screening.
[0193] A monovalent type phagemid supplied by Dr Lowman (Genentech company, San Fransisco, Calif.) was previously modified in order to generate a substrate phage library containing six His residues N terminal to the random pentapeptide fused to the g3p (Cloutier et al, 2002). The six His residues allow the phage fixation to the Ni-NTA column.
[0194] Preparation of the duplex that is inserted into the phagemid was performed by PCR reaction of a degenerated oligonucleotide, in which the 5 random amino acids are coded by NSS (N=A, T, G, C and S=G, C).The resulting library was composed of 1.8×108 transformants, which is largely enough to get all random sequences represented.
[0195] This phage display substrate library was subjected to six rounds of screening with hK14. Briefly, substrate phages (1011) were incubated with sixty microliters of Ni2+-nitrilotriacetic acid resin in PBS 1× containing BSA at 1 mg/mL, washed four times (PBS 1×, BSA lmg/mL, 5 mM imidazole, 0.1% TWEEN® 20 (polysorbate 20 or polyoxyethylene sorbitol ester)) to remove unbound phages and then exposed to 65 nM (final concentration) of hK14 for 45 minutes at 37° C. in 50 mM Tris, 100 mM NaCl, 0.05% Triton, pH 7.5. The released phages were subsequently amplified using XL1-Blue Escherichia coli and then used after purification for subsequent rounds of selection. 32 individual clones from the last round of selection were sequenced for determination of their corresponding amino acid sequences.
Expression of CFP-YFP Fluorescent Substrate
[0196] Recombinant fluorescent substrates, using cyan fluorescent protein as donor and yellow fluorescent protein as acceptor, were constructed as described recently (Felber et al., 2004). CFP-XXXXX-YFP-6×His recombinant proteins were constructed with varying pentapeptides (in bold) between CFP and YFP proteins using synthetic genes possessing the appropriate restriction sites (BssHII; SalI). The constructs contain the following amino acid sequences between CFP and YFP proteins: Gly-Ala-Leu-Gly-Gly-XXXXX-Gly-Ser-Thr (GALGGXXXXXGST (SEQ ID NO:116)). To produce recombinant proteins, TG1 cells were transformed with the corresponding constructs and purified by affinity chromatography using Ni2+-NTA agarose beads. The purity and quantity of the purified CFP-YFP recombinant substrates were evaluated by SDS gel electrophoresis according to Laemmli followed by Coomassie Blue staining and Western blot analysis using a specific anti-His primary antibody (1/3000 dilution), a mouse anti-Fab secondary antibody (1/50000 dilution) and the ECL system (Amersham) for detection. All clones were sequenced prior to evaluation.
Direct Determination of the Kcat/Km and Specificity Studies Using CFP-YFP Fluorescent Substrates
[0197] Substrate specificity of CFP-substrate-YFP proteins was tested towards different proteases and Kcat/Km values calculated as previously described (Felber et al., 2004). Briefly, fluorescence of CFP-X5-YFP proteins was measured in black 96-well plates using a microplate fluorescence reader (Bio-Tek Instruments, Inc.) with excitation at 440 nm (±15) and emissions at 485 nm (±10) and 528 nm (±10). Each recombinant substrate, at a concentration of 150 nM, was incubated with hK14, chymotrypsin, trypsin, PSA, hK2, plasma kallikrein or elastase at a final concentration of 8 nM, 0.1 nM, 0.3 nM, 2 μM, 10 nM, 10 nM and 0.5 nM respectively. The reaction was performed for 60 min at 37° C. in reaction buffer (50 mM Tris pH 7.5, 100 mM NaCl, 0.05% Triton-X100). The enzyme concentration for initial-rate determinations was chosen at a level intended to hydrolyze specifically the substrate linker and not a GGGGG (SEQ ID NO:117) substrate, which was used as negative control. The appearance of fluorescence, corresponding to product formation, was measured spectrometrically with excitation at 440 nm (±15) and emission at 485 nm (±10). The slope was converted into units of nmol of product generated per sec, based on a calibration curve obtained from the complete hydrolysis of each peptide, evaluated on SDS-PAGE. The kinetic parameter kat/Km was determined under pseudo-first order conditions using a substrate concentration far below the estimated Km (Felber et al., 2004).
[0198] The cleavage products were separated by SDS-polyacrylamide gel electrophoresis, transferred to an Immobilon polyvinylidene difluoride membrane (Bio-Rad), and subjected to automated Edman degradation with an Applied Biosystems (model ABI493A) sequenator to determine the cleavage site.
Selection of Phage Substrate for hK14
[0199] The substrate phage library was panned against hK14 to select substrates cleaved by its hydrolytic activity. Cleaved phages were amplified in E. coli TG1 cells and then subjected to five more rounds of enzyme digestion and screening. The amount of released phages increased with each round, indicating the presence of a higher number of hK14-susceptible phages after each round of selection. The amino acid sequences of 32 phage peptides from the last round of selection were determined by sequencing. The sequences corresponding to the substrate regions are listed in Table 1. From all selected and cleaved peptides, 69% possess a basic residue in P1 position, as expected for a putative trypsin-like activity of hK14, whereas 31% of peptides have a tyrosine residue specific for a chymotrypsin-like enzyme in P1.
Kinetic Characterization of Substrate Hydrolysis by hK14
[0200] To verify that the sequences from the phage display analysis were indeed substrates for hK14, and to identify the cleavage site, all selected peptides were constructed in fluorescent substrate form. Applicants substrate system is based on the transfer of energy from CFP to YFP which are linked by the substrate. Cleavage of the linker by a protease separates the two fluorophores and results in a loss of the energy transfer. Thus, hydrolysis of the substrate can be evaluated by the measurement of increasing fluorescence intensity of the donor at 485 nm, corresponding to the wavelength of CFP emission (Mitra et al., 1996; Felber et al., 2004).
[0201] All substrates were hydrolyzed by hK14 with variable level of efficacy and Kcat/Km values ranged from 2 000 to 481 000 M-1 s-1. The specificity of cleavage was demonstrated with CFP-GGGGG-YFP (SEQ ID NO:117) which is not hydrolyzed by hK14 (not shown).
[0202] Results clearly indicate that the preferred P1 amino acid for hK14 susceptibility is Arg (Table 1) since the best hK14 substrates with Kcat/Km greater than 200,000 M-1 s-1 possess an Arg in P1 position. Interestingly, from the four peptides cleaved most efficiently by hK14, two contained a Gln at the P2 position. In contrast, a broad variety of amino acids were found in P1' position, demonstrating no significant preference at this position. However, two substrates possess an aspartic acid in P1' position and are cleaved relatively efficiently.
[0203] On the other hand, all substrates with a Lys at the P1 position were cleaved at low rate with a Kcat/Km equal to or below 34 000 M-1 s-1. Similarly, the cleavage rate for substrates with a P1 tyrosine was very low except for one substrate, peptide G9, which had a Kcat/Km of 134 000 M-1 s-1. With the exception of P1' position, where glycine residue is found in about 50% of P1 Lysine or Tyrosine substrates, no amino acid was recovered more frequently at the other positions. Nevertheless, it has to be stated that the majority of glycine residues found in position PP were originating from the phage linker region flanking the selected pentapeptide substrates, where Lys or Tyr residues are found in position 5 of the selected peptide.
Specificity of Preferred Selected Substrates
[0204] Since many of the selected substrates contained motifs potentially susceptible to cleavage by other proteases, Applicants measured the degree to which hK2, plasma kallikrein, PSA, chymotrypsin, trypsin and elastase could cleave these hK14 substrates (Table VIII). Each substrate was tested at enzyme concentration leading to specific cleavage in the substrate linker and not hydrolyzing the GGGGG (SEQ ID NO:117) control substrate.
[0205] Not surprisingly, most of trypsin-like substrates are cleaved by trypsin with a variable efficacy which was not strictly in correlation with hK14 preferences. For instance, the two pentapeptides VGSLR (SEQ ID NO:118) and RQTND (SEQ ID NO:119) were the best substrates for hK14 but were not very efficiently cleaved by trypsin in comparison to other peptides like LSGGR (SEQ ID NO:124) exhibiting a Kcat/Km of almost 5'000'0000 M-1s-1. In contrast, peptides possessing a Gln in P2 position were excellent substrates for hK14 as well as for trypsin. Only two hK14 substrates with low trypsin-like hK14 activity, RVTST (SEQ ID NO:128) and VVMKD (SEQ ID NO:129), but four out of five substrates with chymotrypsin like hK14 activity were not cleaved by trypsin.
[0206] All chymotrypsin-like substrates were cleaved by chymotrypsin more efficiently than with hK14, except for the substrate TVDYA (SEQ ID NO:130) which gave almost the same kcat/Km with hK14, chymotrypsin and elastase. Elastase also proteolyzed the two selected peptides TSYLN (SEQ ID NO:134) and YQSLN (SEQ ID NO:133), which is also cleaved weakly by PSA. Preferred substrates displayed a high selectivity for hK14 in comparison to other human kallikreins such as hK1, hK2, PSA and PK. Only hK2 proteolyzed most of the trypsin-like substrates with Kcat/Km values always at least 5 fold lower than for hK14. For example, NQRSS (SEQ ID NO:120) peptide is 27 and 78 fold more selective for hK14 than for hK2 and PK, respectively and F3 peptide demonstrates high hK14 specificity and no cleavage with another kallikrein could be detected.
TABLE-US-00010 TABLE VIII Specificity of phage selected hK14 substrates toward different human proteases. Chymo- Plasma Peptide Sequence hK14 Trypsin trypsin Elastase kallikrein hK1 hK2 PSA Kcat/Km (M-1 s-1) Trypsin-like substrate G1 VGSLR 481'000 270'000 145'000 -- -- -- 21'000 -- SEQ ID NO: 118 C11 RQTND 415'000 260'000 251'000 -- -- -- 23'000 -- SEQ ID NO: 119 E5 NQRSS 388'000 2'070'000 -- -- 5'000 -- 14'000 -- SEQ ID NO: 120 E8 LQRAI 367'000 2'270'000 -- 209'000 5'000 -- 25'000 -- SEQ ID NO: 121 F11 QRLRD 307'000 1'420'000 168'000 -- -- L.C. 32'000 -- SEQ ID NO: 122 F3 PDRHM 243'000 319'000 192'000 -- -- -- -- -- SEQ ID NO: 123 E2 LSGGR 207'000 4'676'000 83'000 -- -- -- 14'000 -- SEQ ID NO: 124 E7 LSRDN 127'000 246'000 155'000 -- -- -- 16'000 -- SEQ ID NO: 125 D9 RGKTN 80'000 2'111'000 94'000 -- -- -- 21'000 -- SEQ ID NO: 126 E9 NNKLR 74'000 384'000 77'000 -- -- -- 12'000 -- SEQ ID NO: 127 E12 RVTST 26'000 -- 100'000 200'000 -- -- -- -- SEQ ID NO: 128 E10 VVMKD 15'000 -- -- 65'000 -- -- -- -- SEQ ID NO: 129 Kcat/Km (M-1s-1) Chymotrypsin-like substrate G9 TVDYA 134'000 -- 145'000 181'000 -- -- -- -- SEQ ID NO: 130 E1 AYGYK 24'000 129'000 618'000 -- -- -- -- -- SEQ ID NO: 131 F6 VGLYD 18'000 -- 409'000 -- -- -- -- -- SEQ ID NO: 132 F10 YQSLN 12'000 -- 134'000 49'000 -- -- -- L.C. SEQ ID NO: 133 D7 TSYLN 9'000 -- 266'000 90'000 -- -- -- -- SEQ ID NO: 134 L.C.: low cleavage, kcat/Km not determined; -- no detectable cleavage
Example 2
Materials
[0207] The following materials were obtained from commercial sources: elastase, trypsin, chymotrypsin, thrombin and plasma kallikrein (Calbiochem), T4 DNA ligase (Invitrogen), T4 polynucleotide kinase (Qbiogene), Ni2+-nitrilotriacetic acid agarose beads (Qiagen), restrictions enzymes (Roche, Amersham Pharmacia, Promega), anti-His antibody and an alkaline phosphatase-conjugated goat anti-mouse secondary antibody (Sigma). Fluorescent substrates Z-Phe-Arg-AMC, Suc-Ala-Ala-Pro-Phe-AMC (AAPF (SEQ ID NO:135), Z-Gly-Gly-Arg-AMC and MeOSuc-Ala-Ala-Pro-Val-AMC (AAPV SEQ ID NO:136) were purchased from Calbiochem, Boc-Val-Pro-Arg-AMC from Bachem, Abz-Thr-Phe-Arg-Ser-Ala-Dap(Dnp)-NH2 (TFRSA SEQ ID NO:137) from Neosystem. Oligonucleotide synthesis was carried out by Invitrogen and DNA sequencing by Synergene Biotech GmbH. Human kallikrein 2, 5, 13 and 14 were produced in a yeast system (Yousef et al., 03c; Kapadia et al., 03; Borgono et al., 03). Human kallikrein 6 was produced in a 293 human embryonic kidney cell system and human kallikrein 8 with a baculovirus vector and HighFive insect cells (Little et al., 97; Kishi et al., 03). HK6 and hK8 were activated with Lys-C(Shimizu et al., 98).
Construction of Expression Vectors for Recombinant Wild-Type AAT, ACT and their Variants.
[0208] Human AAT cDNA (Invitrogen, UK) was amplified by PCR using the oligonucleotides 5'-TATGGATCCGATGATCCCCAGGGAGA-3' (SEQ ID No 71) and 5'-CGCGAAGCTTTTATTTTTGGGTGGGA-3' (SEQ ID No 72). The BamHI-HinclIII fragment of the amplified AAT gene was cloned into the vector pQE9 (Qiagen, Germany) resulting in plasmid pAAT, which contains an open reading frame of the mature AAT with an N-terminal His6-tag. Silent mutations producing KasI and Bsu36I restriction sites were introduced in pAAT 24 by upstream and 11 by downstream of the P1 codon of the RSL domain, respectively. The restriction sites were created using the oligonucleotides 5'-ACTGAAGCTGCTGGCGCCGAGCTCTTAGAGGCCATA-3' (SEQ ID No 73) for the KasI and 5'-GTCTATCCCCCCTGAGGTCAAGTTC-3' (SEQ ID No 74) for the Bsu36I site following the QuikChange mutagenesis protocol supplied by Stratagene. Construction of the plasmid expressing wild-type ACT was described previously (Cloutier et al., 2004). rAAT and rACT variants were produced by replacement of the RSL region with corresponding DNA fragments amplified from appropriate template oligonucleotides:
TABLE-US-00011 rAATE8, (SEQ ID No 75) 5'-CCATGTTTCTAGAGGCTCTGCAGCGTGCTATCCCGCCTGAGGTCAA GTT-3'; rAATG9, (SEQ ID No 76) 5'-CCATGTTTCTAGAGACCGTTGACTACGCTATCCCGCCTGAGGTCAA GTT-3', rACTE8, (SEQ ID No 77) 5'-TACCGCGGTCAAAATCCTGCAGCGTGCTATCCTGGTGGAGACGCGT GA-3' and rACTG9, (SEQ ID No 78) 5'-TACCGCGGTCAAAACCGTTGACTACGCTGCTCTGGTGGAGACGCGT GA-3'.
[0209] Templates were amplified using primers corresponding to their respective flanking regions, 5'-GCTGGCGCCATGTTTCTAGAG-3' (SEQ ID No 79; AAT variants1) and 5'-TTGTTGAACTTGACCTCAGG-3'(SEQ ID No 80; AAT variants 2) for AAT variants and 5'-GTACCGCGGTCAAA-3'(SEQ ID No 81; ACT variants 1) and 5'-TCACGCGTGTCCAC-3'(SEQ ID No 82; ACT variants 2) for ACT variants. Resulting PCR fragments were cloned as KasI/Bsu36I fragments into pAAT and as MluI/SacII fragments into rACTWT constructs and confirmed by DNA sequencing. Changes in the reactive site loop between positions P4 and P2' are shown in Table IX.
Expression and Purification of Recombinant Serpins
[0210] Recombinant serpins were produced in Escherichia coli strain TG1. Cells were grown at 37° C. in 2×TY media (16 g tryptone, 10 g yeast extract, 5 g NaCl per L) containing 100 μg/ml ampicillin to O.D.600=0.5-0.7. Isopropyl thio-β-D-galactoside (IPTG) was added to a final concentration of 0.5 mM for production of rACT proteins and 0.1 mM for rAAT proteins and recombinant serpins were expressed for 16 h at 18° C. Cells were harvested by centrifugation and resuspended in 0.1 volume of cold PBS 2×. After 45 mM of incubation with lysozyme (0.5 mg/ml) on ice, total soluble cytoplasmic proteins were extracted by four cycles of freeze/thaw and total DNA was degraded with DNase I. Cell debris was removed by centrifugation (25 min, 17'500 g) and Ni2+-nitrilotriacetic affinity agarose beads were added to the supernatant for 90 min at 4° C. to bind recombinant serpins. The resin was washed three times with 50 mM Tris, pH 7.5, 150 mM NaCl, 20 mM imidazole and bound proteins were eluted with 50 mM Tris, pH 7.5, 150 mM NaCl, 150 mM imidazole. Eluted proteins were dialyzed against 50 mM Tris, pH 7.5, 150 mM NaCl, 0.01% Triton X-100 for 16 h at 4° C. and protein purity was assessed by Coomassie Blue-stained SDS-PAGE. Protein concentrations were determined by the bicinchoninic acid method (Smith et al., 1985), using bovine serum albumin as standard (Pierce Chemical Co., Rockford, Ill.). AATE8, ACTE8 and AATG9, ACTG9 were titrated with trypsin and chymotrypsin, respectively.
Stoichiometry of Inhibition (SI)
[0211] SI values of rAAT, rACT, and their variants were determined with hK14 incubating the protease with varying concentrations of inhibitor. After an incubation of 4 hours at 37° C. in reaction buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA), the residual activity was detected by the addition of fluorescent substrate (Boc-Val-Pro-Arg-AMC). Fluorescence was measured with excitation at 340 nm (±15) and emission at 485 nm (±10) in black 96 well plates using a microplate fluorescence reader FL.sub.x800 (Bio-Tek Instruments, Inc.). The SI value corresponds to the abscissa intercept of the linear regression analysis of fractional velocity (velocity of inhibited enzyme reaction (vi)/velocity of uninhibited enzyme reaction (v0)) vs. the molar ratio of the inhibitor to enzyme ([I0]/[E0]).
Kinetic Analysis
[0212] The association rate constants for interactions of hK14, with different inhibitors were determined under pseudo-first order conditions using the progress curve method (Morrison and Walsh, 1988). Under these conditions, a fixed amount of enzyme (2 nM) was mixed with different concentrations of inhibitor (0-80 nM) and an excess of substrate (20 μM). Reactions were performed in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA) at 37° C. for 45 min and the rate of product formation was measured using a FL.sub.x800 fluorescence 96-well microplate reader (Biotek, USA) Inhibition is considered to be irreversible over the course of reaction and the progression of enzyme activity is expressed as product formation (P), beginning at a rate (vz) and is inhibited over time (t) at a first-order rate (kobs), where the rate constant is only dependent on the inhibitor concentration.
P=(vz/kobs)×[1-e.sup.(-kobst.sup.)] eq 1
[0213] For each inhibitor, a kobs was calculated for four different concentrations of inhibitor, by non linear regression of the data using equation 1. By plotting the kobs versus inhibitor concentration [I], a second-order rate constant, k', equal to the slope of the curve (k'=Δkobs/Δ[I]), was determined. Due to the competition between the inhibitor and the substrate, equation 2 below is used to correct the second order rate constant k' by taking into account the substrate concentration [S] and the Km of the enzyme for its substrate, giving the ka.
ka=(1+[S]/Km)×k' eq 2
[0214] The Km of hK14 for MeOSuc-VPR-AMC was 8 μM. However, it will be understood that, depending on the purity grade and specific activity of the hK14 protease, the Km may vary.
SDS-PAGE Analysis of Enzyme-Inhibitor Complexes
[0215] A constant amount of the different inhibitors (ranging from 1 to 2 ug) was incubated for 4 h in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100) with different amounts of hK14 corresponding to 0.5, 1 and 2 times the SI value. Samples were heated at 90° C. for 10 minutes, resolved on a 10% SDS gel under reducing conditions and visualized by Coomassie Blue staining.
Inhibitory Specificity of Recombinant rAAT and rACT Variants (Table IX)
[0216] 2 nM of trypsin, chymotrypsin, plasma kallikrein, human neutrophil elastase and thrombin and 10 nM of hK2, hK3, hK5, hK6, hK8, hK13 and hK14 were incubated for 30 minutes at 37° C. with 100 nM and 500 nM of recombinant inhibitors, respectively. Residual activities were detected by the addition of fluorescent substrates (Z-Phe-Arg-AMC for trypsin and plasma kallikrein, Suc-Ala-Ala-Pro-Phe-AMC for chymotrypsin, Z-Gly-Gly-Arg-AMC for thrombin and MeOSuc-Ala-Ala-Pro-Val-AMC for human neutrophil elastase and Abz-Thr-Phe-Arg-Ser-Ala-Dap(Dnp)-NH2 for human kallikreins).
Stability of the Complex
[0217] HK14 (2 nM) was incubated with different amounts of inhibitors, corresponding to 0, 1 and 2 times the SI. After incubations for 4, 8 and 24 h at 37° C. in reaction buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA), the residual activity was detected by addition of 20 μM of the fluorescent substrates Boc-Val-Pro-Arg-AMC. The slope (velocity) of each inhibitory reaction was divided by the slope of the corresponding reaction without inhibitor.
Design and Production of Soluble Recombinant Serpins
[0218] To develop specific inhibitors for hK14, Applicants substituted five residues surrounding the scissile bond of rAATwt and rACTwt by two substrate pentapeptides, previously selected with hK14 using phage-display technology (Felber et al., 05). Profiling of hK14 enzymatic activity demonstrated that hK14 has a dual trypsin and chymotrypsin-like activity. Applicants therefore decided to develop inhibitors with two substrate peptides, E8 and G9, specific for trypsin and chymotrypsin-like activity, respectively. The scissile bond of these substrates was aligned according to the P1-P'1 of the rAATwt and rACTwt. The RSL regions of the serpin variants are shown in Table IX.
