Patent application title: COMPOSITIONS AND METHODS FOR PREVENTING AND TREATING DISEASE
Inventors:
IPC8 Class: AC12Q102FI
USPC Class:
1 1
Class name:
Publication date: 2019-03-07
Patent application number: 20190071706
Abstract:
A method for increasing production of a polypeptide in a bacterial cell
in culture is provided. The method can comprise contacting a bacterial
cell in a culture medium with an amount of an albumin polypeptide
sufficient to induce an increase in accumulation of the polypeptide in
the bacterial cell and/or an increase in secretion of the polypeptide
from the bacterial cell into the culture medium relative to a bacterial
cell grown in a culture medium in the absence of the albumin polypeptide.
The bacterial cell can be a Bordetella species cell, optionally wherein
the Bordetella species cell is a Bordetella pertussis cell, a Bordetella
bronchiseptica cell or a Bordetella parapertussis cell. Kits, vaccine
production methods, screening methods and therapeutic methods are also
disclosed.Claims:
1. A method for increasing production of a polypeptide in a bacterial
cell in culture, the method comprising contacting a bacterial cell in a
culture medium with an amount of an albumin polypeptide sufficient to
induce an increase in accumulation of the polypeptide in the bacterial
cell and/or an increase in secretion of the polypeptide from the
bacterial cell into the culture medium relative to a bacterial cell grown
in a culture medium in the absence of the albumin polypeptide.
2. The method of claim 1, wherein the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
3. The method of claim 1 or claim 2, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment or thereof; or a combination thereof.
4. The method of any one of claims 1-3, wherein the culture medium comprises sufficient calcium to enhance secretion of the polypeptide from the bacterial cell into the culture medium.
5. The method of claim 4, wherein the concentration of calcium in the culture medium is at least about 0.5 mM.
6. The method of claim 1, wherein the amount of the albumin polypeptide is at least 0.2 mg/ml in the culture medium.
7. A kit comprising albumin and instructions for its use in increasing accumulation of a polypeptide in a bacterial cell in a culture medium and/or for increasing secretion of the polypeptide from the bacterial cell into a culture medium.
8. The kit of claim 7, wherein the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
9. The kit of claim 7 or claim 8, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof.
10. The kit of any one of claims 7-9, wherein the kit further comprises calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the bacterial cell into the culture medium.
11. The kit of any one of claims 7-10, further comprising a ligand adapted for removing the albumin from the culture medium.
12. The kit of claim 11, wherein the ligand binds specifically to the albumin when the albumin is present in the culture medium.
13. The kit of claim 12, wherein the ligand is an antibody or a fragment or derivative thereof.
14. The kit of any one of claims 11-13, wherein the ligand comprises a bead, optionally a magnetic bead, to which the albumin is directly or indirectly conjugated.
15. The kit of claim 14, wherein the albumin is indirectly conjugated to the bead via a tether, optionally wherein the tether comprising an antibody or a fragment or derivative thereof that specifically binds to the albumin and is conjugated to the bead.
16. A method for screening for a molecule that inhibits albumin-induced signaling in a bacterial cell, the method comprising: a. contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises at least 0.5 mM calcium and at least 0.2 mg/ml albumin; and b. comparing accumulation of a gene product in the culture medium in presence of the candidate compound to accumulation of the gene product in the culture medium in absence of the candidate compound, wherein reduced accumulation of the gene product in the culture medium in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
17. A method for screening for a molecule that inhibits albumin-induced signaling in a bacterial cell, the method comprising: a. contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises less than about 0.5 mM calcium and at least about 0.2 mg/ml albumin; and b. comparing accumulation of a gene product in the bacterial cell in presence of the candidate compound to accumulation of the gene product in the bacterial cell in absence of the candidate compound. wherein reduced accumulation of the gene product in the bacterial cell in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
18. The method of claim 16 or 17, wherein the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
19. The method of any one of claims 16-18, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof.
20. The method of any one of claims 16-19, wherein the candidate compound is a fragment of an albumin polypeptide.
21. The method of any one of claims 16-19, wherein the candidate compound is an antibody or a small molecule.
22. A method for treating or preventing a bacterial infection in a subject in need thereof, the method comprising administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a bacterial infection in the subject.
23. The method of claim 22, wherein the bacteria is a Bordetella species, optionally wherein the Bordetella species is Bordetella pertussis, Bordetella bronchiseptica or Bordetella parapertussis.
24. A method for producing a vaccine component, the method comprising: a. growing bacterial cells in a culture medium comprising a sufficient concentration of albumin to induce an increase in accumulation of the polypeptide in the cells and/or secretion of the polypeptide from the cells into the culture medium; and b. isolating the polypeptide from the cells and/or the culture medium, whereby a vaccine component is produced.
25. The method of claim 24, wherein the bacterial cells comprise a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
26. The method of claim 24 or claim 25, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof.
27. The method of any one of claims 24-26, further comprising inactivating the polypeptide or the fragment or thereof.
28. The method of any one of claims 24-27, wherein the culture medium comprises at least about 0.2 mg/ml albumin.
29. The method of any one of claims 24-28, wherein the culture medium comprises at least about 0.5 mM calcium.
30. The method of any one of claims 24-29, wherein the polypeptide is purified from the culture medium using a ligand that binds to the polypeptide.
31. The method of claim 30, wherein the ligand is an antibody or a fragment or derivative thereof.
32. The method of claim 30 or claim 31, wherein the ligand comprises a bead, optionally a magnetic bead, to which the ligand or the fragment or derivative thereof is directly or indirectly conjugated.
33. The method of claim 32, wherein the ligand is indirectly conjugated to the bead via a tether, optionally wherein the tether comprises polyethylene glycol.
34. The method of any one of claims 24-33, further comprising combining the polypeptide with one or more additional polypeptides to produce an antigen pool to be employed in a vaccine.
35. The method of claim 34, wherein the one or more additional polypeptides are selected from the group consisting of pertussis toxin (PT), Bp filamentous hemagglutinin adhesin (FHA), Bp pertactin (PRN), Bp fimbriae 2 (Fim2), Bp fimbriae 3 (Fim3), diphtheria toxoid, tetanus toxoid, a polio antigen, a Haemophilus influenzae type b antigen, a HepB antigen, or a combination thereof.
36. The method of any one of claims 24-35, further comprising adding one or more pharmaceutically acceptable carriers and/or excipients, thereby producing a vaccine.
37. The method of claim 36, wherein the vaccine is in the form of an injectable or an aerosol.
Description:
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional Patent Application Ser. No. 62/318,158, filed Apr. 4, 2016, the disclosure of which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
[0003] The presently disclosed subject matter relates to compositions and methods for preventing and treating diseases, disorders, and conditions associated with bacterial infection. In some embodiments, the presently disclosed subject matter relates to compositions and methods for increasing production of bacterial polypeptides in order to employ the same in vaccines.
BACKGROUND
[0004] Pertussis (whooping cough) is a respiratory illness caused by Bordetella pertussis (Bp) that can be life-threatening, especially in infants. In 2012, the number of cases of whooping cough in the United States was the highest since 1960 despite high vaccine coverage (Warfel & Edwards, 2015). The limited duration of protection by acellular pertussis vaccines is a major factor in the resurgence of pertussis (Cherry, 2013).
[0005] There are several acellular pertussis vaccines (aPVs) that have used in the United States and other countries, such as DAPTACEL.RTM. brand (Sanofi Pasteur, Swiftwater, Pa., United States of America), TRIPEDIA.RTM. brand (Sanofi Pasteur, Swiftwater, Pa., United States of America) and INFANRIX.RTM. brand (GlaxoSmithKline, Research Triangle Park, N.C., United States of America), which are generally produced by purification of various antigens from B. pertussis grown in culture. After purification, fractions containing select antigens, generally pertussis toxin (PT) and filamentous haemagglutinin adhesin (FHA), have been combined and treated to inactivate PT to produce the vaccines. The process of purification and inactivation of Bp antigens is expensive and time-consuming, and although attempts have been made to produce antigens by recombinant means, no fully recombinant anti-Bp vaccines are currently available in the United States.
[0006] Disclosed herein are compositions and methods that can be employed to increase the production of bacterial antigens including but not limited to B. pertussis antigens, thereby increasing the ease of purification and thus availability of said antigens.
SUMMARY
[0007] This Summary lists several embodiments of the presently disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.
[0008] In some embodiments, the presently disclosed subject matter provides methods for increasing production of polypeptide in bacterial cells in culture. In some embodiments, the methods comprise contacting a bacterial cell in a culture medium with an amount of an albumin polypeptide sufficient to induce an increase in accumulation of the polypeptide in the bacterial cell and/or an increase in secretion of the polypeptide from the bacterial cell into the culture medium relative to a bacterial cell grown in a culture medium in the absence of the albumin polypeptide. In some embodiments, the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment or thereof; or a combination thereof. In some embodiments, the culture medium comprises sufficient calcium to enhance secretion of the polypeptide from the bacterial cell into the culture medium. In some embodiments, the concentration of calcium in the culture medium is at least about 0.15 mM, 0.2 mM, 0.3 mM, 0.4 mM, or 0.5 mM. In some embodiments, the amount of the albumin polypeptide is at least 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, or 0.5 mg/ml in the culture medium.
[0009] The presently disclosed subject matter also provides in some embodiments kits comprising albumin and instructions for its use in increasing accumulation of a polypeptide in a bacterial cell in a culture medium and/or for increasing secretion of the polypeptide from the bacterial cell into a culture medium. In some embodiments, the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; pertactin (PRN) polypeptide or a fragment thereof; fimbriae 2 (Fim2) polypeptide or a fragment thereof; fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof. In some embodiments, the polypeptide is a Bp polypeptide.
[0010] In some embodiments, the kits further comprise calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the bacterial cell into the culture medium.
[0011] In some embodiments, the kits further comprise a ligand adapted for removing the albumin from the culture medium. In some embodiments, the ligand binds specifically to the albumin when the albumin is present in the culture medium. In some embodiments, the ligand is an antibody or a fragment or derivative thereof. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the albumin is directly or indirectly conjugated. In some embodiments, the albumin is indirectly conjugated to the bead via a tether, optionally wherein the tether comprising an antibody or a fragment or derivative thereof that specifically binds to the albumin and is conjugated to the bead.
[0012] In some embodiments, the presently disclosed subject matter also provides methods for screening for molecules that inhibit albumin-induced signaling in bacterial cells. In some embodiments, the methods comprise contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises at least 0.5 mM calcium, optionally 0.5-2.0 mM calcium, and at least 0.2 mg/ml albumin, optionally at least 0.5 mg/ml albumin; and comparing accumulation of a gene product in the culture medium in presence of the candidate compound to accumulation of the gene product in the culture medium in absence of the candidate compound, wherein reduced accumulation of the gene product in the culture medium in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
[0013] In some embodiments, the presently disclosed subject matter also provides methods for screening for molecule that inhibit albumin-induced signaling in bacterial cells, wherein the method comprises contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises less than about 0.5 mM calcium, optionally less than about 0.4 mM calcium, optionally less than about 0.3 mM calcium, and optionally less than about 0.2 mM calcium, and at least about 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml albumin; and comparing accumulation of a gene product in the bacterial cell in presence of the candidate compound to accumulation of the gene product in the bacterial cell in absence of the candidate compound, wherein reduced accumulation of the gene product in the bacterial cell in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
[0014] In some embodiments of the screening methods, the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; a pertussis toxin (PT) polypeptide or a fragment thereof; a filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; a pertactin (PRN) polypeptide or a fragment thereof; a fimbriae 2 (Fim2) polypeptide or a fragment thereof; a fimbriae 3 (Fim3) polypeptide or a fragment thereof; or any combination thereof. In some embodiments, one or more of the ACT, PT, FHA, PRN, Fim2, and/or Fim3 polypeptides or fragments thereof are Bp polypeptides or fragments thereof. In some embodiments, the candidate compound is a fragment of an albumin polypeptide. In some embodiments, the candidate compound is an antibody or a small molecule.
[0015] In some embodiments, the presently disclosed subject matter provides methods for treating or preventing bacterial infections in subjects in need thereof. In some embodiments, the methods comprise administering to a subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a bacterial infection in the subject. In some embodiments, the bacteria is a Bordetella species, optionally wherein the Bordetella species is Bordetella pertussis, Bordetella bronchiseptica, or Bordetella parapertussis.
[0016] The presently disclosed subject matter also provides methods for producing vaccine components. In some embodiments, the methods comprise growing bacterial cells in a culture medium comprising a sufficient concentration of albumin to induce an increase in accumulation of the polypeptide in the cells and/or secretion of the polypeptide from the cells into the culture medium; and isolating the polypeptide from the cells and/or the culture medium, whereby a vaccine component is produced. In some embodiments, the bacterial cells comprise a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; a pertussis toxin (PT) polypeptide or a fragment thereof; a filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; a pertactin (PRN) polypeptide or a fragment thereof; a fimbriae 2 (Fim2) polypeptide or a fragment thereof; a fimbriae 3 (Fim3) polypeptide or a fragment thereof; or any combination thereof. In some embodiments, one or more of the ACT, PT, FHA, PRN, Fim2, and/or Fim3 polypeptides or fragments thereof are Bp polypeptides or fragments thereof. In some embodiments, the presently disclosed methods further comprise inactivating the polypeptide or the fragment or thereof. In some embodiments the culture medium comprises at least about 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, or 0.5 mg/ml albumin. In some embodiments, the culture medium comprises at least about 0.2 mM, 0.3 mM, 0.4 mM, or 0.5 mM calcium. In some embodiments, the polypeptide is purified from the culture medium using a ligand that binds to the polypeptide. In some embodiments, the ligand is an antibody or a fragment or derivative thereof. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the ligand or the fragment or derivative thereof is directly or indirectly conjugated. In some embodiments, the ligand is indirectly conjugated to the bead via a tether, optionally wherein the tether comprises polyethylene glycol.
[0017] In some embodiments, the presently disclosed methods further comprise combining the polypeptide with one or more additional polypeptides to produce an antigen pool to be employed in a vaccine. In some embodiments, the one or more additional polypeptides are selected from the group consisting of a pertussis toxin (PT), a filamentous hemagglutinin adhesin (FHA), a pertactin (PRN), a fimbriae 2 (Fim2), a fimbriae 3 (Fim3), a diphtheria toxoid, a tetanus toxoid, a polio antigen, a Haemophilus influenzae type b antigen, a HepB antigen, or any combination thereof. In some embodiments, one or more of the ACT, PT, FHA, PRN, Fim2, and/or Fim3 polypeptides or fragments thereof are Bp polypeptides or fragments thereof.
[0018] In some embodiments, the presently disclosed methods further comprise adding one or more pharmaceutically acceptable carriers and/or excipients, thereby producing a vaccine. In some embodiments, the vaccine is in the form of an injectable or an aerosol.
[0019] Various aspects and embodiments of the presently disclosed subject matter are described in further detail below.
[0020] These and other aspects and embodiments which will be apparent to those of skill in the art upon reading the specification provide the art with immunological tools and agents useful for diagnosing, prognosing, monitoring, and/or treating human cancers.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 is a graph of AC enzymatic activity (expressed as pmoles cAMP/10 minutes/10 .mu.l) versus time (hours) used to convert enzyme activity measurements to milliUnits/ml (mU/ml). Bp UT25 was grown in Stainer-Scholte medium (SSM; Stainer & Scholte, 1970) with (black squares) or without (black triangles) 10% fetal bovine serum (FBS) and samples were taken at indicated time points. The total fraction included both culture supernatant and bacterial cells. Adenylate cyclase (AC) enzyme activity was measured as described in Materials and Methods for the EXAMPLES below. Data represent the mean+/-standard deviation (SD) calculated using GraphPad Prism 7 software of three (3) independent experiments and is the same data presented in FIG. 2A. One unit is defined as 1 .mu.mol of cAMP formed in 1 minute at pH 8 at 30.degree. C.
[0022] FIGS. 2A and 2B are a bar graph and a digital image of a western blot showing that serum elicited a significant increase in amount of total and extracellular Bp ACT. Bp UT25 was grown in SSM+/-10% fetal bovine serum (FBS) for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. In FIG. 2A, AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of nine (9) independent experiments. A student's t-test was used to determine statistical significance. ***p.ltoreq.0.0001. FIG. 2B is a digital image of western blot analysis using a rabbit polyclonal anti-ACT antibody, detecting the approximately 200 kDa ACT protein. FBS: fetal bovine serum. -: no FBS. +: 10% FBS included.
[0023] FIGS. 3A and 3B are graphs of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l) versus time (hours in FIG. 3A, minutes in FIG. 3B) showing the response to serum was rapid and peaked at 24 hours of growth. Bp UT25 was grown in SSM+/-10% FBS and samples were taken at indicated time points. The supernatant was collected after centrifugation. AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below. In FIG. 3A, data represent the mean+/-SD of three (3) independent experiments. Comparisons between enzyme activity+/-FBS at all time points were statistically significant as determined by an unpaired t-test (p.ltoreq.0.05). Comparisons between bacterial density+/-FBS were statistically significant (p.ltoreq.0.05) at 8, 16, 24, and 32 hours. Solid triangles: AC enzyme activity in SSM minus FBS. Solid squares: AC enzyme activity in SSM+10% FBS. Solid lines: OD.sub.600 in SSM minus FBS. Dott lines: OD.sub.600 in SSM+10% FBS. In FIG. 3B, data represent the mean+/-SD of two (2) independent experiments done in duplicate. The total fraction included both culture supernatant and bacterial cells. The supernatant was collected after centrifugation. Open circles: AC enzyme activity in the supernatant for cells grown in SSM minus FBS. Solid circles: total AC enzyme activity for cells grown in SSM+10% FBS. Open squares: AC enzyme activity in the supernatant for cells grown in SSM+10% FBS. Solid squares: total AC enzyme activity for cells grown in SSM+10% FBS.
[0024] FIG. 4 is a bar graph showing that albumin and calcium acted synergistically to increase ACT production and secretion. Bp UT25 was grown in SSM+/-2 mg/ml BSA, 2 mM CaCl.sub.2, and/or 10% FBS (as indicated) for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of three (3) independent experiment done in duplicate. Statistical significance was assessed using a two-way ANOVA. **p.ltoreq.0.01; ***p.ltoreq.0.001 as compared to growth in SSM.
[0025] FIG. 5 is a bar graph showing that albumin and calcium-stripped albumin had equivalent effects on ACT amount and release. Bp UT25 was grown in SSM+/-2 mg/ml BSA or EGTA-treated BSA for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of three (3) independent experiments done in duplicate. Statistical significance was assessed using a two-way ANOVA, and comparisons between SSM+BSA and SSM+EGTA-treated BSA were not significantly different.
[0026] FIG. 6 is a graph of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) versus calcium concentration (in mM) showing that the maximum effect on ACT amount and release required a minimum of 0.5 mM calcium. Bp UT25 was grown in SSM with 2 mg/ml BSA with indicated concentrations of total calcium for 8 hours. The total fraction (solid line and solid black circle) included both culture supernatant and bacterial cells. The supernatant (dashed line and open circle) was collected after centrifugation. AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data presented are the mean+/-SD of a single experiment done in duplicate but representative of four (4) similar experiments.
[0027] FIG. 7 is a digital image of a Coomassie blue-stained SDS-PAGE gel showing that serum collected from analbuminemic mice lacked albumin. Wild-type C56BL/6 mouse serum or ALB-/- mouse serum were analyzed by SDS-PAGE and Coomassie staining to detect protein profiles. The band corresponding to albumin in the wild-type sample is indicated with an arrow.
[0028] FIGS. 8A and 8B are a bar graph and a digital image of a western blot showing that albumin was required for increased ACT amount during growth in the presence of mouse serum. In FIG. 8A, Bp UT25 was grown in SSM+/-wild-type C56BL/6 mouse serum or ALB.sup.-/- mouse serum+/-2 mg/ml BSA, all with 2 mM CaCl.sub.2, for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of three (3) independent experiments done in duplicate. Statistical significance was assessed using a two-way ANOVA. ***p.ltoreq.0.001 as compared to growth in SSM. FIG. 8B shows the results of western blot analysis using a rabbit polyclonal anti-ACT antibody, detecting the approximately 200 kDa ACT protein. SSM: growth in SSM without added serum. SSM+WT serum: growth in SSM plus wild-type C56BL/6 mouse serum. SSM+ALB-/- serum: growth in SSM plus albumin-minus (Alb-/-) mouse serum. S: supernatant. T: total. .alpha.-ACT; anti-ACT.
[0029] FIG. 9 is a graph of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) versus albumin concentration (in mg/ml) showing that human serum (Total HS: dashed line and solid black squares) and human serum albumin (Total HSA: solid line and solid black circles) increased ACT amount and shifted localization of ACT to the supernatant. Bp UT25 was grown in SSM+/-HS or HSA (as indicated), all with 2 mM CaCl.sub.2, for 8 hours. The total fraction included both culture supernatant and bacterial cells. AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of two (2) independent experiments done in duplicate.
[0030] FIGS. 10A and 10B are bar graphs showing that the regulation of cyaA during growth+/-HSA was not occurring at the level of transcription through the Bvg two-component system. In FIG. 10A, RNA was isolated from Bp UT25 grown in SSM alone (black bars), SSM+2 mg/ml HSA (dark gray bars), and SSM+40 mM MgSO.sub.4 (light gray bars) with 2 mM calcium for 4 hours. Expression of target genes was determined using the relative quantification method and shown as relative fold expression on the y-axis. Statistical significance was analyzed by an unpaired t-test. Data represent the mean+/-SD of three (3) independent experiments. ***p.ltoreq.0.001 as compared to growth in SSM. cyaA: Bp adenylate cyclase. bvgA: Bp transcriptional regulator BvgA. ptxA: Bp pertussis toxin subunit 1 precursor. ptxA: Bp pertussis toxin subunit 1 precursor. fhaB: Bp filamentous hemagglutinin/adhesin. In FIG. 10B, Bp UT25 was grown in SSM with calcium+/-2 mg/ml HSA and/or 40 mM MgSO.sub.4 for 4 hours (same conditions and cultures that were used for RNA expression analyses). AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600) was measured in the total fraction as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of three (3) independent experiments done in duplicate. ***p.ltoreq.0.001 as compared to growth in SSM alone; ###p.ltoreq.0.001 as compared to growth in SSM+MgSO.sub.4. SSM: growth in SSM without added serum. SSM+HSA: growth in SSM plus human serum albumin. SSM+MgSO.sub.4: growth in SSM plus 40 mM magnesium sulfate. SSM+MgSO.sub.4+HAS: growth in SSM plus 40 mM magnesium sulfate and 2 mg/ml human serum albumin.
[0031] FIG. 11 is a bar graph showing that transcription of genes encoded in the cya operon is not altered+/-HSA. RNA was isolated from Bp UT25 grown in SSM alone (black bars), SSM+2 mg/ml HSA (dark gray bars), or SSM+40 mM MgSO.sub.4 (light gray bars) with 2 mM calcium for 4 hours. Expression of target genes was determined using the relative quantification method. Statistical significance was analyzed by an unpaired t-test. Data represent the mean+/-SD of three (3) independent experiments. **p.ltoreq.0.01; ***p.ltoreq.0.001 as compared to growth in SSM. cyaB: Bp cyclolysin secretion ATP-binding protein cyaA. cyaD: Bp cyclolysin secretion cyaD protein. cyaE: Bp cyclolysin secretion cyaE protein. cyaX: Bp cyaX protein. cyaC: Bp cyclolysin-activating lysine-acyltransferase.
[0032] FIG. 12 is a digital image of a composite of the results of western blow analyses showing that respiratory secretions, isolated by bronchoalveolar lavage (BAL), contained albumin. BAL was performed on 7 patients with interstitial lung disease or bronchiectasis, and the resulting samples were pooled and concentrated as described in Materials and Methods for the EXAMPLES. SSM+BAL, SSM+2.3 mg/ml HSA, and 5% HS samples were analyzed by western blotting with an anti-BSA antibody as well as SDS-PAGE and Coomassie staining to detect protein profiles and confirm the presence of albumin. The amount of albumin present in the pooled BAL sample was determined to be approximately 2.0 mg/ml by SDS-PAGE using purified HSA as a standard over a range of concentrations and confirmed by western blot analyses with an anti-BSA antibody to be comparable to the amount of albumin present in 5% HS. Molecular weights of known components of serum and respiratory secretions: albumin (66 kDa), gammaglobulin heavy chains (55-60 kDa), and gammaglobulin light chains (25-28 kDa). BAL: SSM+BAL. 2.3 mg/ml HSA: SSM+2.3 mg/ml human serum albumin. 5% HS: SSM+5% human serum.
[0033] FIGS. 13A and 13B are a bar graph and digital image of a western blot, respectively, showing that respiratory secretions increased total and extracellular ACT amount. In FIG. 13A, Bp UT25 was grown in SSM+saline, SSM+BAL (described in FIG. 12), SSM+5% HS, or SSM+2 mg/ml HSA, all with 2 mM CaCl.sub.2, for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l/OD.sub.600 was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD.sub.600. Data represent the mean+/-SD of two (2) independent experiments done in duplicate. Statistical significance was assessed using a two-way ANOVA. ***p.ltoreq.0.001 as compared to growth in SSM. FIG. 13B is a western blot of Bp UT25 grown in SSM+/-saline, BAL, 2 mg/ml HSA, or 5% HS, all with 2 mM CaCl.sub.2, using a rabbit polyclonal anti-ACT antibody, showing detection of the approximately 200 kDa ACT protein. SSM: SSM alone. SSM+BAL: SSM plus concentrated BAL, as described in FIG. 12. SSM+5% HS: SSM plus 5% human serum. SSM+HAS: SSM plus 2 mg/ml human serum albumin.
[0034] FIG. 14 is a graph of percent viable cells versus AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l) showing that extracellular ACT produced during growth with respiratory secretions was a functional toxin. J774 cells were incubated with the supernatant from growth of Bp UT25 in SSM+BAL (black circles) or rACT (black squares; normalized to equivalent enzyme activity) for 3 hours at 37.degree. C. The number of viable cells was calculated using the CCK8 assay (see Materials and Methods for the EXAMPLES). Data represent the mean+/-one (1) SD of a single experiment done in triplicate, which was representative of three (3) additional experiments.
[0035] FIG. 15 is a bar graph of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 .mu.l) showing that albumin increases intracellular ACT in a strain that is unable to secrete ACT due to deletion of the Type I Secretion System (T1SS). Bp UT25 .DELTA.T1SS was grown in SSM alone (SSM), SSM supplemented with 2 mM calcium (SSM+Ca), SSM supplemented with 2 mg/ml BSA (SSM+BSA), or SSM supplemented with both 2 mM calcium and 2 mg/ml BSA (SSM+BSA+Ca) for 2 hours. The supernatantsupernatants (light gray bars; level too low to show in FIG. 15) were collected after centrifugation. The pellet was treated with 4M urea for 20 minutes at room temperature, and then the supernatant was collected after centrifugation as the surface-associated ACT fraction (dark gray bars). The resulting pellet was then solubilized with 8M urea to isolate the intracellular ACT fraction (black bars). AC enzyme activity was measured and normalized by OD.sub.600. Data represent the mean+/-SD of two (2) independent experiments done in duplicate. Statistical significance was assessed using a 2-way ANOVA. *** p.ltoreq.0.001 as compared to growth in SSM.
[0036] FIG. 16 is a digital image of a western blot demonstrating that albumin binds to Bp in a Bvg-dependent manner. Bp strains (UT25, BP338, BP348, and BP347) were grown in SSM with 2 mM calcium+/-2 mg/ml BSA (as indicated) for 6 hours. The bacteria were then extensively washed (7 wash steps with three changes to fresh tubes to eliminate carry-over albumin not bound to the bacterial surface) with SSM (without calcium or albumin). Purified BSA was loaded as a positive control (400 ng). Samples were normalized by bacterial density and analyzed by western blotting with an anti-BSA antibody. Data represent a single experiment which was representative of three (3) additional experiments.
[0037] FIG. 17 is a digital image of a western blot showing the effect of albumin on amount and localization of filamentous hemagglutinin (FHA) and pertussis toxin (PT). Bp UT25 was grown in SSM with 2 mM calcium+/-0.46 mg/ml or 4.6 mg/ml HSA (as indicated) for 8 hours. The total fraction (T) included both culture supernatant and bacterial cells. The supernatant (S) was collected after centrifugation. Samples were normalized by bacterial density and analyzed by western blotting with a rabbit polyclonal anti-FHA or anti-PT antibody. Data represent a single experiment which was representative of two (2) additional experiments
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0038] SEQ ID NO: 1 is an amino acid sequence of a Bordetella pertussis ACT holoenzyme polypeptide. It corresponds to Accession No. NP_879578.1 in the GENBANK.RTM. biosequence database.
[0039] SEQ ID NO: 2 is an amino acid sequence of a Bordetella pertussis AC Domain polypeptide. It corresponds to amino acids 1-400 of SEQ ID NO: 1.
[0040] SEQ ID NOs: 3 and 4 are amino acid sequences of the T25 and T18 peptides, respectively, derived from the Bordetella pertussis AC Domain polypeptide of SEQ ID NO: 1. They correspond to amino acids 1-225 and 226-400 of SEQ ID NO: 1, respectively.
[0041] SEQ ID NO: 5 is an amino acid sequence of an inactivated Bordetella pertussis AC Domain polypeptide. The polypeptide has been inactivated by substituting the aspartic acid at amino acid 188 of SEQ ID NO: 1 with a cysteine and the isoleucine at amino acid 189 of SEQ ID NO: 1 with a threonine.
[0042] SEQ ID NOs: 6-25 are the nucleotide sequences of the primers listed in Table 1.
[0043] SEQ ID NOs: 26-30 are the amino acid sequences of subunits 1-5, respectively, of a Bordetella pertussis PT polypeptide. SEQ ID NOs: 26-30 correspond to GENBANK.RTM. biosequence database Accession Nos. NP_882282.1, NP_882283.1, NP_882286.1, NP_882284.1, and NP_882285.1, respectively.
[0044] SEQ ID NOs: 31-35 are the amino acid sequences of subunits 1-5, respectively, of a Bordetella bronchiseptica PT polypeptide. SEQ ID NOs: 31-35 correspond to GENBANK.RTM. biosequence database Accession Nos. WP_033452809.1, WP_033452812.1, WP_015064783.1, WP_033468323.1, and WP_033446920.1, respectively.
[0045] SEQ ID NOs: 36 and 37 are the amino acid sequences of FHA polypeptides from Bordetella pertussis and Bordetella bronchiseptica, respectively. SEQ ID NOs: 36 and 37 correspond to GENBANK.RTM. biosequence database Accession Nos. NP_880571.1 and YP_006966876.1, respectively.
[0046] SEQ ID NOs: 38 and 39 are the amino acid sequences of Fim2 and Fim3 polypeptides, respectively, from Bordetella pertussis. SEQ ID NOs: 38 and 39 correspond to GENBANK.RTM. biosequence database Accession Nos. NP_879898.1 and NP_880302.1, respectively.
[0047] SEQ ID NOs: 40 and 41 are the amino acid sequences of Fim2 and Fim3 polypeptides, respectively, from Bordetella bronchiseptica. SEQ ID NOs: 40 and 41 correspond to GENBANK.RTM. biosequence database Accession Nos. YP_006967303.1 and YP_006967865.1, respectively.
[0048] SEQ ID NOs: 42 and 43 are the amino acid sequences of PRN polypeptides from Bordetella pertussis and Bordetella bronchiseptica, respectively. SEQ ID NOs: 42 and 43 correspond to GENBANK.RTM. biosequence database Accession Nos. NP_879839.1 and WP_033839724.1, respectively.
[0049] SEQ ID NO: 44 is an amino acid sequence of a Bordetella bronchiseptica ACT holoenzyme polypeptide. SEQ ID NO: 44 corresponds to Accession No. WP_080702041.1 in the GENBANK.RTM. biosequence database.
[0050] SEQ ID NO: 45 is an amino acid sequence of a Bordetella bronchiseptica AC Domain polypeptide. SEQ ID NO: 45 corresponds to amino acids 1-400 of SEQ ID NO: 44.
[0051] SEQ ID NOs: 46 and 47 are amino acid sequences of the T25 and T18 peptides, respectively, derived from the Bordetella bronchiseptica AC Domain polypeptide of SEQ ID NO: 1. SEQ ID NOs: 46 and 47 correspond to amino acids 1-225 and 226-400 of SEQ ID NO: 1, respectively.
[0052] SEQ ID NO: 48 is an amino acid sequence of an inactivated Bordetella bronchiseptica AC Domain polypeptide. The polypeptide has been inactivated by substituting the aspartic acid at amino acid 188 of SEQ ID NO: 44 with a cysteine and the isoleucine at amino acid 189 of SEQ ID NO: 44 with a threonine.
[0053] SEQ ID NO: 49 is an amino acid sequence of a Bordetella parapertussis ACT holoenzyme polypeptide (hemolysin). SEQ ID NO: 49 corresponds to Accession No. WP_010927405.1 in the GENBANK.RTM. biosequence database.
[0054] SEQ ID NO: 50 is an amino acid sequence of a Bordetella parapertussis AC Domain polypeptide. SEQ ID NO: 50 corresponds to amino acids 35-434 of SEQ ID NO: 49.
[0055] SEQ ID NOs: 51 and 52 are amino acid sequences of the T25 and T18 peptides, respectively, derived from the Bordetella parapertussis AC Domain polypeptide of SEQ ID NO: 49. SEQ ID NOs: 51 and 52 correspond to amino acids 35-249 and 250-434 of SEQ ID NO: 49, respectively.
[0056] SEQ ID NO: 53 is an amino acid sequence of an inactivated Bordetella parapertussis AC Domain polypeptide. The polypeptide has been inactivated by substituting the aspartic acid at amino acid 222 of SEQ ID NO: 49 with a cysteine and the isoleucine at amino acid 223 of SEQ ID NO: 49 with a threonine.
[0057] SEQ ID NOs: 54-58 are the amino acid sequences of subunits 1-5, respectively, of a Bordetella parapertussis PT polypeptide. SEQ ID NOs: 54-58 correspond to GENBANK.RTM. biosequence database Accession Nos. WP_010929490.1, YP_006898153.1, YP_006898156.1, YP_006898154.1, and YP_006898155.1, respectively.
[0058] SEQ ID NO: 59 is the amino acid sequence of an FHA polypeptide from Bordetella parapertussis. SEQ ID NO: 59 corresponds to GENBANK.RTM. biosequence database Accession No. YP_006896577.1.