TABLE-US-00012 TABLE IX Selecteda Substrate Serpin Peptide P6 P5 P4 P3 P2 P1 P1' P2' P3' P4' P5' AATWT L E A I P M* S I P P E AATE8 LQR↓AI L E A L Q R* A I P P E SEQ ID NO: 121 AATG9 TVDY↓A L E T V D Y* A I P P E SEQ ID NO: 130 ACTWT V K I T L L* S A L V E ACTE8 LQR↓AI V K I L Q R* A I L V E SEQ ID NO: 121 ACTG9 TVDY↓A V K T V D Y* A A L V E SEQ ID NO: 130 Comparison of amino acid sequence of the scissile bond region of the reactive serpin loop (RSL)of wild type AAT, ACT and their variants . aSubstrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library (Felber et al., 2004). Plain type residues are common to wild type serpin, bold residues correspond to substrate peptides relocated in RSL of AAT and ACT variants. The scissile bond cleaved by hK14 in substrate peptides is designated by ↓ and putative cleavage sites in serpins are marked by asterisks between the P1-P1' residues.
[0219] The recombinant serpins were produced as soluble, active form and were purified under native conditions from cytoplasmic proteins in a one-step procedure over a nickel affinity column Analysis on SDS-PAGE under reducing conditions revealed a single band for each inhibitor, rAAT and rACT variants, migrating at apparent sizes of 45 to 50 kDa, corresponding with their molecular weight, except for the protein AATE8, which is migrating slightly faster (data not shown). All inhibitors were estimated to be more than 95% pure by densitometric analysis, with a range of production yield of 1 to 5 mg/L.
Stoichiometry of Inhibition, Association Constants and Complex Stability
[0220] Determination of stoichiometry of inhibition (SI) was performed under physiological conditions of pH and ionic strength. The SI indicates the number of inhibitor molecule required to inhibit one molecule of hK14. Applicants observed that titration curves were linear, even for SI values >>1, indicating that the reaction is completely finished. The calculated SI values of the serpin variants range from ˜1 to 1.5, except for rAATE8 which resulted in a SI of 7.4 (Table X). Whereas wild type ACT did not react with hK14 under the tested conditions, AATWT was found to be a good inhibitor for hK14 with a SI of 1. Substitution of ACT RSL region with hK14 substrate peptides not only allowed generating reactivity toward the enzyme but creating inhibitors with high affinity. On the other hand, using AATWT as scaffold, modification of the RSL was less favorable since all inhibitors are less efficient than wild type version (Table X).
TABLE-US-00013 TABLE X Selecteda Inhibitor Substrate Peptide SI ka M-1 s-1 AATWT IPM*SI 1.0 263 000 SEQ ID NO: 140 AATE8 LQR↓AI 7.4 n.a. SEQ ID NO: 121 AATG9 TVDY↓A 1.2 217 000 SEQ ID NO: 130 ACTWT TLL*SA -- -- SEQ ID NO: 138 ACTE8 LQR↓AI 1.2 575 000 SEQ ID NO: 121 ACTG9 TVDY↓A 1.5 74 000 SEQ ID NO: 130 Stoichiometry Inhibition (SI) and second-order rate constants (ka) values for the reaction of rAATwt, rACTwt and their variants with hK14. aSubstrate peptide selected by phage display technology with hK14 (Felber et al., 2005) and used to modify the rAATwt and rACTwt. --, No detectable inhibitory activity.
[0221] Calculated SI values were consistent with the ratio between cleaved and complexed forms of the serpins after reaction with hK14 as demonstrated by SDS-PAGE analysis (data not shown). Each variant was incubated with different concentrations of hK14 corresponding to a ratio of inhibitor to protease below, equal and above the SI value. The analysis of SDS-PAGE showed the formation of covalent complexes (C) for each serpin variant hK14 pair, with apparent molecular masses consistent with expected values. When hK14 concentration was 0.5 time the SI value, degraded forms of the complex was observed which is certainly generated by the uncomplexed and free hK14.
[0222] Besides the formation of an inhibitor complex, reaction with hK14 also produced a fraction of hydrolyzed inhibitor, with a molecular size consistent with the serpin being cleaved at or near the reactive site of the RSL. The amount of this fraction was largely lowered when the SI value is close to 1 (AAT-G9, ACT-E8 and ACT-G9). In contrast, the only variant with a SI values >>1 (rAATE8) exhibited a substrate behavior with hK14, resulting mainly in accumulation of the cleaved form of the inhibitor rather than formation of the irreversible complex. As expected, the presence of intact inhibitor was observed when the ratio [I]o/[E]o was above the SI with a weak band of complex.
[0223] Surprisingly, most of complexes were found to be SDS stable (data not shown) even if a relatively slow breakdown of the complex was observed with AATG9 resulting in the reappearance of hK14 activity after 8 hours of incubation.
[0224] Kinetic analysis of the inhibition of human hK14 by recombinant serpins were performed under pseudo-first-order conditions using an excess of inhibitor at various molar ratios of hK14. The time-dependent inactivation of the enzyme through reaction with serpin was monitored continuously, following the decrease in the rate of substrate turnover. Progress curves for reactions with different serpin concentrations were fitted to equation 1 to calculate values describing the rate constant (kobs). The association rate constants (ka) were determined from the slope of kobs values versus the concentration of the hK14 inhibitors. Independently of the inhibitor scaffold (AAT or ACT), the recombinant serpins modified with the substrate E8 showed superior ka values than the equivalent G9 inhibitor.
[0225] Serpins modified with the chymotrypsin-like substrate, rAATG9 and rACTG9, demonstrated only a moderate affinity for hK14, with association constants of respectively 217'000 and 74'000 M-1 s-1 while rACTE8 possessed association constants of 575'000 M-1 s-1.
Inhibitory Specificity of Recombinant rAAT and rACT Variants
[0226] In order to define the inhibitory specificity of hK14 inhibitors, Applicants investigated the reaction of purified variants with a broad panel of proteinases. First at all, proteinases with broad specificities were examined, including trypsin, chymotrypsin, plasma kallikrein, human neutrophil elastase and thrombin. Additionally, Applicants assessed the specificity of hK14 inhibitors towards enzymes belonging to the same protease family, i.e. hK2, hK3, hK5, hK6, hK8 and hK13 (Table XI). Following 30 minutes of incubation of hK14 with an excess of inhibitors ([I]o/[E]o of 50:1), no residual activity was detected with all modified serpins and rAATwt. Under these conditions, only rACTwt showed weak inhibitory activity against hK14, with only 17% of inhibition. Serpins modified with the E8 substrate showed a moderate specificity since several other enzymes were inhibited by these inhibitors. A very high specificity was observed with AATG9 and ACTG9 and none of the tested enzymes was inhibited, except for chymotrypsin and to a lower extent for hK5.
TABLE-US-00014 TABLE XI Protease AATwt AATE8 AATG9 ACTwt ACTE8 ACTG9 hK14 100 100 100 17 100 100 Trypsin 100 100 0 0 100 0 Chtr 100 19 100 100 14 100 PK 17 100 0 46 36 0 HNE 100 0 0 16 0 0 Thrombin 4 0 0 18 0 0 hK2 0 19 0 0 100 0 hK3 0 0 0 100 0 0 hK4 na na na Na 100 0 hK5 28 100 30 7 100 0 hK6 33 100 0 24 72 0 hK8 0 36 0 0 34 0 hK13 0 30 0 0 0 0 Inhibitory specificity of hK14 inhibitors. Percentage inhibition conrresponding to 100 × [1 - (velocity in presence of inhibitor/velocity of uninhibited control)]. Reaction of 30 min. incubation with an excess of inhibitors ([I]o/[E]o of 50:1).
Example 3
Production and Purification of Active hK14
[0227] Human Kallikrein 14 was produced and purified as previously described. Selection of substrate peptides for hk14 using phage display technology
[0228] The substrate phage library was panned against hK14 to select substrates hydrolyzed by its hydrolytic activity. Cleaved phages were amplified in E. coli TG1 cells and then subjected to five more rounds of enzyme digestion and screening. The amount of released phages increased with each round, thus verifying a higher number of hK14-susceptible phages after each round of selection. The amino acid sequences of 32 phage peptides from the last round of selection were determined by sequencing and the obtained sequences corresponding to the substrate regions were listed in Table 8. From all selected and cleaved peptides, 69% possess at least one basic residue in P1 position as expected with the putative trypsin-like activity of hK14 whereas 31% of peptides have a tyrosine residue specific to chymotrypsin-like enzyme in P1.
Kinetic Characterization of Substrate Hydrolysis by hK14
[0229] To verify that the sequences from the phage display analysis were indeed substrates for hK14 and to identify the cleavage site, all selected peptides were constructed in fluorescent substrate form. All substrates were hydrolyzed by hK14 with variable level of efficacy and kcat/Km ranged from 2'000 to 481'000 M-1 s-1. The specificity of cleavage was demonstrated by CFP-GGGGG-YFP (SEQ ID NO:117) which is not hydrolyzed by hK14.
[0230] Results clearly indicate that the preferred P1 amino acid for hK14 susceptibility is Arg (Table XIII) since all of the best hK14 substrates with kcat/Km superior to 200 000 M-1 s-1 possess an Arg in P1 position. Interestingly, from the four peptides cleaved most efficiently by hK14, two contained Glu at the P2 position. In contrast, a broad variety of amino acids occurred in P'1 position demonstrating no significant preference at this position. However, two substrates possess an aspartic acid in P'1 position and are cleaved relatively efficiently.
[0231] On the other hand, all substrates with a Lys at the P1 position were cleaved at very low rate with a Kcat/Km below 34 000 M-1 s-1. Similarly, the cleavage rate for the substrate with a P1 Tyrosine was very low excepted one substrate, peptide G9, which has a Kcat/Km of 134 000 M-1 s-1. With the exception of P'1 position, where glycine residue is recovered in almost 50% of P1 Lysine or Tyrosine substrates, none amino acid in particular was recovered more frequently at the other positions.
[0232] Since many of the selected substrates contained some motifs susceptible to be cleaved by other proteases, Applicants measured the degree to which hK2, plasma kallikrein, PSA, chymotrypsin, trypsin and elastase could cleave these hK14 substrates (Table XII). Each substrate was tested at enzyme concentration giving a specific cleavage in the substrate linker.
[0233] Not surprisingly, most of trypsin-like substrates are cleaved by trypsin with a variable efficacy which was not strictly in correlation with hK14 preferences. For instance, the two pentapeptides VGSLR (SEQ ID NO:118) and RQTND (SEQ ID NO:119) were best substrates for hK14 but were not very efficiently cleaved by trypsin in comparison to other peptides like LSGGR (SEQ ID NO:124) peptide giving a Kcat/Km of almost 5'000'0000 M-1s-1 with trypsin. In contrast, peptides possessing a Gln in P2 position were best substrates as well as for hK14 than for trypsin. Only two hK14 substrates, RVTST (SEQ ID NO:128) and VVMKD (SEQ ID NO:129), in exception to chymotrypsin-like substrates were not cleaved by trypsin.
[0234] Chymotrypsin-like substrates were cleaved by chymotrypsin more efficiently than with hK14 excepted TVDYA (SEQ ID NO:130) substrate which gave almost the same Kcat/Km with hK14, chymotrypsin and elastase. This last enzyme also proteolyzed the two selected peptides YQSLN (SEQ ID NO:133), which is also cleaved weakly by PSA, and TSYLN (SEQ ID NO:134). Selected substrates displayed a high selectivity for hK14 in comparison to other human kallikreins such as hK1, hK2, PSA and PK. Only hK2 proteolyzed most of the trypsin-like substrates with Kcat/Km values always at least 5 fold less than for hK14. For example, NQRSS (SEQ ID NO:120) peptide is 27 and 78 fold more selective for hK14 than for hK2 and PK, respectively.
TABLE-US-00015 TABLE XII Specificity of preferred selected substrates Clone Sequence kcat/Km (M-1 s-1) G1 VGSLR 481'000 SEQ ID NO: 118 C11 RQTND 415'000 SEQ ID NO: 119 E5 NQRSS 388'000 SEQ ID NO: 120 E8 LQRAI 367'000 SEQ ID NO: 121 F11 QRLRD 307'000 SEQ ID NO: 122 F3 PDRHM 243'000 SEQ ID NO: 123 E2 LSGGR 207'000 SEQ ID NO: 124 G9 TVDYA 134'000 SEQ ID NO: 130 E7 LSRDN 127'000 SEQ ID NO: 125 D9 RGKTN 80'000 SEQ ID NO: 126 E9 NNKLR 74'000 SEQ ID NO: 127 E6 MQVKH 34'000 SEQ ID NO: 142 E4 TTDLR 27'000 SEQ ID NO: 143 E12 RVTST 26'000 SEQ ID NO: 128 E1 AYGYK 24'000 SEQ ID NO: 131 G3 STKGI 20'000 SEQ ID NO: 144 F5 KLKET 19'000 SEQ ID NO: 145 F6 VGLYD 18'000 SEQ ID NO: 132 E10 VVMKD 15'000 SEQ ID NO: 129 D11 RVDTG 15'000 SEQ ID NO: 146 F7 GHRIN 12'000 SEQ ID NO: 147 F10 YQSLN 12'000 SEQ ID NO: 133 C5 SDKVY 9'000 SEQ ID NO: 148 G11 HETLK 9'000 SEQ ID NO: 149 D7 TSYLN 9'000 SEQ ID NO: 134 F4 MQATK 8'000 SEQ ID NO: 150 G7 EAPAK 8'000 SEQ ID NO: 151 F12 PVHLY 7'000 SEQ ID NO: 152 F1 QPNGY 6'000 SEQ ID NO: 153 G5 AYGLA 6'000 SEQ ID NO: 154 C9 YQNSS 6'000 SEQ ID NO: 155 E11 SAVRP 5'000 SEQ ID NO: 156 Comparison of specificity constant (kcat/Km) values of CFP-X5-YFP substrates based on selected substrates for hK14. (P1 positions of scissile bonds are in bold).
A11
TABLE-US-00016
[0235] TABLE XIII Specificity of phage selected hK14 substrates toward different human proteases. Chymo- Plasma Peptide Sequence hK14 Trypsin trypsin Elastase kallikrein hK1 hK2 PSA kcat/Km (M-1 s-1) Trypsin-like substrate G1 VGSLR 481'000 270'000 145'000 -- -- -- 21'000 -- SEQ ID NO: 118 C11 RQTND 415'000 260'000 251'000 -- -- -- 23'000 -- SEQ ID NO: 119 E5 NQRSS 388'000 2'070'000 -- -- 5'000 -- 14'000 -- SEQ ID NO: 120 E8 LQRAI 367'000 2'270'000 -- 209'000 5'000 -- 25'000 -- SEQ ID NO: 121 F11 QRLRD 307'000 1'420'000 168'000 -- -- L.C. 32'000 -- SEQ ID NO: 122 F3 PDRHM 243'000 319'000 192'000 -- -- -- -- -- SEQ ID NO: 123 E2 LSGGR 207'000 4'676'000 83'000 -- -- -- 14'000 -- SEQ ID NO: 124 E7 LSRDN 127'000 246'000 155'000 -- -- -- 16'000 -- SEQ ID NO: 125 D9 RGKTN 80'000 2'111'000 94'000 -- -- -- 21'000 -- SEQ ID NO: 126 E9 NNKLR 74'000 384'000 77'000 -- -- -- 12'000 -- SEQ ID NO: 127 E12 RVTST 26'000 -- 100'000 200'000 -- -- -- -- SEQ ID NO: 128 E10 VVMKD 15'000 -- -- 65'000 -- -- -- -- SEQ ID NO: 129 kcat/Km (M-1 s-1)) Chymotrypsin-like substrate G9 TVDYA 134'000 -- 145'000 181'000 -- -- -- -- SEQ ID NO: 130 E1 AYGYK 24'000 129'000 618'000 -- -- -- -- -- SEQ ID NO: 131 F6 VGLYD 18'000 -- 409'000 -- -- -- -- -- SEQ ID NO: 132 F10 YQSLN 12'000 -- 134'000 49'000 -- -- -- L.C. SEQ ID NO: 133 D7 TSYLN 9'000 -- 266'000 90'000 -- -- -- -- SEQ ID NO: 134 L.C.: low cleavage, kcat/Km not determined; -- no detectable cleavage
[0236] This study identified two classes of pentapeptide substrates for hK14: trypsin-like and chymotrypsin-like substrates. However, Applicants showed that hK14 has trypsin-rather than chymotrypsin-like cleavage specificity despite the selection of several aromatic residue-containing substrates. The substrates with the highest Kcat/Km have an arginine in P1 position indicating a preference for this amino acid (Table XIV). Lysine, on the other hand, seems to be less suitable than tyrosine in P1 position. If the two amino acids were present in the same peptide, hK14 cleaved after the tyrosine residue. In addition, one of the chymotrypsin-like substrates, TVDYA (SEQ ID NO:130), gave a significantly higher kinetic value, 134,000 M-1s-1, than all the lysine-P1 substrates, with Kcat/km values not higher than 34,000 M-1s-1. No selectivity of hK14 was observed for the P1' position, where different types of amino acids such as small and uncharged, hydrophobic, positively charged or negatively charged residues have been recovered in the best substrates Analysis of other surrounding positions demonstrated that hK14 can be accommodated by a large variety of amino acids. This observation does not mean that hK14 has a large spectrum of activities like trypsin or chymotrypsin but demonstrates an ability to cleave different sequences depending to the context.
[0237] The chymotrypsin-like activity of hK14, even if it is inferior to its trypsin-like activity, is interesting. To Applicants knowledge, except for the Phe-Phe link cleaved by hK1 in kallistatin and some derived peptides, this is the first human kallikrein described with a dual activity. The conformation of the specificity pocket in hK14 should therefore accommodate both aromatic and basic amino acid side chains at the substrate P1 position to explain the dual chymotrypsin and trypsin-like activity of hK14.
Development of hK14 Specific Inhibitors
[0238] Modifications of the RSL of α1-antichymotrypsin (ACT) and α1-antitrypsin (AT or AAT) have been performed to change the specificity of this inhibitor. Selected substrates (G1, C11, E5, E8, F3, F11, G9) were then transplanted into the reactive site loop of serpins to generate new variants, able to inhibit the human kallikrein hK14. More than one inhibitor variants have been constructed using sequences from peptides G1 and C11.
TABLE-US-00017 TABLE XIV Alignment of RSL (reactive serpin loop) region of recombinant serpin α1-antichymotrypsin (ACT) and its variants. Selecteda Serpin Substrate Peptide P6 P5 P4 P3 P2 P1 P'1 P'2 P'3 P'4 P'5 ACTWT V K I T L L* S A L V V AcTG1 vGSLR V K G S L R* S A L V V SEQ ID NO: 118 ACTG1g vGSLRG V K G S L R* G A L V V SEQ ID NO: 141 ACTG1v VGSLR V V G S L R* S A L V E SEQ ID NO: 118 ACTC11 RQTNd V K I T L R* Q T N V V SEQ ID NO: 119 ACTC11g gRQTNd V K I T G R* Q T N V V SEQ ID NO: 139 ACTC11D gRQTND V K I T L R* Q T N D V SEQ ID NO: 139 ACTE5 NQRSS V K I N Q R* S S L V V SEQ ID NO: 120 ACTE8 LQRAI V K I L Q R* A I L V V SEQ ID NO: 121 ACTF11 QRLRD V K Q R L R* D A L V V SEQ ID NO: 122 ACTF3 PDRHM V K I P D R* H M L V V SEQ ID NO: 123 ACTG9 TVDYA V K T V D Y* A A L V V SEQ ID NO: 130 aSubstrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library. Plain type residues are common to rACTWT, underlined residues correspond to substrate peptides relocated in RSL of ACT variants. The scissile bond by hK14 in substrate peptides is designated by bold and putative cleavage site in serpins is marked by asterisks between the P1-P1' residues.
TABLE-US-00018 TABLE XV Alignment of RSL (reactive serpin loop) region of recombinant serpin alpha-1-antitrypsin (AAT) and its variants. Selecteda Serpin Substrate Peptide P6 P5 P4 P3 P2 P1 P'1 P'2 P'3 P'4 P'5 AATWT L E A I P M* S I P P E AATG1 vGSLR L E G S L R* S I P P E SEQ ID NO: 118 AATG1g vGSLRG L E G S L R* G I P P E SEQ ID NO: 141 AATG1v VGSLR L V G S L R* S I P P E SEQ ID NO: 118 AATC11 RQTND L E A I P R* Q T N P E SEQ ID NO: 119 AATC11g gRQTND L E A I G R* Q T N P E SEQ ID NO: 139 AATE5 NQRSS L E A N Q R* S S P P E SEQ ID NO: 120 AATE8 LQRAI L E A L Q R* A I P P E SEQ ID NO: 121 AATF11 QRLRD L E Q R L R* D I P P E SEQ ID NO: 122 AATF3 PDRHM L E A P D R* H M P P E SEQ ID NO: 123 AATG9 TVDYA L E T V D Y* A I P P E SEQ ID NO: 130 aSubstrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library. Plain type residues are common to rAATWT, underlined residues correspond to substrate peptides relocated in RSL of AT variants. The scissile bond by hK14 in substrate peptides is designated by bold and putative cleavage site in serpins is marked by asterisks between the P1-P1' residues.
[0239] The determination of the stoichiometry of inhibitory (SI) and the rate of inhibitory reaction (ka) were performed under physiological conditions of pH and ionic strength to ensure a more relevant comparison. Almost all the newly constructed variants of ACT showed lower SI values with hK14 than wild type ACT. From these variants rACTC11, rACTC11D, rACTG9 and rACTE8 had the lowest stoichiometry of inhibition values for hK14 (4.8, 2.8, 1.5 and 1.2 respectively) and the highest association constants (65000, 74000, 75000 and 575000 M-1 s-1 respectively). Contrary to ACT, the serpin AATwt is a good inhibitor for hK14 with an association constant of 263 000 M-1 s-1. All the AAT variants had a lower association constant than AATwt, but several of them still react at high velocity with hK14, as AATG1, AATG9, AATE8, AATG1g and AATC11 exhibiting a ka of 168 000, 217 000, 242 000, 257 000 and 63 000 M-1 s-1 respectively. Only two AT variants did not inhibit hK14.
TABLE-US-00019 TABLE XVI Comparison of Stoichiometry Inhibition values and second-order rate constants (ka) for the reaction of ACT variants with hK14. Selecteda Clone Substrate Peptide SI ka M-1 s-1 ACTWT -- -- ACTG1 vGSLR↓ 13.3 3 200* SEQ ID NO: 118 ACTG1g vGSLR↓G -- -- SEQ ID NO: 141 ACTG1v VGSLR↓ 11.7 22 000* SEQ ID NO: 118 ACTC11 R↓QTNd 4.8 65 000* SEQ ID NO: 119 ACTC11g gR↓QTNd 13.8 7 600* SEQ ID NO: 139 ACTC11D gR↓QTND 2.8 74 000* SEQ ID NO: 139 ACTE5 NQR↓SS -- -- SEQ ID NO: 120 ACTE8 LQR↓AI 1.2 575 000 SEQ ID NO: 121 ACTF11 QRLR↓D -- -- SEQ ID NO: 122 ACTF3 PDR↓HM -- -- SEQ ID NO: 123 ACTG9 TVDY↓A 1.5 74 000 SEQ ID NO: 130 *Calculation based on reaction conditions in which [I0]/[E0] < 5 * SI
TABLE-US-00020 TABLE XVII Comparison of Stoichiometry Inhibition values and second-order rate constants (ka) for the reaction of AT variants with hK14. Selecteda Clone Substrate Peptide SI ka M-1 s-1 AATWT 1.0 263 000 AATG1 vGSLR↓ 3.6 168 00* SEQ ID NO: 118 AATG1g vGSLR↓G 2.3 257 000* SEQ ID NO: 141 AATG1v VGSLR↓ -- -- SEQ ID NO: 118 AATC11 R↓QTNd 2.8 63 000* SEQ ID NO: 119 AATC11g gR↓QTNd 9 42 000* SEQ ID NO: 139 AATE5 NQR↓SS 10 28 000* SEQ ID NO: 120 AATE8 LQR↓AI 7.4 242 000* SEQ ID NO: 121 AATE11 QRLR↓D -- -- SEQ ID NO: 122 AATF3 PDR↓HM 11.7 13 000* SEQ ID NO: 123 AATG9 TVDY↓A 1.2 217 000 SEQ ID NO: 130 *Calculation based on reaction conditions in which [I0]/[E0] < 5 * SI
[0240] A panel of enzymes including trypsin, human neutrophil elastase, chymotrypsin, plasma kallikrein (PK), urokinase (uPA), and thrombin were screened to determine inhibitory specificity of ACT and AAT variants with a SI for hK14 lower than 10 (Table XVIII). When incubated for 30 min with an excess of inhibitor ([I]o/[E]o of 50:1), hK14 is completely inhibited (100%). Under this condition, wild type ACT showed only 17% inhibition activity toward hK14 contrary to AATwt (100% of inhibition). Among the ACT variants, two (rACTC11 and rACTC11D) show specificity to hK14, inhibiting no other tested enzymes apart from trypsin and chymotrypsin. For AAT variants, these new inhibitors clearly exhibited a higher specificity toward hK14 than AATwt. AATG9 demonstrated to be highly specific to hK14, showing no reactivity with any trypsin-like proteases.
TABLE-US-00021 TABLE XVIII Inhibitory profile of ACTWT, AATWT and its variants. ACTC11 ACTC11D ACTE8 ACTWT AATG1 AATG1g AATC11 AATE8 AATG9 AATWT Protease % Inhibition HK14 100 100 100 17 100 100 100 100 100 100 Trypsin 100 100 100 0 100 100 100 100 0 100 Chtr 84 83 14 100 27 17 18 19 100 100 PK 0 0 36 46 100 100 8 100 0 17 HNE 0 0 0 26 0 0 0 0 0 100 Urokinase 0 0 0 0 17 0 0 0 0 0 Trombin 0 0 0 18 51 0 100 0 0 4 a Serpins and proteases were incubated for 30 min at 37° C. at a [I]o/[E]o ratio of 50:1. Percent inhibition correspond to 100 × (1 - (velocity in presence of inhibitor/velocity of uninhibited control).
[0241] Additional hK14 inhibiting ACT variants were screened against a larger panel of tissue kallikreins related to hK14. Partial inhibition was observed against different subsets of tested kallikreins.
TABLE-US-00022 TABLE XIX ACTG1 ACTG1g ACTC11g ACTE5 ACTF11 % Inhibitiona Protease hK2 15 0 25 0 25 hK4 0 0 0 75 45 hK5 50 10 5 10 15 hK6 20 0 0 0 0 hK8 0 0 0 10 0 aProtease and serpins were incubated for 30 min at 37° C. (90 min at 37° for PSA) at a [I]o/[E]o ratio of 50:1. Percent inhibition correspond to 100 × (1- (velocity in presence of inhibitor/velocity of uninhibited control)).
[0242] The permutation of RSL cleavage site for hK14 phage display selected substrates has changed wild type serpins (ACT and AAT) into highly sensitive inhibitors for hK14, especially AATG9 showing a unique reactivity. To Applicants knowledge, this is the first report describing the development of a specific inhibitor for hK14. The fact that some recombinant inhibitors also inhibited other enzymes than hK14 is not surprising because of the homology of substrate between trypsin-like proteases. Moreover, the velocity of reaction should be determined for recombinant inhibitors toward other enzymes.
TABLE-US-00023 TABLE XX Acanthosis Nigricans, Bacterial Mouth Infections, Confluent and Reticulated Acne Conglobata, Balanitis Circumscripta Papillomatosis, Acne Fulminans, Plasmacellularis, Congenital Hypertrichosis Acne Keloidalis Nuchae, Balanitis Xerotica Obliterans, Lanuginosa, Acne Vulgaris, Balanoposthitis, Congenital Nevi, Acneiform Eruptions, Basal Cell Carcinoma, Congenital Onychodystrophy of Acquired Digital Fibrokeratoma, Basic Excisional Surgery, the Index Fingers, Acquired Progressive Becker Melanosis, Congenital Patterned Lymphangioma Bedbug Bites, Leukodermas, Acrochordon, Behcet Disease, Connective Tissue Nevus, Acrodermatitis Chronica Berloque Dermatitis, Contact Dermatitis, (Allergic), Atrophicans, Birt-Hogg-Dube Syndrome, Contact Dermatitis, (Irritant), Acrodermatitis Enteropathica, Black Heel (Calcaneal Contact Stomatitis, Acrodynia, Petechiae), Corns, Acrokeratoelastoidosis, Black Widow Spider Bite, Cosmeceuticals, Acrokeratosis Neoplastica, Bloom Syndrome (Congenital Cosmetics, Acrokeratosis Verruciformis of Telangiectatic Erythema), Cowden Disease (Multiple Hopf, Blue Nevi, Hamartoma Syndrome), Acromegaly, Blue Rubber Bleb Nevus Cowpox Infection, Human, Acropustulosis of Infancy, Syndrome, CREST Syndrome, Actinic Keratosis, Botanical Dermatology, Cronkhite-Canada Syndrome, Actinic Prurigo, Botulinum Toxin, Crouzon Syndrome, Actinic Purpura, Boutonneuse Fever, Cryotherapy, Actinomycosis, Bowen Disease, Cutaneous CD30+ (Ki-1) Acute Febrile Neutrophilic Bowenoid Papulosis, Anaplastic Large-Cell Lymphoma, Dermatosis, Branchial Cleft Cyst, Acute Hemorrhagic Edema of Bromhidrosis, Cutaneous Cholesterol Emboli, Infancy, Brown Recluse Spider Bite, Cutaneous Columnar Cysts, Addison Disease, Bruton Agammaglobulinemia, Cutaneous Cryptococcus, Adiposis Dolorosa, Bullous Disease of Diabetes, Cutaneous Ectopic Brain, Advancement Flaps, Bullous Disease of Dialysis, Cutaneous Horn, Ainhum, Bullous Pemphigoid, Cutaneous Kikuchi Disease, Albinism, Burns, Chemical, Cutaneous Larva Migrans, Albright Syndrome, Burns, Electrical, Cutaneous Laser Resurfacing: Alezzandrini Syndrome, Buruli Ulcer, Carbon Dioxide, Alopecia Areata, Calcinosis Cutis, Cutaneous Laser Resurfacing: Alopecia Mucinosa, Calciphylaxis, Erbium:YAG, Amyloidosis, Lichen, Cancers of the Oral Mucosa, Cutaneous Manifestations Amyloidosis, Macular, Candidiasis, Chronic Following Exposures to Marine Amyloidosis, Nodular Localized Mucocutaneous, Life, Cutaneous, Candidiasis, Cutaneous, Cutaneous Manifestations of Amyloidosis, Primary Systemic, Candidiasis, Mucosal, Cholesterol Embolism, Anagen Effluvium, Capillary Malformation, Cutaneous Manifestations of Anatomy in Cutaneous Surgery, Carney Syndrome, Hepatitis C, Androgenetic Alopecia, Carotenemia, Cutaneous Manifestations of HIV Anetoderma, Catscratch Disease, Disease, Angina Bullosa Hemorrhagica, Cellulitis, Cutaneous Manifestations of Angioedema, Acquired, Chancroid, Smoking, Angioedema, Hereditary, Chediak-Higashi Syndrome, Cutaneous Melanoacanthoma, Angioendotheliomatosis, Cheek Reconstruction, Cutaneous T-Cell Lymphoma, Angioimmunoblastic Cheilitis Glandularis, Cutaneous Tuberculosis, Lymphadenopathy With Cheilitis Granulomatosa Cutis Laxa (Elastolysis), Dysproteinemia, (Miescher-Melkersson-Rosenthal Cutis Marmorata Telangiectatica Angiokeratoma Circumscriptum, Syndrome), Congenita, Angiokeratoma Corporis Chemical Peels, Cutis Verticis Gyrata, Diffusum (Fabry Syndrome), Chemotherapy-Induced Oral Cylindroma, Angiokeratoma of the Scrotum, Mucositis, Dabska Tumor Angiolymphoid Hyperplasia with Cherry Hemangioma, de Lange Syndrome, Eosinophilia, Chickenpox, Degos Disease, Angioma Serpiginosum, CHILD Syndrome, Delusions of Parasitosis, Animal Bites, Childhood HIV Disease, Dengue, Aphthous Stomatitis, Chondrodermatitis Nodularis Denture Stomatitis, Aplasia Cutis Congenita, Helicis, Dermabrasion, Apocrine Hidrocystoma, Chromhidrosis, Dermal Fillers, Arcanobacterium Haemolyticum, Chromoblastomycosis Dermatitis Artefacta, Argyria, Chronic Granulomatous Disease, Dermatitis Herpetiformis, Arsenical Keratosis, Churg-Strauss Syndrome Dermatofibroma, Aspergillosis, (Allergic Granulomatosis), Dermatofibrosarcoma Asteatotic Eczema, Cicatricial Pemphigoid, Protuberans, Asymmetric Periflexural Clavus, Dermatofibrosis Lenticularis Exanthem of Childhood, Closure of Complicated Wounds, (Buschke-Ollendorf Syndrome), Ataxia-Telangiectasia, Clubbing of the Nails, Dermatologic Aspects of Atopic Dermatitis, Cobb Syndrome, Bioterrorism Agents, Atrophia Maculosa Varioliformis Coccidioidomycosis, Dermatologic Aspects of Cutis, Cockayne Syndrome, Bioterrorism Agents, Anthrax, Atrophoderma of Pasini and Cold Panniculitis, Dermatologic Manifestations of Pierini, Colloid Milium, Cardiac Disease, Atypical Fibroxanthoma, Common Variable Dermatologic Manifestations of Atypical Mole (Dysplastic Nevus), Immunodeficiency, Gastrointestinal Disease, Atypical Mycobacterial Diseases, Complement Receptor Dermatologic Manifestations of Avitaminosis A, Deficiency, Hematologic Disease, Axillary Granular Parakeratosis, Complications of Dermatologic Dermatologic Manifestations of Bacillary Angiomatosis, Laser Surgery, Neurologic Disease, Digital Mucous Cyst, Florid Cutaneous Papillomatosis Dermatologic Manifestations of Digital Photography, Focal Dermal Hypoplasia Pulmonary Disease, Dilated Pore of Winer, Syndrome, Dermatologic Manifestations of Disseminate and Recurrent Fogo Selvagem, Renal Disease, Infundibular Folliculitis, Follicular Infundibulum Tumor, Dermatology Internet Sites, Down Syndrome, Folliculitis, Dermatomyositis, Drug Eruptions, Folliculoma, Dermatopathia Pigmentosa Drug-Induced Bullous Disorders, Forehead and Temple Reticularis, Drug-Induced Gingival Reconstruction, Dermatosis Papulosa Nigra, Hyperplasia, Fox-Fordyce Disease, Dermoid Cyst, Drug-Induced Photosensitivity, Friction Blisters, Dermoscopy, Drug-Induced Pigmentation, Frostbite, Desmoid Tumor, DiGeorge Drug-Induced Pseudolymphoma Gardner Syndrome Syndrome, Syndrome, Generalized Essential Intertrigo Dupuytren Contracture, Telangiectasia Jellyfish Stings Dyshidrotic Eczema, Geographic Tongue Jessner Lymphocytic Infiltration Dyskeratosis Congenita, Gianotti-Crosti Syndrome of the Skin Dysmorphophobia, (Papular Acrodermatitis of Job Syndrome Ear Reconstruction, Childhood) Juvenile Xanthogranuloma Eccrine Carcinoma, Giant Condylomata Acuminata of (Nevoxanthoendothelioma) Eccrine Spiradenoma, Buschke and Lowenstein Kaposi Sarcoma Ecthyma, Glomus Tumor Kaposi Varicelliform Eruption Ecthyma Gangrenosum, Glucagonoma Syndrome Kawasaki Disease Ectodermal Dysplasia, Glycogen Storage Diseases Keloid and Hypertrophic Scar Ehlers-Danlos Syndrome, Types I-VII Keratoacanthoma Elastofibroma, Gonococcemia Keratosis Follicularis (Darier Elastosis Perforans Graft Versus Host Disease Disease) Serpiginosum, Graham-Little-Piccardi-Lasseur Keratosis Palmaris et Plantaris Elejalde Syndrome, Syndrome Keratosis Pilaris Endemic Syphilis, Gram-Negative Folliculitis Kimura Disease Enteroviral Infections, Gram-Negative Toe Web Kindler Syndrome Eosinophilia-Myalgia Syndrome, Infection Klippel-Trenaunay-Weber Eosinophilic Fasciitis, Granuloma Annulare Syndrome Eosinophilic Pustular Folliculitis, Granuloma Faciale Knuckle Pads Eosinophilic Ulcer, Granuloma Gluteale Infantum Kyrie Disease Ephelides (Freckles), Granuloma Inguinale Langerhans Cell Histiocytosis Epidermal Inclusion Cyst, (Donovanosis) Laser Revision of Scars Epidermal Nevus Syndrome, Granulosis Rubra Nasi Laser Treatment of Acquired and Epidermodysplasia Verruciformis, Griscelli Syndrome Congenital Vascular Lesions Epidermolysis Bullosa, Haberland Syndrome Hair Transplantation Laser Treatment of Benign Epidermolysis Bullosa Acquisita, Hair Transplantation: Follicular Pigmented Lesions Epidermolytic Hyperkeratosis Unit Transplant Method Laser Treatment of Leg Veins (Bullous Congenital Hairy Tongue Laser-Assisted Hair Removal Ichthyosiform Erythroderma), Halo Nevus Laugier-Hunziker Syndrome Epulis Fissuratum, Halogenoderma Lawrence-Seip Syndrome Eruptive Vellus Hair Cysts, Hand-Foot-and-Mouth Disease Leiomyoma Erysipelas, Handheld Computers in Leishmaniasis Erysipeloid, Dermatology Lentigo Erythema Ab Igne, Hartnup Disease LEOPARD Syndrome Erythema Annulare Centrifugum, Hemochromatosis Leprosy Erythema Dyschromicum Henoch-Schonlein Purpura Leukemia Cutis Perstans, (Anaphylactoid Purpura) Leukoplakia, Oral Erythema Elevatum Diutinum, Hermansky-Pudlak Syndrome Lice Erythema Gyratum Repens, Herpes Simplex Lichen Myxedematosus Erythema Induratum (Nodular Herpes Zoster Lichen Nitidus Vasculitis), Hidradenitis Suppurativa Lichen Planus Erythema Infectiosum (Fifth Hirsutism Lichen Sclerosus et Atrophicus Disease), Homocystinuria Lichen Simplex Chronicus Erythema Multiforme, Human Bites Lichen Spinulosus Erythema Nodosum, Human Herpesvirus 6 Lichen Striatus Erythema Toxicum Neonatorum Hutchinson-Gilford Progeria Linear IgA Dermatosis Erythrasma, Hydroa Vacciniforme Lip Reconstruction Erythroderma (Generalized Hypereosinophilic Syndrome Lipodystrophy, HIV Exfoliative Dermatitis), Hyperhidrosis Lipodystrophy, Localized Erythrokeratodermia Variabilis, Hyperkeratosis Lenticularis Lipodystrophy, Progressive Erythroplasia of Queyrat (Bowen Perstans (Flegel Disease) Lipoid Proteinosis Disease of the Glans Penis), Hyperkeratosis of the Nipple and Lipomas Erythropoietic Porphyria, Areola Liposarcoma Erythropoietic Protoporphyria, Hypersensitivity Vasculitis Livedoid Vasculopathy Essentials of Tissue Movement, (Leukocytoclastic Vasculitis) Lobomycosis Eumycetoma (Fungal Mycetoma), Hypnosis: Applications in Local Anesthesia and Regional Dermatology and Dermatologic Nerve Block Anesthesia Extracorporeal Photopheresis, Surgery Loose Anagen Syndrome Extramammary Paget Disease, Hypomelanosis of Ito Lupus Erythematosus, Acute Familial Benign Pemphigus Ichthyosis Fetalis Lupus Erythematosus, Bullous (Hailey-Hailey Disease), Ichthyosis Vulgaris, Hereditary Lupus Erythematosus, Discoid Favre-Racouchot Syndrome and Acquired Lupus Erythematosus, Drug- (Nodular Elastosis with Cysts Ichthyosis, Lamellar Induced and Comedones), Ichthyosis, X-Linked Lupus Erythematosus, Subacute Favus, Id Reaction (Autoeczematization) Cutaneous Fibrodysplasia Ossificans, Lupus Miliaris Disseminatus Fibrous Papule of the Face, Idiopathic Guttate Faciei Filariasis, Hypomelanosis Lyme Disease Fire Ant Bites, Impetigo Lymphangiectasia Fissured Tongue, Incontinentia Pigmenti Lymphangioma Materials for Wound Closure Infantile Digital Fibromatosis Lymphocytoma Cutis Measles, Rubeola Infantile Hemangioma Lymphogranuloma Venereum Melanotic Neuroectodermal Insect Bites Lymphomatoid Papulosis Tumor of Infancy Insect Repellents Maffucci Syndrome Melasma Interactive Teledermatology Majocchi Granuloma Meningococcemia Oral Examination Malakoplakia Menkes Kinky Hair Disease Oral Fibromas and Fibromatoses Malignant Melanoma Merkel Cell Carcinoma Mastocytosis Metastatic Carcinoma of the Skin Oral Florid Papillomatosis Postinflammatory Oral Frictional Hyperkeratosis Hyperpigmentation Metastatic Neoplasms to the Oral Granular Cell Tumors Preauricular Sinuses Oral Cavity Oral Hemangiomas Premalignant Fibroepithelial Microcystic Adnexal Carcinoma Oral Lichen Planus Tumor (Pinkus Tumor) Milia Oral Lymphangiomas Preoperative Evaluation and Miliaria Oral Malignant Melanoma Management Milker's Nodules Oral Manifestations of Pretibial Myxedema Mixed Connective Tissue Autoimmune Blistering Diseases Proliferating Pilar Tumor Disease Oral Manifestations of Drug Protein-Energy Malnutrition Mohs Micrographic Surgery Reactions Proteus Syndrome Moisturizers Oral Manifestations of Systemic Protothecosis, Cutaneous Molluscum Contagiosum Diseases Prurigo Nodularis Mondor Disease Oral Melanoacanthoma Pruritic Urticarial Papules and Mongolian Spot Oral Neurofibroma Plaques of Pregnancy Monilethrix Oral Nevi Pruritus and Systemic Disease Monkeypox Oral Pyogenic Granuloma Pseudo-Kaposi Sarcoma Morphea Oral Submucous Fibrosis (Acroangiodermatitis) Mucocele and Ranula Orf Pseudoatrophoderma Colli Mucopolysaccharidoses Types I- Osler-Weber-Rendu Syndrome Pseudocyst of the Auricle VII Osteoma Cutis Pseudofolliculitis of the Beard Mucous Cyst Outpatient Surgical Suite Pseudolymphoma, Cutaneous Muehrcke Lines of the Pachydermoperiostosis Pseudomonas Folliculitis Fingernails Pachyonychia Congenita Pseudopelade, Brocq Muir-Torre Syndrome Paget Disease, Mammary Pseudoporphyria Multicentric Reticulohistiocytosis Papular Urticaria Pseudoxanthoma Elasticum Multinucleate Cell Papulonecrotic Tuberculids Psoriasis, Guttate Angiohistiocytoma Paraneoplastic Diseases Psoriasis, Nails Multiple Endocrine Neoplasia Parapsoriasis Psoriasis, Plaque Type 1 Paronychia Psoriasis, Pustular
Mycetoma Pearly Penile Papules Psoriatic Arthritis Mycobacterium Avium- Pedicle/Interpolation Flaps Pulp Polyp Intracellulare Infection Pellagra Punch Biopsy and Scalpel Mycobacterium Marinum Pemphigoid Gestationis Biopsy Infection of the Skin Pemphigus Erythematosus Pyoderma Gangrenosum Naegeli-Franceschetti- Pemphigus Foliaceus Pyoderma Vegetans Jadassohn Syndrome Pemphigus Herpetiformis Pyogenic Granuloma (Lobular Nail Cosmetics Pemphigus Vulgaris Capillary Hemangioma) Nail Surgery Pemphigus, Drug-Induced Reactive Arthritis Nail-Patella Syndrome Pemphigus, IgA Reactive Perforating Nasal Reconstruction Pemphigus, Paraneoplastic Collagenosis Nasopalatine Duct Cyst Penile Squamous Cell Refsum Disease Necrobiosis Lipoidica Carcinoma Relapsing Polychondritis Necrolytic Acral Erythema Perforating Folliculitis Reticulate Pigmented Anomaly Necrotizing Fasciitis Perifolliculitis Capitis Abscedens Rhinoscleroma Necrotizing Sialometaplasia Et Suffodiens Riehl Melanosis Neonatal Lupus Erythematosus Perioral Dermatitis Rocky Mountain Spotted Fever Nephrogenic Fibrosing Peripheral Giant Cell Granuloma Rosacea Dermopathy Pernio Roseola Infantum Neurilemoma Peyronie Disease Rotation Flaps Neurofibromatosis Phenylketonuria Rothmund-Thomson Syndrome Neurotic Excoriations Photodynamic Therapy for the Rubella Neutrophilic Eccrine Hidradenitis Dermatologist Rubinstein-Taybi Syndrome Nevi of Ota and Ito Phytophotodermatitis Rud Syndrome Nevi, Melanocytic Piebaldism Sarcoidosis Nevoid Basal Cell Carcinoma Piedra Scabies Syndrome Piezogenic Pedal Papules Scalp Reconstruction Nevus Anemicus Pigmented Purpuric Dermatitis Scar Revision Nevus Araneus (Spider Nevus) Pilar Cyst Scarlet Fever Nevus Comedonicus Pilomatrixoma Schnitzler Syndrome Nevus Sebaceus Pitted Keratolysis Scleredema Nicotine Stomatitis Pityriasis Alba Sclerema Neonatorum Niemann-Pick Disease Pityriasis Lichenoides Scrub Typhus Nijmegen Breakage Syndrome Pityriasis Rosea Scurvy Nocardiosis Pityriasis Rotunda Seabather's Eruption Nonablative Resurfacing Pityriasis Rubra Pilaris Sebaceous Adenoma Noncandidal Fungal Infections of Pityrosporum Folliculitis Sebaceous Carcinoma the Mouth Plantar Fibromatosis Sebaceous Hyperplasia Nonlaser Hair Removal POEMS Syndrome Seborrheic Dermatitis Techniques Poikiloderma of Civatte Seborrheic Keratosis Nummular Dermatitis Polymorphous Light Eruption Severe Combined Ochronosis Porokeratosis Immunodeficiency Onchocerciasis (River Poroma Sign of Leser-Trelat Blindness) Porphyria Cutanea Tarda Sjogren Syndrome Onycholysis Urticaria, Cholinergic Sjogren-Larsson Syndrome Onychomycosis Urticaria, Chronic Skin and Hair Cleansers Oral Brush Biopsy With Urticaria, Contact Syndrome Skin Grafting Computer-Assisted Analysis Urticaria, Dermographism Skin Lightening and Oral Cutaneous Fistulas Urticaria, Pressure Depigmenting Agents Smokeless Tobacco Lesions Urticaria, Solar Smallpox Smoker's Melanosis Urticarial Vasculitis Transposition Flaps South American Blastomycosis Varicose Vein Treatment with Traumatic Ulcers Speckled Lentiginous Nevus Endovenous Laser Therapy Trichilemmoma Spitz Nevus Varicose Veins and Spider Veins Trichoepithelioma Sporotrichosis Varicose Veins Treated with Trichofolliculoma Squamous Cell Carcinoma Ambulatory Phlebectomy Trichomycosis Axillaris Staphylococcal Scalded Skin Varicose Veins Treated with Trichomycosis Pubis Syndrome Radiofrequency Ablation Trichorrhexis Invaginata Stasis Dermatitis Therapy (Netherton Syndrome or Bamboo Steatocystoma Multiplex Variegate Porphyria Hair) Stevens-Johnson Syndrome and Venous Insufficiency Trichorrhexis Nodosa Toxic Epidermal Necrolysis Venous Lakes Trichostasis Spinulosa Stewart-Treves Syndrome Verruciform Xanthoma Trichotillomania Store-and-Forward Verrucous Carcinoma Tuberous Sclerosis Teledermatology Vesicular Palmoplantar Eczema Tufted Angioma Striae Distensae Vibrio Vulnificus Infection Tufted Hair Folliculitis Strongyloidiasis Viral Hemorrhagic Fevers Tumescent Liposuction Stucco Keratosis Viral Infections of the Mouth Tungiasis Subacute Nodular Migratory Vitiligo Ulerythema Panniculitis (Vilanova Disease) Vogt-Koyanagi-Harada Unilateral Nevoid Telangiectasia Subcorneal Pustular Dermatosis Syndrome Urticaria, Acute Subcutaneous Fat Necrosis of Vohwinkel Syndrome Transient Neonatal Pustular the Newborn Waardenburg Syndrome Melanosis Sunscreens and Photoprotection Warts, Genital Tinea Corporis Supernumerary Digit Warts, Nongenital Supernumerary Nipple Warty Dyskeratoma Surgical Complications Wegener Granulomatosis Surgical Dressings Wells Syndrome (Eosinophilic Suturing Techniques Cellulitis) Syphilis Werner Syndrome Syringoma Winchester Syndrome Systemic Sclerosis Wiskott-Aldrich Syndrome Targetoid Hemosiderotic Xanthomas Hemangioma Xeroderma Pigmentosum Tattoo Lasers Yaws Tattoo Reactions Tinea Cruris Teledermatology Tinea Faciei Telogen Effluvium Tinea Nigra Temporal (Giant Cell) Arteritis Tinea Pedis The Role of Antibiotics in Tinea Versicolor Cutaneous Surgery Tooth Discoloration The Role of Sentinel Node Toxic Shock Syndrome Biopsy in Skin Cancer Traction Alopecia Thermal Burns Transient Acantholytic Thrombophlebitis Dermatosis Tinea Barbae Tinea Capitis
Example 4
[0243] A potential therapeutic effect of MDPK67b (rACT6.7) on skin diseases has been tested on a Netherton syndrome mouse model as a topical application.