[0059] SEQ ID NOs: 60 and 61 are the amino acid sequences of Fim2 and Fim3 polypeptides, respectively, from Bordetella parapertussis. SEQ ID NOs: 60 and 61 correspond to GENBANK.RTM. biosequence database Accession Nos. YP_006895663.1 and YP_006895400.1, respectively.
[0060] SEQ ID NO: 62 is the amino acid sequence of a PRN polypeptide from Bordetella parapertussis. SEQ ID NO: 62 corresponds to GENBANK.RTM. biosequence database Accession No. YP_006897297.1.
DETAILED DESCRIPTION
[0061] ACT is a single polypeptide of 1706 amino acid residues. It has a calculated molecular weight of about 177 kiloDaltons (kDa), but runs as a protein of approximately 200 kDa when analyzed by SDS-PAGE (Glaser et al., 1988a; Hewlett et al., 1989; Rogel et al., 1989; Bellalou et al., 1990a). ACT belongs to the RTX (repeats-in-toxin) family of proteins and has two activities (Glaser et al., 1988b). The toxin function involves insertion of the adenylate cyclase (AC) catalytic domain into the cytoplasm of host cells, activation by the host protein calmodulin, and conversion of intracellular ATP into cyclic AMP, resulting in dysregulation of signaling processes and depletion of ATP in the intoxicated cell (Hanski, 1989; Gray et al., 1998). At higher concentrations, ACT undergoes oligomerization to form pores in the target cell membrane (Gray et al., 1998; Basler et al., 2006; Vojtova-Vodolanova et al., 2009); these pores are responsible for hemolysis during Bp growth on Bordet-Gengou agar (Ehrmann et al., 1992). The repeat regions in the RTX domain bind calcium, and calcium-binding induces conformational changes that are critical for efficient secretion and toxin activity (Hewlett et al., 1991; Rose et al., 1995; Rhodes et al., 2001; Chenal et al., 2009; Chenal et al., 2010; Bumba et al., 2016). ACT uses the .beta.2 integrin, CD11b/CD18, as its receptor (Guermonprez et al., 2001; Eby et al., 2012), suggesting that a primary role for ACT in the pathogenesis of pertussis is inhibition of the functions of CD11b/CD18-expressing myeloid leukocytes (including neutrophils, monocytes, macrophages, and dendritic cells), which are involved in the clearance of Bp (Mattoo & Cherry, 2005; Carbonetti, 2010; Eby et al., 2012; Eby et al., 2015).
[0062] ACT is encoded within the cya operon that includes the structural gene cyaA, as well as cyaB, cyaD, and cyaE encoding the Type 1 Secretion System (T1SS) by which it is secreted, the acyl transferase cyaC which is responsible for post-translational acylation, and cyaX, of unknown function but annotated as a LysR-family transcriptional regulator (Glaser et al., 1988b; Betsou et al., 1993; Thomas et al., 2014). Expression of cyaA, as well as other Bp factors critical to establishing infection, is controlled by the Bvg two-component regulatory system, which has been described as the master transcriptional regulator of virulence in Bordetellae (Arico et al., 1989; Cotter & Jones, 2003; Melvin et al., 2014). To initiate transcription of the Bvg regulon, the sensor kinase BvgS phosphorylates the response regulator BvgA, which binds to promoter elements upstream of target genes (Boucher et al., 1994; Boucher & Stibitz, 1995; Steffen et al., 1996; Boucher et al., 1997). The default operation of this regulatory system appears to be in the "on" position, since the only signals that have been identified are those that decrease expression of target genes, for example magnesium sulfate (MgSO.sub.4) or a shift in temperature from 37.degree. C. to 25.degree. C. (Melton & Weiss, 1989). A Bvg-activated state, promoting transcription of cyaA, is required and sufficient for infection (Cotter & Miller, 1994).
[0063] During in vitro growth in SSM, ACT is primarily associated with the bacterial cell surface (Hewlett et al., 1976; Confer & Eaton, 1982; Bellalou et al., 1990a; Zaretzky et al., 2002); however, it was shown previously that it is the released, not surface-associated, ACT that is responsible for increasing cAMP and causing cytotoxicity (Gray et al., 2004). This is consistent with the study of nasal washes from humans with pertussis and from infected baboons, showing that ACT is virtually all in the released form in vivo (Eby et al., 2013). These observations together support the concept that released ACT is the active and most relevant molecule during infection and suggest that the in vitro conditions currently in use to study ACT and other components of pertussis pathogenesis are not representative of the environment within the host. While seeking to understand the differences between culture conditions in vitro and the environment within the host respiratory tract, it was noted that ACT was also primarily in the supernatant when Bp is studied in vitro with eukaryotic cells (Eby et al., 2013). Under these conditions, Bp is exposed to tissue culture media supplemented with 10% heat-inactivated fetal bovine serum. Since serum components are present in respiratory secretions, this led to the hypothesis that one or more molecules in serum might promotes ACT release into the culture medium. The testing of this hypothesis yielded the data presented herein.
[0064] The presently disclosed subject matter now will be described more fully hereinafter, in which some, but not all embodiments of the presently disclosed subject matter are described. Indeed, the presently disclosed subject matter can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements.
I. Definitions
[0065] While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.
[0066] All technical and scientific terms used herein, unless otherwise defined below, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. Mention of techniques employed herein are intended to refer to the techniques as commonly understood in the art, including variations on those techniques or substitutions of equivalent techniques that would be apparent to one of skill in the art. While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter. Thus, unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of the presently disclosed subject matter. Although any compositions, methods, kits, and means for communicating information similar or equivalent to those described herein can be used to practice the presently disclosed subject matter, particular compositions, methods, kits, and means for communicating information are described herein. It is understood that the particular compositions, methods, kits, and means for communicating information described herein are exemplary only and the presently disclosed subject matter is not intended to be limited to just those embodiments.
[0067] The articles "a", "an", and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0068] As used herein, the term "about" means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. For example, in one aspect, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of in some embodiments .+-.20%, in some embodiments .+-.15%, in some embodiments .+-.10%, in some embodiments .+-.5%, in some embodiments .+-.1%, in some embodiments .+-.0.5%, in some embodiments .+-.0.1%, and in some embodiments less than .+-.0.1%.
[0069] The term "comprising", which is synonymous with "including" "containing" or "characterized by" is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. "Comprising" is a term of art used in claim language which means that the named elements are essential, but other elements can be added and still form a construct within the scope of the claim.
[0070] As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. When the phrase "consists of" appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.
[0071] As used herein, the phrase "consisting essentially of" limits the scope of a claim to the specified materials or steps, plus those that do not materially affect the basic and novel characteristic(s) of the claimed subject matter.
[0072] With respect to the terms "comprising", "consisting of", and "consisting essentially of", where one of these three terms is used herein, the presently disclosed and claimed subject matter can include the use of either of the other two terms.
[0073] As used herein, the term "and/or" when used in the context of a listing of entities, refers to the entities being present singly or in combination. Thus, for example, the phrase "A, B, C, and/or D" includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D.
[0074] As used herein, amino acids are represented by the full name thereof, by the three letter code corresponding thereto, and/or by the one-letter code corresponding thereto, as indicated in the following:
TABLE-US-00001 Full Name Three-Letter Code One-Letter Code Aspartic Acid Asp D Glutamic Acid Glu E Lysine Lys K Arginine Arg R Histidine His H Tyrosine Tyr Y Cysteine Cys C Asparagine Asn N Glutamine Gln Q Serine Ser S Threonine Thr T Glycine Gly G Alanine Ala A Valine Val V Leucine Leu L Isoleucine Ile I Methionine Met M Proline Pro P Phenylalanine Phe F Tryptophan Trp W
[0075] The phrase "amino acid" is used interchangeably with "amino acid residue", and may refer to a free amino acid and/or to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
[0076] Amino acids have the following general structure:
##STR00001##
[0077] They may be classified into seven groups on the basis of the side chain R: (1) aliphatic side chains; (2) side chains containing a hydroxylic (OH) group; (3) side chains containing sulfur atoms; (4) side chains containing an acidic or amide group; (5) side chains containing a basic group; (6) side chains containing an aromatic ring; and (7) proline, an imino acid in which the side chain is fused to the amino group.
[0078] The nomenclature used to describe the peptide compounds of the presently disclosed subject matter follows the conventional practice wherein the amino group is presented to the left and the carboxy group to the right of each amino acid residue. In the formulae representing selected specific embodiments of the presently disclosed subject matter, the amino- and carboxy-terminal groups, although not specifically shown, will be understood to be in the form they would assume at physiologic pH values, unless otherwise specified.
[0079] The term "basic" and the phrase "positively charged" as they relate to amino acids refer herein to amino acids in which the R groups have a net positive charge at pH 7.0, and include, but are not limited to, the standard amino acids lysine, arginine, and histidine.
[0080] As used herein, an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5-fluorouracil is an analog of thymine).
[0081] The term "antibody" indicates an immunoglobulin protein, or fragment or derivative thereof, including but not limited to a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a hybrid antibody, a single chain antibody (e.g., a single chain antibody represented in a phage library), a mutagenized antibody, a humanized antibody, and antibody fragments that comprise an antigen binding site (e.g., Fab and Fv antibody fragments).
[0082] The term "antigen" as used herein refers to a molecule that provokes an immune response in vitro and/or in vivo. This immune response can involve antibody production, the activation of specific immunologically-competent cells, or both. An antigen can be derived from an organism, a subunit of a protein, a killed or inactivated whole cell or lysate, or any other source to which an organism's immune system or a component thereof (e.g., an immune cell) can react.
[0083] The term "binding" refers to the adherence of molecules to one another, such as, but not limited to, enzymes to substrates, ligands to receptors, antibodies to antigens, DNA binding domains of proteins to DNA, and DNA or RNA strands to complementary strands.
[0084] As used herein, the phrase "binding partner" refers to a molecule capable of binding to another molecule. In some embodiments, binding partner bind to each other in vitro, ex vivo, in vivo, and/or under physiological conditions.
[0085] As used herein, the phrases "biologically active fragment" and "bioactive fragment" of polypeptides, including antibodies, encompass natural and synthetic portions of full-length polypeptides that have one or more desirable characteristics of the full-length polypeptides, including but not limited to specific binding to their natural ligand(s) and/or performing desirable functions of the polypeptides.
[0086] The phrase "biological sample", as used herein, refers to samples obtained and/or otherwise isolated from a subject, including, but not limited to, skin, hair, tissue, blood, plasma, cells, sweat, and urine.
[0087] A "compound", as used herein, refers to any type of substance or agent that is commonly considered a drug, or a candidate for use as a drug, as well as combinations and mixtures of the above.
[0088] As used herein, the phrase "conservative amino acid substitution" is defined herein as an amino acid exchange within one of the following five groups:
[0089] A. Small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, Gly;
[0090] B. Polar, negatively charged residues and their amides: Asp, Asn, Glu, Gln;
[0091] C. Polar, positively charged residues: His, Arg, Lys;
[0092] D. Large, aliphatic, nonpolar residues: Met, Leu, Ile, Val, Cys; and
[0093] E. Large, aromatic residues: Phe, Tyr, Trp. Thus, a conservative amino acid substitution includes a substitution of in some embodiments any small aliphatic, nonpolar, or slightly polar residue for any other small aliphatic, nonpolar, or slightly polar residues; in some embodiments any polar, negatively charged residue and its amide for any other polar, negatively charged residue and its amide; in some embodiments any polar, positively charged residue for any other polar, positively charged residue; in some embodiments any large, aliphatic, nonpolar residue for any other large, aliphatic, nonpolar residue; and/or in some embodiments any large, aromatic residue for any other large, aromatic residue.
[0094] As used herein, a "derivative" of a compound refers to a chemical compound that may be produced from another compound of similar structure in one or more steps, as in replacement of H by an alkyl, acyl, or amino group.
[0095] A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health would be expected to deteriorate.
[0096] In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
[0097] As used herein, the term "domain" refers to a part of a molecule or structure that shares common physicochemical features, such as, but not limited to, hydrophobic, polar, globular, and helical domains, and/or properties such as ligand binding, signal transduction, cell penetration, and the like. Specific examples of binding domains include, but are not limited to, DNA binding domains and ATP binding domains.
[0098] As used herein, an "effective amount" or "therapeutically effective amount" means an amount sufficient to produce a desired effect, such as ameliorating or alleviating symptoms of a disease or disorder. In the context of administering compounds in the form of a combination, such as multiple compounds, the amount of each compound, when administered in combination with another compound(s), may be different from when that compound is administered alone. Thus, an effective amount of a combination of compounds refers collectively to the combination as a whole, although the actual amounts of each compound may vary. The term "more effective" means that the selected effect is ameliorated and/or alleviated to a greater extent by one treatment relative to a second treatment to which it is being compared.
[0099] As used herein, an "essentially pure" preparation of a particular protein or peptide is a preparation wherein in some embodiments at least about 95%, in some embodiments at least about 97%, and in some embodiments at least about 99%, by weight, of the total protein or total peptide in the preparation is the particular protein or peptide of interest.
[0100] A "fragment" or "segment" is a portion of an amino acid sequence (i.e., a subsequence) comprising at least one amino acid or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms "fragment" and "segment" are used interchangeably herein.
[0101] As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a desirable property by which it can be characterized. A functional enzyme, for example, is one which exhibits the characteristic catalytic activity by which the enzyme is characterized.
[0102] By "interaction" between a first protein and a second protein is meant the interaction such as binding which is necessary for an event or process to occur, such as sperm-egg binding, fusion, and fertilization. In some embodiments, the interaction may be similar to a receptor-ligand type of binding or interaction.
[0103] A "ligand" is a molecule that specifically binds to a target molecule such as but not limited to a receptor. A "receptor" is a molecule that specifically binds to a ligand. In some embodiments, the attribution of a given molecule as being a "ligand" or a "receptor" is merely one of convenience in the event that the "receptor" can be a molecule that is not recognized as a "receptor" as that term might be understood with respect to cell biology and/or signal transduction.
[0104] As such, in some embodiments a ligand or a receptor (e.g., an antibody) "specifically binds to" or "is specifically immunoreactive with" a compound when the ligand or receptor functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds. Thus, under designated assay (e.g., immunoassay) conditions, the ligand or receptor binds preferentially to a particular compound and does not bind in a significant amount to other compounds present in the sample. For example, a polynucleotide specifically binds under hybridization conditions to a compound polynucleotide comprising a complementary sequence; an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow & Lane, 1988 for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
[0105] The term "peptide" typically refers to short polypeptides. In some embodiments, a peptide of the presently disclosed subject matter is thus at least or about 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids long, including but not limited to at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids long. The peptides of the presently disclosed subject matter can in some embodiments also have a length that falls in the ranges of 6-8, 8-10, 9-12, 10-13, 11-14, 12-15, 15-20, 20-25, 25-30, 30-35, 35-40, and 45-50 amino acids.
[0106] As used herein, the term "plurality" means at least two and, unless specifically limited herein, has no upper boundary.
[0107] As used herein, the term "polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and/or synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.
[0108] As used herein, the phrase "synthetic peptides or polypeptides" refers to non-naturally occurring peptides and polypeptides. Synthetic peptides and polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. Various solid phase peptide synthesis methods are known to those of skill in the art.
[0109] In some embodiments, the presently disclosed subject matter provides polypeptides whose production in a bacterial cell is responsive to the presence of an amount of albumin and/or calcium in a culture medium. In some embodiments, the albumin is present in serum in the culture medium.
[0110] In some embodiments, the polypeptide is a Bordetella adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof. See, for example SEQ ID NOs:1, 44 or 49. As used herein, the phrases "Adenylate Cyclase Toxin" and "ACT" refer to a bifunctional hemolysin-adenylate cyclase gene and/or gene product encoding or having an amino acid sequence emplified by, but not limited to, that set forth in GENBANK.RTM. biosequence database Accession No. NP_879578.1. This amino acid sequence is set forth in SEQ ID NO:1. While this particular amino acid sequence represents the amino acid sequence of ACT from Bordetella pertussis Tohama I, it is recognized that the genomes of other isolates of B. pertussis might encode ACT polypeptides with one or more modifications of the sequence of SEQ ID NO:1. For example, the ACT polypeptide of certain isolates of B. pertussis include a serine at position 304 in place of the asparagine of SEQ ID NO:1. The presently disclosed subject matter is understood to encompass all such ACT polypeptides, both naturally occurring and artificially produced. In some embodiments, the polypeptide comprises, consists essentially of, or consists of an amino acid sequence of SEQ ID NOs:1, 44 or 49.
[0111] As used herein, the phrases "Adenylate Cyclase domain" and "AC domain" refer to the catalytic domain of an ACT polypeptide. The AC domain of B. pertussis ACT includes the N-terminal approximately 400 amino acids of an ACT polypeptide. Exemplary AC domains include in some embodiments amino acids 1-398, in some embodiments amino acids 1-399, and in some embodiments amino acids 1-400 of SEQ ID NO:1 (i.e., SEQ ID NO:2). Here as well, it is recognized that the genomes of other isolates of B. pertussis might encode AC domain polypeptides with one or more modifications of the sequence of SEQ ID NO:2, and the presently disclosed subject matter is understood to encompass all such AC domain polypeptides, both naturally occurring and artificially produced. In some embodiments, the polypeptide comprises, consists essentially of, or consists of an amino acid sequence of SEQ ID NO:2, 45 or 50.
[0112] In some embodiments, other polypeptides in which the production/maturation is induced by albumin and/or calcium are prepared, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptide or a fragment or variant thereof; filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment or variant thereof; pertactin (PRN) polypeptide or a fragment or variant thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment or variant thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment or variant thereof; or a combination thereof. See, for example SEQ ID NOs:26-43 and 53-62. In some embodiments, the polypeptide comprises, consists essentially of, or consists of an amino acid sequence selected from the group consisting of SEQ ID NOs:26-43 and 53-62.
[0113] Variants, both naturally occurring and artificially produced, are also encompassed by the presently disclosed subject matter. In some embodiments, a variant of a peptide or polypeptide of the presently disclosed subject matter is characterized by having a substantially identical amino acid sequence to one or more of SEQ ID NOs:1-5 and 26-62. Variants can include polypeptides from any cell, including any bacterial cell, which responds to a sufficient amount of albumin and/or calcium by increasing accumulation of the polypeptide in the cell, and/or increasing in secretion of the polypeptide.
[0114] As used herein, a "substantially identical amino acid sequences" includes those amino acid sequences which have in some embodiments at least about 80% identity, in some embodiments at least about 85% identity, in some embodiments at least about 90% identity, in some embodiments at least about 91% identity, in some embodiments at least about 92% identity, in some embodiments at least about 93% identity, in some embodiments at least about 94% identity, in some embodiments at least about 95% identity, in some embodiments at least about 96% identity, in some embodiments at least about 97% identity, in some embodiments at least about 98% identity, and in some embodiments at least about 99% or more identity to an amino acid sequence as set forth herein. Amino acid sequence identity, similarity, or identity can be computed by using the BLASTP and TBLASTN programs which employ the BLAST (basic local alignment search tool) 2.0.14 algorithm (Altschul et al., 1990a; Altschul et al., 1990b; Karlin & Altschul, 1990; Karlin & Altschul, 1993; Altschul et al., 1997). The default settings used for these programs are suitable for identifying substantially similar amino acid sequences for purposes of the presently disclosed subject matter.
[0115] "Primer" refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase. A primer is typically single-stranded, but may be double-stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
[0116] As used herein, the term "purified" and like terms relate to an enrichment of a molecule or compound relative to other components normally associated with the molecule or compound in a native environment. The term "purified" does not necessarily indicate that complete purity of the particular molecule has been achieved during the process. A "highly purified" compound as used herein refers to a compound that is greater than 90% pure. In particular, purified sperm cell DNA refers to DNA that does not produce significant detectable levels of non-sperm cell DNA upon PCR amplification of the purified sperm cell DNA and subsequent analysis of that amplified DNA. A "significant detectable level" is an amount of contaminate that would be visible in the presented data and would need to be addressed/explained during analysis of the forensic evidence.
[0117] "Recombinant polynucleotide" refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
[0118] A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.
[0119] A "recombinant polypeptide" is one which is produced upon expression of a recombinant polynucleotide.
[0120] A "sample", as used herein, refers preferably to a biological sample from a subject, including, but not limited to, normal tissue samples, diseased tissue samples, biopsies, blood, saliva, feces, semen, tears, and urine. A sample can also be any other source of material obtained from a subject which contains cells, tissues, or fluid of interest. A sample can also be obtained from cell or tissue culture.
[0121] By the term "specifically binds to", as used herein, is meant when a compound or ligand functions in a binding reaction or assay conditions which is determinative of the presence of the compound in a sample of heterogeneous compounds.
[0122] The term "standard", as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.
[0123] The term "substantially pure" describes a compound, e.g., a protein or polypeptide which has been separated from components which naturally accompany it. Typically, a compound is substantially pure when at least 10%, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 90%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis, or HPLC analysis. A compound, e.g., a protein, is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.
[0124] A "therapeutic" treatment is a treatment administered to a subject who exhibits signs of pathology (e.g., a disease or disorder) for the purpose of diminishing or eliminating those signs.
[0125] The term to "treat", as used herein, means reducing the frequency with which symptoms are experienced by a patient or subject or administering an agent or compound to reduce the frequency with which symptoms are experienced.
II. Methods for Polypeptide and/or Vaccine Production
[0126] The presently disclosed subject matter provides in some embodiments methods for increasing production of a polypeptide in a cell. In some embodiments, the method comprises contacting a cell in a culture medium with an amount of an albumin polypeptide sufficient to induce an increase in accumulation of the polypeptide in the cell, and/or an increase in secretion of the polypeptide from the cell into the culture medium relative to a cell grown in a culture medium in the absence of the albumin polypeptide. In some embodiments, the albumin is present in serum in the culture medium.
[0127] A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of albumin by increasing accumulation one or more polypeptides in the cell, and/or increasing secretion of the one or more polypeptides. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of calcium to enhance secretion of one or more polypeptides from the cell.
[0128] In some embodiments, the cell is a Bordetella pertussis (Bp) cell, optionally a Bp cell in culture. The same response to serum has been observed in Bordetella bronchiseptica and Bordetella parapertussis. Thus, in some embodiments, the cell is a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. Thus, in some embodiments, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell. Other bacteria produce related RTX toxins and/or other molecules secreted through the T1SS. For example, Escherichia coli produces a hemolysin that is secreted through the T1SS. In some embodiments, the cell can thus be a cell from another bacterium that produces RTX toxins and/or other molecules that are secreted through the T1SS.
[0129] In some embodiments, the culture medium comprises sufficient calcium to enhance secretion of one or more polypeptides from the cell into the culture medium. The concentration of calcium in the culture medium is in some embodiments at least about 0.15 mM, in some embodiments at least about 0.2 mM, in some embodiments at least about 0.3 mM, in some embodiments at least about 0.4 mM, in some embodiments at least about 0.5 mM. In some embodiments, the concentration of calcium in the culture medium is less than or equal to about 2.0 mM. Thus, the concentration of calcium in the culture medium is in some embodiments 0.15-2.0 mM, in some embodiments 0.2-2.0 mM, in some embodiments 0.3-2.0 mM, in some embodiments 0.4-2.0 mM, and in some embodiments 0.5-2.0 mM. It is noted that SSM medium is approximately 0.136 mM calcium, and this level is not sufficient to promote ACT secretion. The amount of the albumin in the culture medium is in some embodiments at least about 0.2 mg/ml, in some embodiments at least about 0.3 mg/ml, in some embodiments at least about 0.4 mg/ml, in some embodiments at least about 0.5 mg/ml, in some embodiments at least about 1.0 mg/ml, in some embodiments at least about 1.5 mg/ml, and in some embodiments at least about 2.0 mg/ml. By way of example and not limitation for human serum albumin (HAS), at least about 0.23 mg/ml is sufficient to enhance secretion of one or more polypeptides from the cell into the culture medium. In some embodiments, for bovine serum albumin (BSA), higher concentrations of albumin are desired, such as at least about 0.5 mg/ml, at least about 1.0 mg/ml, or at least about 2.0 mg/ml.
[0130] In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide, or a fragment or variant thereof. In some embodiments, the polypeptide is a Bp ACT polypeptide, or a fragment or variant thereof including, but not limited to a polypeptide having an amino acid sequence comprising, consisting essentially of, or consisting of a amino acid sequence as set forth in SEQ ID NOs:1-5. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof from a species other than B. pertussis including, but not limited to B. bronchiseptica or B. parapertussis. See, for example SEQ ID NOs: 44 and 49. In some embodiments, the ACT polypeptide or a fragment or variant thereof comprises an AC domain of an ACT polypeptide. See, for example SEQ ID NOs:2-5. In some embodiments, the polypeptide is an AC domain of an ACT polypeptide or a fragment or variant thereof from a species other than B. pertussis including, but not limited to B. bronchiseptica or B. parapertussis. See, for example SEQ ID NOs: 46-48 and 50-53. In some embodiments, other polypeptides for which the production/maturation is induced by albumin are prepared, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 26-35 and 54-58); filamentous hemagglutinin adhesin (FHA) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 36, 37, and 59); fimbriae 2 (Fim2) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 38, 40, and 60); fimbriae 3 (Fim3) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 39, 41, and 61); pertactin (PRN) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 42, 43, and 62), or any combination thereof. An increased PT amount and secretion has been observed and in the presence of albumin and calcium. The amount of FHA is not dramatically affected by albumin and calcium, but FHA release is increased. Preliminary mass spectroscopy data-/+FBS indicated that both PRN and Fim3 are increased by serum, presumptively also as a response to albumin and calcium.
[0131] In some embodiments, a method for producing a vaccine component is also provided. In some embodiments, the method comprises growing cells in a culture medium comprising a sufficient concentration of albumin to induce an increase in accumulation of the polypeptide in the cells and/or secretion of the polypeptide from the cells into the culture medium; and isolating the polypeptide from the cells and/or the culture medium, whereby a vaccine component is produced.
[0132] A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of an albumin by increasing accumulation of a polypeptide in the cell, and/or increasing in secretion of the polypeptide. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, that responds to a sufficient concentration of calcium to enhance secretion of a polypeptide from the cell.
[0133] In some embodiments, the cell is a Bordetella pertussis (Bp) cell in culture. The same response to serum has been observed in Bordetella bronchiseptica and Bordetella parapertussis. Thus, in some embodiments, the cell is a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, then, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
[0134] In some embodiments, the vaccine component comprises a vaccine antigen. In some embodiments, the vaccine antigen comprises a peptide and/or a polypeptide. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof. See, for example SEQ ID NOs:1-5 and 44-63. In some embodiments, the ACT polypeptide or a fragment or variant thereof comprises an AC domain of an ACT polypeptide. See, for example SEQ ID NOs:2-5, 45-48, and 50-53. In some embodiments, other polypeptides in which production/maturation is induced by albumin are prepared, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 26-35 and 54-58); filamentous hemagglutinin adhesin (FHA) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 36, 37, and 59); pertactin (PRN) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 42, 43, and 62); fimbriae 2 (Fim2) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 38, 40, and 60); fimbriae 3 (Fim3) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 39, 41, and 61); or any combination thereof. An increased PT amount and secretion was observed in response to albumin and calcium. The amount of FHA was not dramatically affected by albumin and calcium, but FHA release is increased. Preliminary mass spectroscopy data-/+FBS indicated that both PRN and Fim3 were increased by serum, which is presumed to also be a response to albumin and calcium
[0135] In some embodiments, the culture medium comprises sufficient calcium to enhance secretion of the polypeptide from the cell into the culture medium. In some embodiments, the concentration of calcium in the culture medium is at least about 0.5 mM. In some embodiments, the amount of the albumin polypeptide is at least about 0.2 mg/ml in the culture medium. By way of example for HSA, at least about 0.23 mg/ml is sufficient. In some embodiments, for BSA, higher concentrations of albumin are desired, such as at least about 0.5 mg/ml, at least about 1.0 mg/ml, or at least about 2.0 mg/ml.
[0136] In some embodiments, the vaccine component, such as a peptide or polypeptide, is purified from the culture medium using a ligand that binds to the component. In some embodiments, the ligand is an antibody or a fragment or derivative thereof, wherein the antibody, fragment, or derivative comprises at least one paratope that binds to the peptide or polypeptide. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the ligand or the fragment or derivative thereof is directly or indirectly conjugated. In some embodiments, the ligand is indirectly conjugated to the bead via a tether. Optionally, the tether comprises polyethylene glycol.
[0137] In some embodiments, the method comprises combining the peptide or polypeptide with one or more additional peptides and/or polypeptides to produce an antigen pool to be employed in a vaccine. In some embodiments, the one or more additional peptides and/or polypeptides are selected from the group consisting of pertussis toxin (PT), optionally Bp PT; filamentous hemagglutinin adhesin (FHA), optionally Bp FHA; pertactin (PRN), optionally Bp PRN; fimbriae 2 (Fim2), optionally Bp Fim2; fimbriae 3 (Fim3), optionally Bp Fim3; diphtheria toxoid (DT), tetanus toxoid (TT), and combinations thereof. Other polypeptides include antigens found in pertussis combination vaccines that contain Haemophilus (including Haemophilus influenza type b), polio, and/or HepB components, as are known in the art.
[0138] In some embodiments, the method comprises inactivating the polypeptide. In some embodiments, the inactivated polypeptide is combined with one or more additional polypeptides to produce an antigen pool to be employed in a vaccine. The one or more additional polypeptides can be selected from the group consisting of pertussis toxin (PT), optionally Bp PT; filamentous hemagglutinin adhesin (FHA), optionally Bp FHA; pertactin (PRN), optionally Bp PRN; fimbriae 2 (Fim2), optionally Bp Fim2; fimbriae 3 (Fim3), optionally Bp Fim3; diphtheria toxoid (DT), tetanus toxoid (TT), and combinations thereof. Other polypeptides include antigens found in pertussis combination vaccines that contain Haemophilus (including Haemophilus influenza type b), polio, and/or HepB components, as are known in the art.
[0139] In some embodiments, the method comprises adding to the vaccine component and/or antigen pool one or more pharmaceutically acceptable carriers and/or excipients, thereby producing a vaccine. In some embodiments the vaccine is in the form of an injectable or an aerosol.
III. Methods of Screening and Compositions Identified by the Same
[0140] A method for screening for a molecule that inhibits albumin-induced signaling in a cell, such as a Bordetella pertussis (Bp) cell, is provided in accordance with the presently disclosed subject matter. In some embodiments, the method comprises contacting a cell growing in a culture medium with a candidate compound, wherein the culture medium comprises at least about 0.5 mM calcium and at least about 0.2 mg/ml albumin; and comparing accumulation of a gene product in the culture medium in presence of the candidate compound to accumulation of the gene product in the culture medium in absence of the candidate compound. A reduced accumulation of the gene product in the culture medium in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits album in-induced signaling in the cell.
[0141] In some embodiments, a method for screening for a molecule that inhibits albumin-induced signaling in a cell, such as a Bordetella pertussis (Bp) cell, comprises contacting a cell growing in a culture medium with a candidate compound, wherein the culture medium comprises less than about 0.5 mM calcium and at least about 0.2 mg/ml albumin; and comparing accumulation of a gene product in the cell, such as a Bp cell, in presence of the candidate compound to accumulation of the gene product in absence of the candidate compound. In some embodiments, reduced accumulation of the gene product in the cell in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the cell.
[0142] A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of an albumin by increasing accumulation of a polypeptide in the cell, and/or increasing in secretion of the polypeptide. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, that responds to a sufficient calcium to enhance secretion of a polypeptide from the cell.
[0143] In some embodiments, the cell is a Bordetella pertussis (Bp) cell. The same response to serum has been observed in Bordetella bronchiseptica and Bordetella parapertussis. Thus, in some embodiments, the cell is a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, then, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell or a Bordetella parapertussis cell.
[0144] By way of example for HSA, at least about 0.23 mg/ml is sufficient. In some embodiments, for BSA, higher concentrations of albumin are desired, such as at least about 0.5 mg/ml, at least about 1.0 mg/ml, or at least about 2.0 mg/ml.
[0145] In some embodiments, the gene product is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof. See, for example SEQ ID NOs:1-5 and 44-53. In some embodiments, the ACT polypeptide or a fragment or variant thereof comprises an AC domain of an ACT polypeptide. See, for example SEQ ID NOs:2-5, 45-48, and 50-53. In some embodiments, other gene products in which production/maturation is induced by albumin are employed, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides and/or fragments thereof (see e.g., SEQ ID NOs: 26-35 and 54-58); filamentous hemagglutinin adhesin (FHA) polypeptides and/or fragments thereof (see e.g., 36, 37, and 59); pertactin (PRN) polypeptides and/or fragments thereof (see e.g., 42, 43, and 62); fimbriae 2 (Fim2) polypeptides and/or fragments thereof (see e.g., 38, 40, and 60); fimbriae 3 (Fim3) polypeptides and/or fragments thereof (see e.g., 39, 41, and 61); or any combination thereof. Increased PT amount in response to albumin has been observed and in the presence of calcium, secretion also appears to be increased. The amount of FHA is not dramatically affected by albumin and calcium, but FHA release is increased. Preliminary mass spectroscopy data-/+FBS indicated that both PRN and Fim3 are increased by serum, presumptively also as a response to albumin and calcium.
[0146] As used herein, the phrase "candidate compound" refers to any molecule for which testing for an ability to modulate production and/or maturation of a polypeptide of the presently disclosed subject matter might be desired. Representative candidate compounds include but are not limited to peptides, oligomers, nucleic acids (e.g., aptamers), small molecules (e.g., chemical compounds), antibodies or fragments thereof, nucleic acid-protein fusions, any other affinity agent, and combinations thereof. In some embodiments, a candidate compound of the presently disclosed subject matter comprises an albumin polypeptide or a fragment of an albumin polypeptide. In some embodiments, the candidate compound is an antibody or fragment or derivative thereof. In some embodiments, the candidate compound is a small molecule. A candidate substance to be tested can be a purified molecule, a homogenous sample, or a mixture of molecules or compounds.
[0147] The term "small molecule" as used herein refers to a compound, for example an organic compound, with a molecular weight of less than about 1,000 daltons, more preferably less than about 750 daltons, still more preferably less than about 600 daltons, and still more preferably less than about 500 daltons. A small molecule also preferably has a computed log octanol-water partition coefficient in the range of about -4 to about +14, more preferably in the range of about -2 to about +7.5.