Trial Design
[0244] The molecule has been formulated at 2 mg/ml in NATROSOL® (hydroxyethylcellulose (HEC)) 2% (w/v). The formulation has been chosen following in vitro diffusion criteria retaining MDPK67b inhibition property over trypsin (surrogate in vitro substrate). MDPK67b 2 mg/ml, prepared as a solution, is formulated in 2% NATROSOL® (hydroxyethylcellulose (HEC)) (w/v), PBS1×pH7.4 at 4° C. under slow agitation to prevent molecule shearing. The preparation is carefully homogenized under stirring at 4° C. to ensure proper inhibitor repartition within the hydrogel. NATROSOL® (hydroxyethylcellulose (HEC)) has to be added as a powder to MDPK67b solution to avoid clumps and to allow a homogenous formulation without shearing. To maintain sterility the solutions are autoclaved or filtered through a 0.22 u filter.
[0245] MDPK67b 2 mg/ml/Hydroxyethylcellulose formulation contains 4 mg MDPK67b, 2 ml PBS 1× pH7.4 and 0.04 g NATROSOL® (hydroxyethylcellulose (HEC)). The formulation is then stored at 4° C. or lyophilized overnight and stored at -20° C. Protease inhibition properties of MDPK67b are tested in vitro upon formulation before in vivo use.
[0246] MDPK67b potential therapeutic effect has been assessed on a group of 12 transgenic KLK5 mice with different lesion grade severity, starting from a low severity grade (grade 1) to a more severe grade (grade 4) (FIG. 30). Group 1 has been treated once per day with 0.3 ml of vehicle, 2% NATROSOL® (hydroxyethylcellulose (HEC)) and group 2 once per day with 0.3 ml of MDPK67b formulated at 2 mg/ml in 2% NATROSOL® (hydroxyethylcellulose (HEC)) over 28 days. This time period corresponds to two epiderma renewals in the mouse model.
[0247] Mice have been monitored for changes in lesion grade and lesion size phenotypes. Lesion size has been measured every 3 days and lesion grade was monitored daily
Results (FIG. 31)
[0248] Comparison of the development of skin lesions on KLK5 transgenic mice of MDPK67b treated versus non-treated mice showed a decrease of lesion sizes within the MDPK67b group (group 2) compared to vehicle group (group 1). Whereas lesion sizes increased in a majority of the vehicle control group, the majority of the MDPK67b treated group showed a decrease in lesion size. A clear size increase was observed in 3 test animals of group1 and 1 within group 2. A slight lesion size increase was observed 1 animal of group 2. No change was reported in 1 animal of group 1. A decrease in lesion size was observed in 1 test animals of group1 and 3 within group 2. The protective effect seems larger in mice with low grade symptoms.
TABLE-US-00024 TABLE XXI Group 1 Group 2 Lesion size evolution (control) (MDPK67b ) evolution 3 1 slight evolution 0 1 stable 1 0 decrease 1 3
[0249] Lesion grade development was also positively affected by topical application of MDPK67b. One MDPK67b treated test animal showed a complete reversion of the phenotype. A partial reversion was seen on a second MDPK67b treated animal. The protective effect seems larger in mice with low grade symptoms.
REFERENCE LIST
[0250] Barrett. In: Proteinase Inhibitors. Ed. Barrett, A. J. et al, Elsevier, Amsterdam, pages 3-22 (1986)
[0251] Blasi. In: Human Genes and Diseases. Ed. Blasi, F., John Wiley & Sons, Ltd., pages 377-414 (1986)
[0252] Borgono et al. Cancer Res. 63, 9032-9041 (2003)
[0253] Borgono et al. J. Biol. Chem 282(6):3640-52 (2007)
[0254] Brattsand and Egelrud. J. Biol. Chem. 274, 30033-40 (1999)
[0255] Brattsand et al. J Invest Dermatol. 124, 198-203 (2005)
[0256] Carrell et al. Trends Biochem Sci. 10:20-24 (1985)
[0257] Carrell et al. Cold Spring Harbor Symp Quant Biol. 52:527-35 (1987)
[0258] Caubet et al. J. Invest Dermatol. 122, 1235-1244 (2004)
[0259] Chavanas et al. Nat. Genet. 25, 141-142 (2000)
[0260] Cloutier et al. Eur J Biochem 271, 607-613 (2004)
[0261] Cloutier et al. Eur J Biochem. 269, 2747-2754 (2002)
[0262] Cooley et al. Biochemistry 40, 15762-70 (2001)
[0263] Deraison et al. Mol Biol Cell. 18(9):3607-19 (2007).
[0264] Descargues et al. J Invest Dermatol. 126(7):1622-32 (2006)
[0265] Descargues et al. Nat Genet. 37(1):56-65 (2005)
[0266] Egelrud et al. Br. J. Dermatol. 153, 1200-1203(2005)
[0267] Ekholm and Egelrud. Arch Dermatol Res. 291, 195-200. (1999)
[0268] Felber et al. Biol Chem. 386(3):291-8 (2005)
[0269] Felber et al. Biotechniques 36, 878-885 (2004)
[0270] Felber et al. FEBS J. 273(11):2505-14 (2006)
[0271] Frenette et al. Biochim Biophys Acta 1334, 109-115 (1997)
[0272] Frenette et al. J Urol 159, 1375-8 (1998)
[0273] Gerard et al. Mol Biol Med. 2:449-457 (1986)
[0274] Hachem et al. J. Invest Dermatol. 126, 1609-1621 (2006)
[0275] Hansson et al. J. Biol. Chem. 269, 19420-19426 (1994)
[0276] Hansson et al. J. Invest Dermatol. 118, 444-449. (2002)
[0277] Huang et al. Oncol Res. 14, 387-397. (2004).
[0278] Hunt and Dayhoff. Biochem Biophys Res Commun 95(2):864-71 (1980)
[0279] Kapadia. Clin Chem 49, 77-86 (2003)
[0280] Ketcham et al. In: Atlas of Protein Sequence and Structure. Ed. Dayhoff, pages 131-143 (1978)
[0281] Kishi et al. Clin Chem 49, 87-96 (2003)
[0282] Kishibe et al. J. Biol. Chem. 282(8):5834-41 (2007)
[0283] Komatsu et al. Br. J. Dermatol. 153, 274-281 (2005)
[0284] Komatsu et al. J. Invest Dermatol. 118, 436-443. (2002)
[0285] Komatsu et al. J. Invest Dermatol. 125, 1182-1189. (2005)
[0286] Komatsu et al. J. Invest Dermatol. 126, 2338-2342. (2006)
[0287] Kraut et al. Z Physiol Chem 192: 1-21 (1930)
[0288] Laemmli Nature 227, 680-5 (1970)
[0289] Laskowski et al. Annu Rev Biochem. 49:593-626 (1980)
[0290] Laskowski et al. Cold Spring Harbor Symp Quant Biol. 545-553 (1987)
[0291] Levin et al. Proc Natl Acad Sci USA. 80:6804-6808 (1983)
[0292] Little et al. J Biol Chem 272, 25135-25142 (1997)
[0293] Lowman et al. Biochemistry 12, 10832-8 (1991)
[0294] Luo et al. Clin. Chem. 47, 237-246 (2001)
[0295] Mahajan et al. Chem Biol 6, 401-9
[0296] Mitra et al. Gene 173, 13-17 (1996)
[0297] Mize et al. Mol Cancer Res. 6(6):1043-51. 2008
[0298] Morrison and Walsh. Adv Enzymol Relat Areas Mol Biol 61, 201-301 (1988)
[0299] Nin et al. J Dermatol Sci. 2008 (2008).
[0300] Oikonomopoulou et al. J. Biol. Chem. 281, 32095-32112. (2006).
[0301] Paine et al. J. Invest. Dermatol. 116, 587-595. (2001).
[0302] Papamokos et al. J Mol Biol. 158(3):515-37 (1982)
[0303] Potempa et al. J Biol Chem. 269(23):15957-60 (1994)
[0304] Read, R. J. et al, In: Proteinase Inhibitors. Ed. Barrett, Elsevier, Amsterdam, pages 301-336 (1986)
[0305] Remold-O'Donnell. FEBS Lett. 315(2):105-8 (1993)
[0306] Shimizu et al. J Biol Chem 273, 11189-11196 (1998)
[0307] Smith and Scott. Methods Enzymol. 217, 228-57 (1993)
[0308] Sommer et al. Biochemistry. 26(20):6407-10 (1987)
[0309] Sondell et al. J. Invest Dermatol. 104, 819-823. (1995)
[0310] Sprecher et al. J. Invest Dermatol. 117, 179-187(2001)
[0311] Sprengers et al. Blood. 69(2):381-7 (1987)
[0312] Stefansson et al. Biol. Chem. 387, 761-768 (2006)
[0313] Stefansson et al. J Invest Dermatol. 128(1):18-25 (2008)
[0314] Stump et al. J Biol Chem. 261(27):12759-66 (1986)
[0315] Suzuki et al. J Biol Chem. 262(2):611-6 (1987)
[0316] Travis et al. Annu Rev Biochem. 52:655-709 (1983)
[0317] Vandell et al. J Neurochem. 107(3):855-70 (2008)
[0318] Voegeli et al. Int. J. Cosm. Sci. 29, 191-200. (2007).
[0319] Werle. Biochem Z. 269:415-34.
[0320] Yamasaki et al. LFASEB J. 20, 2068-2080. (2006)
[0321] Yousef et al. Cancer Res 63, 3958-3965 (2003)
Sequence CWU
1
1
16311239DNAArtificial SequenceSynthetic 1atgagaggat cccatcacca tcaccatcac
tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa ccaagaccga
gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt cagcctgtac
aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact gagcatctcc
accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga gattctcaaa
ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag cttccagcac
ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg aaatgccatg
tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa gaggctgtat
ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa gctcatcaac
gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga ccttgactcg
cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga gatgcccttt
gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg ggtaatggtg
cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga gctgtcctgc
accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct ccctgatcaa
gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg gtggagagac
tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat ctcgagggac
tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac cagcaaggct
gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt ccataaggct
gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt caaaatcacc
ctccgttctc gagcagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc cttcctgatg
atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac caatcccaag
caagcctaa 12392412PRTArtificial
SequenceSynthetic 2Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Thr Leu Arg Ser Arg Ala Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
31239DNAArtificial SequenceSynthetic 3atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcacc aggaggtcta tcgatgtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 12394412PRTArtificial
SequenceSynthetic 4Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Thr Arg Arg Ser Ile Asp Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
51239DNAArtificial SequenceSynthetic 5atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcagg gggagatctg agttagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 12396412PRTArtificial
SequenceSynthetic 6Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Arg Gly Arg Ser Glu Leu Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
71239DNAArtificial SequenceSynthetic 7atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcaag cttagaacaa cattagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 12398412PRTArtificial
SequenceSynthetic 8Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Lys Leu Arg Thr Thr Leu Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
91239DNAArtificial SequenceSynthetic 9atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcatg acaagatcta acgcagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 123910412PRTArtificial
SequenceSynthetic 10Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Met Thr Arg Ser Asn Ala Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
111239DNAArtificial SequenceSynthetic 11atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcacc gagcgtgtct cgcccgtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 123912412PRTArtificial
SequenceSynthetic 12Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Thr Glu Arg Val Ser Pro Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
131239DNAArtificial SequenceSynthetic 13atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcacc tttagatctg cattagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 123914412PRTArtificial
SequenceSynthetic 14Met Arg Gly Ser His His His His His His Ser Arg His
Pro Asn Ser 1 5 10 15
Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr
20 25 30 His Val Asp Leu
Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser 35
40 45 Leu Tyr Lys Gln Leu Val Leu Lys Ala
Pro Asp Lys Asn Val Ile Phe 50 55
60 Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser
Leu Gly Ala 65 70 75
80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu
85 90 95 Thr Glu Thr Ser
Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu 100
105 110 Arg Thr Leu Asn Gln Ser Ser Asp Glu
Leu Gln Leu Ser Met Gly Asn 115 120
125 Ala Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe
Thr Glu 130 135 140
Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145
150 155 160 Asp Ser Ala Ala Ala
Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly 165
170 175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys
Asp Leu Asp Ser Gln Thr 180 185
190 Met Met Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu
Met 195 200 205 Pro
Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu Ser Lys 210
215 220 Lys Lys Trp Val Met Val
Pro Met Met Ser Leu His His Leu Thr Ile 225 230
235 240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr
Val Val Glu Leu Lys 245 250
255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys
260 265 270 Met Glu
Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg Trp 275
280 285 Arg Asp Ser Leu Glu Phe Arg
Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290 295
300 Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile
Leu Leu Gln Leu 305 310 315
320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr
325 330 335 Gly Ala Arg
Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu 340
345 350 Asp Val Phe Glu Glu Gly Thr Glu
Ala Ser Ala Ala Thr Ala Val Lys 355 360
365 Ile Thr Phe Arg Ser Ala Leu Val Glu Thr Arg Thr Ile
Val Arg Phe 370 375 380
Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385
390 395 400 Phe Phe Met Ser
Lys Val Thr Asn Pro Lys Gln Ala 405 410
1525DNAArtificial SequenceSynthetic 15gtgattttga ccgcggtggc agcag
25161239DNAArtificial
SequenceSynthetic 16atgagaggat cccatcacca tcaccatcac tctagacacc
ctaacagccc acttgacgag 60gagaatctga cccaggagaa ccaagaccga gggacacacg
tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt cagcctgtac aagcagttag
tcctgaaggc ccctgataag 180aatgtcatct tctccccact gagcatctcc accgccttgg
ccttcctgtc tctgggggcc 240cataatacca ccctgacaga gattctcaaa ggcctcaagt
tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca
ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag
agcaactcag tctgctggac 420aggttcacgg aggatgccaa gaggctgtat ggctccgagg
cctttgccac tgactttcag 480gactcagctg cagctaagaa gctcatcaac gactacgtga
agaatggaac tagggggaaa 540atcacagatc tgatcaagga ccttgactcg cagacaatga
tggtcctggt gaattacatc 600ttctttaaag ccaaatggga gatgcccttt gacccccaag
atactcatca gtcaaggttc 660tacttgagca agaaaaagtg ggtaatggtg cccatgatga
gtttgcatca cctgactata 720ccttacttcc gggacgagga gctgtcctgc accgtggtgg
agctgaagta cacaggcaat 780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg
aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg gtggagagac tctctggagt
tcagagagat aggtgagctc 900tacctgccaa agttttccat ctcgagggac tataacctga
acgacatact tctccagctg 960ggcattgagg aagccttcac cagcaaggct gacctgtcag
ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg
tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt caaaatcacc ctcctttctg
cattagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc
ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239171239DNAArtificial SequenceSynthetic
17atgagaggat cccatcacca tcaccatcac tctagacacc ctaacagccc acttgacgag
60gagaatctga cccaggagaa ccaagaccga gggacacacg tggacctcgg attagcctcc
120gccaacgtgg acttcgcttt cagcctgtac aagcagttag tcctgaaggc ccctgataag
180aatgtcatct tctccccact gagcatctcc accgccttgg ccttcctgtc tctgggggcc
240cataatacca ccctgacaga gattctcaaa ggcctcaagt tcaacctcac ggagacttct
300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca ccctcaatca gtccagcgat
360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag agcaactcag tctgctggac
420aggttcacgg aggatgccaa gaggctgtat ggctccgagg cctttgccac tgactttcag
480gactcagctg cagctaagaa gctcatcaac gactacgtga agaatggaac tagggggaaa
540atcacagatc tgatcaagga ccttgactcg cagacaatga tggtcctggt gaattacatc
600ttctttaaag ccaaatggga gatgcccttt gacccccaag atactcatca gtcaaggttc
660tacttgagca agaaaaagtg ggtaatggtg cccatgatga gtttgcatca cctgactata
720ccttacttcc gggacgagga gctgtcctgc accgtggtgg agctgaagta cacaggcaat
780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg aggaagtgga agccatgctg
840ctcccagaga ccctgaagcg gtggagagac tctctggagt tcagagagat aggtgagctc
900tacctgccaa agttttccat ctcgagggac tataacctga acgacatact tctccagctg
960ggcattgagg aagccttcac cagcaaggct gacctgtcag ggatcacagg ggccaggaac
1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg tatttgagga gggcacagaa
1080gcatctgctg ccaccgcggt caaaggttct ctgcgttctg ctctggtgga gacgcgtacc
1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc ctacagacac ccagaacatc
1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239181239DNAArtificial SequenceSynthetic 18atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaggttct ctgcgtggtg ctctggtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 1239191239DNAArtificial
SequenceSynthetic 19atgagaggat cccatcacca tcaccatcac tctagacacc
ctaacagccc acttgacgag 60gagaatctga cccaggagaa ccaagaccga gggacacacg
tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt cagcctgtac aagcagttag
tcctgaaggc ccctgataag 180aatgtcatct tctccccact gagcatctcc accgccttgg
ccttcctgtc tctgggggcc 240cataatacca ccctgacaga gattctcaaa ggcctcaagt
tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca
ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag
agcaactcag tctgctggac 420aggttcacgg aggatgccaa gaggctgtat ggctccgagg
cctttgccac tgactttcag 480gactcagctg cagctaagaa gctcatcaac gactacgtga
agaatggaac tagggggaaa 540atcacagatc tgatcaagga ccttgactcg cagacaatga
tggtcctggt gaattacatc 600ttctttaaag ccaaatggga gatgcccttt gacccccaag
atactcatca gtcaaggttc 660tacttgagca agaaaaagtg ggtaatggtg cccatgatga
gtttgcatca cctgactata 720ccttacttcc gggacgagga gctgtcctgc accgtggtgg
agctgaagta cacaggcaat 780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg
aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg gtggagagac tctctggagt
tcagagagat aggtgagctc 900tacctgccaa agttttccat ctcgagggac tataacctga
acgacatact tctccagctg 960ggcattgagg aagccttcac cagcaaggct gacctgtcag
ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg
tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt caaaatcacc ctgcgtcaga
ccaacgtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc
ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239201239DNAArtificial SequenceSynthetic
20atgagaggat cccatcacca tcaccatcac tctagacacc ctaacagccc acttgacgag
60gagaatctga cccaggagaa ccaagaccga gggacacacg tggacctcgg attagcctcc
120gccaacgtgg acttcgcttt cagcctgtac aagcagttag tcctgaaggc ccctgataag
180aatgtcatct tctccccact gagcatctcc accgccttgg ccttcctgtc tctgggggcc
240cataatacca ccctgacaga gattctcaaa ggcctcaagt tcaacctcac ggagacttct
300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca ccctcaatca gtccagcgat
360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag agcaactcag tctgctggac
420aggttcacgg aggatgccaa gaggctgtat ggctccgagg cctttgccac tgactttcag
480gactcagctg cagctaagaa gctcatcaac gactacgtga agaatggaac tagggggaaa
540atcacagatc tgatcaagga ccttgactcg cagacaatga tggtcctggt gaattacatc
600ttctttaaag ccaaatggga gatgcccttt gacccccaag atactcatca gtcaaggttc
660tacttgagca agaaaaagtg ggtaatggtg cccatgatga gtttgcatca cctgactata
720ccttacttcc gggacgagga gctgtcctgc accgtggtgg agctgaagta cacaggcaat
780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg aggaagtgga agccatgctg
840ctcccagaga ccctgaagcg gtggagagac tctctggagt tcagagagat aggtgagctc
900tacctgccaa agttttccat ctcgagggac tataacctga acgacatact tctccagctg
960ggcattgagg aagccttcac cagcaaggct gacctgtcag ggatcacagg ggccaggaac
1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg tatttgagga gggcacagaa
1080gcatctgctg ccaccgcggt caaaatcacc ggtcgtcaga ccaacgtgga gacgcgtacc
1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc ctacagacac ccagaacatc
1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239211239DNAArtificial SequenceSynthetic 21atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcaac cagcgttctt ccctggtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 1239221239DNAArtificial
SequenceSynthetic 22atgagaggat cccatcacca tcaccatcac tctagacacc
ctaacagccc acttgacgag 60gagaatctga cccaggagaa ccaagaccga gggacacacg
tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt cagcctgtac aagcagttag
tcctgaaggc ccctgataag 180aatgtcatct tctccccact gagcatctcc accgccttgg
ccttcctgtc tctgggggcc 240cataatacca ccctgacaga gattctcaaa ggcctcaagt
tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca
ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag
agcaactcag tctgctggac 420aggttcacgg aggatgccaa gaggctgtat ggctccgagg
cctttgccac tgactttcag 480gactcagctg cagctaagaa gctcatcaac gactacgtga
agaatggaac tagggggaaa 540atcacagatc tgatcaagga ccttgactcg cagacaatga
tggtcctggt gaattacatc 600ttctttaaag ccaaatggga gatgcccttt gacccccaag
atactcatca gtcaaggttc 660tacttgagca agaaaaagtg ggtaatggtg cccatgatga
gtttgcatca cctgactata 720ccttacttcc gggacgagga gctgtcctgc accgtggtgg
agctgaagta cacaggcaat 780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg
aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg gtggagagac tctctggagt
tcagagagat aggtgagctc 900tacctgccaa agttttccat ctcgagggac tataacctga
acgacatact tctccagctg 960ggcattgagg aagccttcac cagcaaggct gacctgtcag
ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg
tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt caaaatcctg cagcgtgcta
tcctggtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc
ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239231239DNAArtificial SequenceSynthetic
23atgagaggat cccatcacca tcaccatcac tctagacacc ctaacagccc acttgacgag
60gagaatctga cccaggagaa ccaagaccga gggacacacg tggacctcgg attagcctcc
120gccaacgtgg acttcgcttt cagcctgtac aagcagttag tcctgaaggc ccctgataag
180aatgtcatct tctccccact gagcatctcc accgccttgg ccttcctgtc tctgggggcc
240cataatacca ccctgacaga gattctcaaa ggcctcaagt tcaacctcac ggagacttct
300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca ccctcaatca gtccagcgat
360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag agcaactcag tctgctggac
420aggttcacgg aggatgccaa gaggctgtat ggctccgagg cctttgccac tgactttcag
480gactcagctg cagctaagaa gctcatcaac gactacgtga agaatggaac tagggggaaa
540atcacagatc tgatcaagga ccttgactcg cagacaatga tggtcctggt gaattacatc
600ttctttaaag ccaaatggga gatgcccttt gacccccaag atactcatca gtcaaggttc
660tacttgagca agaaaaagtg ggtaatggtg cccatgatga gtttgcatca cctgactata
720ccttacttcc gggacgagga gctgtcctgc accgtggtgg agctgaagta cacaggcaat
780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg aggaagtgga agccatgctg
840ctcccagaga ccctgaagcg gtggagagac tctctggagt tcagagagat aggtgagctc
900tacctgccaa agttttccat ctcgagggac tataacctga acgacatact tctccagctg
960ggcattgagg aagccttcac cagcaaggct gacctgtcag ggatcacagg ggccaggaac
1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg tatttgagga gggcacagaa
1080gcatctgctg ccaccgcggt caaacagcgt ctgcgtgacg ctctggtgga gacgcgtacc
1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc ctacagacac ccagaacatc
1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239241239DNAArtificial SequenceSynthetic 24atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
caaaatcccg gaccgtcaca tgctggtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 1239251239DNAArtificial
SequenceSynthetic 25atgagaggat cccatcacca tcaccatcac tctagacacc
ctaacagccc acttgacgag 60gagaatctga cccaggagaa ccaagaccga gggacacacg
tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt cagcctgtac aagcagttag
tcctgaaggc ccctgataag 180aatgtcatct tctccccact gagcatctcc accgccttgg
ccttcctgtc tctgggggcc 240cataatacca ccctgacaga gattctcaaa ggcctcaagt
tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca
ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag
agcaactcag tctgctggac 420aggttcacgg aggatgccaa gaggctgtat ggctccgagg
cctttgccac tgactttcag 480gactcagctg cagctaagaa gctcatcaac gactacgtga
agaatggaac tagggggaaa 540atcacagatc tgatcaagga ccttgactcg cagacaatga
tggtcctggt gaattacatc 600ttctttaaag ccaaatggga gatgcccttt gacccccaag
atactcatca gtcaaggttc 660tacttgagca agaaaaagtg ggtaatggtg cccatgatga
gtttgcatca cctgactata 720ccttacttcc gggacgagga gctgtcctgc accgtggtgg
agctgaagta cacaggcaat 780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg
aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg gtggagagac tctctggagt
tcagagagat aggtgagctc 900tacctgccaa agttttccat ctcgagggac tataacctga
acgacatact tctccagctg 960ggcattgagg aagccttcac cagcaaggct gacctgtcag
ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg
tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt caaaaccgtt gactacgctg
ctctggtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc
ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
1239261221DNAArtificial SequenceSynthetic
26atgagaggat cgcatcacca tcaccatcac ggatccgatg atccccaggg agatgctgcc
60cagaagacag atacatccca ccatgatcag gatcacccaa ccttcaacaa gatcaccccc
120aacctggctg agttcgcctt cagcctatac cgccagctgg cacaccagtc caacagcacc
180aatatcttct tctccccagt gagcatcgct acagcctttg caatgctctc cctggggacc
240aaggctgaca ctcacgatga aatcctggag ggcctgaatt tcaacctcac ggagattccg
300gaggctcaga tccatgaagg cttccaggaa ctcctccgta ccctcaacca gccagacagc
360cagctccagc tgaccaccgg caatggcctg ttcctcagcg agggcctgaa gctagtggat
420aagtttttgg aggatgttaa aaagttgtac cactcagaag ccttcactgt caacttcggg
480gacaccgaag aggccaagaa acagatcaac gattacgtgg agaagggtac tcaagggaaa
540attgtggatt tggtcaagga gcttgacaga gacacagttt ttgctctggt gaattacatc
600ttctttaaag gcaaatggga gagacccttt gaagtcaagg acaccgagga agaggacttc
660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga agcgtttagg catgtttaac
720atccagcact gtaagaagct gtccagctgg gtgctgctga tgaaatacct gggcaatgcc
780accgccatct tcttcctgcc tgatgagggg aaactacagc acctggaaaa tgaactcacc
840cacgatatca tcaccaagtt cctggaaaat gaagacagaa ggtctgccag cttacattta
900cccaaactgt ccattactgg aacctatgat ctgaagagcg tcctgggtca actgggcatc
960actaaggtct tcagcaatgg ggctgacctc tccggggtca cagaggaggc acccctgaag
1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg agaaagggac tgaagctgct
1080ggggccatgt ttttagaggc catacccatg tctatccccc ccgaggtcaa gttcaacaaa
1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc ccctcttcat gggaaaagtg
1200gtgaatccca cccaaaaata a
1221271221DNAArtificial SequenceSynthetic 27atgagaggat cgcatcacca
tcaccatcac ggatccgatg atccccaggg agatgctgcc 60cagaagacag atacatccca
ccatgatcag gatcacccaa ccttcaacaa gatcaccccc 120aacctggctg agttcgcctt
cagcctatac cgccagctgg cacaccagtc caacagcacc 180aatatcttct tctccccagt
gagcatcgct acagcctttg caatgctctc cctggggacc 240aaggctgaca ctcacgatga
aatcctggag ggcctgaatt tcaacctcac ggagattccg 300gaggctcaga tccatgaagg
cttccaggaa ctcctccgta ccctcaacca gccagacagc 360cagctccagc tgaccaccgg
caatggcctg ttcctcagcg agggcctgaa gctagtggat 420aagtttttgg aggatgttaa
aaagttgtac cactcagaag ccttcactgt caacttcggg 480gacaccgaag aggccaagaa
acagatcaac gattacgtgg agaagggtac tcaagggaaa 540attgtggatt tggtcaagga
gcttgacaga gacacagttt ttgctctggt gaattacatc 600ttctttaaag gcaaatggga
gagacccttt gaagtcaagg acaccgagga agaggacttc 660cacgtggacc aggcgaccac
cgtgaaggtg cctatgatga agcgtttagg catgtttaac 720atccagcact gtaagaagct
gtccagctgg gtgctgctga tgaaatacct gggcaatgcc 780accgccatct tcttcctgcc
tgatgagggg aaactacagc acctggaaaa tgaactcacc 840cacgatatca tcaccaagtt
cctggaaaat gaagacagaa ggtctgccag cttacattta 900cccaaactgt ccattactgg
aacctatgat ctgaagagcg tcctgggtca actgggcatc 960actaaggtct tcagcaatgg
ggctgacctc tccggggtca cagaggaggc acccctgaag 1020ctctccaagg ccgtgcataa
ggctgtgctg accatcgacg agaaagggac tgaagctgct 1080ggcgccatgt ttctagaggg
ttctctgcgt tctatcccgc ctgaggtcaa gttcaacaaa 1140ccctttgtct tcttaatgat
tgaacaaaat accaagtctc ccctcttcat gggaaaagtg 1200gtgaatccca cccaaaaata a
1221281221DNAArtificial
SequenceSynthetic 28atgagaggat cgcatcacca tcaccatcac ggatccgatg
atccccaggg agatgctgcc 60cagaagacag atacatccca ccatgatcag gatcacccaa
ccttcaacaa gatcaccccc 120aacctggctg agttcgcctt cagcctatac cgccagctgg
cacaccagtc caacagcacc 180aatatcttct tctccccagt gagcatcgct acagcctttg
caatgctctc cctggggacc 240aaggctgaca ctcacgatga aatcctggag ggcctgaatt
tcaacctcac ggagattccg 300gaggctcaga tccatgaagg cttccaggaa ctcctccgta
ccctcaacca gccagacagc 360cagctccagc tgaccaccgg caatggcctg ttcctcagcg
agggcctgaa gctagtggat 420aagtttttgg aggatgttaa aaagttgtac cactcagaag
ccttcactgt caacttcggg 480gacaccgaag aggccaagaa acagatcaac gattacgtgg
agaagggtac tcaagggaaa 540attgtggatt tggtcaagga gcttgacaga gacacagttt
ttgctctggt gaattacatc 600ttctttaaag gcaaatggga gagacccttt gaagtcaagg
acaccgagga agaggacttc 660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga
agcgtttagg catgtttaac 720atccagcact gtaagaagct gtccagctgg gtgctgctga
tgaaatacct gggcaatgcc 780accgccatct tcttcctgcc tgatgagggg aaactacagc
acctggaaaa tgaactcacc 840cacgatatca tcaccaagtt cctggaaaat gaagacagaa
ggtctgccag cttacattta 900cccaaactgt ccattactgg aacctatgat ctgaagagcg
tcctgggtca actgggcatc 960actaaggtct tcagcaatgg ggctgacctc tccggggtca
cagaggaggc acccctgaag 1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg
agaaagggac tgaagctgct 1080ggcgccatgt ttctagaggg ttctctgcgt ggtatcccgc
ctgaggtcaa gttcaacaaa 1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc
ccctcttcat gggaaaagtg 1200gtgaatccca cccaaaaata a
1221291221DNAArtificial SequenceSynthetic
29atgagaggat cgcatcacca tcaccatcac ggatccgatg atccccaggg agatgctgcc
60cagaagacag atacatccca ccatgatcag gatcacccaa ccttcaacaa gatcaccccc
120aacctggctg agttcgcctt cagcctatac cgccagctgg cacaccagtc caacagcacc
180aatatcttct tctccccagt gagcatcgct acagcctttg caatgctctc cctggggacc
240aaggctgaca ctcacgatga aatcctggag ggcctgaatt tcaacctcac ggagattccg
300gaggctcaga tccatgaagg cttccaggaa ctcctccgta ccctcaacca gccagacagc
360cagctccagc tgaccaccgg caatggcctg ttcctcagcg agggcctgaa gctagtggat
420aagtttttgg aggatgttaa aaagttgtac cactcagaag ccttcactgt caacttcggg
480gacaccgaag aggccaagaa acagatcaac gattacgtgg agaagggtac tcaagggaaa
540attgtggatt tggtcaagga gcttgacaga gacacagttt ttgctctggt gaattacatc
600ttctttaaag gcaaatggga gagacccttt gaagtcaagg acaccgagga agaggacttc
660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga agcgtttagg catgtttaac
720atccagcact gtaagaagct gtccagctgg gtgctgctga tgaaatacct gggcaatgcc
780accgccatct tcttcctgcc tgatgagggg aaactacagc acctggaaaa tgaactcacc
840cacgatatca tcaccaagtt cctggaaaat gaagacagaa ggtctgccag cttacattta
900cccaaactgt ccattactgg aacctatgat ctgaagagcg tcctgggtca actgggcatc
960actaaggtct tcagcaatgg ggctgacctc tccggggtca cagaggaggc acccctgaag
1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg agaaagggac tgaagctgct
1080ggcgccatgt ttctagaggc tatcccgcgt cagaccaacc ctgaggtcaa gttcaacaaa
1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc ccctcttcat gggaaaagtg
1200gtgaatccca cccaaaaata a
1221301221DNAArtificial SequenceSynthetic 30atgagaggat cgcatcacca
tcaccatcac ggatccgatg atccccaggg agatgctgcc 60cagaagacag atacatccca
ccatgatcag gatcacccaa ccttcaacaa gatcaccccc 120aacctggctg agttcgcctt
cagcctatac cgccagctgg cacaccagtc caacagcacc 180aatatcttct tctccccagt
gagcatcgct acagcctttg caatgctctc cctggggacc 240aaggctgaca ctcacgatga
aatcctggag ggcctgaatt tcaacctcac ggagattccg 300gaggctcaga tccatgaagg
cttccaggaa ctcctccgta ccctcaacca gccagacagc 360cagctccagc tgaccaccgg
caatggcctg ttcctcagcg agggcctgaa gctagtggat 420aagtttttgg aggatgttaa
aaagttgtac cactcagaag ccttcactgt caacttcggg 480gacaccgaag aggccaagaa
acagatcaac gattacgtgg agaagggtac tcaagggaaa 540attgtggatt tggtcaagga
gcttgacaga gacacagttt ttgctctggt gaattacatc 600ttctttaaag gcaaatggga
gagacccttt gaagtcaagg acaccgagga agaggacttc 660cacgtggacc aggcgaccac
cgtgaaggtg cctatgatga agcgtttagg catgtttaac 720atccagcact gtaagaagct
gtccagctgg gtgctgctga tgaaatacct gggcaatgcc 780accgccatct tcttcctgcc
tgatgagggg aaactacagc acctggaaaa tgaactcacc 840cacgatatca tcaccaagtt
cctggaaaat gaagacagaa ggtctgccag cttacattta 900cccaaactgt ccattactgg
aacctatgat ctgaagagcg tcctgggtca actgggcatc 960actaaggtct tcagcaatgg
ggctgacctc tccggggtca cagaggaggc acccctgaag 1020ctctccaagg ccgtgcataa
ggctgtgctg accatcgacg agaaagggac tgaagctgct 1080ggcgccatgt ttctagaggc
tatcggtcgt cagaccaacc ctgaggtcaa gttcaacaaa 1140ccctttgtct tcttaatgat
tgaacaaaat accaagtctc ccctcttcat gggaaaagtg 1200gtgaatccca cccaaaaata a
1221311221DNAArtificial
SequenceSynthetic 31atgagaggat cgcatcacca tcaccatcac ggatccgatg
atccccaggg agatgctgcc 60cagaagacag atacatccca ccatgatcag gatcacccaa
ccttcaacaa gatcaccccc 120aacctggctg agttcgcctt cagcctatac cgccagctgg
cacaccagtc caacagcacc 180aatatcttct tctccccagt gagcatcgct acagcctttg
caatgctctc cctggggacc 240aaggctgaca ctcacgatga aatcctggag ggcctgaatt
tcaacctcac ggagattccg 300gaggctcaga tccatgaagg cttccaggaa ctcctccgta
ccctcaacca gccagacagc 360cagctccagc tgaccaccgg caatggcctg ttcctcagcg
agggcctgaa gctagtggat 420aagtttttgg aggatgttaa aaagttgtac cactcagaag
ccttcactgt caacttcggg 480gacaccgaag aggccaagaa acagatcaac gattacgtgg
agaagggtac tcaagggaaa 540attgtggatt tggtcaagga gcttgacaga gacacagttt
ttgctctggt gaattacatc 600ttctttaaag gcaaatggga gagacccttt gaagtcaagg
acaccgagga agaggacttc 660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga
agcgtttagg catgtttaac 720atccagcact gtaagaagct gtccagctgg gtgctgctga
tgaaatacct gggcaatgcc 780accgccatct tcttcctgcc tgatgagggg aaactacagc
acctggaaaa tgaactcacc 840cacgatatca tcaccaagtt cctggaaaat gaagacagaa
ggtctgccag cttacattta 900cccaaactgt ccattactgg aacctatgat ctgaagagcg
tcctgggtca actgggcatc 960actaaggtct tcagcaatgg ggctgacctc tccggggtca
cagaggaggc acccctgaag 1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg
agaaagggac tgaagctgct 1080ggcgccatgt ttctagaggc taaccagcgt tcttccccgc
ctgaggtcaa gttcaacaaa 1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc
ccctcttcat gggaaaagtg 1200gtgaatccca cccaaaaata a
1221321221DNAArtificial SequenceSynthetic
32atgagaggat cgcatcacca tcaccatcac ggatccgatg atccccaggg agatgctgcc
60cagaagacag atacatccca ccatgatcag gatcacccaa ccttcaacaa gatcaccccc
120aacctggctg agttcgcctt cagcctatac cgccagctgg cacaccagtc caacagcacc
180aatatcttct tctccccagt gagcatcgct acagcctttg caatgctctc cctggggacc
240aaggctgaca ctcacgatga aatcctggag ggcctgaatt tcaacctcac ggagattccg
300gaggctcaga tccatgaagg cttccaggaa ctcctccgta ccctcaacca gccagacagc
360cagctccagc tgaccaccgg caatggcctg ttcctcagcg agggcctgaa gctagtggat
420aagtttttgg aggatgttaa aaagttgtac cactcagaag ccttcactgt caacttcggg
480gacaccgaag aggccaagaa acagatcaac gattacgtgg agaagggtac tcaagggaaa
540attgtggatt tggtcaagga gcttgacaga gacacagttt ttgctctggt gaattacatc
600ttctttaaag gcaaatggga gagacccttt gaagtcaagg acaccgagga agaggacttc
660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga agcgtttagg catgtttaac
720atccagcact gtaagaagct gtccagctgg gtgctgctga tgaaatacct gggcaatgcc
780accgccatct tcttcctgcc tgatgagggg aaactacagc acctggaaaa tgaactcacc
840cacgatatca tcaccaagtt cctggaaaat gaagacagaa ggtctgccag cttacattta
900cccaaactgt ccattactgg aacctatgat ctgaagagcg tcctgggtca actgggcatc
960actaaggtct tcagcaatgg ggctgacctc tccggggtca cagaggaggc acccctgaag
1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg agaaagggac tgaagctgct
1080ggcgccatgt ttctagaggc tctgcagcgt gctatcccgc ctgaggtcaa gttcaacaaa
1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc ccctcttcat gggaaaagtg
1200gtgaatccca cccaaaaata a
1221331221DNAArtificial SequenceSynthetic 33atgagaggat cgcatcacca
tcaccatcac ggatccgatg atccccaggg agatgctgcc 60cagaagacag atacatccca
ccatgatcag gatcacccaa ccttcaacaa gatcaccccc 120aacctggctg agttcgcctt
cagcctatac cgccagctgg cacaccagtc caacagcacc 180aatatcttct tctccccagt
gagcatcgct acagcctttg caatgctctc cctggggacc 240aaggctgaca ctcacgatga
aatcctggag ggcctgaatt tcaacctcac ggagattccg 300gaggctcaga tccatgaagg
cttccaggaa ctcctccgta ccctcaacca gccagacagc 360cagctccagc tgaccaccgg
caatggcctg ttcctcagcg agggcctgaa gctagtggat 420aagtttttgg aggatgttaa
aaagttgtac cactcagaag ccttcactgt caacttcggg 480gacaccgaag aggccaagaa
acagatcaac gattacgtgg agaagggtac tcaagggaaa 540attgtggatt tggtcaagga
gcttgacaga gacacagttt ttgctctggt gaattacatc 600ttctttaaag gcaaatggga
gagacccttt gaagtcaagg acaccgagga agaggacttc 660cacgtggacc aggcgaccac
cgtgaaggtg cctatgatga agcgtttagg catgtttaac 720atccagcact gtaagaagct
gtccagctgg gtgctgctga tgaaatacct gggcaatgcc 780accgccatct tcttcctgcc
tgatgagggg aaactacagc acctggaaaa tgaactcacc 840cacgatatca tcaccaagtt
cctggaaaat gaagacagaa ggtctgccag cttacattta 900cccaaactgt ccattactgg
aacctatgat ctgaagagcg tcctgggtca actgggcatc 960actaaggtct tcagcaatgg
ggctgacctc tccggggtca cagaggaggc acccctgaag 1020ctctccaagg ccgtgcataa
ggctgtgctg accatcgacg agaaagggac tgaagctgct 1080ggcgccatgt ttctagagca
gcgtctgcgt gacatcccgc ctgaggtcaa gttcaacaaa 1140ccctttgtct tcttaatgat
tgaacaaaat accaagtctc ccctcttcat gggaaaagtg 1200gtgaatccca cccaaaaata a
1221341221DNAArtificial
SequenceSynthetic 34atgagaggat cgcatcacca tcaccatcac ggatccgatg
atccccaggg agatgctgcc 60cagaagacag atacatccca ccatgatcag gatcacccaa
ccttcaacaa gatcaccccc 120aacctggctg agttcgcctt cagcctatac cgccagctgg
cacaccagtc caacagcacc 180aatatcttct tctccccagt gagcatcgct acagcctttg
caatgctctc cctggggacc 240aaggctgaca ctcacgatga aatcctggag ggcctgaatt
tcaacctcac ggagattccg 300gaggctcaga tccatgaagg cttccaggaa ctcctccgta
ccctcaacca gccagacagc 360cagctccagc tgaccaccgg caatggcctg ttcctcagcg
agggcctgaa gctagtggat 420aagtttttgg aggatgttaa aaagttgtac cactcagaag
ccttcactgt caacttcggg 480gacaccgaag aggccaagaa acagatcaac gattacgtgg
agaagggtac tcaagggaaa 540attgtggatt tggtcaagga gcttgacaga gacacagttt
ttgctctggt gaattacatc 600ttctttaaag gcaaatggga gagacccttt gaagtcaagg
acaccgagga agaggacttc 660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga
agcgtttagg catgtttaac 720atccagcact gtaagaagct gtccagctgg gtgctgctga
tgaaatacct gggcaatgcc 780accgccatct tcttcctgcc tgatgagggg aaactacagc
acctggaaaa tgaactcacc 840cacgatatca tcaccaagtt cctggaaaat gaagacagaa
ggtctgccag cttacattta 900cccaaactgt ccattactgg aacctatgat ctgaagagcg
tcctgggtca actgggcatc 960actaaggtct tcagcaatgg ggctgacctc tccggggtca
cagaggaggc acccctgaag 1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg
agaaagggac tgaagctgct 1080ggcgccatgt ttctagaggc tccggaccgt cacatgccgc
ctgaggtcaa gttcaacaaa 1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc
ccctcttcat gggaaaagtg 1200gtgaatccca cccaaaaata a
1221351221DNAArtificial SequenceSynthetic
35atgagaggat cgcatcacca tcaccatcac ggatccgatg atccccaggg agatgctgcc
60cagaagacag atacatccca ccatgatcag gatcacccaa ccttcaacaa gatcaccccc
120aacctggctg agttcgcctt cagcctatac cgccagctgg cacaccagtc caacagcacc
180aatatcttct tctccccagt gagcatcgct acagcctttg caatgctctc cctggggacc
240aaggctgaca ctcacgatga aatcctggag ggcctgaatt tcaacctcac ggagattccg
300gaggctcaga tccatgaagg cttccaggaa ctcctccgta ccctcaacca gccagacagc
360cagctccagc tgaccaccgg caatggcctg ttcctcagcg agggcctgaa gctagtggat
420aagtttttgg aggatgttaa aaagttgtac cactcagaag ccttcactgt caacttcggg
480gacaccgaag aggccaagaa acagatcaac gattacgtgg agaagggtac tcaagggaaa
540attgtggatt tggtcaagga gcttgacaga gacacagttt ttgctctggt gaattacatc
600ttctttaaag gcaaatggga gagacccttt gaagtcaagg acaccgagga agaggacttc
660cacgtggacc aggcgaccac cgtgaaggtg cctatgatga agcgtttagg catgtttaac
720atccagcact gtaagaagct gtccagctgg gtgctgctga tgaaatacct gggcaatgcc
780accgccatct tcttcctgcc tgatgagggg aaactacagc acctggaaaa tgaactcacc
840cacgatatca tcaccaagtt cctggaaaat gaagacagaa ggtctgccag cttacattta
900cccaaactgt ccattactgg aacctatgat ctgaagagcg tcctgggtca actgggcatc
960actaaggtct tcagcaatgg ggctgacctc tccggggtca cagaggaggc acccctgaag