[0148] Test substances can be obtained or prepared as a library. As used herein, the term "library" means a collection of molecules. A library can contain a few or a large number of different molecules, varying from about ten molecules to several billion molecules or more. A molecule can comprise a naturally occurring molecule, a recombinant molecule, or a synthetic molecule. A plurality of test substances in a library can be assayed simultaneously. Optionally, test substances derived from different libraries can be pooled for simultaneous evaluation.
[0149] A library can comprise a random collection of molecules. Alternatively, a library can comprise a collection of molecules having a bias for a particular sequence, structure, or conformation. See e.g., U.S. Pat. Nos. 5,264,563 and 5,824,483, herein incorporated by reference. Methods for preparing libraries containing diverse populations of various types of molecules are known in the art, for example as described in U.S. Patents cited herein above. Numerous libraries are also commercially available.
IV. Therapeutic Methods and Compositions
[0150] In some embodiments, a candidate compound as identified or prepared herein is used in a method for treating or preventing a disease or disorder in a subject in need thereof. In some embodiments, the method comprises administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a disease or disorder in the subject.
[0151] In some embodiments, a candidate compound as identified or prepared herein is used in a method for treating or preventing an infection in a subject in need thereof. In some embodiments, the method comprising administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing an infection in the subject.
[0152] In some embodiments, a vaccine as prepared herein is administered to a subject in need thereof. In some embodiments, the vaccine is used in treating or preventing an infection in a subject in need thereof.
[0153] In some embodiments, the infection is a Bordetella species infection, such as a Bordetella pertussis infection, a Bordetella bronchiseptica infection, or a Bordetella parapertussis infection.
[0154] The term "subject" as used herein includes any vertebrate species, preferably warm-blooded vertebrates such as mammals and birds. More particularly, the methods of the presently disclosed subject matter are provided for the treatment of mammals such as humans, as well as those mammals of importance due to being endangered (such as Siberian tigers), of economical importance (animals raised on farms for consumption by humans) and/or social importance (animals kept as pets or in zoos) to humans, for instance, carnivores other than humans (such as cats and dogs), swine (pigs, hogs, and wild boars), ruminants and livestock (such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels), and horses. Also provided is the treatment of birds, including those kinds of birds that are endangered or kept in zoos, as well as fowl, and more particularly domesticated fowl or poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economical importance to humans.
[0155] Suitable formulations for administration of a therapeutic composition of the presently disclosed subject matter to a subject include aqueous and non-aqueous sterile injection solutions which can contain anti-oxidants, buffers, bacteriostats, bactericidal antibiotics and solutes which render the formulation isotonic with the bodily fluids of the intended recipient; and aqueous and non-aqueous sterile suspensions which can include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a frozen or freeze-dried (lyophilized) condition requiring only the addition of sterile liquid carrier, for example water for injections, immediately prior to use. Some preferred ingredients are sodium dodecyl sulphate (SDS), for example in the range of 0.1 to 10 mg/ml, preferably about 2.0 mg/ml; and/or mannitol or another sugar, for example in the range of 10 to 100 mg/ml, preferably about 30 mg/ml; phosphate-buffered saline (PBS), and any other formulation agents conventional in the art.
[0156] A therapeutic composition of the presently disclosed subject matter can be administered to a subject systemically, parenterally, or orally. The term "parenteral" as used herein includes intravenous injection, intra-muscular injection, intra-arterial injection, and infusion techniques. For delivery of compositions to pulmonary pathways, compositions can be administered as an aerosol or coarse spray. A delivery method is selected based on considerations such as the type of the type of carrier, therapeutic efficacy of the composition, and the condition to be treated. An effective amount of a composition of the presently disclosed subject matter is administered to a subject.
[0157] Actual dosage levels of active ingredients in a therapeutic composition of the presently disclosed subject matter can be varied so as to administer an amount of the composition that is effective to achieve the desired therapeutic response for a particular subject. The selected dosage level will depend upon a variety of factors including the activity of the therapeutic composition, formulation, the route of administration, combination with other drugs or treatments, the disease or disorder to be treated, and the physical condition and prior medical history of the subject being treated. Determination and adjustment of an effective amount or dose, as well as evaluation of when and how to make such adjustments, are known to those of ordinary skill in the art of medicine.
[0158] For soluble formulations of a composition of the presently disclosed subject matter, conventional methods of extrapolating human dosage are based on doses administered to a murine animal model can be carried out using the conversion factor for converting the mouse dosage to human dosage: Dose Human per kg=Dose Mouse per kg.times.12. Drug doses are also given in milligrams per square meter of body surface area because this method rather than body weight achieves a good correlation to certain metabolic and excretionary functions. Moreover, body surface area can be used as a common denominator for drug dosage in adults and children as well as in different animal species as described by Freireich et al. (1966) Cancer Chemother Rep 50:219-244. Briefly, to express a mg/kg dose in any given species as the equivalent mg/m.sup.2 dose, the dose is multiplied by the appropriate km factor. In adult humans, 100 mg/kg is equivalent to 100 mg/kg.times.37 kg/m.sup.2=3700 mg/m.sup.2.
[0159] For additional guidance regarding dose, see Berkow et al. (1997) The Merck Manual of Medical Information, Home ed. Merck Research Laboratories, Whitehouse Station, N.J.; Goodman et al. (1996) Goodman & Gilman's the Pharmacological Basis of Therapeutics, 9th ed. McGraw-Hill Health Professions Division, New York; Ebadi (1998) CRC Desk Reference of Clinical Pharmacology. CRC Press, Boca Raton, Fla., United States of America; Katzung (2001) Basic & Clinical Pharmacology, 8th ed. Lange Medical Books/McGraw-Hill Medical Pub. Division, New York; Remington et al. (1975) Remington's Pharmaceutical Sciences, 15th ed. Mack Pub. Co., Easton, Pa.; Speight et al. (1997) Avery's Drug Treatment: A Guide to the Properties, Choice, Therapeutic Use and Economic Value of Drugs in Disease Management, 4th ed. Adis International, Auckland/Philadelphia, United States of America; Duch et al. (1998) Toxicol Lett 100-101:255-263.
V. Kits and Storage
[0160] In some embodiments, a kit is disclosed, wherein the kit comprises albumin and instructions for its use in increasing accumulation of a polypeptide in a cell, such as a Bp cell, in a culture medium and/or for increasing secretion of the polypeptide from the cell, such as a Bp cell into a culture medium. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof, optionally a Bp ACT polypeptide or a fragment or variant thereof. In some embodiments, the kit further comprises calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the cell, such as a Bp cell, into the culture medium. In some embodiments, the kit is employed for carrying out any and methods disclosed herein and can be used to contain the components, and amounts thereof, used in any and all methods as disclosed herein.
[0161] A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of an albumin by increasing accumulation of a polypeptide in the cell, and/or increasing in secretion of the polypeptide. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, that responds to a sufficient calcium to enhance secretion of a polypeptide from the cell. In some embodiments, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
[0162] In some embodiments, the kit comprises a ligand adapted for removing the albumin from the culture medium. In some embodiments, the ligand binds specifically to the albumin when the albumin is present in the culture medium. In some embodiments, the ligand is an antibody or a fragment or derivative thereof. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the albumin is directly or indirectly conjugated. In some embodiments, the albumin is indirectly conjugated to the bead via a tether, optionally wherein the tether comprising an antibody or a fragment or derivative thereof that specifically binds to the albumin and is conjugated to the bead.
[0163] In some embodiments, a kit is disclosed comprising (a) a container that contains at least one composition as described herein, in solution or in lyophilized form; (b) optionally, a second container containing a diluent or reconstituting solution for the lyophilized formulation; and (c) optionally, instructions for (i) use of the solution or (ii) reconstitution and/or use of the lyophilized formulation. The kit may further comprise one or more of (iii) a buffer, (iv) a diluent, (v) a filter, (vi) a needle, or (v) a syringe. In some embodiments, the container is selected from the group consisting of: a bottle, a vial, a syringe, a test tube, or a multi-use container. In some embodiments, the composition is lyophilized.
[0164] The kits can contain exactly, about, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, or more compositions. Each composition in the kit can be used or administered at the same time or at different times.
[0165] In some embodiments, the kits can comprise a lyophilized formulation of the presently disclosed compositions in a suitable container and instructions for its reconstitution and/or use. Suitable containers include, for example, bottles, vials (e.g., dual chamber vials), syringes (such as dual chamber syringes), and test tubes. The container can be formed from a variety of materials such as glass or plastic. In some embodiments, the kit and/or the container contain(s) instructions on or associated therewith that indicate(s) directions for reconstitution and/or use of a lyophilized formulation. For example, the label can indicate that the lyophilized formulation is to be reconstituted to concentrations as described herein. Lyophilized and liquid formulations are typically stored at -20.degree. C. to -80.degree. C.
[0166] The container holding the composition(s) can be a multi-use vial, which in some embodiments allows for repeat uses (e.g., from 2-6 or more uses) of the reconstituted formulation. The kit can further comprise a second container comprising a suitable diluent (e.g., sodium bicarbonate solution).
[0167] In some embodiments, upon mixing of the diluent and the lyophilized formulation, the final concentration of an active agent in the reconstituted formulation is at least about 0.20, 0.25, 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, or 2.0 mg/mL/albumin. In some embodiments, upon mixing of the diluent and the lyophilized formulation, the concentration of calcium in the reconstituted formulation is at least or about 0.5 .mu.g/mL/calcium.
[0168] The kit can further include other materials desirable from a commercial and/or user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with or without instructions for use.
[0169] The kits can have a single container that contains the formulation of the compositions with or without other components (e.g., other compounds or compositions of these other compounds) or can have a distinct container for each component.
[0170] Additionally, the kits can include a formulation of the presently disclosed compositions packaged for use in combination with the co-administration of a second compound, e.g., a candidate compound. One or more of the components of the kit can be pre-complexed or one or more components can be in a separate distinct container prior to use. One or more of the components of the kit can be provided in one or more liquid solutions. In some embodiments, the liquid solution is an aqueous solution. In a further embodiment, the liquid solution is a sterile aqueous solution. One or more of the components of the kit can also be provided as solids, which in some embodiments can be converted into liquids by addition of suitable solvents, which in some embodiments can be provided in another distinct container.
[0171] The container of a kit can be a vial, a test tube, a flask, a bottle, a syringe, or any other structure suitable for enclosing a solid or liquid. Typically, when there is more than one component, the kit contains a second vial or other container that allows for separate use. The kit can also contain another container for an acceptable diluent. In some embodiments, a therapeutic kit contains an apparatus (e.g., one or more needles, syringes, eye droppers, pipette, etc.), which enables use of the agents of the disclosure that are components of the kit.
EXAMPLES
[0172] The following Examples provide further illustrative embodiments. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following EXAMPLES are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter.
Materials and Methods for the Examples
[0173] Growth of B. pertussis, B. parapertussis (Bpp), and B. bronchiseptica (Bb).
[0174] For the majority of the experiments presented here, Bp clinical isolate UT25 (Parker et al., 1980) was used. Bp, Bpp, and Bb strains (listed in Table 2) were plated on Bordet-Gengou agar (GIBCO.TM. brand, available from Thermo Fisher Scientific Inc., Waltham, Mass., United States of America) containing 15% defibrinated sheep blood (Cocalico Biologicals Inc., Reamstown, Pa., United States of America) and incubated for 48-72 hours at 37.degree. C. Bacteria were transferred to modified synthetic Stainer-Scholte liquid media (SSM; Stainer & Scholte, 1970; Hewlett & Wolff, 1976), grown for 20-24 hours at 35.5.degree. C. shaking, and then diluted to an OD.sub.600 of 0.08 and grown another 20-24 hours. On the day of the experiment, bacteria were diluted to an OD.sub.600 of 0.1 and grown for 8 hours, unless otherwise stated. Bacteria were cultured as indicated in the presence or absence of fetal bovine serum (FBS; GIBCO.TM. brand, available from Thermo Fisher Scientific Inc., Waltham, Mass., United States of America), mouse serum, human serum (from a pool of healthy human donors as approved by the Institutional Review Board at the University of Virginia), bovine serum albumin (Sigma A3059, further purified fraction V, fatty acid depleted, essentially .gamma.-globulin free, .about.99% pure; Sigma-Aldrich Corp., St. Louis, Mo., United States of America), or human serum albumin (Sigma A3782, fatty acid free, globulin 101 free, .gtoreq.99% pure; Sigma-Aldrich Corp., St. Louis, Mo., United States of America). All serum was heat-inactivated for 30 minutes at 56.degree. C. before addition to bacterial cultures. At indicated time points, 1 ml of bacterial culture was removed (total) and an equal volume of culture was spun at 15,000 rotations per minute (rpm) for 10 min and the supernatant reserved (supernatant). Samples were stored at -80.degree. C. until tested.
[0175] Adenylate Cyclase Enzymatic Activity.
[0176] Bp organisms were grown as described in the BRIEF DESCRIPTION OF THE DRAWINGS, and the total and supernatant fractions were obtained as described. Adenylate cyclase enzymatic activity was measured by the conversion of [.sup.32P] ATP to [.sup.32P]cAMP as described previously (Hewlett et al., 1989). Briefly, each assay tube contained 60 mM Tricine, 10 mM MgCl.sub.2, 2 mM ATP with 3.times.10.sup.5 cpm of [.alpha.-.sup.32P] ATP and 1 .mu.M calmodulin at pH 8.0. The reaction was carried out at 30.degree. C. for 10 minutes and terminated by the addition of 100 .mu.l of a solution containing 1% SDS, 20 mM ATP, and 6.24 mM cAMP, with 2.0.times.10.sup.4 cpm of [.sup.3H] cAMP. Cyclic AMP was quantified by the double column method of Salomon et al. (Salomon et al., 1974) and reported at pmoles cAMP/10 min/10 .mu.l. All measurements were taken on the linear part of a curve comparing ACT amount and enzyme activity, generated using known concentrations of recombinant ACT, providing reproducible quantification of the amount of ACT present in the sample (Eby et al., 2013). Data are also presented as mU/ml where one unit of AC corresponds to 1 .mu.mole of cAMP formed in 1 minute at pH 8.0 at 30.degree. C. (Ladant et al., 1986) in FIG. 1.
[0177] Western Blot Analysis.
[0178] Bp organisms were grown as described in the BRIEF DESCRIPTION OF THE DRAWINGS, and the total and supernatant fractions were obtained as described. Samples were normalized according to optimal density at 600 nm, boiled in reducing sample buffer (Thermo Fisher Scientific Inc., Waltham, Mass., United States of America) for 5 minutes, and loaded on a 10% polyacrylamide gel for electrophoresis. Gels were then electroblotted at 20 volts onto PVDF membranes overnight at 4.degree. C. The membrane was blocked with 5% nonfat dry milk in PBS+0.1% TWEEN.RTM. 20 brand non-ionic detergent, pH 7.4 (PBS-T) for 1 hour and then incubated with primary antibodies (Polyclonal rabbit anti-ACT antibody, which recognizes all major domains of the toxin molecule (Gray et al., 2001), anti-BSA (EMD Millipore Corp., Billerica, Mass., United States of America), polycolonal rabbit anti-PT antibody, or polyclonal rabbit anti-FHA antibody)) at 1:10,000 for 2 hours. The membrane was extensively washed in PBS-T and probed with anti-rabbit IgG HRP-linked antibody (Cell Signaling Technologies, Danvers, Mass., United States of America) at a 1:15,000 dilution. ECL chemiluminescence (Amersham, available from GE Healthcare Bio-Sciences, Pittsburgh, Pa., United States of America) was used to detect HRP-labeled secondary antibodies.
[0179] Measurement of Albumin Binding to Bp.
[0180] Bp strains were grown in SSM with 2 mM calcium+1-2 mg/ml BSA (as indicated) for 6 hours. The bacteria were then extensively washed (7 wash steps with three changes to fresh tubes to eliminate carry-over albumin not bound to the bacterial surface) with SSM (without calcium or albumin). Purified BSA was loaded as a positive control (400 ng). Samples were normalized by bacterial density and analyzed by Western blotting with an anti-BSA antibody.
[0181] Fractionation of FBS.
[0182] Spin columns with 10 kilodalton (kDa) or 50 kDa size exclusions (AMICON.RTM. brand, available from EMD Millipore Corp., Billerica, Mass., United States of America) were used to fractionate FBS according to manufacturer's instructions. Thirteen ml of FBS was concentrated into 1 ml with a 50 kDa molecular weight cut off column, generating the .gtoreq.50 kDa and .ltoreq.50 kDa fractions. Four ml of flow-through was added to a spin column with a 10 kDa molecular weight cut off and centrifuged until almost the entire volume was collected as flow-through to generate the 10 kDa fraction. Fractions were added to bacterial cultures at concentrations as equivalent as possible to 10% FBS.
[0183] EGTA Treatment of BSA.
[0184] Three ml of BSA at 50 mg/ml was dialyzed against 1 liter of PBS, pH 7.5+2 mM EGTA, 4 times for a total of 4 liters, using a Slide-A-Lyzer Dialysis cassette (Thermo Fisher Scientific Inc., Waltham, Mass., United States of America). This material was then dialyzed versus PBS, pH 7.5 and the protein measured before its use in indicated experiments.
[0185] Mouse Serum.
[0186] Mice were euthanized and blood collected through ventricular puncture. Serum was isolated from whole blood using a BD Microtainer serum separator following manufacturer's instructions. All mice were treated in accordance with the Animal Care and Use Committee at The Jackson Laboratory. Total protein was quantified using the Pierce BCA Protein Assay (Thermo Fisher Scientific Inc., Waltham, Mass., United States of America) to be 65 mg/ml for the wild-type serum and 44 mg/ml for the analbuminemic serum, and the concentration of albumin in 10% wild-type mouse serum was determined to be 2 mg/ml by SDS-PAGE with a concentration range (0.25-4 mg/ml) of purified BSA.
[0187] RNA Extraction and qRT-PCR.
[0188] Bp was grown as indicated. Bacterial cells from three biological replicate cultures were pelleted and treated with RNAprotect (QIAGEN Inc., Germantown, Md., United States of America). RNA was extracted using the RNeasy kit (QIAGEN Inc., Germantown, Md., United States of America) following the manufacturer's instructions. Primers used in real-time qPCR assays were validated before use, and their sequences are listed in Table 1. Reaction mixtures were prepared as previously described (Walters & Sperandio, 2006). qRT-PCR was performed using a one-step reaction in an ABI 7500-FAST sequence 162 detection system (APPLIED BIOSYSTEMS.TM. brand, available from Thermo Fisher Scientific Inc., Waltham, Mass., United States of America). All data were normalized to the levels of rpoB and analyzed using the comparative cycle threshold (C.sub.T) method (Livak & Schmittgen, 2001). The relative quantification method was used to determine the expression level of target genes in various growth conditions. Statistical significance was determined by an unpaired t-test, and a p value of 0.05 was considered significant.
TABLE-US-00002 TABLE 1 Primers Employed for qPCR Primer Name Primer Sequence Reference rpoB Bp F GCTGGGACCCGAGGAAAT Bibova etal., (SEQ ID NO: 6) 2013 rpoB Bp R CGCCAATGTAGACGATGCC Bibova etal., (SEQ ID NO: 7) 2013 cyaA Bp F CGAGGCGGTCAAGGTGAT Bibova et al., (SEQ ID NO: 8) 2013 cyaA Bp R GCGGAAGTTGGACAGATGC Bibova et al., (SEQ ID NO: 9) 2013 bvgA Bp F AGGTCATCAATGCCGCCA Bibova et al., (SEQ ID NO: 10) 2013 bvgA Bp R GCAGGACGGTCAGTTCGC Bibova et al., (SEQ ID NO: 11) 2013 fhaB Bp F CAAGGGCGGCAAGGTGA Bibova et al., (SEQ ID NO: 12) 2013 fhaB Bp R ACAGGATGGCGAACAGGCT Bibova et al., (SEQ ID NO: 13) 2013 ptxA Bp F CCAGAACGGATTCACGGC Bibova et al., (SEQ ID NO: 14) 2013 ptxA Bp R CTGCTGCTGGTGGAGACGA Bibova et al., (SEQ ID NO: 15) 2013 cyaBRTF TCATGCTGGCTCGCTATCAC [disclosure] (SEQ ID NO: 16) cyaBRTR TCGCTACAGAATGCCTGCTC [disclosure] (SEQ ID NO: 17) cyaDRTF AGCAAGGACATCGGCTTTGT [disclosure] (SEQ ID NO: 18) cyaDRTR TTCGAGCGTTCCGTACTTCG [disclosure] (SEQ ID NO: 19) cyaERTF CGCCCTATTATCCCAGCGTC [disclosure] (SEQ ID NO: 20) cyaERTR TACCGCCATCACATTGTTGC [disclosure] (SEQ ID NO: 21) cyaXRTF CCGATGTCTTGCGCCTGTAT [disclosure] (SEQ ID NO: 22) cyaXRTR GCGCATACGACACATAGGGA [disclosure] (SEQ ID NO: 23) cyaCRTF ATGAACTCTCCCATGCACCG [disclosure] (SEQ ID NO: 24) cyaCRTR TATGCAACCGGCACGTCATT [disclosure] (SEQ ID NO: 25)
[0189] Bronchoalveolar Lavage (BAL).
[0190] BAL was performed for clinical indications on 7 patients with interstitial lung disease or bronchiectasis using published protocols (Anonymous, 1990). Three 50 ml aliquots of saline were sequentially perfused and then aspirated in the right middle lobe or lingula. A 10 ml aliquot of the sample that would have otherwise been discarded was used for this study via a protocol that was classified as exempt by the Institutional Review Board at the University of Virginia. Samples were centrifuged at 3,000 rpm to remove cells, and the supernatants were pooled and concentrated 10-fold using AMICON.RTM. CENTRICON.RTM. brand spin columns with a 10 kDa molecular weight cut off (EMD Millipore Corp., Billerica, Mass., United States of America). The concentrated BAL was filter sterilized before addition to bacterial cultures.
[0191] Culture of J774.1 Cells.
[0192] J774.1 (J774) cells, a murine macrophage cell line, were maintained at 37.degree. C. in Dulbecco's Modified Eagle's medium with high glucose (GIBCO.TM. brand, available from Thermo Fisher Scientific Inc., Waltham, Mass., United States of America) plus 10% heat-inactivated FBS in 5% CO.sub.2.
[0193] Cytotoxicity Assay.
[0194] ACT causes cytotoxicity of J774 cells (Hewlett et al., 2006, Vojtova et al., 2006). J774 cells (30,000 in 90 .mu.l) were seeded in each well of a 96-well plate and allowed to attach overnight at 37.degree. C., 5%, CO.sub.2. Samples were added and cells incubated at 37.degree. C. for 3 hours. The number of viable cells was determined using the CCK8 Assay (Dijindo Molecular Technologies, Gaithersburg, Md., United States of America), which measures the reduction of WST-8, a water-soluble tetrazolium salt by dehydrogenases in viable cells. The percentage of viable cells was determined by the following equation:
[(Experimental-Blank/Control cells-Blank)].times.100.
A blank is a well containing media and CCK8 reagent, but no cells. Control cells are J774 cells that are not treated.
Example 1
Serum Increases the Amount of ACT and Shifts Localization to the Supernatant
[0195] To test the hypothesis that serum promoted an increase in extracellular ACT, the amount of ACT was measured in cultures of wild-type Bp strain UT25 grown in Stainer-Scholte medium (SSM; see Stainer & Scholte, 1970) with and without 10% FBS for 8 hours. The amount and relative distribution of ACT were determined by enzyme activity using a cell-free assay measuring conversion of [.sup.32P]-ATP to [.sup.32P]-cAMP (Hewlett et al., 1989, Salomon et al., 1974; FIG. 2A), and relative differences in protein amount were confirmed by Western blotting with a polyclonal rabbit anti-ACT antibody, recognizing the full-length, 200 kDa protein (FIG. 2B). It has been shown previously that this AC assay is highly sensitive and quantitative with a linear range of 0.064-80 ng/ml (Eby et al., 2013). When necessary, samples were diluted to be within this range of toxin concentrations. In addition, it was confirmed the presence of FBS had no effect on enzymatic activity of purified ACT. As seen previously, 90% of the total ACT is associated with the bacterium during growth in SSM (Hewlett et al., 1976); however, during growth in the presence of FBS, 90% of this ACT was located in the supernatant (FIG. 2A), similar to published observations about the distribution of ACT in vivo (Eby et al., 2013). In addition, there was an unexpected 12.6-fold increase in the amount of ACT during growth with FBS relative to absence of serum (FIG. 2A), resulting in concentrations equivalent to 2 .mu.g/ml ACT in the supernatant at 8 hours. These data supported the hypothesis that serum components change the distribution of ACT and also reveal that they stimulate an increase in the amount of ACT.
[0196] To understand whether there are differences in growth+/-FBS that could account for ACT amount and localization, Bp UT25 was grown in SSM+/-10% FBS and measured bacterial growth by optical density at 600 nm (OD.sub.600) every 8 hours for two days. The bacterial densities were significantly higher between 8-32 hours when Bp was grown in SSM+FBS versus SSM alone (FIG. 3A). Because of this difference in growth, quantities of ACT by enzyme activity presented herein, except for FIG. 3, were normalized to bacterial density (OD.sub.600). Importantly, the quantity of ACT peaked at 24 hours in the presence or absence of FBS, but that amount was nearly 30-fold greater at this time point for Bp grown with serum versus without (FIG. 3A). The response to serum was rapid, including even modest increases at the zero time point, most likely due to the .about.10 minute sample processing time (FIG. 3B). By 30 minutes, there was a 3-fold increase in the amount of toxin and 59% of the total ACT was in the supernatant. By 120 minutes, there was a 10.9-fold increase in the amount of ACT during growth in SSM+FBS versus SSM and 85% of the total ACT was in the supernatant. These early increases occurred with minimal changes in bacterial density. Together, these results showed that the response to serum was rapid, robust, and peaked near the end of the logarithmic phase of Bp growth.
[0197] Multiple wild-type and mutant strains of Bp, B. parapertussis (Bpp), and B. bronchiseptica (Bb) were tested to determine if the response to serum is conserved. All strains were grown in SSM or SSM+10% FBS for 8 hours. ACT was detected by measuring AC enzyme activity, and the percent activity in the supernatant and fold increase in total ACT were determined (Table 2). Seven strains of Bp (all strains tested except a Bvg(-) strain, discussed further below) responded to serum by increasing the amount of ACT and releasing the majority of the ACT to the supernatant. Bp strain UT25 makes approximately 10-fold more ACT than the reference strain Bp Tohama, and the elevated level of ACT produced by UT25 was more comparable to the level of ACT produced by recent clinical isolates that were tested. For this reason, Bp UT25 was used for the majority of the experiments presented herein. As shown previously (Zaretzky et al., 2002), Bp strains deficient in the adhesin filamentous hemagglutinin (FHA, encoded by fhaB) had a higher percentage of ACT present in the supernatant during growth in SSM (Table 2). It was found, however, that Bp BP353, a BP338 derivative with a Tn5 insertion in fhaB, still responded to FBS; the amount of ACT increased 9.2-fold and 100% of ACT was present in the supernatant. Bpp CN8234 responded to serum comparably to Bp with a 7.2-fold increase in total ACT and a shift from 16% to 88% in the supernatant (Table 2). Strains of Bb had a higher percentage of ACT localized to the supernatant during growth in SSM compared to Bp, but both the total amount (3.1-fold or 5.1-fold depending on strain) and percentage of ACT in the supernatant were enhanced by serum. As might be expected, basal levels of ACT in the supernatant in the absence of FBS were higher in the Bb fhaB deletion strain RBX9 compared to its wild-type parent strain Bb RB50, but the levels of total and supernatant-localized ACT were further enhanced during growth in the presence of serum, consistent with data from the Bp BP353 strain. These findings demonstrated that the response to serum was conserved amongst Bp, Bpp, and Bb, and also indicated that strains secreting higher levels of ACT under basal conditions still responded to serum by further increasing ACT amount and the proportion in the supernatant.
TABLE-US-00003 TABLE 2 Response to Serum is Conserved Amongst B. pertussis, Bordetella parapertussis, and B. bronchiseptica Strains Tested Fold Strain Description FBS (-).sup.a FBS (+).sup.b increase.sup.c Bp UT25 Clinical Isolate 10 90 12.6 (Parker et al., 1980) Bp WHO Reference 13 99 5.2 Tohama Strain (Sato & Arai, 1972) Bp BP338 Laboratory Strain 8 100 12.6 (Weiss et al., 1983) Bp BP347 BP338 bvgA::Tn5 None None None (Weiss et al., 1983) detected detected detected Bp BP353 BP338 fhaB::Tn5 34 100 9.8 (Weiss et al., 1983) Bp BPSM Laboratory Strain 23 90 10.2 (Menozzi et al., 1994) Bp V252 Clinical Isolate 14 92 12.8 Bp D420 Clinical Isolate 9 100 5.5 (Boinett et al., 2015) Bpp Clinical Isolate 16 88 7.2 CN8234 (McLafferty et al., 1988) Bb RB50 Laboratory Strain 61 99 3.1 (Cotter & Miller, 1994) Bb RBX9 RB50 .DELTA.fhaB 88 99 3.8 (Cotter et al., 1998) Bb 1289 Hypervirulent isolate 64 95 5.2 (Buboltz et al., 2009) .sup.a% AC enzyme activity in supernatant in SSM without FBS .sup.b% AC enzyme activity in supernatant in SSM + FBS .sup.CFold increase in AC enzyme activity in the presence of FBS as compared to in the absence of FBS
Example 2
Albumin and Calcium Act Synergistically to Increase ACT Amount and Distribution to the Supernatant
[0198] To determine which components in serum promoted the observed changes in ACT amount and distribution, preliminary fractionation of serum using spin columns with different size exclusions (.ltoreq.10 kD, .ltoreq.50 kD, and .gtoreq.50 kD) were performed. Bp UT25 was then cultured in SSM with the individual serum fractions for 8 hours as indicated in Table 3. ACT was detected by measuring AC enzyme activity, and the percent activity in the supernatant and fold increase in total ACT were determined. The responses to the .ltoreq.10 kD and .ltoreq.50 kD fractions, as reflected by percentage of ACT in the supernatant and fold increases in ACT, were comparable, suggesting that active component or components in these two fractions were less than 10 kDa in size. There was partial activity in each of the three fractions, and the majority of the response to serum was recapitulated by recombining the .ltoreq.50 kD and .gtoreq.50 kD fractions (Table 3). These experiments suggested that the combined activity of at least two factors in serum was responsible for the observed effects on ACT amount and localization.
TABLE-US-00004 TABLE 3 ACT Production During Growth of Bp UT25 with Crude Fractions of FBS % AC enzyme activity Fold increase in AC Condition In supernatant enzyme activity SSM 6.0 .+-. 0.7 -- SSM + 10% FBS 79.6 .+-. 2.2 10.7 .+-. 0.3 SSM + .ltoreq.10 kDa 40.4 .+-. 2.4 1.3 .+-. 0.1 SSM + .ltoreq.50 kDa 43.6 .+-. 1.6 1.8 .+-. 0.1 SSM + .gtoreq.50 kDa 62.8 .+-. 0.3 3.6 .+-. 0.1 SSM + .ltoreq.50 kDa + .gtoreq.50 kDa 85.1 .+-. 0.9 8.3 .+-. 0.0
[0199] A recent publication by Bumba et al. elucidated the requirement for physiological concentrations of calcium (2 mM, equivalent to concentration in human respiratory tract) to enhance secretion of ACT (Bumba et al., 2016; Potter et al., 1967). SSM contains 0.136 mM calcium, which was not sufficient for proper folding of ACT and thus resulted in less efficient secretion and accumulation of unfolded, secreted ACT on the bacterial surface (Potter et al., 1967). These authors showed that growth of Bp Tohama in SSM (with 1 g/L hepatikis and 1 g/L casamino acids) in the presence of 2 mM calcium allowed for proper folding of ACT and increased efficiency of secretion by greater than 20-fold with .about.95% of total ACT localized to the supernatant. There was, however, minimal effect on the total amount of ACT produced (Bumba et al., 2016). Because of their findings, it was hypothesized that calcium is the active molecule in the .ltoreq.10 kD fraction. Under the growth conditions described herein, there was an increase in the proportion of ACT released to the supernatant when Bp was grown in SSM with 2 mM calcium compared to SSM alone (26.3.+-.7.6% and 11.4.+-.2.9%, respectively) but no increase in the total amount of ACT (FIG. 4).
[0200] Recapitulation of the response to FBS by the .ltoreq.50 kD and .gtoreq.50 kD fractions suggested a combined effect of at least two components, and whether calcium and another molecule, greater than 50 kDa, together affected the amount and distribution of ACT was tested. Albumin has a molecular weight of 66 kDa and is the most abundant protein in serum, accounting for about 60% of the total serum protein, yielding concentrations ranging between 20-36 mg/ml in FBS and 35-52 mg/ml in human serum (Peters, 1996). Albumin is also present in respiratory secretions, and its abundance increases during inflammation (Masson et al., 1965; Yeager, 1971; Nicholson et al., 2000). In addition, previous work by Bellalou et al. showed that growth of Bp with albumin-supplemented SSM resulted in a high level of ACT in the supernatant (Bellalou et al., 1990b). On the basis of this information, whether albumin could be the active component in the 50 kD fraction was tested. When Bp UT25 was grown with SSM+2 mg/ml bovine serum albumin (BSA) for 8 hours, there was a 1.9-fold increase in the amount of ACT and 50% of the total ACT was detected in the supernatant (FIG. 4). This suggested that BSA, or perhaps protein in general, shifted localization of ACT to the supernatant but not to the magnitude detected with FBS.
[0201] Next, BSA was tested in combination with 2 mM calcium and the results were striking; BSA and calcium together promoted a 6.3-fold increase in ACT production and 93% of the ACT was localized to the supernatant (FIG. 4). Also tested was whether contamination of purified albumin with calcium contributed to the effect on ACT. Bp UT25 was grown with BSA or EGTA-treated BSA, both in the absence of supplemented calcium, and the response in total and released ACT was compared. It was determined that there was no significant difference between BSA or EGTA-treated BSA (FIG. 5). These findings were consistent with preliminary fractionation data implicating two separate components and suggesting synergistic roles for calcium and albumin to enhance ACT amount and change its localization during growth with FBS.