1020ctctccaagg ccgtgcataa ggctgtgctg accatcgacg agaaagggac tgaagctgct
1080ggcgccatgt ttctagagac cgttgactac gctatcccgc ctgaggtcaa gttcaacaaa
1140ccctttgtct tcttaatgat tgaacaaaat accaagtctc ccctcttcat gggaaaagtg
1200gtgaatccca cccaaaaata a
1221361239DNAArtificial SequenceSynthetic 36atgagaggat cccatcacca
tcaccatcac tctagacacc ctaacagccc acttgacgag 60gagaatctga cccaggagaa
ccaagaccga gggacacacg tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt
cagcctgtac aagcagttag tcctgaaggc ccctgataag 180aatgtcatct tctccccact
gagcatctcc accgccttgg ccttcctgtc tctgggggcc 240cataatacca ccctgacaga
gattctcaaa ggcctcaagt tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag
cttccagcac ctcctgcgca ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg
aaatgccatg tttgtcaaag agcaactcag tctgctggac 420aggttcacgg aggatgccaa
gaggctgtat ggctccgagg cctttgccac tgactttcag 480gactcagctg cagctaagaa
gctcatcaac gactacgtga agaatggaac tagggggaaa 540atcacagatc tgatcaagga
ccttgactcg cagacaatga tggtcctggt gaattacatc 600ttctttaaag ccaaatggga
gatgcccttt gacccccaag atactcatca gtcaaggttc 660tacttgagca agaaaaagtg
ggtaatggtg cccatgatga gtttgcatca cctgactata 720ccttacttcc gggacgagga
gctgtcctgc accgtggtgg agctgaagta cacaggcaat 780gccagcgcac tcttcatcct
ccctgatcaa gacaagatgg aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg
gtggagagac tctctggagt tcagagagat aggtgagctc 900tacctgccaa agttttccat
ctcgagggac tataacctga acgacatact tctccagctg 960ggcattgagg aagccttcac
cagcaaggct gacctgtcag ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt
ccataaggct gtgcttgatg tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt
cgttggttct ctgcgttctg cattagtgga gacgcgtacc 1140attgtgcgtt tcaacaggcc
cttcctgatg atcattgtcc ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac
caatcccaag caagcctaa 1239371239DNAArtificial
SequenceSynthetic 37atgagaggat cccatcacca tcaccatcac tctagacacc
ctaacagccc acttgacgag 60gagaatctga cccaggagaa ccaagaccga gggacacacg
tggacctcgg attagcctcc 120gccaacgtgg acttcgcttt cagcctgtac aagcagttag
tcctgaaggc ccctgataag 180aatgtcatct tctccccact gagcatctcc accgccttgg
ccttcctgtc tctgggggcc 240cataatacca ccctgacaga gattctcaaa ggcctcaagt
tcaacctcac ggagacttct 300gaggcagaaa ttcaccagag cttccagcac ctcctgcgca
ccctcaatca gtccagcgat 360gagctgcagc tgagtatggg aaatgccatg tttgtcaaag
agcaactcag tctgctggac 420aggttcacgg aggatgccaa gaggctgtat ggctccgagg
cctttgccac tgactttcag 480gactcagctg cagctaagaa gctcatcaac gactacgtga
agaatggaac tagggggaaa 540atcacagatc tgatcaagga ccttgactcg cagacaatga
tggtcctggt gaattacatc 600ttctttaaag ccaaatggga gatgcccttt gacccccaag
atactcatca gtcaaggttc 660tacttgagca agaaaaagtg ggtaatggtg cccatgatga
gtttgcatca cctgactata 720ccttacttcc gggacgagga gctgtcctgc accgtggtgg
agctgaagta cacaggcaat 780gccagcgcac tcttcatcct ccctgatcaa gacaagatgg
aggaagtgga agccatgctg 840ctcccagaga ccctgaagcg gtggagagac tctctggagt
tcagagagat aggtgagctc 900tacctgccaa agttttccat ctcgagggac tataacctga
acgacatact tctccagctg 960ggcattgagg aagccttcac cagcaaggct gacctgtcag
ggatcacagg ggccaggaac 1020ctagcagtct cccaggtggt ccataaggct gtgcttgatg
tatttgagga gggcacagaa 1080gcatctgctg ccaccgcggt caaaatcacc ctccgtcaga
ccaacgacga gacgcgtacc 1140attgtgcgtt tcaacaggcc cttcctgatg atcattgtcc
ctacagacac ccagaacatc 1200ttcttcatga gcaaagtcac caatcccaag caagcctaa
123938412PRTArtificial SequenceSynthetic 38Met Arg
Gly Ser His His His His His His Ser Arg His Pro Asn Ser 1 5
10 15 Pro Leu Asp Glu Glu Asn Leu
Thr Gln Glu Asn Gln Asp Arg Gly Thr 20 25
30 His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp
Phe Ala Phe Ser 35 40 45
Leu Tyr Lys Gln Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe
50 55 60 Ser Pro Leu
Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser Leu Gly Ala 65
70 75 80 His Asn Thr Thr Leu Thr Glu
Ile Leu Lys Gly Leu Lys Phe Asn Leu 85
90 95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser
Phe Gln His Leu Leu 100 105
110 Arg Thr Leu Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly
Asn 115 120 125 Ala
Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe Thr Glu 130
135 140 Asp Ala Lys Arg Leu Tyr
Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145 150
155 160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp
Tyr Val Lys Asn Gly 165 170
175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr
180 185 190 Met Met
Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu Met 195
200 205 Pro Phe Asp Pro Gln Asp Thr
His Gln Ser Arg Phe Tyr Leu Ser Lys 210 215
220 Lys Lys Trp Val Met Val Pro Met Met Ser Leu His
His Leu Thr Ile 225 230 235
240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys
245 250 255 Tyr Thr Gly
Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys 260
265 270 Met Glu Glu Val Glu Ala Met Leu
Leu Pro Glu Thr Leu Lys Arg Trp 275 280
285 Arg Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr
Leu Pro Lys 290 295 300
Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305
310 315 320 Gly Ile Glu Glu
Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr 325
330 335 Gly Ala Arg Asn Leu Ala Val Ser Gln
Val Val His Lys Ala Val Leu 340 345
350 Asp Val Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala
Val Lys 355 360 365
Ile Thr Leu Leu Ser Ala Leu Val Glu Thr Arg Thr Ile Val Arg Phe 370
375 380 Asn Arg Pro Phe Leu
Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385 390
395 400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys
Gln Ala 405 410
39412PRTArtificial SequenceSynthetic 39Met Arg Gly Ser His His His His
His His Ser Arg His Pro Asn Ser 1 5 10
15 Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp
Arg Gly Thr 20 25 30
His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser
35 40 45 Leu Tyr Lys Gln
Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe 50
55 60 Ser Pro Leu Ser Ile Ser Thr Ala
Leu Ala Phe Leu Ser Leu Gly Ala 65 70
75 80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu
Lys Phe Asn Leu 85 90
95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly Asn 115
120 125 Ala Met Phe Val Lys Glu Gln Leu
Ser Leu Leu Asp Arg Phe Thr Glu 130 135
140 Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr
Asp Phe Gln 145 150 155
160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly
165 170 175 Thr Arg Gly Lys
Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr 180
185 190 Met Met Val Leu Val Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Glu Met 195 200
205 Pro Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu
Ser Lys 210 215 220
Lys Lys Trp Val Met Val Pro Met Met Ser Leu His His Leu Thr Ile 225
230 235 240 Pro Tyr Phe Arg Asp
Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys 245
250 255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile
Leu Pro Asp Gln Asp Lys 260 265
270 Met Glu Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg
Trp 275 280 285 Arg
Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290
295 300 Phe Ser Ile Ser Arg Asp
Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305 310
315 320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp
Leu Ser Gly Ile Thr 325 330
335 Gly Ala Arg Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu
340 345 350 Asp Val
Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala Val Lys 355
360 365 Gly Ser Leu Arg Ser Ala Leu
Val Glu Thr Arg Thr Ile Val Arg Phe 370 375
380 Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp
Thr Gln Asn Ile 385 390 395
400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys Gln Ala 405
410 40412PRTArtificial SequenceSynthetic 40Met
Arg Gly Ser His His His His His His Ser Arg His Pro Asn Ser 1
5 10 15 Pro Leu Asp Glu Glu Asn
Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr 20
25 30 His Val Asp Leu Gly Leu Ala Ser Ala Asn
Val Asp Phe Ala Phe Ser 35 40
45 Leu Tyr Lys Gln Leu Val Leu Lys Ala Pro Asp Lys Asn Val
Ile Phe 50 55 60
Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser Leu Gly Ala 65
70 75 80 His Asn Thr Thr Leu
Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu 85
90 95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln
Ser Phe Gln His Leu Leu 100 105
110 Arg Thr Leu Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly
Asn 115 120 125 Ala
Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe Thr Glu 130
135 140 Asp Ala Lys Arg Leu Tyr
Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145 150
155 160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp
Tyr Val Lys Asn Gly 165 170
175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr
180 185 190 Met Met
Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu Met 195
200 205 Pro Phe Asp Pro Gln Asp Thr
His Gln Ser Arg Phe Tyr Leu Ser Lys 210 215
220 Lys Lys Trp Val Met Val Pro Met Met Ser Leu His
His Leu Thr Ile 225 230 235
240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys
245 250 255 Tyr Thr Gly
Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys 260
265 270 Met Glu Glu Val Glu Ala Met Leu
Leu Pro Glu Thr Leu Lys Arg Trp 275 280
285 Arg Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr
Leu Pro Lys 290 295 300
Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305
310 315 320 Gly Ile Glu Glu
Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr 325
330 335 Gly Ala Arg Asn Leu Ala Val Ser Gln
Val Val His Lys Ala Val Leu 340 345
350 Asp Val Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala
Val Lys 355 360 365
Gly Ser Leu Arg Gly Ala Leu Val Glu Thr Arg Thr Ile Val Arg Phe 370
375 380 Asn Arg Pro Phe Leu
Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385 390
395 400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys
Gln Ala 405 410
41412PRTArtificial SequenceSynthetic 41Met Arg Gly Ser His His His His
His His Ser Arg His Pro Asn Ser 1 5 10
15 Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp
Arg Gly Thr 20 25 30
His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser
35 40 45 Leu Tyr Lys Gln
Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe 50
55 60 Ser Pro Leu Ser Ile Ser Thr Ala
Leu Ala Phe Leu Ser Leu Gly Ala 65 70
75 80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu
Lys Phe Asn Leu 85 90
95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly Asn 115
120 125 Ala Met Phe Val Lys Glu Gln Leu
Ser Leu Leu Asp Arg Phe Thr Glu 130 135
140 Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr
Asp Phe Gln 145 150 155
160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly
165 170 175 Thr Arg Gly Lys
Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr 180
185 190 Met Met Val Leu Val Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Glu Met 195 200
205 Pro Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu
Ser Lys 210 215 220
Lys Lys Trp Val Met Val Pro Met Met Ser Leu His His Leu Thr Ile 225
230 235 240 Pro Tyr Phe Arg Asp
Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys 245
250 255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile
Leu Pro Asp Gln Asp Lys 260 265
270 Met Glu Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg
Trp 275 280 285 Arg
Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290
295 300 Phe Ser Ile Ser Arg Asp
Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305 310
315 320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp
Leu Ser Gly Ile Thr 325 330
335 Gly Ala Arg Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu
340 345 350 Asp Val
Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala Val Lys 355
360 365 Ile Thr Leu Arg Gln Thr Asn
Val Glu Thr Arg Thr Ile Val Arg Phe 370 375
380 Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp
Thr Gln Asn Ile 385 390 395
400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys Gln Ala 405
410 42412PRTArtificial SequenceSynthetic 42Met
Arg Gly Ser His His His His His His Ser Arg His Pro Asn Ser 1
5 10 15 Pro Leu Asp Glu Glu Asn
Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr 20
25 30 His Val Asp Leu Gly Leu Ala Ser Ala Asn
Val Asp Phe Ala Phe Ser 35 40
45 Leu Tyr Lys Gln Leu Val Leu Lys Ala Pro Asp Lys Asn Val
Ile Phe 50 55 60
Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser Leu Gly Ala 65
70 75 80 His Asn Thr Thr Leu
Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu 85
90 95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln
Ser Phe Gln His Leu Leu 100 105
110 Arg Thr Leu Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly
Asn 115 120 125 Ala
Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe Thr Glu 130
135 140 Asp Ala Lys Arg Leu Tyr
Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145 150
155 160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp
Tyr Val Lys Asn Gly 165 170
175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr
180 185 190 Met Met
Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu Met 195
200 205 Pro Phe Asp Pro Gln Asp Thr
His Gln Ser Arg Phe Tyr Leu Ser Lys 210 215
220 Lys Lys Trp Val Met Val Pro Met Met Ser Leu His
His Leu Thr Ile 225 230 235
240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys
245 250 255 Tyr Thr Gly
Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys 260
265 270 Met Glu Glu Val Glu Ala Met Leu
Leu Pro Glu Thr Leu Lys Arg Trp 275 280
285 Arg Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr
Leu Pro Lys 290 295 300
Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305
310 315 320 Gly Ile Glu Glu
Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr 325
330 335 Gly Ala Arg Asn Leu Ala Val Ser Gln
Val Val His Lys Ala Val Leu 340 345
350 Asp Val Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala
Val Lys 355 360 365
Ile Thr Gly Arg Gln Thr Asn Val Glu Thr Arg Thr Ile Val Arg Phe 370
375 380 Asn Arg Pro Phe Leu
Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385 390
395 400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys
Gln Ala 405 410
43412PRTArtificial SequenceSynthetic 43Met Arg Gly Ser His His His His
His His Ser Arg His Pro Asn Ser 1 5 10
15 Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp
Arg Gly Thr 20 25 30
His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser
35 40 45 Leu Tyr Lys Gln
Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe 50
55 60 Ser Pro Leu Ser Ile Ser Thr Ala
Leu Ala Phe Leu Ser Leu Gly Ala 65 70
75 80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu
Lys Phe Asn Leu 85 90
95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly Asn 115
120 125 Ala Met Phe Val Lys Glu Gln Leu
Ser Leu Leu Asp Arg Phe Thr Glu 130 135
140 Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr
Asp Phe Gln 145 150 155
160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly
165 170 175 Thr Arg Gly Lys
Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr 180
185 190 Met Met Val Leu Val Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Glu Met 195 200
205 Pro Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu
Ser Lys 210 215 220
Lys Lys Trp Val Met Val Pro Met Met Ser Leu His His Leu Thr Ile 225
230 235 240 Pro Tyr Phe Arg Asp
Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys 245
250 255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile
Leu Pro Asp Gln Asp Lys 260 265
270 Met Glu Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg
Trp 275 280 285 Arg
Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290
295 300 Phe Ser Ile Ser Arg Asp
Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305 310
315 320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp
Leu Ser Gly Ile Thr 325 330
335 Gly Ala Arg Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu
340 345 350 Asp Val
Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala Val Lys 355
360 365 Ile Asn Gln Arg Ser Ser Leu
Val Glu Thr Arg Thr Ile Val Arg Phe 370 375
380 Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp
Thr Gln Asn Ile 385 390 395
400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys Gln Ala 405
410 44412PRTArtificial SequenceSynthetic 44Met
Arg Gly Ser His His His His His His Ser Arg His Pro Asn Ser 1
5 10 15 Pro Leu Asp Glu Glu Asn
Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr 20
25 30 His Val Asp Leu Gly Leu Ala Ser Ala Asn
Val Asp Phe Ala Phe Ser 35 40
45 Leu Tyr Lys Gln Leu Val Leu Lys Ala Pro Asp Lys Asn Val
Ile Phe 50 55 60
Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser Leu Gly Ala 65
70 75 80 His Asn Thr Thr Leu
Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu 85
90 95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln
Ser Phe Gln His Leu Leu 100 105
110 Arg Thr Leu Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly
Asn 115 120 125 Ala
Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe Thr Glu 130
135 140 Asp Ala Lys Arg Leu Tyr
Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145 150
155 160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp
Tyr Val Lys Asn Gly 165 170
175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr
180 185 190 Met Met
Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu Met 195
200 205 Pro Phe Asp Pro Gln Asp Thr
His Gln Ser Arg Phe Tyr Leu Ser Lys 210 215
220 Lys Lys Trp Val Met Val Pro Met Met Ser Leu His
His Leu Thr Ile 225 230 235
240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys
245 250 255 Tyr Thr Gly
Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys 260
265 270 Met Glu Glu Val Glu Ala Met Leu
Leu Pro Glu Thr Leu Lys Arg Trp 275 280
285 Arg Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr
Leu Pro Lys 290 295 300
Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305
310 315 320 Gly Ile Glu Glu
Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr 325
330 335 Gly Ala Arg Asn Leu Ala Val Ser Gln
Val Val His Lys Ala Val Leu 340 345
350 Asp Val Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala
Val Lys 355 360 365
Ile Leu Gln Arg Ala Ile Leu Val Glu Thr Arg Thr Ile Val Arg Phe 370
375 380 Asn Arg Pro Phe Leu
Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385 390
395 400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys
Gln Ala 405 410
45412PRTArtificial SequenceSynthetic 45Met Arg Gly Ser His His His His
His His Ser Arg His Pro Asn Ser 1 5 10
15 Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp
Arg Gly Thr 20 25 30
His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser
35 40 45 Leu Tyr Lys Gln
Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe 50
55 60 Ser Pro Leu Ser Ile Ser Thr Ala
Leu Ala Phe Leu Ser Leu Gly Ala 65 70
75 80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu
Lys Phe Asn Leu 85 90
95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly Asn 115
120 125 Ala Met Phe Val Lys Glu Gln Leu
Ser Leu Leu Asp Arg Phe Thr Glu 130 135
140 Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr
Asp Phe Gln 145 150 155
160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly
165 170 175 Thr Arg Gly Lys
Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr 180
185 190 Met Met Val Leu Val Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Glu Met 195 200
205 Pro Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu
Ser Lys 210 215 220
Lys Lys Trp Val Met Val Pro Met Met Ser Leu His His Leu Thr Ile 225
230 235 240 Pro Tyr Phe Arg Asp
Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys 245
250 255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile
Leu Pro Asp Gln Asp Lys 260 265
270 Met Glu Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg
Trp 275 280 285 Arg
Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290
295 300 Phe Ser Ile Ser Arg Asp
Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305 310