[0202] To determine what concentration of calcium is required for the full response to albumin, Bp UT25 was grown in SSM+2 mg/ml BSA with varying concentrations of calcium between 0.136 mM (present in SSM) and 2 mM. It was determined that 0.5 mM calcium was sufficient to promote the full increase in ACT amount and release by albumin (FIG. 6). Of note, SSM supplemented with 10% FBS contains about 0.47 mM calcium, which is close to the determined concentration of calcium required for the maximal effect of albumin. Because calcium was necessary for the response to BSA and the physiological concentration of calcium in the human respiratory tract is .about.2 mM, the experiments described herein below were performed in the presence of 2 mM calcium.
Example 3
Albumin is Required for Increased ACT Amount and Altered Distribution During Growth in the Presence of Mouse Serum
[0203] Next, whether albumin was both necessary and sufficient (the sole protein in serum required) for the effects on ACT amount was tested. Roopenian et al. have developed an albumin-deficient (analbuminemic; ALB-/-) mouse strain for studying the metabolism of human albumin and the pharmacokinetics of albumin-conjugated drugs (Roopenian et al., 2015). Serendipitously, this animal provides a unique resource with which to probe the specificity of albumin in the observed effects on ACT disclosed herein. Similar to humans with a genetic deficiency in albumin, analbuminemic mice increase concentrations of other serum proteins to compensate for the loss of albumin (Roopenian et al., 2015). Serum from these mice was used to investigate the role of albumin in alteration of the amount and distribution of ACT, adjusted to assure comparable protein concentrations. Consistent with published data on this mouse strain (Roopenian et al., 2015), it was determined that total protein in the analbuminemic (ALB.sup.-/-) mouse serum was 68% of that in serum from the wild-type, C57BL/6 mouse, and it was confirmed that the analbuminemic mouse serum lacked albumin as demonstrated by SDS-PAGE and Coomassie straining (FIG. 7).
[0204] Because of the difference in protein concentrations, Bp UT25 was grown in the presence of 2 mM calcium and 6.8% wild-type mouse serum or 10% analbuminemic mouse serum, yielding equivalent total protein concentrations. The wild-type mouse serum enhanced ACT amount by 15.7-fold and 90% of ACT was the supernatant compared to 21% in SSM. ACT levels in the total and supernatant fractions were not significantly different during growth with the analbuminemic mouse serum compared to growth in SSM alone (FIGS. 8A and 8B). Since total protein was equivalent in both conditions, these data indicated that the effects were specific to albumin and not simply a consequence of elevated protein concentrations during growth with serum or purified albumin. Further, the response was restored (16.4-fold increase and 99% of total ACT in the supernatant) when 2 mg/ml BSA, a concentration equivalent to amount of albumin present in wild-type mouse serum, was added to the analbuminemic serum (FIG. 8A). Together, these data strongly supported the concept that albumin, in the presence of calcium, was responsible for the increase in ACT amount and shift to localization in the supernatant elicited by mouse serum, highlighting the key roles of these two molecules in regulating the availability of this critical bacterial virulence factor.
Example 4
Human Serum Albumin, Either Purified and Present in Human Serum, Increased the Amount and Release of ACT
[0205] Because Bp is a human pathogen, whether albumin in human samples could influence ACT amount and localization was tested. HS was combined from a pool of healthy donors; the concentration of albumin in the pool was determined by the Clinical Chemistry Lab at the University of Virginia to be 46 mg/ml. Bp UT25 was grown for 8 hours in SSM with HS, ranging from 0.05% to 2%, or the equivalent concentration of HSA, ranging from 0.0225-0.92 mg/ml, all in the presence of 2 mM calcium. As shown in FIG. 9, there was an albumin concentration-dependent response of Bp UT25 to heat-inactivated HS or HSA. In the presence of 2 mM calcium, 85% of the total ACT was found in the supernatant at all concentrations of HSA and HS tested, suggesting that human albumin at very low concentrations (.ltoreq.0.0225 mg/ml) was able to shift the predominant distribution of ACT to the supernatant. In the presence of calcium, the quantity of ACT plateau at albumin concentrations of 0.23 mg/ml albumin (FIG. 9). These data suggested that albumin, in the presence of calcium, was the critical component in human serum to increase ACT amount and alter its distribution.
Example 5
Role of Bvg 2-component System in Control of ACT Expression in Response to Albumin
[0206] As with other virulence factors, ACT expression in Bordetellae is transcriptionally controlled by the Bvg two-component system. For that reason, whether the increased amount of ACT detected during growth with albumin was due to higher levels of Bvg activation and enhanced transcription of cyaA was tested. qRT-PCR analyses were performed on bvgA and cyaA as well as fhaB and ptxA, two other genes within the bvg regulon which encode filamentous hemagglutinin and pertussis toxin, respectively. Expression of none of these genes was significantly different+/-HSA in the presence of calcium (FIG. 10A), indicating that increased ACT during growth in the presence of albumin was not due to further activation of Bvg and that cyaA was not being regulated at the transcriptional level+/-albumin. The Bvg(+) state was, however, required for expression of ACT; when Bp is modulated to Bvg(-), either genetically by a transposon insertion in bvgA (Table 2) or chemically with 40 mM MgSO4 (FIG. 10B), virtually no ACT was detected either with or without HSA or FBS. There was a small but significant increase in the amount of ACT during growth with MgSO.sub.4 and HSA, when added simultaneously, compared to MgSO.sub.4 alone (FIG. 10B); possible explanations include that the response to albumin was faster than modulation with MgSO.sub.4 or that albumin acted through an additional mechanism that was not dependent on Bvg activation and cyaA transcription. In summary, these data suggested that regulation of ACT production by albumin was downstream of transcriptional regulation of cyaA by the Bvg system, potentially through a previously uncharacterized post-transcriptional regulatory process.
[0207] Since it was found that more ACT was being released in the presence of albumin and calcium, whether HSA increased transcription of the genes within the cya operon--the T1SS (cyaBDE), cyaC (acyl transferase responsible for post-translational acylation of cyaA), and cyaX (a putative transcriptional regulator of unknown function; Betsou et al., 1993; Thomas et al., 2014) was tested. The T1SS is comprised of three proteins: an ATP-binding inner membrane protein (CyaB), an outer-membrane protein (CyaE), and a membrane-fusion protein spanning the periplasm (CyaD) to connect CyaB and CyaE (30). As determined by qRT-PCR, the expression of none of these genes was significantly altered+/-HSA (FIG. 11), but, as anticipated, expression of all genes was significantly reduced during growth with 40 mM MgSO.sub.4. These data indicated that HSA was also not acting transcriptionally to regulate genes encoded within the cya operon that are involved in secretion or activation of ACT.
Example 6
Human Respiratory Secretions Contain Albumin and Stimulate Increased Amounts of Extracellular ACT
[0208] To address the role of albumin during human infection with Bp, human respiratory secretions were tested for the ability to affect ACT amount and distribution. Respiratory secretions contain serum components, notably albumin, and the concentrations of these components increases during inflammation (Masson et al., 1965; Yeager, 1971; Nicholson et al., 2000). Bronchoalveolar lavage (BAL) was performed on 7 patients with interstitial lung disease or bronchiectasis, and the resulting samples were pooled and concentrated as described. The amount of albumin present in the pooled BAL sample was determined to be approximately 2.0 mg/ml by SDS-PAGE using purified HSA as a standard over a range of concentrations and confirmed by Western blot analyses with an anti-BSA antibody to be comparable to the amount of albumin present in 5% HS (2.3 mg/ml; see FIG. 12). Since endogenous calcium was diluted during sample acquisition with saline washes, the BAL pool was tested in the presence of calcium at a physiological concentration (2 mM). As shown in FIGS. 11A and 11B, growth of Bp UT25 in the BAL specimen elicited an 8.7-fold increase in ACT amount and a shift in distribution to the supernatant (96%) compared to SSM alone (22%). Similar concentrations of HS and purified HSA elicited 9.3 and 9.1-fold increases in ACT amount and 96% or 97% of ACT in the supernatant, respectively (FIGS. 13A and 13B).
[0209] To determine if the increased ACT obtained during growth in the BAL was comparable in toxin activity, the culture supernatant from Bp UT25 grown in SSM+BAL was incubated for 8 hours with J774 cells and cytotoxicity was measured. ACT produced in the presence of human respiratory secretions elicited concentration-dependent cytotoxicity of J774 cells and was equivalent to recombinant ACT (rACT) at concentrations with equal enzyme activity (FIG. 14). These results confirmed that albumin was present in human respiratory secretions, which Bp encounters during infection of the human respiratory tract, and that these secretions promoted an increase in the amount of functional ACT that was almost entirely present in the supernatant. Thus, albumin, in the presence of calcium, appeared to act as a critical factor in the host environment to increase active, newly secreted ACT, which was essential for establishment of Bp infection.
Example 7
ACT Amount in the Absence of the Type 1 Secretion System
[0210] ACT amount was also determined in a Bp strain that lacked a functional Type 1 Secretion System (Bp UT25 .DELTA.T1SS) The results are shown in FIG. 15.
[0211] Bp UT25 .DELTA.T1SS was grown in SSM alone (SSM), SSM supplemented with 2 mM calcium (SSM+Ca), SSM supplemented with 2 mg/ml BSA (SSM+BSA), or SSM supplemented with both 2 mM calcium and 2 mg/ml BSA (SSM+BSA+Ca) for 2 hours. SupernatantSupernatants (light gray bars; level too low to show in FIG. 15) were collected after centrifugation. The pellet was treated with 4M urea for 20 minutes at room temperature, and then the supernatant was collected after centrifugation as the surface-associated ACT fraction (dark gray bars). The resulting pellet was then solubilized with 8M urea to isolate the intracellular ACT fraction (black bars). AC enzyme activity was measured and normalized by OD.sub.600. Data represent the mean+/-SD of two (2) independent experiments done in duplicate. Statistical significance was assessed using a 2-way ANOVA (*** p.ltoreq.0.001 as compared to growth in SSM).
[0212] In this strain, detectable ACT was almost entirely intracellular. Comparing equivalent conditions the presence or absence of calcium alone showed no significant difference in intracellular ACT, suggesting that calcium did not influence ACT amount in the Type 1 secretion-deficient strain and supported the hypothesized role for calcium as enhancing ACT secretion. Growth in the presence of albumin had about 1.7-fold more intracellular ACT than growth in the absence of albumin. These data implicated albumin (possibly acting extracellularly) in increasing intracellular ACT and led to the hypothesis that albumin acted as a signaling molecule to increase ACT amount.
Example 8
Albumin Binds to Bvq+Bp
[0213] One mechanism for extracellular albumin to increase intracellular ACT is through engagement of a surface-exposed, bacterial receptor and initiation of intracellular signaling events. Whether albumin physically interacted with Bp was tested by growing Bp in SSM with 2 mM calcium+/-2 mg/ml BSA, extensively washing the bacteria, and then performing western blot analyses with an anti-BSA antibody. It was determined that BSA bound to both wild-type Bp strains tested (UT25 and BP338) as well as an ACT-deficient BP338 derivative (Bp BP348; see FIG. 16). Interestingly, BSA did not bind to Bp BP347, a Bvg(-) BP338 derivative, suggesting that BSA binding required Bvg activation. These data potentially implicated a Bvg-regulated outer membrane factor as an albumin receptor in Bp and provided further support for the role of albumin as a extracellular signal to modulate ACT production in Bp.
Example 9
Albumin Affects Amount and/or Localization of Other Bp Virulence Determinants
[0214] Since albumin could act as a signal to alter ACT production, whether the albumin regulon extended beyond ACT to other well-characterized Bp virulence factors was determined. Bp UT25 was grown for 8 hours in SSM with 2 mM calcium+/-0.46 or 4.6 mg/ml HSA, corresponding to the concentration of albumin in 1% and 10% concentrations of the human serum pool described herein, respectively. The samples were normalized by bacterial density, and western blot analyses were performed with an anti-FHA or anti-PT polyclonal antibody. Increased PT amount and secretion in the presence of albumin and calcium were observed. The amount of FHA was not dramatically affected by albumin and calcium, but FHA release was increased. Preliminary mass spectroscopy data-/+FBS indicated that both PRN and Fim3 were increased by serum, which could be a response to albumin and calcium. These data were consistent with a more global response to albumin by Bp that could involve modulation of localization and amount of key virulence traits in response to the host molecule albumin.
Discussion of the Examples
[0215] Pertussis (whooping cough), caused by Bordetella pertussis (Bp), is resurging in the United States and worldwide. Adenylate cyclase toxin (ACT) is a critical factor in establishing infection with Bp and acts by specifically inhibiting the response of myeloid leukocytes to the pathogen. Disclosed herein is the discovery that serum components, as observed during growth in fetal bovine serum (FBS), elicited a robust increase in the amount of ACT, and at least 90% of this ACT was localized to the supernatant, unlike growth without FBS in which at least 90% was associated with the bacterium. As set forth herein, albumin, in the presence of physiological concentrations of calcium, acted specifically to enhance ACT amount and localization to the supernatant and that respiratory secretions, which contain albumin, promoted an increase in amount and localization of active ACT that was comparable to that elicited by serum and albumin. The response to albumin was not mediated through regulation of ACT at the transcriptional level or by activation of the Bvg two-component system. As a further illustration of the specificity of this phenomenon, serum collected from mice that lacked albumin did not stimulate an increase in ACT. These data, demonstrating that albumin and calcium acted synergistically in the host environment to increase production and release of ACT, strongly suggested that this phenomenon reflected a novel host-pathogen interaction that is central to infection with Bp and other Bordetellae.
[0216] During quantification of ACT in samples from Bp-infected humans and baboons, it was observed that ACT localization was different than during in vitro growth of Bp (Zaretzky et al., 2002; Eby et al., 2013). While working to make in vitro conditions more reflective of the environment within the host respiratory tract, it was found that serum components, specifically albumin and calcium, stimulated a robust increase in ACT and changed its distribution. It had previously been reported that Bp secreted high levels of ACT during growth in SSM with albumin (Bellalou et al., 1990b). As disclosed herein, it was determined that ACT amount was increased even further in the presence of albumin and calcium together. Since calcium alone did not increase the amount of ACT but did affect release under our growth conditions, it appeared that calcium enhanced the effect of albumin by aiding in secretion of ACT (Bumba et al., 2016). Both albumin and calcium are present in the human respiratory tract, and it was determined that respiratory secretions stimulated ACT production and release (FIG. 13), leading to the hypothesis that what is described herein represented the magnitude and localization of ACT during Bp-host interactions. Furthermore, these results indicated that current conditions established for in vitro growth in SSM are not representative of bacterial growth or virulence factor expression within the host, and may stimulate a shift within the Bordetella research community to define new culture conditions that more accurately replicate the host environment.
[0217] Albumin comprises approximately 60% of the total serum protein in healthy human adults and performs many functions, importantly maintaining oncotic pressure and binding fatty acids, ions, amino acids, and drugs (Evans, 2002; Fasano et al., 2005; Merlot et al., 2014). The non-oncotic properties of albumin include transport of metabolites and drugs, free radical scavenging, and modulation of the inflammatory response (Evans, 2002). The data disclosed herein indicated that albumin was responsible for a massive increase in ACT. While not wishing to be bound by any particular theory of operation, those properties of albumin that are required and the mechanism involved could include direct protein-protein interactions between albumin and ACT and/or albumin and a bacterial protein receptor/signaling molecule. It is also feasible, although it is believed to be unlikely, that the effects were not from albumin itself but from a molecule that albumin delivers to the bacterial cell. Because of the data presented herein, this molecule would need to be present in the highly purified albumin employed herein. Regardless of the mechanism, the concept that a host protein, present at the site of infection, was acting specifically to elicit a significant enhancement in the amount of toxin represents an additional level of regulation of a well characterized, critical virulence factor in response to the host environment.
[0218] When the Bvg two-component regulatory system was discovered more than thirty years ago, it was termed the master regulator of virulence, at least for the Bordetella species in which it was studied (Arico et al., 1989; Cotter & Jones, 2003; Melvin et al., 2014). It is now known that there are other pathways by which virulence is controlled in this genus (Bibova et al., 2013; Hanawa et al., 2013; Ahuja et al., 2016; Barbier et al., 2016; Coutte et al., 2016), but how these pathways relate to one another and to Bvg is still to be fully determined. The Bvg system controls production of many bacterial proteins, importantly ACT and other virulence factors, and expression is down regulated in response to sulfate, nicotinic acid, and a shift to lower temperature (25.degree. C.). Except for studies showing that Bvg activation is sufficient for infection and that the Bvg(-) phase is not required for infection (Cotter & Miller, 1994; Vergara-Irigaray et al., 2005; Martinez de Tejada et al., 1998), there is no direct linkage between what is known about Bvg regulation in vitro and the behavior of Bp in vivo. It is still not known whether Bvg modulation occurs in vivo and, if modulation occurs, what signals within the host are responsible. The data presented herein suggested that response to albumin operates downstream from Bvg, and it is postulated that it may represent a novel mechanism for fine-tuning expression of virulence traits at the post-transcriptional level.
[0219] Shown herein is that human respiratory secretions elicited an increased amount of released ACT (FIG. 13), highlighting that this regulatory mechanism likely is activated within the host environment and may be a critical determinant in controlling ACT amount and localization during infection. The present disclosure is believed to represent the first steps to understanding a previously unrecognized regulatory process involving communication between the host and pathogen through which albumin affects production of ACT.
[0220] Previous studies have identified that albumin influences the growth and virulence of microorganisms (de Chateau et al., 1996; Egesten et al., 2011; Kruczek et al., 2012; Traglia et al., 2016). Specifically, albumin has been shown to bind to the bacterial surface of Group B streptococci and inactivate the antibacterial peptide CXCL9, increase expression of virulence genes in Pseudomonas aeruginosa, and specifically induce natural competence in Acinetobacter baumannii (Egesten et al., 2011; Kruczek et al., 2012; Traglia et al., 2016). Albumin and serum also affect other RTX toxins. Albumin enhances the activity of the leukotoxin produced by Mannheimia haemolytica (formerly Pasteurella haemolytica), through disruption of toxin aggregates (Waurzyniak et al., 1994; Urban-Chmiel et al., 2004). This mechanism is not, however, consistent with the presently disclosed observations about ACT; mainly, a functional difference between rACT and ACT secreted in the presence of albumin was not observed (FIG. 14), and a corresponding increase in ACT amount and enzyme activity was detected (FIG. 2). ACT aggregation would decrease the functional activity but would not impact enzyme activity. Additionally, serum and albumin promote the release of leukotoxin from Actinobacillus actinomycetemcomitans from the cell surface, although the association of this leukotoxin with the membrane appears to be different than that of ACT with Bp (Johansson et al., 2003).
[0221] Although ACT is established as a critical virulence factor and protective antigen, it was not considered for inclusion in the acellular pertussis vaccines because its purification and characterization were not adequately defined when those products were being developed. Serious evaluation of ACT as a vaccine antigen has been stimulated more recently by the limited duration of protection by current acellular pertussis vaccines and resultant increase in reported pertussis cases. Because only 10% of the total ACT is in the supernatant during growth in SSM, previous studies of ACT have been limited to use of recombinant ACT (from Escherichia coli) or surface-associated ACT (extracted from Bp with urea and refolded in the presence of calcium). It is now recognized that standard conditions for in vitro culture lack sufficient calcium for folding and efficient secretion of ACT and are not reflective of what Bp encounters within 514 the host (Potter et al., 1967; Bumba et al., 2016).
[0222] Furthermore, previous work suggested that there may be structural or functional differences between secreted and surface-associated ACT (Rose et al., 1995; Gray et al., 2004; Hanawa et al., 2013; Bumba et al., 2016). Disclosed herein is the discovery that albumin, in the presence of physiological concentrations of calcium, stimulated a massive increase of secreted ACT. It is possible that previous observations about ACT amount and localization have been influenced by growth conditions in vitro that are not equivalent to the environment within the host during infection, as has been shown for the effect of physiological concentrations of calcium on ACT folding and secretion (Masure et al., 1988; Rose et al., 1995; Rhodes et al., 2001; Chenal et al., 2009; Chenal et al., 2010; Karst et al., 2014; Bumba et al., 2016), and it has now been determined that albumin, in combination with calcium, had an even more robust effect on ACT amount and secretion. Growth under these conditions produced large quantities of secreted ACT, which were not possible to obtain previously, but as set forth herein are now available for use as a vaccine antigen.
[0223] In summary, disclosed herein is the identification of albumin and calcium as stimulators of a robust increase in the amount of ACT produced by Bp, that the localization of ACT shifted from being primarily on the surface of the bacterium to the majority of the toxin being in the supernatant, and that this toxin was functionally equivalent to purified ACT in its ability to intoxicate cells. These findings represent a significant and new contribution to knowledge with respect to Bp adenylate cyclase biology by revealing conditions to greatly enhance production of secreted ACT, and conditions that better replicated ACT production and localization within the respiratory tract.
REFERENCES
[0224] All references listed in the instant disclosure, including but not limited to all patents, patent applications and publications thereof, scientific journal articles, and database entries (including but not limited to GENBANK.RTM. biosequence database entries and including all annotations available therein) are incorporated herein by reference in their entireties to the extent that they supplement, explain, provide a background for, and/or teach methodology, techniques, and/or compositions employed herein. The discussion of the references is intended merely to summarize the assertions made by their authors. No admission is made that any reference (or a portion of any reference) is relevant prior art. Applicants reserve the right to challenge the accuracy and pertinence of any cited reference.
[0225] Ahuja et al. (2016) Differential regulation of type III secretion and virulence genes in Bordetella pertussis and Bordetella bronchiseptica by a secreted anti-sigma factor. Proc Natl Acad Sci USA 113:2341-2348.
[0226] Altschul et al. (1990a) Basic local alignment search tool. J Mol Biol 215:403-410.
[0227] Altschul et al. (1990b) Protein database searches for multiple alignments. Proc Natl Acad Sci USA 87(14):5509-5513.
[0228] Altschul et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402.
[0229] Anonymous (1990) Clinical guidelines and indications for bronchoalveolar lavage (BAL): Report of the European Society of Pneumology Task Group on BAL. Eur Respir J 3:937-976.
[0230] Arico et al. (1989) Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proc Natl Acad Sci USA 86:6671-6675.
[0231] Barbier et al. (2016) Modulation of pertussis and adenylate cyclase toxins by sigma factor RpoE in Bordetella pertussis. Infect Immun 85: e00565-16.
[0232] Basler et al. (2006) Pore-forming and enzymatic activities of Bordetella pertussis adenylate cyclase toxin synergize in promoting lysis of monocytes. Infect Immun 74:2207-2214.
[0233] Bellalou et al. (1990a) Synthesis and secretion of Bordetella pertussis adenylate cyclase as a 200-kilodalton protein. Infect Immun 58:1195-1200.
[0234] Bellalou et al. (1990b) Deletions affecting hemolytic and toxin activities of Bordetella pertussis adenylate cyclase. Infect Immun 58:3242-3247.
[0235] Betsou et al. (1993) CyaC-mediated activation is important not only for toxic but also for protective activities of Bordetella pertussis adenylate cyclase-hemolysin. Infect Immun 61:3583-3589.
[0236] Bibova et al. (2013) The RNA chaperone Hfq is required for virulence of Bordetella pertussis. Infect Immun 81:4081-4090.
[0237] Boinett et al. (2015) Complete Genome Sequence of Bordetella pertussis D420. Genome Announc 3:10.1128/genomeA.00657-15.
[0238] Boucher & Stibitz (1995) Synergistic binding of RNA polymerase and BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis. J Bacteriol 177:6486-6491.
[0239] Boucher et al. (1994) The modular architecture of bacterial response regulators. Insights into the activation mechanism of the BvgA transactivator of Bordetella pertussis. J Mol Biol 241:363-377.
[0240] Boucher et al. (1997) Nature of DNA binding and RNA polymerase interaction of the Bordetella pertussis BvgA transcriptional activator at the fha promoter. J Bacteriol 179:1755-1763.
[0241] Buboltz et al. (2009) Role of the type III secretion system in a hypervirulent lineage of Bordetella bronchiseptica. Infect Immun 77:3969-3977.
[0242] Bumba et al. (2016) Calcium-Driven Folding of RTX Domain beta-Rolls Ratchets Translocation of RTX Proteins through Type I Secretion Ducts. Mol Cell 62:47-62.
[0243] Carbonetti (2010). Pertussis toxin and adenylate cyclase toxin: key virulence factors of Bordetella pertussis and cell biology tools. Future Microbiol 5:455-469.
[0244] Chenal et al. (2009) RTX calcium binding motifs are intrinsically disordered in the absence of calcium: implication for protein secretion. J Biol Chem 284:1781-1789.
[0245] Chenal et al. (2010) Calcium-induced folding and stabilization of the intrinsically disordered RTX domain of the CyaA toxin. Biophys J 99:3744-3753.
[0246] Cherry (2013) Pertussis: challenges today and for the future. PLoS Pathog 9:e1003418.
[0247] Confer & Eaton (1982) Phagocyte impotence caused by an invasive bacterial adenylate cyclase. Science 217:948-950.
[0248] Cotter & Jones (2003) Phosphorelay control of virulence gene expression in Bordetella. Trends Microbiol 11:367-373.
[0249] Cotter & Miller (1994) BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381-3390.
[0250] Cotter et al. (1998) Filamentous hemagglutinin of Bordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infect Immun 66:5921-5929.
[0251] Coutte et al. (2016) The multifaceted RisA regulon of Bordetella pertussis. Sci Rep 6:32774.
[0252] de Chateau et al. (1996) Protein PAB, an albumin-binding bacterial surface protein promoting growth and virulence. J Biol Chem 271:26609-26615.
[0253] Eby et al. (2012) Role of CD11b/CD18 in the process of intoxication by the adenylate cyclase toxin of Bordetella pertussis. Infect Immun 80:850-859.
[0254] Eby et al. (2013) Quantification of the adenylate cyclase toxin of Bordetella pertussis in vitro and during respiratory infection. Infect Immun 81:1390-1398.
[0255] Eby et al. (2015) Review of the neutrophil response to Bordetella pertussis infection. Pathog Dis 73:ftv081.
[0256] Egesten et al. (2011) Binding of albumin promotes bacterial survival at the epithelial surface. J Biol Chem 286:2469-2476.
[0257] Ehrmann et al. (1992) Enzymatic activity of adenylate cyclase toxin from Bordetella pertussis is not required for hemolysis. FEBS Lett 304:51-56.
[0258] Evans (2002) Review article: albumin as a drug--biological effects of albumin unrelated to oncotic pressure. Aliment Pharmacol Ther 16 Suppl 5:6-11.
[0259] Fasano et al. (2005) The extraordinary ligand binding properties of human serum albumin. IUBMB Life 57:787-796.
[0260] Glaser et al. (1988a) The calmodulin-sensitive adenylate cyclase of Bordetella pertussis: cloning and expression in Escherichia coli. Mol Microbiol 2:19-30.
[0261] Glaser et al. (1988b) Bordetella pertussis adenylate cyclase: the gene and the protein. Tokai J Exp Clin Med 13 Suppl:239-252.
[0262] Goodwin & Weiss (1990) Adenylate cyclase toxin is critical for colonization and pertussis toxin is critical for lethal infection by Bordetella pertussis in infant mice. Infect Immun 58:3445-3447.
[0263] Gray et al. (1998) Distinct mechanisms for K+ efflux, intoxication, and hemolysis by Bordetella pertussis AC toxin. J Biol Chem 273:18260-18267.
[0264] Gray et al. (2001) Translocation-specific conformation of adenylate cyclase toxin from Bordetella pertussis inhibits toxin-mediated hemolysis. J Bacteriol 183:5904-5910.
[0265] Gray et al. (2004) Newly secreted adenylate cyclase toxin is responsible for intoxication of target cells by Bordetella pertussis. Mol Microbiol 53:1709-1719.
[0266] Guermonprez et al. (2001) The adenylate cyclase toxin of Bordetella pertussis binds to target cells via the alpha(M)beta(2) integrin (CD11b/CD18). J Exp Med 193:1035-1044.
[0267] Guiso et al. (1991) Protective activity of Bordetella adenylate cyclase-hemolysin against bacterial colonization. Microb Pathog 11:423-431.
[0268] Hanawa et al. (2013) Role of Bordetella pertussis RseA in the cell envelope stress response and adenylate cyclase toxin release. Pathog Dis 69:7-20.
[0269] Hanski (1989) Invasive adenylate cyclase toxin of Bordetella pertussis. Trends Biochem Sci 14:459-463.
[0270] Harlow & Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., United States of America.
[0271] Hewlett & Wolff (1976) Soluble adenylate cyclase from the culture medium of Bordetella pertussis: purification and characterization. J Bacteriol 127:890-898.
[0272] Hewlett et al. (1976) Extracytoplasmic adenylate cyclase of Bordetella pertussis. Proc Natl Acad Sci USA 73:1926-1930.
[0273] Hewlett et al. (1989) Adenylate cyclase toxin from Bordetella pertussis. Identification and purification of the holotoxin molecule. J Biol Chem 264:19379-19384.
[0274] Hewlett et al. (1991) Adenylate cyclase toxin from Bordetella pertussis. Conformational change associated with toxin activity. J Biol Chem 266:17503-17508.
[0275] Hewlett et al. (2006) Macrophage cytotoxicity produced by adenylate cyclase toxin from Bordetella pertussis: more than just making cyclic AMP! Mol Microbiol 59:447-459.
[0276] Johansson et al. (2003) Serum-mediated release of leukotoxin from the cell surface of the periodontal pathogen Actinobacillus actinomycetemcomitans. Eur J Oral Sci 111:209-215.
[0277] Karlin & Altschul (1990) Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc Natl Acad Sci USA 87:2264-2268.
[0278] Karlin & Altschul (1993) Applications and statistics for multiple high-scoring segments in molecular sequences. Proc Natl Acad Sci USA 90:5873-5877.
[0279] Karst et al. (2014) Calcium, acylation, and molecular confinement favor folding of Bordetella pertussis adenylate cyclase CyaA toxin into a monomeric and cytotoxic form. J Biol Chem 289:30702-30716.
[0280] Kruczek et al. (2012) Serum albumin alters the expression of iron-controlled genes in Pseudomonas aeruginosa. Microbiology 158:353-367.
[0281] Ladant et al. (1986) Bordetella pertussis adenylate cyclase. Purification, characterization, and radioimmunoassay. J Biol Chem 261:16264-16269.
[0282] Livak & Schmittgen (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method Methods 25:402-408.
[0283] Martinez de Tejada et al. (1998) Neither the Bvg- phase nor the vrg6 locus of Bordetella pertussis is required for respiratory infection in mice. Infect Immun 66:2762-2768.
[0284] Masson et al. (1965) Studies on the proteins of human bronchial secretions. Biochim Biophys Acta 111:466-478.
[0285] Masure et al. (1988) The interaction of Ca2+ with the calmodulin-sensitive adenylate cyclase from Bordetella pertussis. J Biol Chem 263:6933-6940.
[0286] Mattoo & Cherry (2005) Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326-382.
[0287] McLafferty et al. (1988) Nucleotide sequence and characterization of a repetitive DNA element from the genome of Bordetella pertussis with characteristics of an insertion sequence. J Gen Microbiol 134:2297-2306.
[0288] Meade et al. (2014) Possible options for new pertussis vaccines. J Infect Dis 209 Suppl 1:S24-7.
[0289] Melton & Weiss (1989) Environmental regulation of expression of virulence determinants in Bordetella pertussis. J Bacteriol 171:6206-6212.
[0290] Melvin et al. (2014) Bordetella pertussis pathogenesis: current and future challenges. Nat Rev Microbiol 12:274-288.
[0291] Menozzi et al. (1994) Heparin-inhibitable lectin activity of the filamentous hemagglutinin adhesin of Bordetella pertussis. Infect Immun 62:769-778.
[0292] Merlot et al. (2014) Unraveling the mysteries of serum albumin-more than just a serum protein. Front Physiol 5:299.
[0293] Nicholson et al. (2000) The role of albumin in critical illness. Br J Anaesth 85:599-610.
[0294] Parker et al. (1980) Variability in derivative strains of Bordetella pertussis. Dev Biol Stan 45:119-127.
[0295] Peters (1996) All about albumin: biochemistry, genetics, and medical applications. Academic Press, San Francisco, Calif.
[0296] Plotkin (2014) Pertussis: pertussis control strategies and the options for improving current vaccines. Expert Rev Vaccines 13:1071-1072.
[0297] Potter et al. (1967) Studies on pulmonary secretions. II. Osmolality and the ionic environment of pulmonary secretions from patients with cystic fibrosis, bronchiectasis, and laryngectomy. Am Rev Respir Dis 96:83-87.
[0298] Rhodes et al. (2001) Structural consequences of divalent metal binding by the adenylyl cyclase toxin of Bordetella pertussis. Arch Biochem Biophys 395:169-176.
[0299] Rogel et al. (1989) Bordetella pertussis adenylate cyclase: purification and characterization of the toxic form of the enzyme. EMBO J 8:2755-2760.
[0300] Roopenian et al. (2015) Albumin-deficient mouse models for studying metabolism of human albumin and pharmacokinetics of albumin-based drugs. MAbs 7:344-351.
[0301] Rose et al. (1995) Interaction of calcium with Bordetella pertussis adenylate cyclase toxin. Characterization of multiple calcium sites and calcium-induced conformational changes. J Biol Chem 270:26370-26376.
[0302] Salomon et al. (1974) A highly sensitive adenylate cyclase assay. Anal Biochem 58:541-548.
[0303] Sato & Arai (1972) Leucocytosis-promoting factor of Bordetella pertussis. I. Purification and characterization. Infect Immun 6:899-904.
[0304] Sebo et al. (2014) Adenylate cyclase toxin-hemolysin relevance for pertussis vaccines. Expert Rev Vaccines 13:1215-1227.
[0305] Stainer & Scholte (1970) A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:211-220.
[0306] Steffen et al. (1996) Phosphorylated BvgA is sufficient for transcriptional activation of virulence-regulated genes in Bordetella pertussis. EMBO J 15:102-109.
[0307] Thomas et al. (2014) The Type 1 secretion pathway--the hemolysin system and beyond. Biochim Biophys Acta 1843:1629-1641.
[0308] Traglia et al. (2016) Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii. Antimicrob Agents Chemother 60:4920-4929.
[0309] Urban-Chmiel et al. (2004) Evaluation of Mannheimia haemolytica leukotoxin prepared in nonsupplemented and BSA or FBS supplemented RPMI 1640 medium. Pol J Vet Sci 7:1-8.