315 320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp
Leu Ser Gly Ile Thr 325 330
335 Gly Ala Arg Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu
340 345 350 Asp Val
Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala Val Lys 355
360 365 Gln Arg Leu Arg Asp Ala Leu
Val Glu Thr Arg Thr Ile Val Arg Phe 370 375
380 Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp
Thr Gln Asn Ile 385 390 395
400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys Gln Ala 405
410 46412PRTArtificial SequenceSynthetic 46Met
Arg Gly Ser His His His His His His Ser Arg His Pro Asn Ser 1
5 10 15 Pro Leu Asp Glu Glu Asn
Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr 20
25 30 His Val Asp Leu Gly Leu Ala Ser Ala Asn
Val Asp Phe Ala Phe Ser 35 40
45 Leu Tyr Lys Gln Leu Val Leu Lys Ala Pro Asp Lys Asn Val
Ile Phe 50 55 60
Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser Leu Gly Ala 65
70 75 80 His Asn Thr Thr Leu
Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu 85
90 95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln
Ser Phe Gln His Leu Leu 100 105
110 Arg Thr Leu Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly
Asn 115 120 125 Ala
Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe Thr Glu 130
135 140 Asp Ala Lys Arg Leu Tyr
Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145 150
155 160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp
Tyr Val Lys Asn Gly 165 170
175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr
180 185 190 Met Met
Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu Met 195
200 205 Pro Phe Asp Pro Gln Asp Thr
His Gln Ser Arg Phe Tyr Leu Ser Lys 210 215
220 Lys Lys Trp Val Met Val Pro Met Met Ser Leu His
His Leu Thr Ile 225 230 235
240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys
245 250 255 Tyr Thr Gly
Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys 260
265 270 Met Glu Glu Val Glu Ala Met Leu
Leu Pro Glu Thr Leu Lys Arg Trp 275 280
285 Arg Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr
Leu Pro Lys 290 295 300
Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305
310 315 320 Gly Ile Glu Glu
Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr 325
330 335 Gly Ala Arg Asn Leu Ala Val Ser Gln
Val Val His Lys Ala Val Leu 340 345
350 Asp Val Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala
Val Lys 355 360 365
Ile Pro Asp Arg His Met Leu Val Glu Thr Arg Thr Ile Val Arg Phe 370
375 380 Asn Arg Pro Phe Leu
Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385 390
395 400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys
Gln Ala 405 410
47412PRTArtificial SequenceSynthetic 47Met Arg Gly Ser His His His His
His His Ser Arg His Pro Asn Ser 1 5 10
15 Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp
Arg Gly Thr 20 25 30
His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser
35 40 45 Leu Tyr Lys Gln
Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe 50
55 60 Ser Pro Leu Ser Ile Ser Thr Ala
Leu Ala Phe Leu Ser Leu Gly Ala 65 70
75 80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu
Lys Phe Asn Leu 85 90
95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly Asn 115
120 125 Ala Met Phe Val Lys Glu Gln Leu
Ser Leu Leu Asp Arg Phe Thr Glu 130 135
140 Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr
Asp Phe Gln 145 150 155
160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly
165 170 175 Thr Arg Gly Lys
Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr 180
185 190 Met Met Val Leu Val Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Glu Met 195 200
205 Pro Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu
Ser Lys 210 215 220
Lys Lys Trp Val Met Val Pro Met Met Ser Leu His His Leu Thr Ile 225
230 235 240 Pro Tyr Phe Arg Asp
Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys 245
250 255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile
Leu Pro Asp Gln Asp Lys 260 265
270 Met Glu Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg
Trp 275 280 285 Arg
Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290
295 300 Phe Ser Ile Ser Arg Asp
Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305 310
315 320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp
Leu Ser Gly Ile Thr 325 330
335 Gly Ala Arg Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu
340 345 350 Asp Val
Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala Val Lys 355
360 365 Thr Val Asp Tyr Ala Ala Leu
Val Glu Thr Arg Thr Ile Val Arg Phe 370 375
380 Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp
Thr Gln Asn Ile 385 390 395
400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys Gln Ala 405
410 48406PRTArtificial SequenceSynthetic 48Met
Arg Gly Ser His His His His His His Gly Ser Asp Asp Pro Gln 1
5 10 15 Gly Asp Ala Ala Gln Lys
Thr Asp Thr Ser His His Asp Gln Asp His 20
25 30 Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu
Ala Glu Phe Ala Phe Ser 35 40
45 Leu Tyr Arg Gln Leu Ala His Gln Ser Asn Ser Thr Asn Ile
Phe Phe 50 55 60
Ser Pro Val Ser Ile Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr 65
70 75 80 Lys Ala Asp Thr His
Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu 85
90 95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu
Gly Phe Gln Glu Leu Leu 100 105
110 Arg Thr Leu Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly
Asn 115 120 125 Gly
Leu Phe Leu Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu 130
135 140 Asp Val Lys Lys Leu Tyr
His Ser Glu Ala Phe Thr Val Asn Phe Gly 145 150
155 160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp
Tyr Val Glu Lys Gly 165 170
175 Thr Gln Gly Lys Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr
180 185 190 Val Phe
Ala Leu Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg 195
200 205 Pro Phe Glu Val Lys Asp Thr
Glu Glu Glu Asp Phe His Val Asp Gln 210 215
220 Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu
Gly Met Phe Asn 225 230 235
240 Ile Gln His Cys Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr
245 250 255 Leu Gly Asn
Ala Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu 260
265 270 Gln His Leu Glu Asn Glu Leu Thr
His Asp Ile Ile Thr Lys Phe Leu 275 280
285 Glu Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro
Lys Leu Ser 290 295 300
Ile Thr Gly Thr Tyr Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305
310 315 320 Thr Lys Val Phe
Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu 325
330 335 Ala Pro Leu Lys Leu Ser Lys Ala Val
His Lys Ala Val Leu Thr Ile 340 345
350 Asp Glu Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu
Ala Ile 355 360 365
Pro Met Ser Ile Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe 370
375 380 Leu Met Ile Glu Gln
Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val 385 390
395 400 Val Asn Pro Thr Gln Lys
405 49406PRTArtificial SequenceSynthetic 49Met Arg Gly Ser His His
His His His His Gly Ser Asp Asp Pro Gln 1 5
10 15 Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His
His Asp Gln Asp His 20 25
30 Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe
Ser 35 40 45 Leu
Tyr Arg Gln Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe 50
55 60 Ser Pro Val Ser Ile Ala
Thr Ala Phe Ala Met Leu Ser Leu Gly Thr 65 70
75 80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly
Leu Asn Phe Asn Leu 85 90
95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu
100 105 110 Arg Thr
Leu Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn 115
120 125 Gly Leu Phe Leu Ser Glu Gly
Leu Lys Leu Val Asp Lys Phe Leu Glu 130 135
140 Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr
Val Asn Phe Gly 145 150 155
160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly
165 170 175 Thr Gln Gly
Lys Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr 180
185 190 Val Phe Ala Leu Val Asn Tyr Ile
Phe Phe Lys Gly Lys Trp Glu Arg 195 200
205 Pro Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His
Val Asp Gln 210 215 220
Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn 225
230 235 240 Ile Gln His Cys
Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr 245
250 255 Leu Gly Asn Ala Thr Ala Ile Phe Phe
Leu Pro Asp Glu Gly Lys Leu 260 265
270 Gln His Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys
Phe Leu 275 280 285
Glu Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser 290
295 300 Ile Thr Gly Thr Tyr
Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305 310
315 320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu
Ser Gly Val Thr Glu Glu 325 330
335 Ala Pro Leu Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr
Ile 340 345 350 Asp
Glu Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Gly Ser 355
360 365 Leu Arg Ser Ile Pro Pro
Glu Val Lys Phe Asn Lys Pro Phe Val Phe 370 375
380 Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu
Phe Met Gly Lys Val 385 390 395
400 Val Asn Pro Thr Gln Lys 405
50406PRTArtificial SequenceSynthetic 50Met Arg Gly Ser His His His His
His His Gly Ser Asp Asp Pro Gln 1 5 10
15 Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His His Asp
Gln Asp His 20 25 30
Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser
35 40 45 Leu Tyr Arg Gln
Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe 50
55 60 Ser Pro Val Ser Ile Ala Thr Ala
Phe Ala Met Leu Ser Leu Gly Thr 65 70
75 80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly Leu
Asn Phe Asn Leu 85 90
95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn 115
120 125 Gly Leu Phe Leu Ser Glu Gly Leu
Lys Leu Val Asp Lys Phe Leu Glu 130 135
140 Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr Val
Asn Phe Gly 145 150 155
160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly
165 170 175 Thr Gln Gly Lys
Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr 180
185 190 Val Phe Ala Leu Val Asn Tyr Ile Phe
Phe Lys Gly Lys Trp Glu Arg 195 200
205 Pro Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His Val
Asp Gln 210 215 220
Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn 225
230 235 240 Ile Gln His Cys Lys
Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr 245
250 255 Leu Gly Asn Ala Thr Ala Ile Phe Phe Leu
Pro Asp Glu Gly Lys Leu 260 265
270 Gln His Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe
Leu 275 280 285 Glu
Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser 290
295 300 Ile Thr Gly Thr Tyr Asp
Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305 310
315 320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu Ser
Gly Val Thr Glu Glu 325 330
335 Ala Pro Leu Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile
340 345 350 Asp Glu
Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Gly Ser 355
360 365 Leu Arg Gly Ile Pro Pro Glu
Val Lys Phe Asn Lys Pro Phe Val Phe 370 375
380 Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu Phe
Met Gly Lys Val 385 390 395
400 Val Asn Pro Thr Gln Lys 405 51406PRTArtificial
SequenceSynthetic 51Met Arg Gly Ser His His His His His His Gly Ser Asp
Asp Pro Gln 1 5 10 15
Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His
20 25 30 Pro Thr Phe Asn
Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser 35
40 45 Leu Tyr Arg Gln Leu Ala His Gln Ser
Asn Ser Thr Asn Ile Phe Phe 50 55
60 Ser Pro Val Ser Ile Ala Thr Ala Phe Ala Met Leu Ser
Leu Gly Thr 65 70 75
80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu
85 90 95 Thr Glu Ile Pro
Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu 100
105 110 Arg Thr Leu Asn Gln Pro Asp Ser Gln
Leu Gln Leu Thr Thr Gly Asn 115 120
125 Gly Leu Phe Leu Ser Glu Gly Leu Lys Leu Val Asp Lys Phe
Leu Glu 130 135 140
Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr Val Asn Phe Gly 145
150 155 160 Asp Thr Glu Glu Ala
Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly 165
170 175 Thr Gln Gly Lys Ile Val Asp Leu Val Lys
Glu Leu Asp Arg Asp Thr 180 185
190 Val Phe Ala Leu Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu
Arg 195 200 205 Pro
Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln 210
215 220 Ala Thr Thr Val Lys Val
Pro Met Met Lys Arg Leu Gly Met Phe Asn 225 230
235 240 Ile Gln His Cys Lys Lys Leu Ser Ser Trp Val
Leu Leu Met Lys Tyr 245 250
255 Leu Gly Asn Ala Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu
260 265 270 Gln His
Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe Leu 275
280 285 Glu Asn Glu Asp Arg Arg Ser
Ala Ser Leu His Leu Pro Lys Leu Ser 290 295
300 Ile Thr Gly Thr Tyr Asp Leu Lys Ser Val Leu Gly
Gln Leu Gly Ile 305 310 315
320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu
325 330 335 Ala Pro Leu
Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile 340
345 350 Asp Glu Lys Gly Thr Glu Ala Ala
Gly Ala Met Phe Leu Glu Ala Ile 355 360
365 Pro Arg Gln Thr Asn Pro Glu Val Lys Phe Asn Lys Pro
Phe Val Phe 370 375 380
Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val 385
390 395 400 Val Asn Pro Thr
Gln Lys 405 52406PRTArtificial SequenceSynthetic
52Met Arg Gly Ser His His His His His His Gly Ser Asp Asp Pro Gln 1
5 10 15 Gly Asp Ala Ala
Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His 20
25 30 Pro Thr Phe Asn Lys Ile Thr Pro Asn
Leu Ala Glu Phe Ala Phe Ser 35 40
45 Leu Tyr Arg Gln Leu Ala His Gln Ser Asn Ser Thr Asn Ile
Phe Phe 50 55 60
Ser Pro Val Ser Ile Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr 65
70 75 80 Lys Ala Asp Thr His
Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu 85
90 95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu
Gly Phe Gln Glu Leu Leu 100 105
110 Arg Thr Leu Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly
Asn 115 120 125 Gly
Leu Phe Leu Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu 130
135 140 Asp Val Lys Lys Leu Tyr
His Ser Glu Ala Phe Thr Val Asn Phe Gly 145 150
155 160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp
Tyr Val Glu Lys Gly 165 170
175 Thr Gln Gly Lys Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr
180 185 190 Val Phe
Ala Leu Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg 195
200 205 Pro Phe Glu Val Lys Asp Thr
Glu Glu Glu Asp Phe His Val Asp Gln 210 215
220 Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu
Gly Met Phe Asn 225 230 235
240 Ile Gln His Cys Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr
245 250 255 Leu Gly Asn
Ala Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu 260
265 270 Gln His Leu Glu Asn Glu Leu Thr
His Asp Ile Ile Thr Lys Phe Leu 275 280
285 Glu Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro
Lys Leu Ser 290 295 300
Ile Thr Gly Thr Tyr Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305
310 315 320 Thr Lys Val Phe
Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu 325
330 335 Ala Pro Leu Lys Leu Ser Lys Ala Val
His Lys Ala Val Leu Thr Ile 340 345
350 Asp Glu Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu
Ala Ile 355 360 365
Gly Arg Gln Thr Asn Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe 370
375 380 Leu Met Ile Glu Gln
Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val 385 390
395 400 Val Asn Pro Thr Gln Lys
405 53406PRTArtificial SequenceSynthetic 53Met Arg Gly Ser His His
His His His His Gly Ser Asp Asp Pro Gln 1 5
10 15 Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His
His Asp Gln Asp His 20 25
30 Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe
Ser 35 40 45 Leu
Tyr Arg Gln Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe 50
55 60 Ser Pro Val Ser Ile Ala
Thr Ala Phe Ala Met Leu Ser Leu Gly Thr 65 70
75 80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly
Leu Asn Phe Asn Leu 85 90
95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu
100 105 110 Arg Thr
Leu Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn 115
120 125 Gly Leu Phe Leu Ser Glu Gly
Leu Lys Leu Val Asp Lys Phe Leu Glu 130 135
140 Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr
Val Asn Phe Gly 145 150 155
160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly
165 170 175 Thr Gln Gly
Lys Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr 180
185 190 Val Phe Ala Leu Val Asn Tyr Ile
Phe Phe Lys Gly Lys Trp Glu Arg 195 200
205 Pro Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His
Val Asp Gln 210 215 220
Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn 225
230 235 240 Ile Gln His Cys
Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr 245
250 255 Leu Gly Asn Ala Thr Ala Ile Phe Phe
Leu Pro Asp Glu Gly Lys Leu 260 265
270 Gln His Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys
Phe Leu 275 280 285
Glu Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser 290
295 300 Ile Thr Gly Thr Tyr
Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305 310
315 320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu
Ser Gly Val Thr Glu Glu 325 330
335 Ala Pro Leu Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr
Ile 340 345 350 Asp
Glu Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Ala Asn 355
360 365 Gln Arg Ser Ser Pro Pro
Glu Val Lys Phe Asn Lys Pro Phe Val Phe 370 375
380 Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu
Phe Met Gly Lys Val 385 390 395
400 Val Asn Pro Thr Gln Lys 405
54406PRTArtificial SequenceSynthetic 54Met Arg Gly Ser His His His His
His His Gly Ser Asp Asp Pro Gln 1 5 10
15 Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His His Asp
Gln Asp His 20 25 30
Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser
35 40 45 Leu Tyr Arg Gln
Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe 50
55 60 Ser Pro Val Ser Ile Ala Thr Ala
Phe Ala Met Leu Ser Leu Gly Thr 65 70
75 80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly Leu
Asn Phe Asn Leu 85 90
95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn 115
120 125 Gly Leu Phe Leu Ser Glu Gly Leu
Lys Leu Val Asp Lys Phe Leu Glu 130 135
140 Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr Val
Asn Phe Gly 145 150 155
160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly
165 170 175 Thr Gln Gly Lys
Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr 180
185 190 Val Phe Ala Leu Val Asn Tyr Ile Phe
Phe Lys Gly Lys Trp Glu Arg 195 200
205 Pro Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His Val
Asp Gln 210 215 220
Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn 225
230 235 240 Ile Gln His Cys Lys
Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr 245
250 255 Leu Gly Asn Ala Thr Ala Ile Phe Phe Leu
Pro Asp Glu Gly Lys Leu 260 265
270 Gln His Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe
Leu 275 280 285 Glu
Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser 290
295 300 Ile Thr Gly Thr Tyr Asp
Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305 310
315 320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu Ser
Gly Val Thr Glu Glu 325 330
335 Ala Pro Leu Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile
340 345 350 Asp Glu
Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Ala Leu 355
360 365 Gln Arg Ala Ile Pro Pro Glu
Val Lys Phe Asn Lys Pro Phe Val Phe 370 375
380 Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu Phe
Met Gly Lys Val 385 390 395
400 Val Asn Pro Thr Gln Lys 405 55406PRTArtificial
SequenceSynthetic 55Met Arg Gly Ser His His His His His His Gly Ser Asp
Asp Pro Gln 1 5 10 15
Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His
20 25 30 Pro Thr Phe Asn
Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser 35
40 45 Leu Tyr Arg Gln Leu Ala His Gln Ser
Asn Ser Thr Asn Ile Phe Phe 50 55