[0310] U.S. Pat. Nos. 5,264,563 and 5,824,483.
[0311] Vergara-Irigaray et al. (2005) Evaluation of the role of the Bvg intermediate phase in Bordetella pertussis during experimental respiratory infection. Infect Immun 73:748-760.
[0312] Vojtova et al. (2006) Bordetella adenylate cyclase toxin: a swift saboteur of host defense. Curr Opin Microbiol 9:69-75.
[0313] Vojtova-Vodolanova et al. (2009) Oligomerization is involved in pore formation by Bordetella adenylate cyclase toxin. FASEB J 23:2831-2843.
[0314] Walters & Sperandio (2006) Autoinducer 3 and epinephrine signaling in the kinetics of locus of enterocyte effacement gene expression in enterohemorrhagic Escherichia coli. Infect Immun 74:5445-5455.
[0315] Warfel & Edwards (2015) Pertussis vaccines and the challenge of inducing durable immunity. Curr Opin Immunol 35:48-54.
[0316] Waurzyniak et al. (1994) Enhancement of Pasteurella haemolytica leukotoxic activity by bovine serum albumin. Am J Vet Res 55:1267-1274.
[0317] Weiss & Goodwin (1989) Lethal infection by Bordetella pertussis mutants in the infant mouse model. Infect Immun 57:3757-3764.
[0318] Weiss et al. (1983) Tn5-induced mutations affecting virulence factors of Bordetella pertussis. Infect Immun 42:33-41.
[0319] Yeager (1971) Tracheobronchial secretions. Am J Med 50:493-509.
[0320] Zaretzky et al. (2002) Mechanism of association of adenylate cyclase toxin with the surface of Bordetella pertussis: a role for toxin-haemagglutinin interaction. Mol Microbiol 45:1589-1598.
[0321] Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts can have applicability in other sections throughout the entire specification.
[0322] It will be understood that various details of the presently disclosed subject matter may be changed without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.
Sequence CWU
1
1
6211706PRTBordetella pertussis 1Met Gln Gln Ser His Gln Ala Gly Tyr Ala
Asn Ala Ala Asp Arg Glu 1 5 10
15 Ser Gly Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala Val Ala
Lys 20 25 30 Glu
Lys Asn Ala Thr Leu Met Phe Arg Leu Val Asn Pro His Ser Thr 35
40 45 Ser Leu Ile Ala Glu Gly
Val Ala Thr Lys Gly Leu Gly Val His Ala 50 55
60 Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr
Ile Pro Val Asn Pro 65 70 75
80 Asn Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala
85 90 95 Asp Asn
Asp Val Asn Ser Ser Leu Ala His Gly His Thr Ala Val Asp 100
105 110 Leu Thr Leu Ser Lys Glu Arg
Leu Asp Tyr Leu Arg Gln Ala Gly Leu 115 120
125 Val Thr Gly Met Ala Asp Gly Val Val Ala Ser Asn
His Ala Gly Tyr 130 135 140
Glu Gln Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145
150 155 160 Val Gln Tyr
Arg Arg Lys Gly Gly Asp Asp Phe Glu Ala Val Lys Val 165
170 175 Ile Gly Asn Ala Ala Gly Ile Pro
Leu Thr Ala Asp Ile Asp Met Phe 180 185
190 Ala Ile Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala
Arg Ser Ser 195 200 205
Val Thr Ser Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210
215 220 Ala Ala Ser Glu
Ala Thr Gly Gly Leu Asp Arg Glu Arg Ile Asp Leu 225 230
235 240 Leu Trp Lys Ile Ala Arg Ala Gly Ala
Arg Ser Ala Val Gly Thr Glu 245 250
255 Ala Arg Arg Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly
Val Ile 260 265 270
Thr Asp Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala His
275 280 285 Ala Val Gly Ala
Gln Asp Val Val Gln His Gly Thr Glu Gln Asn Asn 290
295 300 Pro Phe Pro Glu Ala Asp Glu Lys
Ile Phe Val Val Ser Ala Thr Gly 305 310
315 320 Glu Ser Gln Met Leu Thr Arg Gly Gln Leu Lys Glu
Tyr Ile Gly Gln 325 330
335 Gln Arg Gly Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val
340 345 350 Ala Gly Lys
Ser Leu Phe Asp Asp Gly Leu Gly Ala Ala Pro Gly Val 355
360 365 Pro Ser Gly Arg Ser Lys Phe Ser
Pro Asp Val Leu Glu Thr Val Pro 370 375
380 Ala Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala Val
Glu Arg Gln 385 390 395
400 Asp Ser Gly Tyr Asp Ser Leu Asp Gly Val Gly Ser Arg Ser Phe Ser
405 410 415 Leu Gly Glu Val
Ser Asp Met Ala Ala Val Glu Ala Ala Glu Leu Glu 420
425 430 Met Thr Arg Gln Val Leu His Ala Gly
Ala Arg Gln Asp Asp Ala Glu 435 440
445 Pro Gly Val Ser Gly Ala Ser Ala His Trp Gly Gln Arg Ala
Leu Gln 450 455 460
Gly Ala Gln Ala Val Ala Ala Ala Gln Arg Leu Val His Ala Ile Ala 465
470 475 480 Leu Met Thr Gln Phe
Gly Arg Ala Gly Ser Thr Asn Thr Pro Gln Glu 485
490 495 Ala Ala Ser Leu Ser Ala Ala Val Phe Gly
Leu Gly Glu Ala Ser Ser 500 505
510 Ala Val Ala Glu Thr Val Ser Gly Phe Phe Arg Gly Ser Ser Arg
Trp 515 520 525 Ala
Gly Gly Phe Gly Val Ala Gly Gly Ala Met Ala Leu Gly Gly Gly 530
535 540 Ile Ala Ala Ala Val Gly
Ala Gly Met Ser Leu Thr Asp Asp Ala Pro 545 550
555 560 Ala Gly Gln Lys Ala Ala Ala Gly Ala Glu Ile
Ala Leu Gln Leu Thr 565 570
575 Gly Gly Thr Val Glu Leu Ala Ser Ser Ile Ala Leu Ala Leu Ala Ala
580 585 590 Ala Arg
Gly Val Thr Ser Gly Leu Gln Val Ala Gly Ala Ser Ala Gly 595
600 605 Ala Ala Ala Gly Ala Leu Ala
Ala Ala Leu Ser Pro Met Glu Ile Tyr 610 615
620 Gly Leu Val Gln Gln Ser His Tyr Ala Asp Gln Leu
Asp Lys Leu Ala 625 630 635
640 Gln Glu Ser Ser Ala Tyr Gly Tyr Glu Gly Asp Ala Leu Leu Ala Gln
645 650 655 Leu Tyr Arg
Asp Lys Thr Ala Ala Glu Gly Ala Val Ala Gly Val Ser 660
665 670 Ala Val Leu Ser Thr Val Gly Ala
Ala Val Ser Ile Ala Ala Ala Ala 675 680
685 Ser Val Val Gly Ala Pro Val Ala Val Val Thr Ser Leu
Leu Thr Gly 690 695 700
Ala Leu Asn Gly Ile Leu Arg Gly Val Gln Gln Pro Ile Ile Glu Lys 705
710 715 720 Leu Ala Asn Asp
Tyr Ala Arg Lys Ile Asp Glu Leu Gly Gly Pro Gln 725
730 735 Ala Tyr Phe Glu Lys Asn Leu Gln Ala
Arg His Glu Gln Leu Ala Asn 740 745
750 Ser Asp Gly Leu Arg Lys Met Leu Ala Asp Leu Gln Ala Gly
Trp Asn 755 760 765
Ala Ser Ser Val Ile Gly Val Gln Thr Thr Glu Ile Ser Lys Ser Ala 770
775 780 Leu Glu Leu Ala Ala
Ile Thr Gly Asn Ala Asp Asn Leu Lys Ser Val 785 790
795 800 Asp Val Phe Val Asp Arg Phe Val Gln Gly
Glu Arg Val Ala Gly Gln 805 810
815 Pro Val Val Leu Asp Val Ala Ala Gly Gly Ile Asp Ile Ala Ser
Arg 820 825 830 Lys
Gly Glu Arg Pro Ala Leu Thr Phe Ile Thr Pro Leu Ala Ala Pro 835
840 845 Gly Glu Glu Gln Arg Arg
Arg Thr Lys Thr Gly Lys Ser Glu Phe Thr 850 855
860 Thr Phe Val Glu Ile Val Gly Lys Gln Asp Arg
Trp Arg Ile Arg Asp 865 870 875
880 Gly Ala Ala Asp Thr Thr Ile Asp Leu Ala Lys Val Val Ser Gln Leu
885 890 895 Val Asp
Ala Asn Gly Val Leu Lys His Ser Ile Lys Leu Asp Val Ile 900
905 910 Gly Gly Asp Gly Asp Asp Val
Val Leu Ala Asn Ala Ser Arg Ile His 915 920
925 Tyr Asp Gly Gly Ala Gly Thr Asn Thr Val Ser Tyr
Ala Ala Leu Gly 930 935 940
Arg Gln Asp Ser Ile Thr Val Ser Ala Asp Gly Glu Arg Phe Asn Val 945
950 955 960 Arg Lys Gln
Leu Asn Asn Ala Asn Val Tyr Arg Glu Gly Val Ala Thr 965
970 975 Gln Thr Thr Ala Tyr Gly Lys Arg
Thr Glu Asn Val Gln Tyr Arg His 980 985
990 Val Glu Leu Ala Arg Val Gly Gln Leu Val Glu Val
Asp Thr Leu Glu 995 1000 1005
His Val Gln His Ile Ile Gly Gly Ala Gly Asn Asp Ser Ile Thr
1010 1015 1020 Gly Asn Ala
His Asp Asn Phe Leu Ala Gly Gly Ser Gly Asp Asp 1025
1030 1035 Arg Leu Asp Gly Gly Ala Gly Asn
Asp Thr Leu Val Gly Gly Glu 1040 1045
1050 Gly Gln Asn Thr Val Ile Gly Gly Ala Gly Asp Asp Val
Phe Leu 1055 1060 1065
Gln Asp Leu Gly Val Trp Ser Asn Gln Leu Asp Gly Gly Ala Gly 1070
1075 1080 Val Asp Thr Val Lys
Tyr Asn Val His Gln Pro Ser Glu Glu Arg 1085 1090
1095 Leu Glu Arg Met Gly Asp Thr Gly Ile His
Ala Asp Leu Gln Lys 1100 1105 1110
Gly Thr Val Glu Lys Trp Pro Ala Leu Asn Leu Phe Ser Val Asp
1115 1120 1125 His Val
Lys Asn Ile Glu Asn Leu His Gly Ser Arg Leu Asn Asp 1130
1135 1140 Arg Ile Ala Gly Asp Asp Gln
Asp Asn Glu Leu Trp Gly His Asp 1145 1150
1155 Gly Asn Asp Thr Ile Arg Gly Arg Gly Gly Asp Asp
Ile Leu Arg 1160 1165 1170
Gly Gly Leu Gly Leu Asp Thr Leu Tyr Gly Glu Asp Gly Asn Asp 1175
1180 1185 Ile Phe Leu Gln Asp
Asp Glu Thr Val Ser Asp Asp Ile Asp Gly 1190 1195
1200 Gly Ala Gly Leu Asp Thr Val Asp Tyr Ser
Ala Met Ile His Pro 1205 1210 1215
Gly Arg Ile Val Ala Pro His Glu Tyr Gly Phe Gly Ile Glu Ala
1220 1225 1230 Asp Leu
Ser Arg Glu Trp Val Arg Lys Ala Ser Ala Leu Gly Val 1235
1240 1245 Asp Tyr Tyr Asp Asn Val Arg
Asn Val Glu Asn Val Ile Gly Thr 1250 1255
1260 Ser Met Lys Asp Val Leu Ile Gly Asp Ala Gln Ala
Asn Thr Leu 1265 1270 1275
Met Gly Gln Gly Gly Asp Asp Thr Val Arg Gly Gly Asp Gly Asp 1280
1285 1290 Asp Leu Leu Phe Gly
Gly Asp Gly Asn Asp Met Leu Tyr Gly Asp 1295 1300
1305 Ala Gly Asn Asp Thr Leu Tyr Gly Gly Leu
Gly Asp Asp Thr Leu 1310 1315 1320
Glu Gly Gly Ala Gly Asn Asp Trp Phe Gly Gln Thr Gln Ala Arg
1325 1330 1335 Glu His
Asp Val Leu Arg Gly Gly Asp Gly Val Asp Thr Val Asp 1340
1345 1350 Tyr Ser Gln Thr Gly Ala His
Ala Gly Ile Ala Ala Gly Arg Ile 1355 1360
1365 Gly Leu Gly Ile Leu Ala Asp Leu Gly Ala Gly Arg
Val Asp Lys 1370 1375 1380
Leu Gly Glu Ala Gly Ser Ser Ala Tyr Asp Thr Val Ser Gly Ile 1385
1390 1395 Glu Asn Val Val Gly
Thr Glu Leu Ala Asp Arg Ile Thr Gly Asp 1400 1405
1410 Ala Gln Ala Asn Val Leu Arg Gly Ala Gly
Gly Ala Asp Val Leu 1415 1420 1425
Ala Gly Gly Glu Gly Asp Asp Val Leu Leu Gly Gly Asp Gly Asp
1430 1435 1440 Asp Gln
Leu Ser Gly Asp Ala Gly Arg Asp Arg Leu Tyr Gly Glu 1445
1450 1455 Ala Gly Asp Asp Trp Phe Phe
Gln Asp Ala Ala Asn Ala Gly Asn 1460 1465
1470 Leu Leu Asp Gly Gly Asp Gly Arg Asp Thr Val Asp
Phe Ser Gly 1475 1480 1485
Pro Gly Arg Gly Leu Asp Ala Gly Ala Lys Gly Val Phe Leu Ser 1490
1495 1500 Leu Gly Lys Gly Phe
Ala Ser Leu Met Asp Glu Pro Glu Thr Ser 1505 1510
1515 Asn Val Leu Arg Asn Ile Glu Asn Ala Val
Gly Ser Ala Arg Asp 1520 1525 1530
Asp Val Leu Ile Gly Asp Ala Gly Ala Asn Val Leu Asn Gly Leu
1535 1540 1545 Ala Gly
Asn Asp Val Leu Ser Gly Gly Ala Gly Asp Asp Val Leu 1550
1555 1560 Leu Gly Asp Glu Gly Ser Asp
Leu Leu Ser Gly Asp Ala Gly Asn 1565 1570
1575 Asp Asp Leu Phe Gly Gly Gln Gly Asp Asp Thr Tyr
Leu Phe Gly 1580 1585 1590
Val Gly Tyr Gly His Asp Thr Ile Tyr Glu Ser Gly Gly Gly His 1595
1600 1605 Asp Thr Ile Arg Ile
Asn Ala Gly Ala Asp Gln Leu Trp Phe Ala 1610 1615
1620 Arg Gln Gly Asn Asp Leu Glu Ile Arg Ile
Leu Gly Thr Asp Asp 1625 1630 1635
Ala Leu Thr Val His Asp Trp Tyr Arg Asp Ala Asp His Arg Val
1640 1645 1650 Glu Ile
Ile His Ala Ala Asn Gln Ala Val Asp Gln Ala Gly Ile 1655
1660 1665 Glu Lys Leu Val Glu Ala Met
Ala Gln Tyr Pro Asp Pro Gly Ala 1670 1675
1680 Ala Ala Ala Ala Pro Pro Ala Ala Arg Val Pro Asp
Thr Leu Met 1685 1690 1695
Gln Ser Leu Ala Val Asn Trp Arg 1700 1705
2400PRTBordetella pertussis 2Met Gln Gln Ser His Gln Ala Gly Tyr Ala Asn
Ala Ala Asp Arg Glu 1 5 10
15 Ser Gly Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala Val Ala Lys
20 25 30 Glu Lys
Asn Ala Thr Leu Met Phe Arg Leu Val Asn Pro His Ser Thr 35
40 45 Ser Leu Ile Ala Glu Gly Val
Ala Thr Lys Gly Leu Gly Val His Ala 50 55
60 Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile
Pro Val Asn Pro 65 70 75
80 Asn Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala
85 90 95 Asp Asn Asp
Val Asn Ser Ser Leu Ala His Gly His Thr Ala Val Asp 100
105 110 Leu Thr Leu Ser Lys Glu Arg Leu
Asp Tyr Leu Arg Gln Ala Gly Leu 115 120
125 Val Thr Gly Met Ala Asp Gly Val Val Ala Ser Asn His
Ala Gly Tyr 130 135 140
Glu Gln Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145
150 155 160 Val Gln Tyr Arg
Arg Lys Gly Gly Asp Asp Phe Glu Ala Val Lys Val 165
170 175 Ile Gly Asn Ala Ala Gly Ile Pro Leu
Thr Ala Asp Ile Asp Met Phe 180 185
190 Ala Ile Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg
Ser Ser 195 200 205
Val Thr Ser Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210
215 220 Ala Ala Ser Glu Ala
Thr Gly Gly Leu Asp Arg Glu Arg Ile Asp Leu 225 230
235 240 Leu Trp Lys Ile Ala Arg Ala Gly Ala Arg
Ser Ala Val Gly Thr Glu 245 250
255 Ala Arg Arg Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly Val
Ile 260 265 270 Thr
Asp Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala His 275
280 285 Ala Val Gly Ala Gln Asp
Val Val Gln His Gly Thr Glu Gln Asn Ser 290 295
300 Pro Phe Pro Glu Ala Asp Glu Lys Ile Phe Val
Val Ser Ala Thr Gly 305 310 315
320 Glu Ser Gln Met Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln
325 330 335 Gln Arg
Gly Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val 340
345 350 Ala Gly Lys Ser Leu Phe Asp
Asp Gly Leu Gly Ala Ala Pro Gly Val 355 360
365 Pro Ser Gly Arg Ser Lys Phe Ser Pro Asp Val Leu
Glu Thr Val Pro 370 375 380
Ala Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln 385
390 395 400
3225PRTBordetella pertussis 3Met Gln Gln Ser His Gln Ala Gly Tyr Ala Asn
Ala Ala Asp Arg Glu 1 5 10
15 Ser Gly Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala Val Ala Lys
20 25 30 Glu Lys
Asn Ala Thr Leu Met Phe Arg Leu Val Asn Pro His Ser Thr 35
40 45 Ser Leu Ile Ala Glu Gly Val
Ala Thr Lys Gly Leu Gly Val His Ala 50 55
60 Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile
Pro Val Asn Pro 65 70 75
80 Asn Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala
85 90 95 Asp Asn Asp
Val Asn Ser Ser Leu Ala His Gly His Thr Ala Val Asp 100
105 110 Leu Thr Leu Ser Lys Glu Arg Leu
Asp Tyr Leu Arg Gln Ala Gly Leu 115 120
125 Val Thr Gly Met Ala Asp Gly Val Val Ala Ser Asn His
Ala Gly Tyr 130 135 140
Glu Gln Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145
150 155 160 Val Gln Tyr Arg
Arg Lys Gly Gly Asp Asp Phe Glu Ala Val Lys Val 165
170 175 Ile Gly Asn Ala Ala Gly Ile Pro Leu
Thr Ala Asp Ile Asp Met Phe 180 185
190 Ala Ile Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg
Ser Ser 195 200 205
Val Thr Ser Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210
215 220 Ala 225
4175PRTBordetella pertussis 4Ala Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu
Arg Ile Asp Leu Leu 1 5 10
15 Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser Ala Val Gly Thr Glu Ala
20 25 30 Arg Arg
Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly Val Ile Thr 35
40 45 Asp Phe Glu Leu Glu Val Arg
Asn Ala Leu Asn Arg Arg Ala His Ala 50 55
60 Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu
Gln Asn Ser Pro 65 70 75
80 Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val Ser Ala Thr Gly Glu
85 90 95 Ser Gln Met
Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln Gln 100
105 110 Arg Gly Glu Gly Tyr Val Phe Tyr
Glu Asn Arg Ala Tyr Gly Val Ala 115 120
125 Gly Lys Ser Leu Phe Asp Asp Gly Leu Gly Ala Ala Pro
Gly Val Pro 130 135 140
Ser Gly Arg Ser Lys Phe Ser Pro Asp Val Leu Glu Thr Val Pro Ala 145
150 155 160 Ser Pro Gly Leu
Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln 165
170 175 5400PRTArtificial SequenceBordetella AC
domain with inactivating substitutions at amino acids 188 and 189
5Met Gln Gln Ser His Gln Ala Gly Tyr Ala Asn Ala Ala Asp Arg Glu 1
5 10 15 Ser Gly Ile Pro
Ala Ala Val Leu Asp Gly Ile Lys Ala Val Ala Lys 20
25 30 Glu Lys Asn Ala Thr Leu Met Phe Arg
Leu Val Asn Pro His Ser Thr 35 40
45 Ser Leu Ile Ala Glu Gly Val Ala Thr Lys Gly Leu Gly Val
His Ala 50 55 60
Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile Pro Val Asn Pro 65
70 75 80 Asn Leu Ser Lys Leu
Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala 85
90 95 Asp Asn Asp Val Asn Ser Ser Leu Ala His
Gly His Thr Ala Val Asp 100 105
110 Leu Thr Leu Ser Lys Glu Arg Leu Asp Tyr Leu Arg Gln Ala Gly
Leu 115 120 125 Val
Thr Gly Met Ala Asp Gly Val Val Ala Ser Asn His Ala Gly Tyr 130
135 140 Glu Gln Phe Glu Phe Arg
Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145 150
155 160 Val Gln Tyr Arg Arg Lys Gly Gly Asp Asp Phe
Glu Ala Val Lys Val 165 170
175 Ile Gly Asn Ala Ala Gly Ile Pro Leu Thr Ala Cys Thr Asp Met Phe
180 185 190 Ala Ile
Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg Ser Ser 195
200 205 Val Thr Ser Gly Asp Ser Val
Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210 215
220 Ala Ala Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu
Arg Ile Asp Leu 225 230 235
240 Leu Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser Ala Val Gly Thr Glu
245 250 255 Ala Arg Arg
Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly Val Ile 260
265 270 Thr Asp Phe Glu Leu Glu Val Arg
Asn Ala Leu Asn Arg Arg Ala His 275 280
285 Ala Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu
Gln Asn Ser 290 295 300
Pro Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val Ser Ala Thr Gly 305
310 315 320 Glu Ser Gln Met
Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln 325
330 335 Gln Arg Gly Glu Gly Tyr Val Phe Tyr
Glu Asn Arg Ala Tyr Gly Val 340 345
350 Ala Gly Lys Ser Leu Phe Asp Asp Gly Leu Gly Ala Ala Pro
Gly Val 355 360 365
Pro Ser Gly Arg Ser Lys Phe Ser Pro Asp Val Leu Glu Thr Val Pro 370
375 380 Ala Ser Pro Gly Leu
Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln 385 390
395 400 618DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 6gctgggaccc gaggaaat
18719DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 7cgccaatgta gacgatgcc
19818DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 8cgaggcggtc aaggtgat
18919DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 9gcggaagttg gacagatgc
191018DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 10aggtcatcaa tgccgcca
181118DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 11gcaggacggt cagttcgc
181217DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 12caagggcggc aaggtga
171319DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 13acaggatggc gaacaggct
191418DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 14ccagaacgga ttcacggc
181519DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 15ctgctgctgg tggagacga
191620DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 16tcatgctggc tcgctatcac
201720DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 17tcgctacaga atgcctgctc
201820DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 18agcaaggaca tcggctttgt
201920DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 19ttcgagcgtt ccgtacttcg
202020DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 20cgccctatta tcccagcgtc
202120DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 21taccgccatc acattgttgc
202220DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 22ccgatgtctt gcgcctgtat
202320DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 23gcgcatacga cacataggga
202420DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 24atgaactctc ccatgcaccg
202520DNAArtificial SequenceArtificially
synthesized oligonucleotide primer 25tatgcaaccg gcacgtcatt
2026269PRTBordetella pertussis 26Met Arg
Cys Thr Arg Ala Ile Arg Gln Thr Ala Arg Thr Gly Trp Leu 1 5
10 15 Thr Trp Leu Ala Ile Leu Ala
Val Thr Ala Pro Val Thr Ser Pro Ala 20 25
30 Trp Ala Asp Asp Pro Pro Ala Thr Val Tyr Arg Tyr
Asp Ser Arg Pro 35 40 45
Pro Glu Asp Val Phe Gln Asn Gly Phe Thr Ala Trp Gly Asn Asn Asp
50 55 60 Asn Val Leu
Asp His Leu Thr Gly Arg Ser Cys Gln Val Gly Ser Ser 65
70 75 80 Asn Ser Ala Phe Val Ser Thr
Ser Ser Ser Arg Arg Tyr Thr Glu Val 85
90 95 Tyr Leu Glu His Arg Met Gln Glu Ala Val Glu
Ala Glu Arg Ala Gly 100 105
110 Arg Gly Thr Gly His Phe Ile Gly Tyr Ile Tyr Glu Val Arg Ala
Asp 115 120 125 Asn
Asn Phe Tyr Gly Ala Ala Ser Ser Tyr Phe Glu Tyr Val Asp Thr 130
135 140 Tyr Gly Asp Asn Ala Gly
Arg Ile Leu Ala Gly Ala Leu Ala Thr Tyr 145 150
155 160 Gln Ser Glu Tyr Leu Ala His Arg Arg Ile Pro
Pro Glu Asn Ile Arg 165 170
175 Arg Val Thr Arg Val Tyr His Asn Gly Ile Thr Gly Glu Thr Thr Thr
180 185 190 Thr Glu
Tyr Ser Asn Ala Arg Tyr Val Ser Gln Gln Thr Arg Ala Asn 195
200 205 Pro Asn Pro Tyr Thr Ser Arg
Arg Ser Val Ala Ser Ile Val Gly Thr 210 215
220 Leu Val Arg Met Ala Pro Val Ile Gly Ala Cys Met
Ala Arg Gln Ala 225 230 235
240 Glu Ser Ser Glu Ala Met Ala Ala Trp Ser Glu Arg Ala Gly Glu Ala
245 250 255 Met Val Leu
Val Tyr Tyr Glu Ser Ile Ala Tyr Ser Phe 260
265 27226PRTBordetella pertussis 27Met Pro Ile Asp Arg
Lys Thr Leu Cys His Leu Leu Ser Val Leu Pro 1 5
10 15 Leu Ala Leu Leu Gly Ser His Val Ala Arg
Ala Ser Thr Pro Gly Ile 20 25
30 Val Ile Pro Pro Gln Glu Gln Ile Thr Gln His Gly Gly Pro Tyr
Gly 35 40 45 Arg
Cys Ala Asn Lys Thr Arg Ala Leu Thr Val Ala Glu Leu Arg Gly 50
55 60 Ser Gly Asp Leu Gln Glu
Tyr Leu Arg His Val Thr Arg Gly Trp Ser 65 70
75 80 Ile Phe Ala Leu Tyr Asp Gly Thr Tyr Leu Gly
Gly Glu Tyr Gly Gly 85 90
95 Val Ile Lys Asp Gly Thr Pro Gly Gly Ala Phe Asp Leu Lys Thr Thr
100 105 110 Phe Cys
Ile Met Thr Thr Arg Asn Thr Gly Gln Pro Ala Thr Asp His 115
120 125 Tyr Tyr Ser Asn Val Thr Ala
Thr Arg Leu Leu Ser Ser Thr Asn Ser 130 135
140 Arg Leu Cys Ala Val Phe Val Arg Ser Gly Gln Pro
Val Ile Gly Ala 145 150 155
160 Cys Thr Ser Pro Tyr Asp Gly Lys Tyr Trp Ser Met Tyr Ser Arg Leu
165 170 175 Arg Lys Met
Leu Tyr Leu Ile Tyr Val Ala Gly Ile Ser Val Arg Val 180
185 190 His Val Ser Lys Glu Glu Gln Tyr
Tyr Asp Tyr Glu Asp Ala Thr Phe 195 200
205 Glu Thr Tyr Ala Leu Thr Gly Ile Ser Ile Cys Asn Pro
Gly Ser Ser 210 215 220
Leu Cys 225 28227PRTBordetella pertussis 28Met Leu Ile Asn Asn Lys
Lys Leu Leu His His Ile Leu Pro Ile Leu 1 5
10 15 Val Leu Ala Leu Leu Gly Met Arg Thr Ala Gln
Ala Val Ala Pro Gly 20 25
30 Ile Val Ile Pro Pro Lys Ala Leu Phe Thr Gln Gln Gly Gly Ala
Tyr 35 40 45 Gly
Arg Cys Pro Asn Gly Thr Arg Ala Leu Thr Val Ala Glu Leu Arg 50
55 60 Gly Asn Ala Glu Leu Gln
Thr Tyr Leu Arg Gln Ile Thr Pro Gly Trp 65 70
75 80 Ser Ile Tyr Gly Leu Tyr Asp Gly Thr Tyr Leu
Gly Gln Ala Tyr Gly 85 90
95 Gly Ile Ile Lys Asp Ala Pro Pro Gly Ala Gly Phe Ile Tyr Arg Glu
100 105 110 Thr Phe
Cys Ile Thr Thr Ile Tyr Lys Thr Gly Gln Pro Ala Ala Asp 115
120 125 His Tyr Tyr Ser Lys Val Thr
Ala Thr Arg Leu Leu Ala Ser Thr Asn 130 135
140 Ser Arg Leu Cys Ala Val Phe Val Arg Asp Gly Gln
Ser Val Ile Gly 145 150 155
160 Ala Cys Ala Ser Pro Tyr Glu Gly Arg Tyr Arg Asp Met Tyr Asp Ala
165 170 175 Leu Arg Arg
Leu Leu Tyr Met Ile Tyr Met Ser Gly Leu Ala Val Arg 180
185 190 Val His Val Ser Lys Glu Glu Gln
Tyr Tyr Asp Tyr Glu Asp Ala Thr 195 200
205 Phe Gln Thr Tyr Ala Leu Thr Gly Ile Ser Leu Cys Asn
Pro Ala Ala 210 215 220
Ser Ile Cys 225 29152PRTBordetella pertussis 29Met Leu Arg Arg
Phe Pro Thr Arg Thr Thr Ala Pro Gly Gln Gly Gly 1 5
10 15 Ala Arg Arg Ser Arg Val Arg Ala Leu
Ala Trp Leu Leu Ala Ser Gly 20 25
30 Ala Met Thr His Leu Ser Pro Ala Leu Ala Asp Val Pro Tyr
Val Leu 35 40 45
Val Lys Thr Asn Met Val Val Thr Ser Val Ala Met Lys Pro Tyr Glu 50
55 60 Val Thr Pro Thr Arg
Met Leu Val Cys Gly Ile Ala Ala Lys Leu Gly 65 70
75 80 Ala Ala Ala Ser Ser Pro Asp Ala His Val
Pro Phe Cys Phe Gly Lys 85 90
95 Asp Leu Lys Arg Pro Gly Ser Ser Pro Met Glu Val Met Leu Arg
Ala 100 105 110 Val
Phe Met Gln Gln Arg Pro Leu Arg Met Phe Leu Gly Pro Lys Gln 115
120 125 Leu Thr Phe Glu Gly Lys
Pro Ala Leu Glu Leu Ile Arg Met Val Glu 130 135
140 Cys Ser Gly Lys Gln Asp Cys Pro 145
150 30133PRTBordetella pertussis 30Met Gln Arg Gln Ala
Gly Leu Pro Leu Lys Ala Asn Pro Met His Thr 1 5
10 15 Ile Ala Ser Ile Leu Leu Ser Val Leu Gly
Ile Tyr Ser Pro Ala Asp 20 25
30 Val Ala Gly Leu Pro Thr His Leu Tyr Lys Asn Phe Thr Val Gln
Glu 35 40 45 Leu
Ala Leu Lys Leu Lys Gly Lys Asn Gln Glu Phe Cys Leu Thr Ala 50
55 60 Phe Met Ser Gly Arg Ser
Leu Val Arg Ala Cys Leu Ser Asp Ala Gly 65 70
75 80 His Glu His Asp Thr Trp Phe Asp Thr Met Leu
Gly Phe Ala Ile Ser 85 90
95 Ala Tyr Ala Leu Lys Ser Arg Ile Ala Leu Thr Val Glu Asp Ser Pro
100 105 110 Tyr Pro
Gly Thr Pro Gly Asp Leu Leu Glu Leu Gln Ile Cys Pro Leu 115
120 125 Asn Gly Tyr Cys Glu 130
31269PRTBordetella bronchiseptica 31Met Arg Cys Thr Arg Ala
Ile Arg Gln Thr Ala Arg Thr Gly Trp Leu 1 5
10 15 Thr Trp Leu Ala Ile Leu Ala Val Thr Ala Pro
Met Thr Ser Pro Ala 20 25
30 Trp Ala Asp Asp Pro Pro Ala Thr Val Tyr Arg Tyr Asp Ser Arg
Pro 35 40 45 Pro
Glu Asp Val Phe Leu Asn Gly Phe Thr Ala Trp Gly Asn Asn Asp 50
55 60 Asn Val Leu Glu His Leu
Thr Gly Arg Ser Cys Gln Val Gly Ser Ser 65 70
75 80 Asn Ser Ala Phe Val Ser Thr Ser Ser Ser Arg
Arg Tyr Thr Glu Val 85 90
95 Tyr Leu Glu His Arg Met Gln Glu Ala Val Glu Ala Glu Arg Ala Gly
100 105 110 Arg Gly
Thr Gly His Phe Ile Gly Tyr Ile Tyr Glu Ile Arg Ala Asp 115
120 125 Asn Asn Phe Tyr Gly Ala Ala
Ser Ser Tyr Phe Glu Tyr Val Asp Thr 130 135
140 Tyr Gly Asp Asn Ala Gly Arg Ile Leu Ala Gly Ala
Leu Ala Thr Tyr 145 150 155
160 Gln Ser Glu Tyr Leu Ala His Arg Arg Ile Pro Pro Glu Asn Ile Arg
165 170 175 Arg Val Thr
Arg Val Tyr His Asn Gly Ile Thr Gly Glu Thr Thr Thr 180
185 190 Thr Glu Tyr Pro Asn Leu Arg Tyr
Val Ser Gln Gln Thr Arg Ala Asn 195 200
205 Pro Asn Pro Tyr Thr Ser Arg Arg Ser Thr Ala Ser Ile
Val Gly Thr 210 215 220
Leu Val Arg Met Ala Pro Val Thr Gly Ala Cys Met Ala Arg Gln Ala 225
230 235 240 Glu Ser Pro Glu
Ala Met Ala Ala Trp Ser Glu Arg Ala Gly Glu Ala 245
250 255 Met Val Leu Val Tyr Tyr Glu Ser Ile
Ala Tyr Ser Phe 260 265
32226PRTBordetella bronchiseptica 32Met Pro Ile Ser Arg Lys Thr Leu Ser
His Leu Leu Ser Val Leu Pro 1 5 10
15 Leu Ala Phe Leu Gly Cys His Val Ala Arg Ala Ser Thr Pro
Gly Ile 20 25 30
Val Ile Pro Pro Gln Glu Gln Ile Thr Gln His Gly Gly Pro Tyr Gly
35 40 45 Arg Cys Ala Asn
Lys Thr Arg Ala Leu Thr Val Ala Glu Leu Arg Gly 50
55 60 Ser Gly Asp Leu Gln Glu Tyr Leu
Arg His Val Thr Arg Gly Trp Ser 65 70
75 80 Ile Phe Ala Leu Tyr Asp Gly Thr Tyr Leu Gly Gly
Glu Tyr Gly Gly 85 90
95 Val Ile Lys Asp Gly Thr Pro Gly Gly Ala Phe Asp Leu Lys Thr Thr
100 105 110 Phe Cys Ile
Met Thr Thr Arg Asn Thr Gly Gln Pro Ala Thr Asp His 115
120 125 Tyr Tyr Ser Asn Val Thr Ala Thr
Arg Leu Leu Ser Ser Thr Asn Ser 130 135
140 Arg Leu Cys Ala Val Phe Val Arg Ser Gly Gln Pro Val
Ile Gly Ala 145 150 155
160 Cys Thr Ser Pro Tyr Asp Gly Lys Tyr Trp Ser Met Tyr Ser Arg Leu
165 170 175 Arg Lys Met Leu
Tyr Leu Ile Tyr Val Ala Gly Ile Ser Val Arg Val 180
185 190 His Val Ser Lys Glu Glu Gln Tyr Tyr
Asp Tyr Glu Asp Ala Thr Phe 195 200
205 Glu Thr Tyr Ala Leu Thr Gly Ile Ser Ile Cys Asn Pro Gly
Ser Ser 210 215 220
Leu Cys 225 33227PRTBordetella bronchiseptica 33Met Leu Thr Asn Asn
Lys Lys Leu Leu His His Ile Leu Pro Ile Leu 1 5
10 15 Leu Leu Ala Leu Leu Gly Met Arg Thr Ala
Gln Ala Val Ala Pro Gly 20 25
30 Ile Val Ile Pro Pro Lys Ala Leu Leu Thr Lys Gln Gly Gly Ala
Tyr 35 40 45 Gly
Arg Cys Pro Asn Gly Thr Arg Ala Leu Thr Ala Ala Glu Leu Arg 50
55 60 Gly Ser Ala Glu Leu Gln
Thr Tyr Leu Arg Gln Ile Thr Pro Gly Trp 65 70
75 80 Ser Ile Tyr Gly Leu Tyr Asp Gly Thr Tyr Leu
Gly Gln Ser Tyr Gly 85 90
95 Gly Ile Ile Lys Asp Ala Pro Pro Gly Gly Gly Phe Ile Tyr His Glu
100 105 110 Thr Phe
Cys Ile Thr Thr Ile Tyr Tyr Thr Gly Gln Pro Asp Thr Asp 115
120 125 His Tyr Tyr Ser Lys Val Thr
Ala Thr Arg Leu Leu Ala Ser Thr Asn 130 135
140 Ser Gly Leu Cys Ala Val Phe Ala Arg Asp Gly Lys
Pro Leu Ile Gly 145 150 155
160 Ala Cys Thr Arg Pro Tyr Gln Ser Ser Tyr Gly Asp Met Tyr Asp Val
165 170 175 Leu Arg Arg
Leu Leu Tyr Met Val Tyr Met Ser Gly Leu Ala Val Arg 180
185 190 Val His Val Ser Lys Glu Glu Gln
Tyr Tyr Asp Tyr Glu Asp Ala Thr 195 200
205 Phe Glu Thr Tyr Ala Leu Thr Gly Ile Ser Leu Cys Asn
Pro Ala Ala 210 215 220
Ser Ile Cys 225 34152PRTBordetella bronchiseptica 34Met Leu Arg
Arg Phe Pro Thr Arg Thr Thr Ala Pro Gly Gln Gly Gly 1 5
10 15 Ala Arg Arg Ser Arg Val Arg Ala
Leu Ala Trp Leu Leu Thr Ser Gly 20 25
30 Ala Met Thr His Leu Ser Pro Ala Leu Ala Asp Val Pro
Tyr Val Leu 35 40 45
Val Lys Thr Asn Met Val Val Thr Ser Val Ala Met Lys Pro Tyr Glu 50
55 60 Val Thr Pro Thr
Arg Met Leu Val Cys Gly Ile Ala Ala Lys Leu Gly 65 70
75 80 Ala Ala Ala Ser Ser Pro Asp Ala His
Val Pro Phe Cys Phe Gly Lys 85 90
95 Asp Leu Lys Arg Ser Gly Ser Ser Pro Met Glu Val Met Leu
Arg Ala 100 105 110
Val Phe Met Gln Gln Arg Pro Leu Arg Met Phe Leu Gly Pro Lys Gln
115 120 125 Leu Thr Phe Glu
Gly Lys Pro Ala Leu Glu Leu Ile Arg Met Val Glu 130
135 140 Cys Ser Gly Lys Gln Asp Cys Pro
145 150 35133PRTBordetella bronchiseptica 35Met
Gln Arg Gln Ala Gly Leu Pro Leu Lys Ala Asn Thr Met His Thr 1
5 10 15 Ile Ala Ser Ile Leu Leu
Ser Val Leu Gly Ile Tyr Ser Pro Ala Asp 20
25 30 Val Ala Gly Leu Pro Thr His Leu Tyr Lys
Asn Phe Thr Val Gln Glu 35 40
45 Leu Ala Leu Lys Leu Lys Gly Lys Asn Gln Glu Phe Cys Leu
Thr Ala 50 55 60
Phe Met Pro Gly Arg Ser Leu Val Arg Ala Cys Leu Ser Asp Ala Gly 65
70 75 80 His Glu His Asp Thr
Trp Phe Asp Thr Met Leu Gly Phe Ala Ile Ser 85
90 95 Ala Tyr Ala Leu Lys Ser Arg Ile Ala Leu
Thr Val Glu Asp Ser Pro 100 105
110 Tyr Pro Gly Thr Pro Gly Asp Leu Leu Glu Leu Gln Ile Cys Pro
Leu 115 120 125 Asn
Gly Tyr Cys Glu 130 363590PRTBordetella pertussis 36Met
Asn Thr Asn Leu Tyr Arg Leu Val Phe Ser His Val Arg Gly Met 1
5 10 15 Leu Val Pro Val Ser Glu
His Cys Thr Val Gly Asn Thr Phe Cys Gly 20
25 30 Arg Thr Arg Gly Gln Ala Arg Ser Gly Ala
Arg Ala Thr Ser Leu Ser 35 40
45 Val Ala Pro Asn Ala Leu Ala Trp Ala Leu Met Leu Ala Cys
Thr Gly 50 55 60
Leu Pro Leu Val Thr His Ala Gln Gly Leu Val Pro Gln Gly Gln Thr 65
70 75 80 Gln Val Leu Gln Gly
Gly Asn Lys Val Pro Val Val Asn Ile Ala Asp 85
90 95 Pro Asn Ser Gly Gly Val Ser His Asn Lys
Phe Gln Gln Phe Asn Val 100 105
110 Ala Asn Pro Gly Val Val Phe Asn Asn Gly Leu Thr Asp Gly Val
Ser 115 120 125 Arg
Ile Gly Gly Ala Leu Thr Lys Asn Pro Asn Leu Thr Arg Gln Ala 130
135 140 Ser Ala Ile Leu Ala Glu
Val Thr Asp Thr Ser Pro Ser Arg Leu Ala 145 150
155 160 Gly Thr Leu Glu Val Tyr Gly Lys Gly Ala Asp
Leu Ile Ile Ala Asn 165 170
175 Pro Asn Gly Ile Ser Val Asn Gly Leu Ser Thr Leu Asn Ala Ser Asn
180 185 190 Leu Thr
Leu Thr Thr Gly Arg Pro Ser Val Asn Gly Gly Arg Ile Gly 195
200 205 Leu Asp Val Gln Gln Gly Thr
Val Thr Ile Glu Arg Gly Gly Val Asn 210 215
220 Ala Thr Gly Leu Gly Tyr Phe Asp Val Val Ala Arg
Leu Val Lys Leu 225 230 235
240 Gln Gly Ala Val Ser Ser Lys Gln Gly Lys Pro Leu Ala Asp Ile Ala
245 250 255 Val Val Ala
Gly Ala Asn Arg Tyr Asp His Ala Thr Arg Arg Ala Thr 260
265 270 Pro Ile Ala Ala Gly Ala Arg Gly
Ala Ala Ala Gly Ala Tyr Ala Ile 275 280
285 Asp Gly Thr Ala Ala Gly Ala Met Tyr Gly Lys His Ile
Thr Leu Val 290 295 300
Ser Ser Asp Ser Gly Leu Gly Val Arg Gln Leu Gly Ser Leu Ser Ser 305
310 315 320 Pro Ser Ala Ile
Thr Val Ser Ser Gln Gly Glu Ile Ala Leu Gly Asp 325
330 335 Ala Thr Val Gln Arg Gly Pro Leu Ser
Leu Lys Gly Ala Gly Val Val 340 345
350 Ser Ala Gly Lys Leu Ala Ser Gly Gly Gly Ala Val Asn Val
Ala Gly 355 360 365
Gly Gly Ala Val Lys Ile Ala Ser Ala Ser Ser Val Gly Asn Leu Ala 370
375 380 Val Gln Gly Gly Gly
Lys Val Gln Ala Thr Leu Leu Asn Ala Gly Gly 385 390
395 400 Thr Leu Leu Val Ser Gly Arg Gln Ala Val
Gln Leu Gly Ala Ala Ser 405 410
415 Ser Arg Gln Ala Leu Ser Val Asn Ala Gly Gly Ala Leu Lys Ala
Asp 420 425 430 Lys
Leu Ser Ala Thr Arg Arg Val Asp Val Asp Gly Lys Gln Ala Val 435
440 445 Ala Leu Gly Ser Ala Ser
Ser Asn Ala Leu Ser Val Arg Ala Gly Gly 450 455
460 Ala Leu Lys Ala Gly Lys Leu Ser Ala Thr Gly
Arg Leu Asp Val Asp 465 470 475
480 Gly Lys Gln Ala Val Thr Leu Gly Ser Val Ala Ser Asp Gly Ala Leu
485 490 495 Ser Val
Ser Ala Gly Gly Asn Leu Arg Ala Lys Gln Leu Val Ser Ser 500
505 510 Ala Gln Leu Glu Val Arg Gly
Gln Arg Glu Val Ala Leu Asp Asp Ala 515 520
525 Ser Ser Ala Arg Gly Met Thr Val Val Ala Ala Gly
Ala Leu Ala Ala 530 535 540
Arg Asn Leu Gln Ser Lys Gly Ala Ile Gly Val Gln Gly Gly Glu Ala 545
550 555 560 Val Ser Val
Ala Asn Ala Asn Ser Asp Ala Glu Leu Arg Val Arg Gly 565
570 575 Arg Gly Gln Val Asp Leu His Asp
Leu Ser Ala Ala Arg Gly Ala Asp 580 585
590 Ile Ser Gly Glu Gly Arg Val Asn Ile Gly Arg Ala Arg
Ser Asp Ser 595 600 605
Asp Val Lys Val Ser Ala His Gly Ala Leu Ser Ile Asp Ser Met Thr 610
615 620 Ala Leu Gly Ala
Ile Gly Val Gln Ala Gly Gly Ser Val Ser Ala Lys 625 630
635 640 Asp Met Arg Ser Arg Gly Ala Val Thr
Val Ser Gly Gly Gly Ala Val 645 650
655 Asn Leu Gly Asp Val Gln Ser Asp Gly Gln Val Arg Ala Thr
Ser Ala 660 665 670
Gly Ala Met Thr Val Arg Asp Val Ala Ala Ala Ala Asp Leu Ala Leu
675 680 685 Gln Ala Gly Asp
Ala Leu Gln Ala Gly Phe Leu Lys Ser Ala Gly Ala 690
695 700 Met Thr Val Asn Gly Arg Asp Ala
Val Arg Leu Asp Gly Ala His Ala 705 710
715 720 Gly Gly Gln Leu Arg Val Ser Ser Asp Gly Gln Ala
Ala Leu Gly Ser 725 730
735 Leu Ala Ala Lys Gly Glu Leu Thr Val Ser Ala Ala Arg Ala Ala Thr
740 745 750 Val Ala Glu
Leu Lys Ser Leu Asp Asn Ile Ser Val Thr Gly Gly Glu 755
760 765 Arg Val Ser Val Gln Ser Val Asn
Ser Ala Ser Arg Val Ala Ile Ser 770 775
780 Ala His Gly Ala Leu Asp Val Gly Lys Val Ser Ala Lys
Ser Gly Ile 785 790 795
800 Gly Leu Glu Gly Trp Gly Ala Val Gly Ala Asp Ser Leu Gly Ser Asp
805 810 815 Gly Ala Ile Ser
Val Ser Gly Arg Asp Ala Val Arg Val Asp Gln Ala 820
825 830 Arg Ser Leu Ala Asp Ile Ser Leu Gly
Ala Glu Gly Gly Ala Thr Leu 835 840
845 Gly Ala Val Glu Ala Ala Gly Ser Ile Asp Val Arg Gly Gly
Ser Thr 850 855 860
Val Ala Ala Asn Ser Leu His Ala Asn Arg Asp Val Arg Val Ser Gly 865
870 875 880 Lys Asp Ala Val Arg
Val Thr Ala Ala Thr Ser Gly Gly Gly Leu His 885
890 895 Val Ser Ser Gly Arg Gln Leu Asp Leu Gly
Ala Val Gln Ala Arg Gly 900 905
910 Ala Leu Ala Leu Asp Gly Gly Ala Gly Val Ala Leu Gln Ser Ala
Lys 915 920 925 Ala
Ser Gly Thr Leu His Val Gln Gly Gly Glu His Leu Asp Leu Gly 930
935 940 Thr Leu Ala Ala Val Gly
Ala Val Asp Val Asn Gly Thr Gly Asp Val 945 950
955 960 Arg Val Ala Lys Leu Val Ser Asp Ala Gly Ala
Asp Leu Gln Ala Gly 965 970
975 Arg Ser Met Thr Leu Gly Ile Val Asp Thr Thr Gly Asp Leu Gln Ala
980 985 990 Arg Ala
Gln Gln Lys Leu Glu Leu Gly Ser Val Lys Ser Asp Gly Gly 995
1000 1005 Leu Gln Ala Ala Ala
Gly Gly Ala Leu Ser Leu Ala Ala Ala Glu 1010 1015
1020 Val Ala Gly Ala Leu Glu Leu Ser Gly Gln
Gly Val Thr Val Asp 1025 1030 1035
Arg Ala Ser Ala Ser Arg Ala Arg Ile Asp Ser Thr Gly Ser Val
1040 1045 1050 Gly Ile
Gly Ala Leu Lys Ala Gly Ala Val Glu Ala Ala Ser Pro 1055
1060 1065 Arg Arg Ala Arg Arg Ala Leu
Arg Gln Asp Phe Phe Thr Pro Gly 1070 1075
1080 Ser Val Val Val Arg Ala Gln Gly Asn Val Thr Val
Gly Arg Gly 1085 1090 1095
Asp Pro His Gln Gly Val Leu Ala Gln Gly Asp Ile Ile Met Asp 1100
1105 1110 Ala Lys Gly Gly Thr
Leu Leu Leu Arg Asn Asp Ala Leu Thr Glu 1115 1120
1125 Asn Gly Thr Val Thr Ile Ser Ala Asp Ser
Ala Val Leu Glu His 1130 1135 1140
Ser Thr Ile Glu Ser Lys Ile Ser Gln Ser Val Leu Ala Ala Lys
1145 1150 1155 Gly Asp
Lys Gly Lys Pro Ala Val Ser Val Lys Val Ala Lys Lys 1160
1165 1170 Leu Phe Leu Asn Gly Thr Leu
Arg Ala Val Asn Asp Asn Asn Glu 1175 1180
1185 Thr Met Ser Gly Arg Gln Ile Asp Val Val Asp Gly
Arg Pro Gln 1190 1195 1200
Ile Thr Asp Ala Val Thr Gly Glu Ala Arg Lys Asp Glu Ser Val 1205
1210 1215 Val Ser Asp Ala Ala
Leu Val Ala Asp Gly Gly Pro Ile Val Val 1220 1225
1230 Glu Ala Gly Glu Leu Val Ser His Ala Gly
Gly Ile Gly Asn Gly 1235 1240 1245
Arg Asn Lys Glu Asn Gly Ala Ser Val Thr Val Arg Thr Thr Gly
1250 1255 1260 Asn Leu
Val Asn Lys Gly Tyr Ile Ser Ala Gly Lys Gln Gly Val 1265
1270 1275 Leu Glu Val Gly Gly Ala Leu
Thr Asn Glu Phe Leu Val Gly Ser 1280 1285
1290 Asp Gly Thr Gln Arg Ile Glu Ala Gln Arg Ile Glu
Asn Arg Gly 1295 1300 1305
Thr Phe Gln Ser Gln Ala Pro Ala Gly Thr Ala Gly Ala Leu Val 1310
1315 1320 Val Lys Ala Ala Glu
Ala Ile Val His Asp Gly Val Met Ala Thr 1325 1330
1335 Lys Gly Glu Met Gln Ile Ala Gly Lys Gly
Gly Gly Ser Pro Thr 1340 1345 1350
Val Thr Ala Gly Ala Lys Ala Thr Thr Ser Ala Asn Lys Leu Ser
1355 1360 1365 Val Asp
Val Ala Ser Trp Asp Asn Ala Gly Ser Leu Asp Ile Lys 1370
1375 1380 Lys Gly Gly Ala Gln Val Thr
Val Ala Gly Arg Tyr Ala Glu His 1385 1390
1395 Gly Glu Val Ser Ile Gln Gly Asp Tyr Thr Val Ser
Ala Asp Ala 1400 1405 1410
Ile Ala Leu Ala Ala Gln Val Thr Gln Arg Gly Gly Ala Ala Asn 1415
1420 1425 Leu Thr Ser Arg His
Asp Thr Arg Phe Ser Asn Lys Ile Arg Leu 1430 1435
1440 Met Gly Pro Leu Gln Val Asn Ala Gly Gly
Ala Val Ser Asn Thr 1445 1450 1455
Gly Asn Leu Lys Val Arg Glu Gly Val Thr Val Thr Ala Ala Ser
1460 1465 1470 Phe Asp
Asn Glu Thr Gly Ala Glu Val Met Ala Lys Ser Ala Thr 1475
1480 1485 Leu Thr Thr Ser Gly Ala Ala
Arg Asn Ala Gly Lys Met Gln Val 1490 1495
1500 Lys Glu Ala Ala Thr Ile Val Ala Ala Ser Val Ser
Asn Pro Gly 1505 1510 1515
Thr Phe Thr Ala Gly Lys Asp Ile Thr Val Thr Ser Arg Gly Gly 1520
1525 1530 Phe Asp Asn Glu Gly
Lys Met Glu Ser Asn Lys Asp Ile Val Ile 1535 1540
1545 Lys Thr Glu Gln Phe Ser Asn Gly Arg Val
Leu Asp Ala Lys His 1550 1555 1560
Asp Leu Thr Val Thr Ala Ser Gly Gln Ala Asp Asn Arg Gly Ser
1565 1570 1575 Leu Lys
Ala Gly His Asp Phe Thr Val Gln Ala Gln Arg Ile Asp 1580
1585 1590 Asn Ser Gly Thr Met Ala Ala
Gly His Asp Ala Thr Leu Lys Ala 1595 1600
1605 Pro His Leu Arg Asn Thr Gly Gln Val Val Ala Gly
His Asp Ile 1610 1615 1620
His Ile Ile Asn Ser Ala Lys Leu Glu Asn Thr Gly Arg Val Asp 1625
1630 1635 Ala Arg Asn Asp Ile
Ala Leu Asp Val Ala Asp Phe Thr Asn Thr 1640 1645
1650 Gly Ser Leu Tyr Ala Glu His Asp Ala Thr
Leu Thr Leu Ala Gln 1655 1660 1665
Gly Thr Gln Arg Asp Leu Val Val Asp Gln Asp His Ile Leu Pro
1670 1675 1680 Val Ala
Glu Gly Thr Leu Arg Val Lys Ala Lys Ser Leu Thr Thr 1685
1690 1695 Glu Ile Glu Thr Gly Asn Pro
Gly Ser Leu Ile Ala Glu Val Gln 1700 1705
1710 Glu Asn Ile Asp Asn Lys Gln Ala Ile Val Val Gly
Lys Asp Leu 1715 1720 1725
Thr Leu Ser Ser Ala His Gly Asn Val Ala Asn Glu Ala Asn Ala 1730
1735 1740 Leu Leu Trp Ala Ala
Gly Glu Leu Thr Val Lys Ala Gln Asn Ile 1745 1750
1755 Thr Asn Lys Arg Ala Ala Leu Ile Glu Ala
Gly Gly Asn Ala Arg 1760 1765 1770
Leu Thr Ala Ala Val Ala Leu Leu Asn Lys Leu Gly Arg Ile Arg
1775 1780 1785 Ala Gly
Glu Asp Met His Leu Asp Ala Pro Arg Ile Glu Asn Thr 1790
1795 1800 Ala Lys Leu Ser Gly Glu Val
Gln Arg Lys Gly Val Gln Asp Val 1805 1810
1815 Gly Gly Gly Glu His Gly Arg Trp Ser Gly Ile Gly
Tyr Val Asn 1820 1825 1830
Tyr Trp Leu Arg Ala Gly Asn Gly Lys Lys Ala Gly Thr Ile Ala 1835
1840 1845 Ala Pro Trp Tyr Gly
Gly Asp Leu Thr Ala Glu Gln Ser Leu Ile 1850 1855
1860 Glu Val Gly Lys Asp Leu Tyr Leu Asn Ala
Gly Ala Arg Lys Asp 1865 1870 1875
Glu His Arg His Leu Leu Asn Glu Gly Val Ile Gln Ala Gly Gly
1880 1885 1890 His Gly
His Ile Gly Gly Asp Val Asp Asn Arg Ser Val Val Arg 1895
1900 1905 Thr Val Ser Ala Met Glu Tyr
Phe Lys Thr Pro Leu Pro Val Ser 1910 1915
1920 Leu Thr Ala Leu Asp Asn Arg Ala Gly Leu Ser Pro
Ala Thr Trp 1925 1930 1935
Asn Phe Gln Ser Thr Tyr Glu Leu Leu Asp Tyr Leu Leu Asp Gln 1940
1945 1950 Asn Arg Tyr Glu Tyr
Ile Trp Gly Leu Tyr Pro Thr Tyr Thr Glu 1955 1960
1965 Trp Ser Val Asn Thr Leu Lys Asn Leu Asp
Leu Gly Tyr Gln Ala 1970 1975 1980
Lys Pro Ala Pro Thr Ala Pro Pro Met Pro Lys Ala Pro Glu Leu
1985 1990 1995 Asp Leu
Arg Gly His Thr Leu Glu Ser Ala Glu Gly Arg Lys Ile 2000
2005 2010 Phe Gly Glu Tyr Lys Lys Leu
Gln Gly Glu Tyr Glu Lys Ala Lys 2015 2020
2025 Met Ala Val Gln Ala Val Glu Ala Tyr Gly Glu Ala
Thr Arg Arg 2030 2035 2040
Val His Asp Gln Leu Gly Gln Arg Tyr Gly Lys Ala Leu Gly Gly 2045
2050 2055 Met Asp Ala Glu Thr
Lys Glu Val Asp Gly Ile Ile Gln Glu Phe 2060 2065
2070 Ala Ala Asp Leu Arg Thr Val Tyr Ala Lys
Gln Ala Asp Gln Ala 2075 2080 2085
Thr Ile Asp Ala Glu Thr Asp Lys Val Ala Gln Arg Tyr Lys Ser
2090 2095 2100 Gln Ile
Asp Ala Val Arg Leu Gln Ala Ile Gln Pro Gly Arg Val 2105
2110 2115 Thr Leu Ala Lys Ala Leu Ser
Ala Ala Leu Gly Ala Asp Trp Arg 2120 2125
2130 Ala Leu Gly His Ser Gln Leu Met Gln Arg Trp Lys
Asp Phe Lys 2135 2140 2145
Ala Gly Lys Arg Gly Ala Glu Ile Ala Phe Tyr Pro Lys Glu Gln 2150
2155 2160 Thr Val Leu Ala Ala
Gly Ala Gly Leu Thr Leu Ser Asn Gly Ala 2165 2170
2175 Ile His Asn Gly Glu Asn Ala Ala Gln Asn
Arg Gly Arg Pro Glu 2180 2185 2190
Gly Leu Lys Ile Gly Ala His Ser Ala Thr Ser Val Ser Gly Ser
2195 2200 2205 Phe Asp
Ala Leu Arg Asp Val Gly Leu Glu Lys Arg Leu Asp Ile 2210
2215 2220 Asp Asp Ala Leu Ala Ala Val
Leu Val Asn Pro His Ile Phe Thr 2225 2230
2235 Arg Ile Gly Ala Ala Gln Thr Ser Leu Ala Asp Gly
Ala Ala Gly 2240 2245 2250
Pro Ala Leu Ala Arg Gln Ala Arg Gln Ala Pro Glu Thr Asp Gly 2255
2260 2265 Met Val Asp Ala Arg
Gly Leu Gly Ser Ala Asp Ala Leu Ala Ser 2270 2275
2280 Leu Ala Ser Leu Asp Ala Ala Gln Gly Leu
Glu Val Ser Gly Arg 2285 2290 2295
Arg Asn Ala Gln Val Ala Asp Ala Gly Leu Ala Gly Pro Ser Ala
2300 2305 2310 Val Ala
Ala Pro Ala Val Gly Ala Ala Asp Val Gly Val Glu Pro 2315
2320 2325 Val Thr Gly Asp Gln Val Asp
Gln Pro Val Val Ala Val Gly Leu 2330 2335
2340 Glu Gln Pro Val Ala Thr Val Arg Val Ala Pro Pro
Ala Val Ala 2345 2350 2355
Leu Pro Arg Pro Leu Phe Glu Thr Arg Ile Lys Phe Ile Asp Gln 2360
2365 2370 Ser Lys Phe Tyr Gly
Ser Arg Tyr Phe Phe Glu Gln Ile Gly Tyr 2375 2380
2385 Lys Pro Asp Arg Ala Ala Arg Val Ala Gly
Asp Asn Tyr Phe Asp 2390 2395 2400
Thr Thr Leu Val Arg Glu Gln Val Arg Arg Ala Leu Gly Gly Tyr
2405 2410 2415 Glu Ser
Arg Leu Pro Val Arg Gly Val Ala Leu Val Ala Lys Leu 2420
2425 2430 Met Asp Ser Ala Gly Thr Val
Gly Lys Ala Leu Gly Leu Lys Val 2435 2440
2445 Gly Val Ala Pro Thr Ala Gln Gln Leu Lys Gln Ala
Asp Arg Asp 2450 2455 2460
Phe Val Trp Tyr Val Asp Thr Val Ile Asp Gly Gln Lys Val Leu 2465
2470 2475 Ala Pro Arg Leu Tyr
Leu Thr Glu Ala Thr Arg Gln Gly Ile Thr 2480 2485
2490 Asp Gln Tyr Ala Gly Gly Gly Ala Leu Ile
Ala Ser Gly Gly Asp 2495 2500 2505
Val Thr Val Asn Thr Asp Gly His Asp Val Ser Ser Val Asn Gly
2510 2515 2520 Leu Ile
Gln Gly Arg Ser Val Lys Val Asp Ala Gly Lys Gly Lys 2525
2530 2535 Val Val Val Ala Asp Ser Lys
Gly Ala Gly Gly Gly Ile Glu Ala 2540 2545
2550 Asp Asp Glu Val Asp Val Ser Gly Arg Asp Ile Gly
Ile Glu Gly 2555 2560 2565
Gly Lys Leu Arg Gly Lys Asp Val Arg Leu Lys Ala Asp Thr Val 2570
2575 2580 Lys Val Ala Thr Ser
Met Arg Tyr Asp Asp Lys Gly Arg Leu Ala 2585 2590
2595 Ala Arg Gly Asp Gly Ala Leu Asp Ala Gln
Gly Gly Gln Leu His 2600 2605 2610
Ile Glu Ala Lys Arg Leu Glu Thr Ala Gly Ala Thr Leu Lys Gly
2615 2620 2625 Gly Lys
Val Lys Leu Asp Val Asp Asp Val Lys Leu Gly Gly Val 2630
2635 2640 Tyr Glu Ala Gly Ser Ser Tyr
Glu Asn Lys Ser Ser Thr Pro Leu 2645 2650
2655 Gly Ser Leu Phe Ala Ile Leu Ser Ser Thr Thr Glu
Thr Asn Gln 2660 2665 2670
Ser Ala His Ala Asn His Tyr Gly Thr Arg Ile Glu Ala Gly Thr 2675
2680 2685 Leu Glu Gly Lys Met
Gln Asn Leu Glu Ile Glu Gly Gly Ser Val 2690 2695
2700 Asp Ala Ala His Thr Asp Leu Ser Val Ala
Arg Asp Ala Arg Phe 2705 2710 2715
Lys Ala Ala Ala Asp Phe Ala His Ala Glu His Glu Lys Asp Val
2720 2725 2730 Arg Gln
Leu Ser Leu Gly Ala Lys Val Gly Ala Gly Gly Tyr Glu 2735
2740 2745 Ala Gly Phe Ser Leu Gly Ser
Glu Ser Gly Leu Glu Ala His Ala 2750 2755
2760 Gly Arg Gly Met Thr Ala Gly Ala Glu Val Lys Val
Gly Tyr Arg 2765 2770 2775
Ala Ser His Glu Gln Ser Ser Glu Thr Glu Lys Ser Tyr Arg Asn 2780
2785 2790 Ala Asn Leu Asn Phe
Gly Gly Gly Ser Val Glu Ala Gly Asn Val 2795 2800
2805 Leu Asp Ile Gly Gly Ala Asp Ile Asn Arg
Asn Arg Tyr Gly Gly 2810 2815 2820
Ala Ala Lys Gly Asn Ala Gly Thr Glu Glu Ala Leu Arg Met Arg
2825 2830 2835 Ala Lys
Lys Val Glu Ser Thr Lys Tyr Val Ser Glu Gln Thr Ser 2840
2845 2850 Gln Ser Ser Gly Trp Ser Val
Glu Val Ala Ser Thr Ala Ser Ala 2855 2860
2865 Arg Ser Ser Leu Leu Thr Ala Ala Thr Arg Leu Gly
Asp Ser Val 2870 2875 2880