60 Ser Pro Val Ser Ile Ala Thr Ala Phe Ala Met Leu Ser
Leu Gly Thr 65 70 75
80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu
85 90 95 Thr Glu Ile Pro
Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu 100
105 110 Arg Thr Leu Asn Gln Pro Asp Ser Gln
Leu Gln Leu Thr Thr Gly Asn 115 120
125 Gly Leu Phe Leu Ser Glu Gly Leu Lys Leu Val Asp Lys Phe
Leu Glu 130 135 140
Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr Val Asn Phe Gly 145
150 155 160 Asp Thr Glu Glu Ala
Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly 165
170 175 Thr Gln Gly Lys Ile Val Asp Leu Val Lys
Glu Leu Asp Arg Asp Thr 180 185
190 Val Phe Ala Leu Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu
Arg 195 200 205 Pro
Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln 210
215 220 Ala Thr Thr Val Lys Val
Pro Met Met Lys Arg Leu Gly Met Phe Asn 225 230
235 240 Ile Gln His Cys Lys Lys Leu Ser Ser Trp Val
Leu Leu Met Lys Tyr 245 250
255 Leu Gly Asn Ala Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu
260 265 270 Gln His
Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe Leu 275
280 285 Glu Asn Glu Asp Arg Arg Ser
Ala Ser Leu His Leu Pro Lys Leu Ser 290 295
300 Ile Thr Gly Thr Tyr Asp Leu Lys Ser Val Leu Gly
Gln Leu Gly Ile 305 310 315
320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu
325 330 335 Ala Pro Leu
Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile 340
345 350 Asp Glu Lys Gly Thr Glu Ala Ala
Gly Ala Met Phe Leu Glu Gln Arg 355 360
365 Leu Arg Asp Ile Pro Pro Glu Val Lys Phe Asn Lys Pro
Phe Val Phe 370 375 380
Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val 385
390 395 400 Val Asn Pro Thr
Gln Lys 405 56406PRTArtificial SequenceSynthetic
56Met Arg Gly Ser His His His His His His Gly Ser Asp Asp Pro Gln 1
5 10 15 Gly Asp Ala Ala
Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His 20
25 30 Pro Thr Phe Asn Lys Ile Thr Pro Asn
Leu Ala Glu Phe Ala Phe Ser 35 40
45 Leu Tyr Arg Gln Leu Ala His Gln Ser Asn Ser Thr Asn Ile
Phe Phe 50 55 60
Ser Pro Val Ser Ile Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr 65
70 75 80 Lys Ala Asp Thr His
Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu 85
90 95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu
Gly Phe Gln Glu Leu Leu 100 105
110 Arg Thr Leu Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly
Asn 115 120 125 Gly
Leu Phe Leu Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu 130
135 140 Asp Val Lys Lys Leu Tyr
His Ser Glu Ala Phe Thr Val Asn Phe Gly 145 150
155 160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp
Tyr Val Glu Lys Gly 165 170
175 Thr Gln Gly Lys Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr
180 185 190 Val Phe
Ala Leu Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg 195
200 205 Pro Phe Glu Val Lys Asp Thr
Glu Glu Glu Asp Phe His Val Asp Gln 210 215
220 Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu
Gly Met Phe Asn 225 230 235
240 Ile Gln His Cys Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr
245 250 255 Leu Gly Asn
Ala Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu 260
265 270 Gln His Leu Glu Asn Glu Leu Thr
His Asp Ile Ile Thr Lys Phe Leu 275 280
285 Glu Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro
Lys Leu Ser 290 295 300
Ile Thr Gly Thr Tyr Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305
310 315 320 Thr Lys Val Phe
Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu 325
330 335 Ala Pro Leu Lys Leu Ser Lys Ala Val
His Lys Ala Val Leu Thr Ile 340 345
350 Asp Glu Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu
Ala Pro 355 360 365
Asp Arg His Met Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe 370
375 380 Leu Met Ile Glu Gln
Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val 385 390
395 400 Val Asn Pro Thr Gln Lys
405 57406PRTArtificial SequenceSynthetic 57Met Arg Gly Ser His His
His His His His Gly Ser Asp Asp Pro Gln 1 5
10 15 Gly Asp Ala Ala Gln Lys Thr Asp Thr Ser His
His Asp Gln Asp His 20 25
30 Pro Thr Phe Asn Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe
Ser 35 40 45 Leu
Tyr Arg Gln Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe 50
55 60 Ser Pro Val Ser Ile Ala
Thr Ala Phe Ala Met Leu Ser Leu Gly Thr 65 70
75 80 Lys Ala Asp Thr His Asp Glu Ile Leu Glu Gly
Leu Asn Phe Asn Leu 85 90
95 Thr Glu Ile Pro Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu
100 105 110 Arg Thr
Leu Asn Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn 115
120 125 Gly Leu Phe Leu Ser Glu Gly
Leu Lys Leu Val Asp Lys Phe Leu Glu 130 135
140 Asp Val Lys Lys Leu Tyr His Ser Glu Ala Phe Thr
Val Asn Phe Gly 145 150 155
160 Asp Thr Glu Glu Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly
165 170 175 Thr Gln Gly
Lys Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr 180
185 190 Val Phe Ala Leu Val Asn Tyr Ile
Phe Phe Lys Gly Lys Trp Glu Arg 195 200
205 Pro Phe Glu Val Lys Asp Thr Glu Glu Glu Asp Phe His
Val Asp Gln 210 215 220
Ala Thr Thr Val Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn 225
230 235 240 Ile Gln His Cys
Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr 245
250 255 Leu Gly Asn Ala Thr Ala Ile Phe Phe
Leu Pro Asp Glu Gly Lys Leu 260 265
270 Gln His Leu Glu Asn Glu Leu Thr His Asp Ile Ile Thr Lys
Phe Leu 275 280 285
Glu Asn Glu Asp Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser 290
295 300 Ile Thr Gly Thr Tyr
Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile 305 310
315 320 Thr Lys Val Phe Ser Asn Gly Ala Asp Leu
Ser Gly Val Thr Glu Glu 325 330
335 Ala Pro Leu Lys Leu Ser Lys Ala Val His Lys Ala Val Leu Thr
Ile 340 345 350 Asp
Glu Lys Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Thr Val 355
360 365 Asp Tyr Ala Ile Pro Pro
Glu Val Lys Phe Asn Lys Pro Phe Val Phe 370 375
380 Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu
Phe Met Gly Lys Val 385 390 395
400 Val Asn Pro Thr Gln Lys 405
58412PRTArtificial SequenceSynthetic 58Met Arg Gly Ser His His His His
His His Ser Arg His Pro Asn Ser 1 5 10
15 Pro Leu Asp Glu Glu Asn Leu Thr Gln Glu Asn Gln Asp
Arg Gly Thr 20 25 30
His Val Asp Leu Gly Leu Ala Ser Ala Asn Val Asp Phe Ala Phe Ser
35 40 45 Leu Tyr Lys Gln
Leu Val Leu Lys Ala Pro Asp Lys Asn Val Ile Phe 50
55 60 Ser Pro Leu Ser Ile Ser Thr Ala
Leu Ala Phe Leu Ser Leu Gly Ala 65 70
75 80 His Asn Thr Thr Leu Thr Glu Ile Leu Lys Gly Leu
Lys Phe Asn Leu 85 90
95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln Ser Phe Gln His Leu Leu
100 105 110 Arg Thr Leu
Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly Asn 115
120 125 Ala Met Phe Val Lys Glu Gln Leu
Ser Leu Leu Asp Arg Phe Thr Glu 130 135
140 Asp Ala Lys Arg Leu Tyr Gly Ser Glu Ala Phe Ala Thr
Asp Phe Gln 145 150 155
160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp Tyr Val Lys Asn Gly
165 170 175 Thr Arg Gly Lys
Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr 180
185 190 Met Met Val Leu Val Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Glu Met 195 200
205 Pro Phe Asp Pro Gln Asp Thr His Gln Ser Arg Phe Tyr Leu
Ser Lys 210 215 220
Lys Lys Trp Val Met Val Pro Met Met Ser Leu His His Leu Thr Ile 225
230 235 240 Pro Tyr Phe Arg Asp
Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys 245
250 255 Tyr Thr Gly Asn Ala Ser Ala Leu Phe Ile
Leu Pro Asp Gln Asp Lys 260 265
270 Met Glu Glu Val Glu Ala Met Leu Leu Pro Glu Thr Leu Lys Arg
Trp 275 280 285 Arg
Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr Leu Pro Lys 290
295 300 Phe Ser Ile Ser Arg Asp
Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305 310
315 320 Gly Ile Glu Glu Ala Phe Thr Ser Lys Ala Asp
Leu Ser Gly Ile Thr 325 330
335 Gly Ala Arg Asn Leu Ala Val Ser Gln Val Val His Lys Ala Val Leu
340 345 350 Asp Val
Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala Val Val 355
360 365 Gly Ser Leu Arg Ser Ala Leu
Val Glu Thr Arg Thr Ile Val Arg Phe 370 375
380 Asn Arg Pro Phe Leu Met Ile Ile Val Pro Thr Asp
Thr Gln Asn Ile 385 390 395
400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys Gln Ala 405
410 59412PRTArtificial SequenceSynthetic 59Met
Arg Gly Ser His His His His His His Ser Arg His Pro Asn Ser 1
5 10 15 Pro Leu Asp Glu Glu Asn
Leu Thr Gln Glu Asn Gln Asp Arg Gly Thr 20
25 30 His Val Asp Leu Gly Leu Ala Ser Ala Asn
Val Asp Phe Ala Phe Ser 35 40
45 Leu Tyr Lys Gln Leu Val Leu Lys Ala Pro Asp Lys Asn Val
Ile Phe 50 55 60
Ser Pro Leu Ser Ile Ser Thr Ala Leu Ala Phe Leu Ser Leu Gly Ala 65
70 75 80 His Asn Thr Thr Leu
Thr Glu Ile Leu Lys Gly Leu Lys Phe Asn Leu 85
90 95 Thr Glu Thr Ser Glu Ala Glu Ile His Gln
Ser Phe Gln His Leu Leu 100 105
110 Arg Thr Leu Asn Gln Ser Ser Asp Glu Leu Gln Leu Ser Met Gly
Asn 115 120 125 Ala
Met Phe Val Lys Glu Gln Leu Ser Leu Leu Asp Arg Phe Thr Glu 130
135 140 Asp Ala Lys Arg Leu Tyr
Gly Ser Glu Ala Phe Ala Thr Asp Phe Gln 145 150
155 160 Asp Ser Ala Ala Ala Lys Lys Leu Ile Asn Asp
Tyr Val Lys Asn Gly 165 170
175 Thr Arg Gly Lys Ile Thr Asp Leu Ile Lys Asp Leu Asp Ser Gln Thr
180 185 190 Met Met
Val Leu Val Asn Tyr Ile Phe Phe Lys Ala Lys Trp Glu Met 195
200 205 Pro Phe Asp Pro Gln Asp Thr
His Gln Ser Arg Phe Tyr Leu Ser Lys 210 215
220 Lys Lys Trp Val Met Val Pro Met Met Ser Leu His
His Leu Thr Ile 225 230 235
240 Pro Tyr Phe Arg Asp Glu Glu Leu Ser Cys Thr Val Val Glu Leu Lys
245 250 255 Tyr Thr Gly
Asn Ala Ser Ala Leu Phe Ile Leu Pro Asp Gln Asp Lys 260
265 270 Met Glu Glu Val Glu Ala Met Leu
Leu Pro Glu Thr Leu Lys Arg Trp 275 280
285 Arg Asp Ser Leu Glu Phe Arg Glu Ile Gly Glu Leu Tyr
Leu Pro Lys 290 295 300
Phe Ser Ile Ser Arg Asp Tyr Asn Leu Asn Asp Ile Leu Leu Gln Leu 305
310 315 320 Gly Ile Glu Glu
Ala Phe Thr Ser Lys Ala Asp Leu Ser Gly Ile Thr 325
330 335 Gly Ala Arg Asn Leu Ala Val Ser Gln
Val Val His Lys Ala Val Leu 340 345
350 Asp Val Phe Glu Glu Gly Thr Glu Ala Ser Ala Ala Thr Ala
Val Lys 355 360 365
Ile Thr Leu Arg Gln Thr Asn Asp Glu Thr Arg Thr Ile Val Arg Phe 370
375 380 Asn Arg Pro Phe Leu
Met Ile Ile Val Pro Thr Asp Thr Gln Asn Ile 385 390
395 400 Phe Phe Met Ser Lys Val Thr Asn Pro Lys
Gln Ala 405 410 6027DNAArtificial
SequenceSynthetic 60gcacaatggt acgcgtctcc actaatg
276148DNAArtificial SequenceSynthetic 61taccgcggtc
aaaatcaccc tccgttctcg agcagtggag acgcgtga
486248DNAArtificial SequenceSynthetic 62taccgcggtc aaaatcacca ggaggtctat
cgatgtggag acgcgtga 486348DNAArtificial
SequenceSynthetic 63taccgcggtc aaaatcaggg ggagatctga gttagtggag acgcgtga
486448DNAArtificial SequenceSynthetic 64taccgcggtc
aaaatcaagc ttagaacaac attagtggag accgctga
486548DNAArtificial SequenceSynthetic 65taccgcggtc aaaatcatga caagatctaa
cttagtggag acgcgtga 486648DNAArtificial
SequenceSynthetic 66taccgcggtc aaaatcaccg agcgtgtctc gcccgtggag acgcgtga
486716DNAArtificial SequenceSynthetic 67taccgcggtc aaaatc
166814DNAArtificial
SequenceSynthetic 68tcacgcgtgt ccac
146929DNAArtificial SequenceSynthetic 69aggatgagga
attcataatt ggtggccat
297029DNAArtificial SequenceSynthetic 70cccaccgtct agaccatcat ttgtcccgc
297126DNAArtificial SequenceSynthetic
71tatggatccg atgatcccca gggaga
267226DNAArtificial SequenceSynthetic 72cgcgaagctt ttatttttgg gtggga
267336DNAArtificial SequenceSynthetic
73actgaagctg ctggcgccga gctcttagag gccata
367425DNAArtificial SequenceSynthetic 74gtctatcccc cctgaggtca agttc
257549DNAArtificial SequenceSynthetic
75ccatgtttct agaggctctg cagcgtgcta tcccgcctga ggtcaagtt
497649DNAArtificial SequenceSynthetic 76ccatgtttct agagaccgtt gactacgcta
tcccgcctga ggtcaagtt 497748DNAArtificial
SequenceSynthetic 77taccgcggtc aaaatcctgc agcgtgctat cctggtggag acgcgtga
487848DNAArtificial SequenceSynthetic 78taccgcggtc
aaaaccgttg actacgctgc tctggtggag acgcgtga
487921DNAArtificial SequenceSynthetic 79gctggcgcca tgtttctaga g
218020DNAArtificial SequenceSynthetic
80ttgttgaact tgacctcagg
208114DNAArtificial SequenceSynthetic 81gtaccgcggt caaa
148214DNAArtificial SequenceSynthetic
82tcacgcgtgt ccac
148320DNAArtificial SequenceSynthetic 83tgagctagtc tagataggtg
208417DNAArtificial SequenceSynthetic
84tgcagcgact gctatga
178520PRTHomo sapiens 85Gly Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Ala
Ile Pro Met Ser 1 5 10
15 Ile Pro Pro Glu 20 8620PRTHomo sapiens 86Gly Thr Glu
Ala Thr Gly Ala Pro His Leu Glu Glu Lys Ala Trp Ser 1 5
10 15 Lys Tyr Gln Thr 20
8720PRTHomo sapiens 87Gly Val Glu Ala Ala Ala Ala Thr Ser Ile Ala Met Ser
Arg Met Ser 1 5 10 15
Leu Ser Ser Phe 20 8820PRTHomo sapiens 88Gly Thr Glu Ala
Ser Ala Ala Thr Ala Val Lys Ile Thr Leu Leu Ser 1 5
10 15 Ala Leu Val Glu 20
8920PRTHomo sapiens 89Gly Ser Glu Ala Ala Ala Ser Thr Ala Val Val Ile Ala
Gly Arg Ser 1 5 10 15
Leu Asn Pro Asn 20 9020PRTHomo sapiens 90Gly Thr Glu Ala
Ala Ala Gly Ser Gly Ser Glu Ile Asp Ile Arg Ile 1 5
10 15 Arg Val Pro Ser 20
9120PRTHomo sapiens 91Gly Asn Pro Phe Asp Gln Asp Ile Tyr Gly Arg Glu Glu
Leu Arg Ser 1 5 10 15
Pro Lys Leu Phe 20 9220PRTHomo sapiens 92Gly Thr Lys Ala
Ser Ala Ala Thr Thr Ala Ile Leu Ile Ala Arg Ser 1 5
10 15 Ser Pro Pro Trp 20
9320PRTHomo sapiens 93Gly Thr Gln Ala Thr Thr Val Thr Thr Val Gly Phe Met
Pro Leu Ser 1 5 10 15
Thr Gln Val Arg 20 9420PRTHomo sapiens 94Gly Val Glu Ala
Ala Ala Ala Ser Ala Ile Ser Val Ala Arg Thr Leu 1 5
10 15 Leu Val Phe Glu 20
9520PRTHomo sapiens 95Gly Thr Glu Ala Ala Ala Ala Thr Ala Gly Ile Ala Thr
Phe Cys Met 1 5 10 15
Leu Met Pro Glu 20 9620PRTHomo sapiens 96Gly Thr Arg Ala
Ala Ala Ala Thr Gly Thr Ile Phe Thr Phe Arg Ser 1 5
10 15 Ala Arg Leu Asn 20
9720PRTHomo sapiens 97Gly Thr Glu Ala Ala Ala Ala Thr Thr Phe Ala Ile Lys
Phe Phe Ser 1 5 10 15
Ala Gln Thr Asn 20 9820PRTHomo sapiens 98Gly Gly Asp Ser
Ile Glu Val Pro Gly Ala Arg Ile Leu Gln His Lys 1 5
10 15 Asp Glu Leu Asn 20
9920PRTHomo sapiens 99Gly Ser Glu Ala Ala Ala Val Ser Gly Met Ile Ala Ile
Ser Arg Met 1 5 10 15
Ala Val Leu Tyr 20 10020PRTHomo sapiens 100Gly Thr Val Ala
Ser Ser Ser Thr Ala Val Ile Val Ser Ala Arg Met 1 5
10 15 Ala Pro Glu Glu 20
10120PRTHomo sapiens 101Gly Thr Glu Ala Ala Ala Gly Thr Gly Gly Val Met
Thr Gly Arg Thr 1 5 10
15 Gly His Gly Gly 20 10220PRTHomo sapiens 102Gly Ala
Gly Thr Thr Pro Ser Pro Gly Leu Gln Pro Ala His Leu Thr 1 5
10 15 Phe Pro Leu Asp
20 10320PRTHomo sapiens 103Gly Thr Glu Ala Ala Ala Ala Thr Ala Ala Ile
Met Met Met Arg Cys 1 5 10
15 Ala Arg Phe Val 20 10420PRTHomo sapiens 104Gly Thr
Glu Ala Ala Ala Ala Thr Ala Val Val Arg Asn Ser Arg Cys 1 5
10 15 Ser Arg Met Glu
20 10520PRTHomo sapiens 105Gly Thr Glu Ala Ala Ala Ala Ser Ser Cys Phe
Val Val Ala Glu Cys 1 5 10
15 Cys Met Glu Ser 20 10620PRTHomo sapiens 106Gly Ala
Glu Ala Ala Ala Ala Thr Ala Val Val Gly Phe Gly Ser Ser 1 5
10 15 Pro Ala Ser Thr
20 10720PRTHomo sapiens 107Gly Val Glu Ala Ala Ala Ala Thr Ala Val Val
Val Val Glu Leu Ser 1 5 10
15 Ser Pro Ser Thr 20 10820PRTHomo sapiens 108Gly Thr
Glu Ala Ala Ala Val Pro Glu Val Glu Leu Ser Asp Gln Pro 1 5
10 15 Glu Asn Thr Phe
20 10920PRTHomo sapiens 109Gly Thr Glu Ala Thr Ala Ala Thr Gly Ser Asn
Ile Val Glu Lys Gln 1 5 10
15 Leu Pro Gln Ser 20 11020PRTHomo sapiens 110Gly Ser
Glu Ala Ala Thr Ser Thr Gly Ile His Ile Pro Val Ile Met 1 5
10 15 Ser Leu Ala Gln
20 11125DNAArtificial SequenceSynthetic sequence 111gtgattttga
ccgcggtggc agcag
2511227DNAArtificial SequenceSynthetic sequence 112gcacaatggt acgcgtctcc
actaatg 2711370DNAArtificial
SequenceSynthetic sequence 113tgagctagtc tagataggtg gcggtnnsnn snnsnnsnns
gggtcgacgt cggtcatagc 60agtcgctgca
7011420DNAArtificial SequenceSynthetic sequence
114acaatgagct gcgtgtggct
2011521DNAArtificial SequenceSynthetic sequence 115tctccttaat gtcacgcacg
a 2111613PRTArtificial
SequenceSynthetic sequence 116Gly Ala Leu Gly Gly Xaa Xaa Xaa Xaa Xaa Gly
Ser Thr 1 5 10
1175PRTArtificial SequenceSynthetic sequence 117Gly Gly Gly Gly Gly 1
5 1185PRTArtificial SequenceSynthetic sequence 118Val Gly Ser
Leu Arg 1 5 1195PRTArtificial SequenceSynthetic sequence
119Arg Gln Thr Asn Asp 1 5 1205PRTArtificial
SequenceSynthetic sequence 120Asn Gln Arg Ser Ser 1 5
1215PRTArtificial SequenceSynthetic sequence 121Leu Gln Arg Ala Ile 1
5 1225PRTArtificial SequenceSynthetic sequence 122Gln Arg Leu
Arg Asp 1 5 1235PRTArtificial SequenceSynthetic sequence
123Pro Asp Arg His Met 1 5 1245PRTArtificial
SequenceSynthetic sequence 124Leu Ser Gly Gly Arg 1 5
1255PRTArtificial SequenceSynthetic sequence 125Leu Ser Arg Asp Asn 1
5 1265PRTArtificial SequenceSynthetic sequence 126Arg Gly Lys
Thr Asn 1 5 1275PRTArtificial SequenceSynthetic sequence
127Asn Asn Lys Leu Arg 1 5 1285PRTArtificial
SequenceSynthetic sequence 128Arg Val Thr Ser Thr 1 5
1295PRTArtificial SequenceSynthetic sequence 129Val Val Met Lys Asp 1
5 1305PRTArtificial SequenceSynthetic sequence 130Thr Val Asp
Tyr Ala 1 5 1315PRTArtificial SequenceSynthetic sequence
131Ala Tyr Gly Tyr Lys 1 5 1325PRTArtificial
SequenceSynthetic sequence 132Val Gly Leu Tyr Asp 1 5
1335PRTArtificial SequenceSynthetic sequence 133Tyr Gln Ser Leu Asn 1
5 1345PRTArtificial SequenceSynthetic sequence 134Thr Ser Tyr
Leu Asn 1 5 1354PRTArtificial SequenceSynthetic sequence
135Ala Ala Pro Phe 1 1364PRTArtificial SequenceSynthetic
sequence 136Ala Ala Pro Val 1 1375PRTArtificial
SequenceSynthetic sequence 137Thr Phe Arg Ser Ala 1 5
1385PRTArtificial SequenceSynthetic sequence 138Thr Leu Leu Ser Ala 1
5 1396PRTArtificial SequenceSynthetic sequence 139Gly Arg Gln
Thr Asn Asp 1 5 1405PRTArtificial SequenceSynthetic
sequence 140Ile Pro Met Ser Ile 1 5 1416PRTArtificial
SequenceSynthetic sequence 141Val Gly Ser Leu Arg Gly 1 5
1425PRTArtificial SequenceSynthetic sequence 142Met Gln Val Lys His 1
5 1435PRTArtificial SequenceSynthetic sequence 143Thr Thr
Asp Leu Arg 1 5 1445PRTArtificial SequenceSynthetic
sequence 144Ser Thr Lys Gly Ile 1 5 1455PRTArtificial
SequenceSynthetic sequence 145Lys Leu Lys Glu Thr 1 5
1465PRTArtificial SequenceSynthetic sequence 146Arg Val Asp Thr Gly 1
5 1475PRTArtificial SequenceSynthetic sequence 147Gly His Arg
Ile Asn 1 5 1485PRTArtificial SequenceSynthetic sequence
148Ser Asp Lys Val Tyr 1 5 1495PRTArtificial
SequenceSynthetic sequence 149His Glu Thr Leu Lys 1 5
1505PRTArtificial SequenceSynthetic sequence 150Met Gln Ala Thr Lys 1
5 1515PRTArtificial SequenceSynthetic sequence 151Glu Ala Pro
Ala Lys 1 5 1525PRTArtificial SequenceSynthetic sequence
152Pro Val His Leu Tyr 1 5 1535PRTArtificial
SequenceSynthetic sequence 153Gln Pro Asn Gly Tyr 1 5
1545PRTArtificial SequenceSynthetic sequence 154Ala Tyr Gly Leu Ala 1
5 1555PRTArtificial SequenceSynthetic sequence 155Tyr Gln Asn
Ser Ser 1 5 1565PRTArtificial SequenceSynthetic sequence
156Ser Ala Val Arg Pro 1 5 1575PRTArtificial
SequenceSynthetic sequence 157Leu Arg Ser Arg Ala 1 5
1585PRTArtificial SequenceSynthetic sequence 158Arg Arg Ser Ile Asp 1
5 1595PRTArtificial SequenceSynthetic sequence 159Arg Gly Arg
Ser Glu 1 5 1605PRTArtificial SequenceSynthetic sequence
160Lys Leu Arg Thr Thr 1 5 1615PRTArtificial
SequenceSynthetic sequence 161Met Thr Arg Ser Asn 1 5
1625PRTArtificial SequenceSynthetic sequence 162Glu Arg Val Ser Pro 1
5 1634PRTArtificial SequenceSynthetic sequence 163Leu Leu Ser
Ala 1
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20160156605 | A METHOD FOR RETRIEVING INTERNET AUTHENTICATION INFORMATION AND MEANS THEREOF |
20160156604 | METHOD AND CLOUD SERVER FOR MANAGING DEVICE |
20160156603 | Low Power Secure User Identity Authentication Ring |
20160156602 | Systems and Methods for Application Identification |
20160156601 | DISTRIBUTED BACKUP AND RETRIEVAL SYSTEM |