Ala Gln Asn Val Glu Asp Gly Arg Glu Ile Arg Gly Glu Leu Met 2885
2890 2895 Ala Ala Gln Val Ala
Ala Glu Ala Thr Gln Leu Val Thr Ala Asp 2900 2905
2910 Thr Ala Ala Val Ala Leu Ser Ala Gly Ile
Ser Ala Asp Phe Asp 2915 2920 2925
Ser Ser His Ser Arg Ser Thr Ser Gln Asn Thr Gln Tyr Leu Gly
2930 2935 2940 Gly Asn
Leu Ser Ile Glu Ala Thr Glu Gly Asp Ala Thr Leu Val 2945
2950 2955 Gly Ala Lys Phe Gly Gly Gly
Asp Gln Val Ser Leu Lys Ala Ala 2960 2965
2970 Lys Ser Val Asn Leu Met Ala Ala Glu Ser Thr Phe
Glu Ser Tyr 2975 2980 2985
Ser Glu Ser His Asn Phe His Ala Ser Ala Asp Ala Asn Leu Gly 2990
2995 3000 Ala Asn Ala Val Gln
Gly Ala Val Gly Leu Gly Leu Thr Ala Gly 3005 3010
3015 Met Gly Thr Ser His Gln Ile Thr Asn Glu
Thr Gly Lys Thr Tyr 3020 3025 3030
Ala Gly Thr Ser Val Asp Ala Ala Asn Val Ser Ile Asp Ala Gly
3035 3040 3045 Lys Asp
Leu Asn Leu Ser Gly Ser Arg Val Arg Gly Lys His Val 3050
3055 3060 Val Leu Asp Val Glu Gly Asp
Ile Asn Ala Thr Ser Lys Gln Asp 3065 3070
3075 Glu Arg Asn Tyr Asn Ser Ser Gly Gly Gly Trp Asp
Ala Ser Ala 3080 3085 3090
Gly Val Ala Ile Gln Asn Arg Thr Leu Val Ala Pro Val Gly Ser 3095
3100 3105 Ala Gly Phe Asn Phe
Asn Thr Glu His Asp Asn Ser Arg Leu Thr 3110 3115
3120 Asn Asp Gly Ala Ala Gly Val Val Ala Ser
Asp Gly Leu Thr Gly 3125 3130 3135
His Val Lys Gly Asp Ala Asn Leu Thr Gly Ala Thr Ile Ala Asp
3140 3145 3150 Leu Ser
Gly Lys Gly Asn Leu Lys Val Asp Gly Ala Val Asn Ala 3155
3160 3165 Gln Asn Leu Lys Asp Tyr Arg
Asp Lys Asp Gly Gly Ser Gly Gly 3170 3175
3180 Leu Asn Val Gly Ile Ser Ser Thr Thr Leu Ala Pro
Thr Val Gly 3185 3190 3195
Val Ala Phe Gly Arg Val Ala Gly Glu Asp Tyr Gln Ala Glu Gln 3200
3205 3210 Arg Ala Thr Ile Asp
Val Gly Gln Thr Lys Asp Pro Ala Arg Leu 3215 3220
3225 Gln Val Gly Gly Gly Val Lys Gly Thr Leu
Asn Gln Asp Ala Ala 3230 3235 3240
Gln Ala Thr Val Val Gln Arg Asn Lys His Trp Ala Gly Gly Gly
3245 3250 3255 Ser Glu
Phe Ser Val Ala Gly Lys Ser Leu Lys Lys Lys Asn Gln 3260
3265 3270 Val Arg Pro Val Glu Thr Pro
Thr Pro Asp Val Val Asp Gly Pro 3275 3280
3285 Pro Ser Arg Pro Thr Thr Pro Pro Ala Ser Pro Gln
Pro Ile Arg 3290 3295 3300
Ala Thr Val Glu Val Ser Ser Pro Pro Pro Val Ser Val Ala Thr 3305
3310 3315 Val Glu Val Val Pro
Arg Pro Lys Val Glu Thr Ala Gln Pro Leu 3320 3325
3330 Pro Pro Arg Pro Val Ala Ala Gln Val Val
Pro Val Thr Pro Pro 3335 3340 3345
Lys Val Glu Val Ala Lys Val Glu Val Val Pro Arg Pro Lys Val
3350 3355 3360 Glu Thr
Ala Gln Pro Leu Pro Pro Arg Pro Val Val Ala Glu Lys 3365
3370 3375 Val Thr Thr Pro Ala Val Gln
Pro Gln Leu Ala Lys Val Glu Thr 3380 3385
3390 Val Gln Pro Val Lys Pro Glu Thr Thr Lys Pro Leu
Pro Lys Pro 3395 3400 3405
Leu Pro Val Ala Lys Val Thr Lys Ala Pro Pro Pro Val Val Glu 3410
3415 3420 Thr Ala Gln Pro Leu
Pro Pro Val Lys Pro Gln Lys Ala Thr Pro 3425 3430
3435 Gly Pro Val Ala Glu Val Gly Lys Ala Thr
Val Thr Thr Val Gln 3440 3445 3450
Val Gln Ser Ala Pro Pro Lys Pro Ala Pro Val Ala Lys Gln Pro
3455 3460 3465 Ala Pro
Ala Pro Lys Pro Lys Pro Lys Pro Lys Pro Lys Ala Glu 3470
3475 3480 Arg Pro Lys Pro Gly Lys Thr
Thr Pro Leu Ser Gly Arg His Val 3485 3490
3495 Val Gln Gln Gln Val Gln Val Leu Gln Arg Gln Ala
Ser Asp Ile 3500 3505 3510
Asn Asn Thr Lys Ser Leu Pro Gly Gly Lys Leu Pro Lys Pro Val 3515
3520 3525 Thr Val Lys Leu Thr
Asp Glu Asn Gly Lys Pro Gln Thr Tyr Thr 3530 3535
3540 Ile Asn Arg Arg Glu Asp Leu Met Lys Leu
Asn Gly Lys Val Leu 3545 3550 3555
Ser Thr Lys Thr Thr Leu Gly Leu Glu Gln Thr Phe Arg Leu Arg
3560 3565 3570 Val Glu
Asp Ile Gly Gly Lys Asn Tyr Arg Val Phe Tyr Glu Thr 3575
3580 3585 Asn Lys 3590
373640PRTBordetella bronchiseptica 37Met Leu Ala Cys Ala Gly Leu Pro Leu
Val Thr His Ala Gln Gly Leu 1 5 10
15 Val Pro Gln Gly Gln Thr Gln Val Leu Gln Gly Gly Asn Lys
Val Pro 20 25 30
Val Val Asn Ile Ala Asn Pro Asn Ser Gly Gly Val Ser His Asn Lys
35 40 45 Phe Gln Gln Phe
Asn Val Ala Asn Pro Gly Val Val Phe Asn Asn Gly 50
55 60 Leu Thr Asp Gly Val Ser Arg Ile
Gly Gly Ala Leu Thr Lys Asn Pro 65 70
75 80 Asn Leu Thr Arg Gln Ala Ser Ala Ile Leu Ala Glu
Val Thr Gly Thr 85 90
95 Ser Pro Ser Arg Leu Ala Gly Thr Leu Glu Val Tyr Gly Lys Gly Ala
100 105 110 Asp Leu Ile
Ile Ala Asn Pro Asn Gly Ile Ser Val Asn Gly Leu Ser 115
120 125 Thr Leu Asn Ala Ser Asn Leu Thr
Leu Thr Thr Gly Arg Pro Ser Val 130 135
140 Asn Gly Gly Arg Ile Gly Leu Asp Val Gln Gln Gly Thr
Val Thr Ile 145 150 155
160 Glu Arg Gly Gly Val Asn Val Thr Gly Leu Gly Tyr Phe Asp Val Val
165 170 175 Ala Arg Leu Val
Lys Leu Gln Gly Ala Val Ser Ser Glu Gln Gly Lys 180
185 190 Pro Leu Ala Asp Ile Ala Val Val Ala
Gly Ala Asn Arg Tyr Asp His 195 200
205 Ala Thr Arg Arg Ala Thr Pro Ile Ala Ala Gly Ala Arg Gly
Ala Ala 210 215 220
Ala Gly Ala Tyr Ala Ile Asp Gly Thr Ala Ala Gly Ala Met Tyr Gly 225
230 235 240 Lys His Ile Thr Leu
Val Ser Ser Asp Ser Gly Leu Gly Val Arg Gln 245
250 255 Leu Gly Ser Leu Ser Ser Pro Ser Ala Ile
Thr Val Ser Ser Gln Gly 260 265
270 Glu Ile Ala Leu Gly Asp Ala Thr Val Gln Arg Gly Pro Leu Ser
Leu 275 280 285 Lys
Gly Ala Gly Ala Val Ser Ala Gly Lys Leu Ala Ser Gly Gly Ala 290
295 300 Val Arg Val Ala Gly Gly
Gly Ala Val Lys Ile Ala Ser Ala Ser Ser 305 310
315 320 Val Gly Asn Leu Ala Val Gln Gly Gly Gly Lys
Val Gln Ala Thr Leu 325 330
335 Leu Asn Ala Gly Gly Thr Leu Gln Val Ser Gly Arg Gln Ala Val Gln
340 345 350 Leu Gly
Thr Ala Ser Ser Arg Gln Val Leu Ser Val Asn Ala Gly Gly 355
360 365 Ala Leu Lys Ala Asp Gln Leu
Ser Ala Thr Gly Arg Leu Glu Val Asp 370 375
380 Gly Lys Gln Ala Val Thr Leu Gly Ser Ala Ala Ser
Arg Asn Ala Leu 385 390 395
400 Ser Val Arg Ala Gly Gly Ala Leu Lys Ala Asp Lys Leu Ser Ala Thr
405 410 415 Gly Arg Leu
Glu Val Asp Gly Gln Gln Ala Val Thr Leu Gly Ser Ala 420
425 430 Ala Ser Gly Asp Ala Leu Ser Val
Ser Ala Gly Ala Ala Leu Arg Ala 435 440
445 Asp Lys Leu Ser Ala Thr Gly Arg Leu Asp Val Asp Gly
Lys Gln Ala 450 455 460
Val Thr Leu Gly Ser Ala Ala Ser Gly Asp Ala Leu Ser Val Ser Ala 465
470 475 480 Gly Ala Ala Leu
Arg Ala Asp Lys Leu Ser Ala Thr Arg Arg Leu Gly 485
490 495 Val Asp Gly Lys Gln Ala Val Thr Leu
Gly Ser Val Ala Ser Asp Gly 500 505
510 Ala Leu Ser Val Ser Ala Gly Gly Asn Leu Gln Ala Lys Gln
Leu Val 515 520 525
Ser Asn Ala Gly Leu Asp Val Arg Gly Gln Arg Glu Val Ser Leu Glu 530
535 540 Ala Ala Ser Ser Val
Arg Gly Met Thr Val Ala Ala Ala Gly Thr Leu 545 550
555 560 Ala Ala Arg Asn Leu Gln Ser Lys Gly Ala
Ile Arg Val Gln Gly Gly 565 570
575 Glu Ala Val Ser Val Ala Asn Ala Asn Ser Asp Ala Glu Leu His
Val 580 585 590 Ser
Gly Arg Gly Gln Val Asp Leu Gly Asp Leu Ser Ala Ala Arg Gly 595
600 605 Ala Asp Ile Thr Gly Glu
Gln Arg Val Ser Ile Gly Arg Ala His Ser 610 615
620 Asp Gly Asp Val Lys Val Ala Ala Arg Gly Ala
Leu Ser Ile Asp Ser 625 630 635
640 Met Thr Ala Leu Gly Ala Ile Gly Val Gln Ala Gly Asp Ser Val Ser
645 650 655 Ala Lys
Asp Met Arg Ser Arg Gly Ala Val Thr Val Ser Gly Gly Gly 660
665 670 Ser Val Asn Leu Gly Asp Val
Gln Ser Asp Gly Gln Val Arg Ala Thr 675 680
685 Ser Ala Gly Ala Met Thr Val Arg Asp Ala Ala Ala
Ala Ala Asp Leu 690 695 700
Ala Leu Gln Ala Gly Gly Ala Leu Gln Ala Gly Phe Leu Lys Ser Ala 705
710 715 720 Gly Ala Met
Thr Val Asn Gly Arg Asp Ala Val Arg Leu Asp Gly Ala 725
730 735 Gln Ala Gly Gly Gln Leu Arg Val
Ser Ser Asp Gly Gln Ala Ala Leu 740 745
750 Gly Ser Leu Ala Ala Lys Gly Ala Leu Thr Val Ser Ala
Ala Arg Ala 755 760 765
Ala Thr Val Ala Glu Leu Lys Ser Leu Asp Ser Ile Ser Val Thr Gly 770
775 780 Gly Glu Arg Val
Ser Val Gln Ser Val Asn Ser Ala Ser Arg Val Ala 785 790
795 800 Ile Ser Ala His Gly Ala Leu Glu Val
Gly Lys Val Ser Ala Lys Ser 805 810
815 Gly Ile Gly Ile Glu Gly Trp Gly Ala Val Ala Val Asp Ser
Leu Gly 820 825 830
Ser Asp Gly Ala Ile Ser Val Ser Gly Arg Asp Ala Val Arg Val Asp
835 840 845 His Ala Arg Ser
Leu Ala Asp Ile Ser Leu Gly Ala Glu Gly Gly Ala 850
855 860 Thr Leu Gly Ala Val Glu Ala Ala
Gly Ser Ile Asp Val Arg Gly Gly 865 870
875 880 Ser Thr Val Ala Ala Asn Ser Leu Arg Ala Asn Arg
Asp Val Arg Val 885 890
895 Ser Gly Lys Asp Ala Val Arg Val Thr Ala Ala Thr Ser Gly Gly Gly
900 905 910 Leu His Val
Ser Ser Gly Arg Gln Leu Asp Leu Gly Ala Val Gln Ala 915
920 925 Arg Gly Ala Leu Ala Leu Asp Gly
Gly Ala Gly Val Ala Leu Gln Ser 930 935
940 Ala Lys Ala Gly Gly Thr Leu His Val Gln Gly Gly Glu
His Leu Asp 945 950 955
960 Leu Gly Thr Leu Ala Ala Val Gly Ala Val Asp Val Asn Gly Thr Gly
965 970 975 Asp Val Arg Val
Ala Lys Leu Val Ser Asp Ala Gly Ala Asp Leu Gln 980
985 990 Ala Gly Arg Ser Met Thr Leu Gly
Thr Val Asp Thr Thr Gly Asp Leu 995 1000
1005 Gln Ala Arg Ala Gln Gln Ala Leu Glu Leu Gly
Ser Val Lys Thr 1010 1015 1020
Glu Gly Gly Leu Gln Ala Ala Ala Gly Gly Ala Leu Ser Leu Ala
1025 1030 1035 Ala Ala Glu
Val Ala Gly Ala Leu Glu Leu Ser Gly His Gly Val 1040
1045 1050 Thr Val Asp Arg Ala Ser Ala Gly
Arg Ala Arg Ile Asp Ser Thr 1055 1060
1065 Gly Ser Val Gly Ile Gly Ala Leu Lys Ala Gly Ala Val
Glu Ala 1070 1075 1080
Ala Ser Pro Arg Arg Ala Arg Arg Ala Leu Arg Gln Asp Phe Phe 1085
1090 1095 Thr Pro Gly Ser Val
Val Val Arg Ala Gln Gly Asn Val Thr Val 1100 1105
1110 Gly Arg Gly Asp Pro His Gln Gly Val Leu
Ala Gln Gly Asp Ile 1115 1120 1125
Val Met Asp Ala Lys Gly Gly Thr Leu Leu Leu Arg Asn Asp Val
1130 1135 1140 Leu Thr
Glu Asn Gly Thr Val Thr Ile Ser Ala Asp Ser Ala Val 1145
1150 1155 Leu Glu His Ser Thr Ile Glu
Ser Lys Ile Ser Gln Ser Ala Leu 1160 1165
1170 Ala Ala Lys Gly Asp Lys Gly Lys Pro Ala Val Ser
Val Lys Val 1175 1180 1185
Ala Lys Lys Leu Phe Leu Asn Gly Thr Leu Arg Ala Val Asn Asp 1190
1195 1200 Asn Glu Glu Thr Met
Pro Gly Arg Gln Ile Asp Val Val Asp Gly 1205 1210
1215 Arg Pro Gln Ile Thr Asp Ala Val Thr Gly
Glu Glu Arg Lys Asp 1220 1225 1230
Glu Ser Val Val Ser Asp Ala Ala Leu Val Ala Asp Gly Gly Pro
1235 1240 1245 Ile Val
Val Glu Ala Gly Glu Leu Val Ser His Ala Gly Gly Ile 1250
1255 1260 Gly Asn Gly Arg Asn Lys Gly
Asp Gly Ala Asp Val Thr Val Arg 1265 1270
1275 Thr Thr Gly Asn Val Met Asn Lys Gly Tyr Ile Ser
Ala Gly Lys 1280 1285 1290
Gln Gly Val Leu Glu Val Gly Gly Thr Leu Thr Asn Glu Phe Leu 1295
1300 1305 Val Gly Ser Asp Gly
Thr Gln Arg Val Glu Ala Gln Arg Ile Glu 1310 1315
1320 Asn Arg Gly Thr Phe Gln Ser Gln Ala Pro
Ala Gly Thr Ala Gly 1325 1330 1335
Ala Leu Val Val Lys Ala Ala Glu Ala Ile Val His Asp Gly Val
1340 1345 1350 Met Ala
Thr Glu Gly Glu Met Gln Ile Ala Gly Lys Gly Gly Gly 1355
1360 1365 Ser Pro Ala Val Thr Ala Gly
Ala Lys Ala Thr Thr Ser Ala Asn 1370 1375
1380 Lys Leu Ser Val Asp Val Ala Ser Trp Asp Asn Ala
Gly Ser Leu 1385 1390 1395
Asp Ile Lys Lys Gly Gly Ala Gln Val Thr Val Ala Gly Arg Tyr 1400
1405 1410 Ala Glu His Gly Lys
Val Ser Ile Gln Gly Asp Tyr Thr Val Ser 1415 1420
1425 Ala Asp Ala Ile Ala Leu Ala Ala Gln Val
Thr Gln Arg Gly Gly 1430 1435 1440
Ala Ala Asn Leu Thr Ser Arg His Asp Thr Arg Phe Ser Asn Asn
1445 1450 1455 Ile Arg
Leu Met Gly Pro Leu Gln Val Asn Ala Gly Gly Ala Val 1460
1465 1470 Ser Asn Thr Gly Asn Leu Lys
Val Arg Glu Gly Val Ser Val Thr 1475 1480
1485 Ala Ala Ser Phe Asp Asn Glu Ala Gly Ala Glu Val
Met Ala Lys 1490 1495 1500
Ser Ala Ala Leu Thr Thr Ser Gly Ala Val Arg Asn Ala Gly Lys 1505
1510 1515 Met Gln Val Lys Glu
Ala Ala Thr Ile Val Ala Ala Ser Val Ser 1520 1525
1530 Asn Pro Gly Thr Phe Thr Ala Gly Lys Asp
Leu Thr Val Thr Ser 1535 1540 1545
Arg Gly Gly Phe Asp Asn Asn Gly Lys Met Glu Ser Asn Lys Asp
1550 1555 1560 Ile Val
Ile Lys Ala Glu Gln Phe Ser Asn Ala Gly Val Leu Asp 1565
1570 1575 Ala Lys His Asp Leu Thr Val
Thr Ala Ser Gly Gln Ala Asp Asn 1580 1585
1590 Arg Gly Ser Leu Lys Ala Gly His Asp Phe Thr Val
Gln Ala Gln 1595 1600 1605
Arg Ile Asp Asn Ser Gly Thr Met Ala Ala Gly His Asp Ala Thr 1610
1615 1620 Leu Lys Ala Pro His
Leu Arg Asn Thr Gly Gln Ile Val Ala Gly 1625 1630
1635 His Asp Ile His Ile Ile Asn Ser Ala Lys
Leu Glu Asn Thr Gly 1640 1645 1650
Arg Val Asp Ala Arg Asn Asp Ile Ala Leu Asp Val Ala Asp Phe
1655 1660 1665 Thr Asn
Thr Gly Ser Leu Tyr Ala Glu His Asp Ala Thr Leu Thr 1670
1675 1680 Leu Ala Gln Gly Thr Gln Arg
Asp Leu Val Val Asp Gln Asp His 1685 1690
1695 Ile Leu Pro Val Ala Glu Gly Thr Leu Arg Val Lys
Ala Lys Ser 1700 1705 1710
Leu Thr Thr Glu Ile Glu Thr Gly Asn Pro Gly Ser Leu Ile Ala 1715
1720 1725 Glu Val Gln Glu Asn
Ile Asp Asn Lys Gln Ala Ile Val Val Gly 1730 1735
1740 Lys Asp Leu Thr Leu Ser Ser Ala His Gly
Asn Val Ala Asn Glu 1745 1750 1755
Ala Asn Ala Leu Leu Trp Ala Ala Gly Asp Leu Thr Val Lys Ala
1760 1765 1770 Gln Asn
Ile Thr Asn Glu Arg Ala Ala Leu Ile Glu Ala Gly Gly 1775
1780 1785 Asn Ala Arg Leu Thr Ala Ala
Val Ala Leu Leu Asn Lys Leu Gly 1790 1795
1800 Arg Ile Arg Ala Gly Glu Asp Met His Leu Asp Ala
Pro Arg Ile 1805 1810 1815
Glu Asn Thr Ala Lys Leu Ser Gly Glu Val Gln Arg Lys Gly Val 1820
1825 1830 Gln Asp Val Gly Gly
Gly Glu Tyr Gly Arg Trp Ser Gly Ile Gly 1835 1840
1845 Tyr Val Asn Tyr Trp Leu Arg Ala Gly Asn
Gly Lys Lys Ala Gly 1850 1855 1860
Thr Ile Ala Ala Pro Trp Tyr Gly Gly Asp Leu Thr Ala Glu Gln
1865 1870 1875 Ser Leu
Ile Glu Val Gly Lys Asp Leu Tyr Leu Asn Ala Gly Ala 1880
1885 1890 Arg Lys Asp Glu His Arg His
Leu Leu Asn Glu Gly Val Ile Gln 1895 1900
1905 Ala Gly Gly His Gly His Ile Gly Gly Asp Val Asp
Asn Arg Ser 1910 1915 1920
Val Val Arg Thr Val Ser Ala Met Glu Tyr Phe Lys Thr Pro Leu 1925
1930 1935 Pro Val Ser Leu Thr
Ala Leu Asp Asn Arg Ala Gly Leu Ser Pro 1940 1945
1950 Ala Thr Trp Asn Phe Asn Ser Thr Tyr Glu
Leu Leu Asp Tyr Leu 1955 1960 1965
Leu Asp Gln Asn Arg Tyr Glu Tyr Ile Trp Gly Val Tyr Pro Thr
1970 1975 1980 Tyr Thr
Glu Trp Ser Val Asn Thr Leu Lys Asn Leu Asn Leu Gly 1985
1990 1995 Tyr Gln Ala Lys Pro Ala Pro
Thr Ala Pro Pro Met Pro Lys Ala 2000 2005
2010 Pro Glu Leu Asp Leu Arg Gly His Thr Leu Glu Ser
Ala Glu Gly 2015 2020 2025
Arg Lys Ile Phe Ala Glu Tyr Lys Lys Gln Gln Gly Glu Tyr Glu 2030
2035 2040 Lys Ala Lys Thr Ala
Val Gln Ala Val Glu Ala Tyr Gly Glu Ala 2045 2050
2055 Thr Arg Arg Val His Asp Gln Leu Gly Gln
Arg Tyr Gly Lys Ala 2060 2065 2070
Leu Gly Gly Met Asp Ala Glu Thr Lys Glu Val Asp Gly Ile Ile
2075 2080 2085 Gln Ala
Phe Ala Ala Asp Leu Arg Thr Val Tyr Ala Lys Gln Ala 2090
2095 2100 Asp Gln Ala Ser Ile Asp Ala
Glu Thr Asp Lys Val Ala Gln Arg 2105 2110
2115 Tyr Lys Ser Gln Ile Asp Ala Val Arg Leu Glu Ala
Ile Gln Pro 2120 2125 2130
Gly Arg Val Met Leu Ala Lys Ala Leu Ser Ala Ala Leu Gly Ala 2135
2140 2145 Asp Trp Arg Ala Leu
Gly His Ala Glu Leu Met Gln Arg Trp Lys 2150 2155
2160 Asp Phe Lys Ala Gly Lys Arg Gly Ala Asn
Ile Ala Phe Tyr Pro 2165 2170 2175
Lys Glu Gln Thr Val Leu Ala Ala Gly Ala Gly Leu Thr Leu Ser
2180 2185 2190 Asn Gly
Ala Val His Asn Gly Glu Asn Ala Ala Gln Asn Arg Gly 2195
2200 2205 Arg Pro Glu Asn Leu Lys Ile
Gly Ala His Ser Ala Thr Ser Val 2210 2215
2220 Gly Gly Ser Phe Asp Ala Leu Arg Asp Val Gly Leu
Glu Lys Arg 2225 2230 2235
Leu Asp Ile Asp Asp Ala Leu Ala Ala Val Leu Val Asn Pro His 2240
2245 2250 Ile Phe Thr Arg Ile
Gly Ala Ala Gln Ala Ser Leu Ala Asp Gly 2255 2260
2265 Ala Ala Gly Pro Ala Leu Ala Arg Gln Ala
Arg Gln Ala Pro Gly 2270 2275 2280
Thr Asp Gly Met Val Asp Ala Arg Gly Leu Gly Ser Ala Asp Ala
2285 2290 2295 Leu Ala
Ser Leu Ala Ser Leu Asp Ala Ala Gln Gly Leu Glu Val 2300
2305 2310 Ser Gly Arg Arg Asn Ala Gln
Val Ala Asp Ala Arg Leu Ala Gly 2315 2320
2325 Pro Ser Ala Val Ala Ala Pro Ala Val Gly Ala Ala
Asp Val Gly 2330 2335 2340
Val Glu Pro Val Ala Gly Asp Gln Val Asp Gln Pro Val Val Ala 2345
2350 2355 Val Gly Phe Glu Gln
Pro Ala Ala Ala Val Arg Val Ala Pro Pro 2360 2365
2370 Ala Val Ala Leu Pro Arg Pro Leu Phe Glu
Thr Arg Ile Lys Phe 2375 2380 2385
Ile Asp Gln Ser Lys Phe Tyr Gly Ser Arg Tyr Phe Phe Glu Gln
2390 2395 2400 Ile Gly
Tyr Lys Pro Asp Arg Ala Ala Arg Val Ala Gly Asp Asn 2405
2410 2415 Tyr Phe Asp Thr Thr Leu Val
Arg Glu Gln Val Arg Arg Ala Leu 2420 2425
2430 Gly Gly Tyr Glu Ser Arg Leu Pro Val Arg Gly Val
Ala Leu Val 2435 2440 2445
Ala Lys Leu Met Asp Ser Ala Gly Thr Val Gly Lys Ala Leu Gly 2450
2455 2460 Leu Lys Val Gly Val
Ala Pro Thr Ala Gln Gln Leu Lys Gln Ala 2465 2470
2475 Asp Arg Asp Phe Val Trp Tyr Val Asp Thr
Val Ile Asp Gly Gln 2480 2485 2490
Lys Val Leu Ala Pro Arg Leu Tyr Leu Thr Glu Ala Thr Arg Gln
2495 2500 2505 Gly Ile
Thr Asp Gln Tyr Ala Gly Gly Gly Ala Leu Ile Ala Ser 2510
2515 2520 Gly Gly Asp Val Asn Val Asp
Thr Asn Gly His Asp Val Ser Ser 2525 2530
2535 Val Asn Gly Leu Ile Gln Gly Lys Arg Val Lys Val
Asp Ala Gly 2540 2545 2550
Lys Gly Arg Val Leu Val Ala Asp Ser Lys Gly Thr Gly Gly Gly 2555
2560 2565 Ile Glu Ala Asp Asp
Glu Val Asp Val Ser Ala Gln Asp Ile Asp 2570 2575
2580 Ile Glu Gly Gly Lys Leu Arg Gly Lys Asp
Val Lys Leu Lys Ala 2585 2590 2595
Asp Thr Val Lys Val Ala Thr Ser Met Arg Tyr Asp Asp Lys Gly
2600 2605 2610 Arg Leu
Ala Ala Arg Gly Asp Gly Ala Leu Asp Ala Gln Gly Gly 2615
2620 2625 Gln Leu His Ile Glu Ala Lys
Arg Leu Glu Thr Ala Gly Ala Thr 2630 2635
2640 Leu Lys Gly Ser Lys Val Lys Leu Asp Val Asp Asp
Val Lys Leu 2645 2650 2655
Gly Gly Val Tyr Glu Ala Gly Ser Ser Tyr Glu Asn Lys Ser Ser 2660
2665 2670 Thr Pro Leu Gly Ser
Leu Phe Ala Ile Leu Ser Ser Thr Thr Glu 2675 2680
2685 Thr Asn Gln Ser Ala Arg Ala Asn His Tyr
Gly Thr Arg Ile Ala 2690 2695 2700
Ala Gly Thr Leu Glu Gly Lys Met Gln Asn Leu Glu Ile Glu Gly
2705 2710 2715 Gly Ser
Val Glu Ala Ala His Thr Asp Leu Ser Val Ala Arg Asp 2720
2725 2730 Ala Ser Phe Lys Ala Ala Ala
Asp Phe Ala His Thr Glu His Glu 2735 2740
2745 Lys Asp Val Arg Gln Leu Ser Leu Gly Ala Lys Val
Gly Ala Gly 2750 2755 2760
Gly Tyr Glu Ala Gly Phe Ser Leu Gly Ser Glu Ser Gly Leu Glu 2765
2770 2775 Ala His Ala Gly Arg
Gly Met Thr Ala Gly Ala Glu Val Lys Val 2780 2785
2790 Gly Tyr Gln Ala Ser His Glu Gln Ser Ser
Glu Thr Glu Lys Ser 2795 2800 2805
Tyr Arg Asn Ala Asn Leu Asn Phe Gly Gly Gly Ser Val Glu Val
2810 2815 2820 Gly Asn
Val Leu Asp Ile Gly Gly Ala Asp Ile Asn Arg Asn Arg 2825
2830 2835 Tyr Gly Gly Ala Ala Lys Gly
Lys Ala Gly Ala Glu Glu Ala Leu 2840 2845
2850 Arg Met Arg Ala Lys Lys Val Glu Ser Thr Lys Tyr
Val Ser Glu 2855 2860 2865
Gln Thr Ser Gln Ser Ser Gly Trp Ser Val Glu Val Ala Ala Thr 2870
2875 2880 Ala Ser Ala Arg Ser
Ser Val Leu Thr Ala Ala Thr Arg Leu Gly 2885 2890
2895 Asp Ser Val Ala Gln Asn Val Glu Asp Gly
Arg Glu Ile Arg Gly 2900 2905 2910
Glu Leu Met Ala Ala Gln Val Ala Ala Glu Ala Thr Gln Leu Val
2915 2920 2925 Thr Ala
Asp Thr Ala Ala Val Ala Leu Ser Ala Gly Ile Ser Ala 2930
2935 2940 Asp Phe Asp Ser Ser His Ser
Arg Ser Thr Ser Gln Asn Thr Gln 2945 2950
2955 Tyr Leu Gly Gly Asn Leu Ser Ile Glu Ala Thr Glu
Gly Asp Ala 2960 2965 2970
Thr Leu Val Gly Ala Lys Phe Gly Gly Gly Asp Gln Val Ser Leu 2975
2980 2985 Lys Ala Ala Lys Asn
Val Asn Leu Met Ala Ala Glu Ser Thr Phe 2990 2995
3000 Glu Ser His Ser Glu Ser His Asn Phe His
Ala Ser Ala Asp Ala 3005 3010 3015
Asn Leu Gly Ala Asn Ala Val Gln Gly Ala Val Gly Leu Gly Leu
3020 3025 3030 Thr Ala
Gly Met Gly Thr Ser His Gln Ile Thr Asn Glu Thr Gly 3035
3040 3045 Lys Thr Tyr Ala Gly Thr Ser
Val Asp Ala Ala Asn Val Ser Ile 3050 3055
3060 Asp Ala Gly Lys Asp Leu Asn Leu Ser Gly Ser Arg
Val Arg Gly 3065 3070 3075
Lys His Val Val Leu Asp Val Glu Gly Asp Ile Asn Ala Thr Ser 3080
3085 3090 Lys Gln Asp Glu Arg
Asn Tyr Asn Ser Ser Gly Gly Gly Trp Asp 3095 3100
3105 Val Ser Ala Gly Val Ala Ile Gln Asn Arg
Thr Leu Val Ala Pro 3110 3115 3120
Val Gly Ser Ala Gly Phe Asn Phe Asn Thr Glu His Asp Asn Ser
3125 3130 3135 Arg Leu
Thr Asn Asp Gly Ala Ala Gly Val Val Ala Ser Asp Gly 3140
3145 3150 Leu Thr Gly His Val Lys Gly
Asp Ala Asn Leu Thr Gly Ala Thr 3155 3160
3165 Ile Ala Asp Leu Ser Asp Lys Gly Asn Leu Lys Val
Asp Gly Ala 3170 3175 3180
Val Asn Ala Gln Asn Leu Lys Asp Tyr Arg Asp Lys Asp Gly Gly 3185
3190 3195 Ser Gly Gly Leu Asn
Val Gly Ile Ser Ser Thr Thr Leu Ala Pro 3200 3205
3210 Thr Val Gly Val Ala Phe Gly Arg Val Ala
Gly Glu Asp Tyr Gln 3215 3220 3225
Ala Glu Gln Arg Ala Thr Ile Asp Val Gly Gln Ala Lys Asp Pro
3230 3235 3240 Ser Arg
Leu Gln Val Gly Gly Gly Val Lys Gly Thr Leu Asn Gln 3245
3250 3255 Asp Ala Ala Lys Ala Thr Val
Val Gln Arg Asn Lys His Trp Ala 3260 3265
3270 Gly Gly Gly Ser Glu Phe Ser Val Ala Gly Lys Ser
Leu Lys Lys 3275 3280 3285
Lys Asn Gln Val Arg Pro Val Glu Thr Pro Thr Pro Asp Ala Val 3290
3295 3300 Asp Gly Pro Pro Ser
Arg Pro Thr Thr Pro Pro Ala Ser Pro Gln 3305 3310
3315 Pro Ile Arg Ala Thr Val Glu Val Ser Ser
Pro Pro Pro Val Ser 3320 3325 3330
Val Ala Thr Val Glu Val Val Pro Arg Pro Lys Val Glu Thr Ala
3335 3340 3345 Gln Pro
Leu Pro Pro Arg Pro Val Pro Ala Lys Ala Val Pro Met 3350
3355 3360 Val Pro Pro Lys Val Glu Val
Ala Lys Val Glu Val Val Pro Arg 3365 3370
3375 Pro Lys Val Glu Thr Ala Gln Pro Leu Pro Pro Arg
Pro Val Pro 3380 3385 3390
Ala Lys Ala Val Pro Met Val Pro Pro Lys Val Glu Val Ala Lys 3395
3400 3405 Val Glu Val Val Pro
Arg Pro Lys Val Glu Thr Ala Gln Pro Leu 3410 3415
3420 Pro Pro Arg Pro Val Val Ala Glu Lys Val
Thr Thr Pro Ala Val 3425 3430 3435
Gln Pro Gln Leu Ala Lys Val Glu Thr Val Gln Pro Val Lys Pro
3440 3445 3450 Glu Thr
Ala Lys Pro Leu Pro Lys Pro Leu Pro Val Ala Lys Val 3455
3460 3465 Thr Glu Ala Pro Pro Pro Val
Met Glu Thr Ala Gln Pro Leu Pro 3470 3475
3480 Pro Val Lys Pro Gln Lys Ala Thr Pro Gly Pro Val
Ala Glu Val 3485 3490 3495
Gly Lys Ala Thr Val Thr Thr Val Gln Val Gln Ser Ala Pro Pro 3500
3505 3510 Lys Pro Ala Pro Val
Ala Lys Gln Pro Ala Pro Ala Pro Lys Pro 3515 3520
3525 Lys Pro Lys Ala Glu Arg Pro Lys Pro Gly
Lys Thr Thr Pro Leu 3530 3535 3540
Ser Gly Arg His Val Val Gln Gln Gln Val Gln Val Leu Gln Arg
3545 3550 3555 Gln Ala
Ser Asp Ile Asn Asn Thr Lys Ser Leu Pro Gly Gly Lys 3560
3565 3570 Leu Pro Lys Pro Val Thr Val
Lys Leu Thr Asp Glu Asn Gly Lys 3575 3580
3585 Pro Gln Thr Tyr Thr Ile Asn Arg Arg Glu Asp Leu
Met Lys Leu 3590 3595 3600
Asn Gly Lys Val Leu Ser Thr Lys Thr Thr Leu Gly Leu Glu Gln 3605
3610 3615 Thr Phe Arg Leu Arg
Val Glu Asp Ile Gly Gly Lys Asn Tyr Arg 3620 3625
3630 Val Phe Tyr Glu Thr Asn Lys 3635
3640 38210PRTBordetella pertussis 38Met Leu Pro Met Gln Ile
Pro Phe Gln Arg Ala Leu Arg Leu Cys Leu 1 5
10 15 Arg Ala Ala Leu Ala Ala Ile Ala Ser Ala Ala
His Ala Asp Asp Gly 20 25
30 Thr Ile Val Ile Thr Gly Thr Ile Thr Asp Thr Thr Cys Val Ile
Glu 35 40 45 Asp
Pro Ser Gly Pro Asn His Thr Lys Val Val Gln Leu Pro Lys Ile 50
55 60 Ser Lys Asn Ala Leu Lys
Ala Asn Gly Asp Gln Ala Gly Arg Thr Pro 65 70
75 80 Phe Ile Ile Lys Leu Lys Asp Cys Pro Ser Ser
Leu Gly Asn Gly Val 85 90
95 Lys Ala Tyr Phe Glu Pro Gly Pro Thr Thr Asp Tyr Ser Thr Gly Asp
100 105 110 Leu Arg
Ala Tyr Lys Met Val Tyr Ala Thr Asn Pro Gln Thr Gln Leu 115
120 125 Ser Asn Ile Thr Ala Ala Thr
Glu Ala Gln Gly Val Gln Val Arg Ile 130 135
140 Ser Asn Leu Asn Asp Ser Lys Ile Thr Met Gly Ala
Asn Glu Ala Thr 145 150 155
160 Gln Gln Ala Ala Gly Phe Asp Pro Glu Val Gln Thr Gly Gly Thr Ser
165 170 175 Arg Thr Val
Thr Met Arg Tyr Leu Ala Ser Tyr Val Lys Lys Asn Gly 180
185 190 Asp Val Glu Ala Ser Ala Ile Thr
Thr Tyr Val Gly Phe Ser Val Val 195 200
205 Tyr Pro 210 39204PRTBordetella pertussis 39Met
Ser Lys Phe Ser Tyr Pro Ala Leu Arg Ala Ala Leu Ile Leu Ala 1
5 10 15 Ala Ser Pro Val Leu Pro
Ala Leu Ala Asn Asp Gly Thr Ile Val Ile 20
25 30 Thr Gly Ser Ile Ser Asp Gln Thr Cys Val
Ile Glu Glu Pro Ser Thr 35 40
45 Leu Asn His Ile Lys Val Val Gln Leu Pro Lys Ile Ser Lys
Asn Ala 50 55 60
Leu Arg Asn Asp Gly Asp Thr Ala Gly Ala Thr Pro Phe Asp Ile Lys 65
70 75 80 Leu Lys Glu Cys Pro
Gln Ala Leu Gly Ala Leu Lys Leu Tyr Phe Glu 85
90 95 Pro Gly Ile Thr Thr Asn Tyr Asp Thr Gly
Asp Leu Ile Ala Tyr Lys 100 105
110 Gln Thr Tyr Asn Ala Ser Gly Asn Gly Asn Leu Ser Thr Val Ser
Ser 115 120 125 Ala
Thr Lys Ala Lys Gly Val Glu Phe Arg Leu Ala Asn Leu Asn Gly 130
135 140 Gln His Ile Arg Met Gly
Thr Asp Lys Thr Thr Gln Ala Ala Gln Thr 145 150
155 160 Phe Thr Gly Lys Val Thr Asn Gly Ser Lys Ser
Tyr Thr Leu Arg Tyr 165 170
175 Leu Ala Ser Tyr Val Lys Lys Pro Lys Glu Asp Val Asp Ala Ala Gln
180 185 190 Ile Thr
Ser Tyr Val Gly Phe Ser Val Val Tyr Pro 195 200
40209PRTBordetella bronchiseptica 40Met His Val Pro Ala Pro
Arg Arg Ala Val Leu Ala Ala Leu Leu Thr 1 5
10 15 Pro Ala Leu Phe Ala Pro Ala Ala Ala His Ala
Asn Asp Gly Thr Ile 20 25
30 Val Val Thr Gly Ala Ile Thr Asp Thr Thr Cys Val Val Glu Asp
Pro 35 40 45 Gly
Gly Pro Thr His Thr Lys Val Val Gln Leu Pro Lys Ile Ser Lys 50
55 60 Ser Ala Leu Ala Lys Asp
Gly Asp Glu Ala Gly Arg Thr Pro Phe Leu 65 70
75 80 Ile Thr Leu Lys Asp Cys Pro Thr Ser Leu Asn
Asn Gly Val Lys Ala 85 90
95 Tyr Phe Glu Pro Gly Pro Thr Thr Asp Tyr Val Thr Gly Asp Leu Lys
100 105 110 Ala Tyr
Ser Ile Ala Tyr Asn Asn Asn Pro Ala Thr Thr Gln Ser Ala 115
120 125 Ile Val Ala Ala Ala Glu Ala
Gln Gly Val Gln Ile Arg Ile Ser Asn 130 135
140 Gln Asn Gly Thr Lys Ile Pro Met Gly Ala Asp Ala
Ala Ala Gln Asn 145 150 155
160 Ala Gln Ala Phe Asp Pro Val Thr Asp Thr Ala Asn Asn Asn Lys Lys
165 170 175 Lys Val Thr
Leu Arg Tyr Leu Ala Ser Tyr Val Lys Lys Ala Gly Asn 180
185 190 Ile Thr Ala Gly Gln Val Thr Thr
Tyr Val Gly Phe Ser Met Val Tyr 195 200
205 Pro 41208PRTBordetella bronchiseptica 41Met Ser
Lys Phe Ser Tyr Pro Ala Leu Arg Thr Ala Leu Ile Leu Ala 1 5
10 15 Ala Ser Pro Val Leu Pro Ala
Leu Ala Asn Asp Gly Thr Ile Val Ile 20 25
30 Thr Gly Ser Ile Ser Asp Gln Thr Cys Val Ile Glu
Glu Pro Ser Ala 35 40 45
Pro Asn His Ile Lys Val Val Gln Leu Pro Lys Ile Ser Lys Ser Ala
50 55 60 Leu Arg Asn
Asp Gly Asp Thr Ala Gly Ala Thr Pro Phe Asp Ile Arg 65
70 75 80 Leu Lys Glu Cys Pro Gln Ala
Leu Gly Ala Leu Lys Leu Tyr Phe Glu 85
90 95 Pro Gly Ile Thr Thr Asn Tyr Asp Thr Gly Asp
Leu Ile Ala Tyr Lys 100 105
110 Gln Ala Tyr Asn Pro Ala Gly Asn Gly Asn Leu Ser Thr Val Ser
Ser 115 120 125 Ala
Thr Lys Ala Lys Gly Val Glu Phe Arg Leu Ala Asn Leu Asn Gly 130
135 140 Gln His Ile Arg Met Gly
Thr Asp Glu Thr Thr Gln Ala Ala Gln Thr 145 150
155 160 Phe Thr Gly Thr Glu Val Thr Asn Gly Gly Asn
Thr Thr Lys Ser Tyr 165 170
175 Thr Leu Arg Tyr Leu Ala Ser Tyr Val Lys Lys Pro Asn Glu Asp Val
180 185 190 Asp Ala
Ala Gln Ile Thr Ser Tyr Val Gly Phe Ser Val Val Tyr Pro 195
200 205 42910PRTBordetella
pertussis 42Met Asn Met Ser Leu Ser Arg Ile Val Lys Ala Ala Pro Leu Arg
Arg 1 5 10 15 Thr
Thr Leu Ala Met Ala Leu Gly Ala Leu Gly Ala Ala Pro Ala Ala
20 25 30 His Ala Asp Trp Asn
Asn Gln Ser Ile Val Lys Thr Gly Glu Arg Gln 35
40 45 His Gly Ile His Ile Gln Gly Ser Asp
Pro Gly Gly Val Arg Thr Ala 50 55
60 Ser Gly Thr Thr Ile Lys Val Ser Gly Arg Gln Ala Gln
Gly Ile Leu 65 70 75
80 Leu Glu Asn Pro Ala Ala Glu Leu Gln Phe Arg Asn Gly Ser Val Thr
85 90 95 Ser Ser Gly Gln
Leu Ser Asp Asp Gly Ile Arg Arg Phe Leu Gly Thr 100
105 110 Val Thr Val Lys Ala Gly Lys Leu Val
Ala Asp His Ala Thr Leu Ala 115 120
125 Asn Val Gly Asp Thr Trp Asp Asp Asp Gly Ile Ala Leu Tyr
Val Ala 130 135 140
Gly Glu Gln Ala Gln Ala Ser Ile Ala Asp Ser Thr Leu Gln Gly Ala 145
150 155 160 Gly Gly Val Gln Ile
Glu Arg Gly Ala Asn Val Thr Val Gln Arg Ser 165
170 175 Ala Ile Val Asp Gly Gly Leu His Ile Gly
Ala Leu Gln Ser Leu Gln 180 185
190 Pro Glu Asp Leu Pro Pro Ser Arg Val Val Leu Arg Asp Thr Asn
Val 195 200 205 Thr
Ala Val Pro Ala Ser Gly Ala Pro Ala Ala Val Ser Val Leu Gly 210
215 220 Ala Ser Glu Leu Thr Leu
Asp Gly Gly His Ile Thr Gly Gly Arg Ala 225 230
235 240 Ala Gly Val Ala Ala Met Gln Gly Ala Val Val
His Leu Gln Arg Ala 245 250
255 Thr Ile Arg Arg Gly Asp Ala Pro Ala Gly Gly Ala Val Pro Gly Gly
260 265 270 Ala Val
Pro Gly Gly Ala Val Pro Gly Gly Phe Gly Pro Gly Gly Phe 275
280 285 Gly Pro Val Leu Asp Gly Trp
Tyr Gly Val Asp Val Ser Gly Ser Ser 290 295
300 Val Glu Leu Ala Gln Ser Ile Val Glu Ala Pro Glu
Leu Gly Ala Ala 305 310 315
320 Ile Arg Val Gly Arg Gly Ala Arg Val Thr Val Ser Gly Gly Ser Leu
325 330 335 Ser Ala Pro
His Gly Asn Val Ile Glu Thr Gly Gly Ala Arg Arg Phe 340
345 350 Ala Pro Gln Ala Ala Pro Leu Ser
Ile Thr Leu Gln Ala Gly Ala His 355 360
365 Ala Gln Gly Lys Ala Leu Leu Tyr Arg Val Leu Pro Glu
Pro Val Lys 370 375 380
Leu Thr Leu Thr Gly Gly Ala Asp Ala Gln Gly Asp Ile Val Ala Thr 385
390 395 400 Glu Leu Pro Ser
Ile Pro Gly Thr Ser Ile Gly Pro Leu Asp Val Ala 405
410 415 Leu Ala Ser Gln Ala Arg Trp Thr Gly
Ala Thr Arg Ala Val Asp Ser 420 425
430 Leu Ser Ile Asp Asn Ala Thr Trp Val Met Thr Asp Asn Ser
Asn Val 435 440 445
Gly Ala Leu Arg Leu Ala Ser Asp Gly Ser Val Asp Phe Gln Gln Pro 450
455 460 Ala Glu Ala Gly Arg
Phe Lys Val Leu Thr Val Asn Thr Leu Ala Gly 465 470
475 480 Ser Gly Leu Phe Arg Met Asn Val Phe Ala
Asp Leu Gly Leu Ser Asp 485 490
495 Lys Leu Val Val Met Gln Asp Ala Ser Gly Gln His Arg Leu Trp
Val 500 505 510 Arg
Asn Ser Gly Ser Glu Pro Ala Ser Ala Asn Thr Leu Leu Leu Val 515
520 525 Gln Thr Pro Leu Gly Ser
Ala Ala Thr Phe Thr Leu Ala Asn Lys Asp 530 535
540 Gly Lys Val Asp Ile Gly Thr Tyr Arg Tyr Arg
Leu Ala Ala Asn Gly 545 550 555
560 Asn Gly Gln Trp Ser Leu Val Gly Ala Lys Ala Pro Pro Ala Pro Lys
565 570 575 Pro Ala
Pro Gln Pro Gly Pro Gln Pro Pro Gln Pro Pro Gln Pro Gln 580
585 590 Pro Glu Ala Pro Ala Pro Gln
Pro Pro Ala Gly Arg Glu Leu Ser Ala 595 600
605 Ala Ala Asn Ala Ala Val Asn Thr Gly Gly Val Gly
Leu Ala Ser Thr 610 615 620
Leu Trp Tyr Ala Glu Ser Asn Ala Leu Ser Lys Arg Leu Gly Glu Leu 625
630 635 640 Arg Leu Asn
Pro Asp Ala Gly Gly Ala Trp Gly Arg Gly Phe Ala Gln 645
650 655 Arg Gln Gln Leu Asp Asn Arg Ala
Gly Arg Arg Phe Asp Gln Lys Val 660 665
670 Ala Gly Phe Glu Leu Gly Ala Asp His Ala Val Ala Val
Ala Gly Gly 675 680 685
Arg Trp His Leu Gly Gly Leu Ala Gly Tyr Thr Arg Gly Asp Arg Gly 690
695 700 Phe Thr Gly Asp
Gly Gly Gly His Thr Asp Ser Val His Val Gly Gly 705 710
715 720 Tyr Ala Thr Tyr Ile Ala Asp Ser Gly
Phe Tyr Leu Asp Ala Thr Leu 725 730
735 Arg Ala Ser Arg Leu Glu Asn Asp Phe Lys Val Ala Gly Ser
Asp Gly 740 745 750
Tyr Ala Val Lys Gly Lys Tyr Arg Thr His Gly Val Gly Ala Ser Leu
755 760 765 Glu Ala Gly Arg
Arg Phe Thr His Ala Asp Gly Trp Phe Leu Glu Pro 770
775 780 Gln Ala Glu Leu Ala Val Phe Arg
Ala Gly Gly Gly Ala Tyr Arg Ala 785 790
795 800 Ala Asn Gly Leu Arg Val Arg Asp Glu Gly Gly Ser
Ser Val Leu Gly 805 810
815 Arg Leu Gly Leu Glu Val Gly Lys Arg Ile Glu Leu Ala Gly Gly Arg
820 825 830 Gln Val Gln
Pro Tyr Ile Lys Ala Ser Val Leu Gln Glu Phe Asp Gly 835
840 845 Ala Gly Thr Val His Thr Asn Gly
Ile Ala His Arg Thr Glu Leu Arg 850 855
860 Gly Thr Arg Ala Glu Leu Gly Leu Gly Met Ala Ala Ala
Leu Gly Arg 865 870 875
880 Gly His Ser Leu Tyr Ala Ser Tyr Glu Tyr Ser Lys Gly Pro Lys Leu
885 890 895 Ala Met Pro Trp
Thr Phe His Ala Gly Tyr Arg Tyr Ser Trp 900
905 910 43907PRTBordetella bronchiseptica 43Met Asn Met
Ser Leu Ser Arg Ile Val Lys Ala Ala Pro Leu Arg Arg 1 5
10 15 Thr Thr Leu Ala Met Ala Leu Gly
Ala Leu Gly Ala Ala Pro Ala Ala 20 25
30 His Ala Asp Trp Asn Asn Gln Ser Ile Val Lys Thr Gly
Glu Arg Gln 35 40 45
His Gly Ile His Ile Gln Gly Ser Asp Pro Gly Gly Val Arg Thr Ala 50
55 60 Ser Gly Thr Thr
Ile Lys Val Ser Gly Arg Gln Ala Gln Gly Ile Leu 65 70
75 80 Leu Glu Asn Pro Ala Ala Glu Leu Gln
Phe Arg Asn Gly Ser Val Thr 85 90
95 Ser Ser Gly Gln Leu Phe Asp Asp Gly Ile Arg Arg Phe Leu
Gly Thr 100 105 110
Val Thr Val Lys Ala Gly Lys Leu Val Ala Asp His Ala Thr Leu Ala
115 120 125 Asn Val Gly Asp
Thr Trp Asp Asp Asp Gly Ile Ala Leu Tyr Val Ala 130
135 140 Gly Glu Gln Ala Gln Ala Ser Ile
Ala Asp Ser Thr Leu Gln Gly Ala 145 150
155 160 Gly Gly Val Gln Val Glu Arg Gly Ala Asn Val Thr
Val Gln Arg Ser 165 170
175 Ala Ile Val Asp Gly Gly Leu His Ile Gly Ala Leu Gln Ser Leu Gln
180 185 190 Pro Glu Asp
Leu Pro Pro Ser Arg Val Val Leu Arg Asp Thr Asn Val 195
200 205 Thr Ala Val Pro Ala Ser Gly Ala
Pro Ala Ala Val Ser Val Leu Gly 210 215
220 Ala Ser Glu Leu Thr Leu Asp Gly Gly His Ile Thr Gly
Gly Arg Ala 225 230 235
240 Ala Gly Val Ala Ala Met Gln Gly Ala Val Val His Leu Gln Arg Ala
245 250 255 Thr Ile Arg Arg
Gly Asp Ala Pro Ala Gly Gly Gly Val Pro Gly Gly 260
265 270 Ala Val Pro Gly Gly Phe Gly Pro Gly
Gly Phe Gly Pro Val Leu Asp 275 280
285 Gly Trp Tyr Gly Val Asp Val Ser Gly Ser Ser Val Glu Leu
Ala Gln 290 295 300
Ser Ile Val Glu Ala Pro Glu Leu Gly Ala Ala Ile Arg Val Gly Arg 305
310 315 320 Gly Ala Arg Val Thr
Val Ser Gly Gly Ser Leu Ser Ala Pro His Gly 325
330 335 Asn Val Ile Glu Thr Gly Gly Ala Arg Arg
Phe Ala Pro Gln Ala Ala 340 345
350 Pro Leu Ser Ile Thr Leu Gln Ala Gly Ala His Ala Gln Gly Lys
Ala 355 360 365 Leu
Leu Tyr Arg Val Leu Pro Glu Pro Val Lys Leu Thr Leu Thr Gly 370
375 380 Gly Ala Asp Ala Gln Gly
Asp Ile Val Ala Thr Glu Leu Pro Pro Ile 385 390
395 400 Pro Gly Thr Ser Ser Gly Pro Leu Asp Val Ala
Leu Ala Ser Gln Ala 405 410
415 Arg Trp Thr Gly Ala Thr Arg Ala Val Asp Ala Leu Ser Ile Asp Asn
420 425 430 Ala Thr
Trp Val Met Thr Asp Asn Ser Asn Val Gly Ala Leu Arg Leu 435
440 445 Ala Ser Asp Gly Ser Val Asp
Phe Gln Gln Pro Ala Glu Ala Gly Arg 450 455
460 Phe Lys Val Leu Thr Val Asn Thr Leu Ala Gly Ser
Gly Leu Phe Arg 465 470 475
480 Met Asn Val Phe Ala Asp Leu Gly Leu Ser Asp Lys Leu Val Val Met
485 490 495 Gln Asp Ala
Ser Gly Gln His Arg Leu Trp Val Arg Asn Ser Gly Ser 500
505 510 Glu Pro Ala Ser Ala Asn Thr Leu
Leu Leu Val Gln Thr Pro Arg Gly 515 520
525 Ser Ala Ala Thr Phe Thr Leu Ala Asn Lys Asp Gly Lys
Val Asp Ile 530 535 540
Gly Thr Tyr Arg Tyr Arg Leu Ala Ala Asn Gly Asn Gly Gln Trp Ser 545
550 555 560 Leu Val Gly Ala
Lys Ala Pro Pro Ala Pro Lys Pro Ala Pro Gln Pro 565
570 575 Gly Pro Gln Pro Pro Gln Pro Pro Gln
Pro Gln Pro Gln Pro Glu Ala 580 585
590 Pro Ala Pro Gln Pro Pro Ala Gly Arg Glu Leu Ser Ala Ala
Ala Asn 595 600 605
Ala Ala Val Asn Thr Gly Gly Val Gly Leu Ala Ser Thr Leu Trp Tyr 610
615 620 Ala Glu Ser Asn Ala
Leu Ser Lys Arg Leu Gly Glu Leu Arg Leu Asn 625 630
635 640 Pro Asp Ala Gly Gly Ala Trp Gly Arg Gly
Phe Ala Gln Arg Gln Gln 645 650
655 Leu Asp Asn Arg Ala Gly Arg Arg Phe Asp Gln Lys Val Ala Gly
Phe 660 665 670 Glu
Leu Gly Ala Asp His Ala Val Ala Val Ala Gly Gly Arg Trp His 675
680 685 Leu Gly Gly Leu Ala Gly
Tyr Thr Arg Gly Asp Arg Gly Phe Thr Gly 690 695
700 Asp Gly Gly Gly His Thr Asp Ser Val His Val
Gly Gly Tyr Ala Thr 705 710 715
720 Tyr Ile Ala Asn Ser Gly Phe Tyr Leu Asp Ala Thr Leu Arg Ala Ser
725 730 735 Arg Leu
Glu Asn Asp Phe Lys Val Ala Gly Ser Asp Gly Tyr Ala Val 740
745 750 Lys Gly Lys Tyr Arg Thr His
Gly Val Gly Ala Ser Leu Glu Ala Gly 755 760
765 Arg Arg Phe Ser His Ala Asp Gly Trp Phe Leu Glu
Pro Gln Ala Glu 770 775 780
Leu Ala Val Phe Arg Ala Gly Gly Gly Ala Tyr Arg Ala Ala Asn Gly 785
790 795 800 Leu Arg Val
Arg Asp Glu Gly Gly Asn Ser Val Leu Gly Arg Leu Gly 805
810 815 Leu Glu Val Gly Lys Arg Ile Glu
Leu Ala Gly Gly Arg Gln Val Gln 820 825
830 Pro Tyr Ile Lys Ala Ser Val Leu Gln Glu Phe Asp Gly
Ala Gly Thr 835 840 845
Val Arg Thr Asn Gly Ile Ala His Arg Thr Glu Leu Arg Gly Thr Arg 850
855 860 Ala Glu Leu Gly
Leu Gly Met Ala Ala Ala Leu Gly Arg Gly His Ser 865 870
875 880 Leu Tyr Ala Ser Tyr Glu Tyr Ser Lys
Gly Pro Lys Leu Ala Met Pro 885 890
895 Trp Thr Phe His Ala Gly Tyr Arg Tyr Ser Trp
900 905 441706PRTBordetella bronchiseptica 44Met
Gln Gln Ser His Gln Ala Gly Tyr Ala Asn Ala Ala Asp Arg Glu 1
5 10 15 Ser Gly Ile Pro Ala Ala
Val Leu Asp Gly Ile Lys Ala Val Ala Lys 20
25 30 Glu Lys Asn Ala Thr Leu Met Phe Arg Leu
Val Asn Pro His Ser Thr 35 40
45 Ser Leu Ile Ala Glu Gly Val Ala Thr Lys Gly Leu Gly Val
His Ala 50 55 60
Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile Pro Val Asn Pro 65
70 75 80 Asn Leu Ser Lys Leu
Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala 85
90 95 Asn Asn Asp Val Asn Ser Ser Leu Ala His
Gly His Thr Ala Val Asp 100 105
110 Leu Thr Leu Ser Lys Glu Arg Leu Asp Tyr Leu Arg Gln Ala Gly
Leu 115 120 125 Val
Thr Gly Met Ala Asp Asp Val Val Ala Ser Asn His Ala Gly Tyr 130
135 140 Glu Gln Phe Glu Phe Arg
Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145 150
155 160 Val Gln Tyr Arg Arg Lys Gly Gly Asp Asp Phe
Glu Ala Val Lys Val 165 170
175 Ile Gly Asn Ala Ala Gly Ile Pro Leu Thr Ala Asp Ile Asp Met Phe
180 185 190 Ala Ile
Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg Ser Ser 195
200 205 Val Thr Ser Gly Asp Ser Val
Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210 215
220 Ala Ala Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu
Arg Ile Asp Leu 225 230 235
240 Leu Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser Ala Val Gly Thr Glu
245 250 255 Ala Arg Arg
Gln Phe Arg Tyr Asp Gly Glu Met Asn Ile Gly Val Ile 260
265 270 Thr Asp Phe Glu Leu Glu Val Arg
Asn Ala Leu Asn Arg Arg Ala His 275 280
285 Ala Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu
Gln Asn Asn 290 295 300
Pro Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val Ser Ala Thr Gly 305
310 315 320 Glu Ser Gln Met
Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln 325
330 335 Gln Arg Gly Glu Gly Tyr Val Phe Tyr
Glu Asn Arg Ala Tyr Gly Val 340 345
350 Ala Gly Lys Ser Leu Phe Asp Asp Gly Leu Gly Thr Ala Pro
Gly Val 355 360 365
Pro Ser Gly Arg Ser Lys Ser Ser Pro Asp Val Leu Glu Thr Val Pro 370
375 380 Ala Ser Pro Gly Leu
Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln 385 390
395 400 Asp Ser Gly Tyr Asp Ser Leu Asp Gly Val
Gly Ser Arg Ser Phe Ser 405 410
415 Leu Gly Glu Val Ser Asp Met Ala Ala Val Glu Ala Val Glu Leu
Glu 420 425 430 Met
Thr Arg Gln Val Leu His Ala Gly Ala Pro Gln Asp Asp Ala Glu 435
440 445 Pro Gly Val Ser Gly Ala
Ser Ala Leu Trp Gly Gln Arg Ser Leu Lys 450 455
460 Gly Val Gln Ala Val Ala Ala Ala Gln Arg Leu
Val His Ala Ile Ala 465 470 475
480 Leu Met Thr Gln Phe Gly Arg Ala Gly Ser Thr Asn Thr Pro Gln Glu
485 490 495 Ala Ala
Ser Leu Ser Ala Ala Val Phe Gly Leu Gly Glu Ala Ser Ser 500
505 510 Ala Val Ala Glu Thr Val Ser
Gly Phe Phe Arg Gly Ser Ser Arg Trp 515 520
525 Ala Gly Gly Phe Gly Val Ala Gly Gly Ala Met Ala
Leu Gly Gly Gly 530 535 540
Ile Ala Ala Ala Val Gly Ala Gly Met Ser Leu Thr Asp Asp Ala Pro 545
550 555 560 Ala Gly Gln
Lys Ala Ala Ala Gly Ala Glu Ile Ala Leu Gln Leu Thr 565
570 575 Gly Gly Thr Val Glu Leu Ala Ser
Ser Ile Ala Leu Ala Leu Ala Ala 580 585
590 Ala Arg Gly Val Thr Ser Gly Leu Gln Val Ala Gly Ala
Ser Ala Gly 595 600 605
Ala Ala Ala Gly Ala Leu Ala Ala Ala Leu Ser Pro Met Glu Ile Tyr 610
615 620 Gly Leu Val Gln
Gln Ser His Tyr Ala Asp Gln Leu Asp Lys Leu Ala 625 630
635 640 Gln Glu Ser Ser Ala Tyr Gly Tyr Glu
Gly Asp Ala Leu Leu Ala Gln 645 650
655 Leu Tyr Arg Asp Lys Thr Ala Ala Glu Gly Ala Val Ala Gly
Val Ser 660 665 670
Ala Val Leu Ser Thr Val Gly Ala Ala Val Ser Ile Ala Ala Ala Ala
675 680 685 Ser Val Val Gly
Ala Pro Val Ala Val Val Thr Ser Leu Leu Thr Gly 690
695 700 Ala Leu Asn Gly Ile Leu Arg Gly
Val Gln Gln Pro Ile Ile Glu Lys 705 710
715 720 Leu Ala Asn Asp Tyr Ala Arg Lys Ile Asp Glu Leu
Gly Gly Pro Gln 725 730
735 Ala Tyr Phe Glu Lys Asn Leu Gln Ala Arg His Glu Gln Leu Ala Asn
740 745 750 Ser Asp Gly
Leu Arg Lys Met Leu Ala Asp Leu Gln Ala Gly Trp Asn 755
760 765 Ala Ser Ser Val Ile Gly Val Gln
Thr Thr Glu Ile Ser Lys Ser Ala 770 775
780 Leu Glu Leu Ala Ala Ile Thr Gly Asn Ala Asp Asn Leu
Lys Ser Val 785 790 795
800 Asp Val Phe Val Asp Arg Phe Val Gln Gly Glu Arg Val Ala Gly Gln
805 810 815 Pro Val Val Leu
Asp Val Ala Ala Gly Gly Ile Asp Ile Ala Ser Arg 820
825 830 Lys Gly Glu Arg Pro Ala Leu Thr Phe
Ile Thr Pro Leu Ala Ala Pro 835 840
845 Gly Glu Glu Gln Arg Arg Arg Thr Lys Thr Gly Lys Ser Glu
Phe Thr 850 855 860
Thr Phe Val Glu Ile Val Gly Lys Gln Asp Arg Trp Arg Ile Arg Asp 865
870 875 880 Gly Ala Ala Asp Thr
Thr Ile Asp Leu Ala Lys Val Val Ser Gln Leu 885
890 895 Val Asp Ala Asn Gly Val Leu Lys His Ser
Ile Lys Leu Asp Val Ile 900 905
910 Gly Gly Asp Gly Asp Asp Val Val Leu Ala Asn Ala Ser Arg Ile
His 915 920 925 Tyr
Asp Gly Gly Ala Gly Thr Asn Thr Val Ser Tyr Ala Ala Leu Gly 930
935 940 Arg Gln Asp Ser Ile Thr
Val Ser Ala Asp Gly Glu Arg Phe Asn Val 945 950
955 960 Arg Lys Gln Leu Asn Asn Ala Asn Val Tyr Arg
Glu Gly Val Ala Thr 965 970
975 Gln Thr Thr Ala Tyr Gly Lys Arg Thr Glu Asn Val Gln Tyr Arg His
980 985 990 Val Glu
Leu Ala Arg Val Gly Gln Leu Val Glu Val Asp Thr Leu Glu 995
1000 1005 His Val Gln His Ile
Ile Gly Gly Ala Gly Asn Asp Ser Ile Thr 1010 1015
1020 Gly Asn Ala His Asp Asn Phe Leu Ala Gly
Gly Ser Gly Asp Asp 1025 1030 1035
Arg Leu Asp Gly Gly Ala Gly Asn Asp Thr Leu Val Gly Gly Glu
1040 1045 1050 Gly Gln
Asn Thr Val Ile Gly Gly Ala Gly Asp Asp Val Phe Leu 1055
1060 1065 Gln Asp Leu Gly Val Trp Ser
Asn Gln Leu Asp Gly Gly Ala Gly 1070 1075
1080 Val Asp Thr Val Lys Tyr Asn Val His Gln Pro Ser
Glu Glu Arg 1085 1090 1095
Leu Glu Arg Met Gly Asp Thr Gly Ile His Ala Asp Leu Gln Lys 1100
1105 1110 Gly Thr Val Glu Lys
Trp Pro Ala Leu Asn Leu Phe Ser Val Asp 1115 1120
1125 His Val Lys Asn Ile Glu Asn Leu His Gly
Ser Arg Leu Asn Asp 1130 1135 1140
Arg Ile Ala Gly Asp Asp Arg Asp Asn Glu Leu Trp Gly His Asp
1145 1150 1155 Gly Asn
Asp Thr Ile Arg Gly Arg Gly Gly Asp Asp Ile Leu Arg 1160
1165 1170 Gly Gly Leu Gly Leu Asp Thr
Leu Tyr Gly Glu Asp Gly Asn Asp 1175 1180
1185 Ile Phe Leu Gln Asp Asp Glu Thr Val Ser Asp Asp
Ile Asp Gly 1190 1195 1200
Gly Ala Gly Leu Asp Thr Val Asp Tyr Ser Ala Met Ile His Pro 1205
1210 1215 Gly Arg Ile Val Ala
Pro His Glu Tyr Gly Phe Gly Ile Glu Ala 1220 1225
1230 Asp Leu Ser Arg Glu Trp Val Arg Lys Ala
Ser Ala Leu Gly Val 1235 1240 1245
Asp Tyr Tyr Asp Asn Val Arg Asn Val Glu Asn Val Ile Gly Thr
1250 1255 1260 Ser Met
Lys Asp Val Leu Ile Gly Asp Ala Gln Ala Asn Thr Leu 1265
1270 1275 Met Gly Gln Gly Gly Asp Asp
Thr Val Arg Gly Gly Asp Gly Asp 1280 1285
1290 Asp Leu Leu Phe Gly Gly Asp Gly Asn Asp Met Leu
Tyr Gly Asp 1295 1300 1305
Ala Gly Asn Asp Thr Leu Tyr Gly Gly Leu Gly Asp Asp Thr Leu 1310
1315 1320 Glu Gly Gly Ala Gly
Asn Asp Trp Phe Gly Gln Thr Gln Ala Arg 1325 1330
1335 Glu His Asp Val Leu Arg Gly Gly Asp Gly
Val Asp Thr Val Asp 1340 1345 1350
Tyr Ser Gln Thr Gly Ala His Ala Gly Ile Ala Ala Gly Arg Ile
1355 1360 1365 Gly Leu
Gly Ile Leu Ala Asp Leu Gly Ala Gly Arg Val Asp Lys 1370
1375 1380 Leu Gly Glu Ala Gly Ser Ser
Ala Tyr Asp Thr Val Ser Gly Ile 1385 1390
1395 Glu Asn Val Val Gly Thr Glu Leu Ala Asp Arg Ile
Thr Gly Asp 1400 1405 1410
Ala Gln Ala Asn Val Leu Arg Gly Ala Gly Gly Ala Asp Val Leu 1415
1420 1425 Ala Gly Gly Glu Gly
Asp Asp Val Leu Leu Gly Gly Asp Gly Asp 1430 1435
1440 Asp Gln Leu Ser Gly Asp Ala Gly Arg Asp
Arg Leu Tyr Gly Glu 1445 1450 1455
Ala Gly Asp Asp Trp Phe Phe Gln Asp Ala Ala Asn Ala Gly Asn
1460 1465 1470 Leu Leu
Asp Gly Gly Asp Gly Arg Asp Thr Val Asp Phe Ser Gly 1475
1480 1485 Pro Gly Arg Gly Leu Asp Ala
Gly Ala Lys Gly Val Phe Leu Ser 1490 1495
1500 Leu Gly Lys Gly Phe Ala Ser Leu Met Asp Glu Pro
Glu Thr Ser 1505 1510 1515
Asn Val Leu Arg His Ile Glu Asn Ala Val Gly Ser Ala Arg Asp 1520
1525 1530 Asp Val Leu Ile Gly
Asp Ala Gly Ala Asn Val Leu Asn Gly Leu 1535 1540
1545 Ala Gly Asn Asp Val Leu Ser Gly Gly Ala
Gly Asp Asp Val Leu 1550 1555 1560
Leu Gly Asp Glu Gly Ser Asp Leu Leu Ser Gly Asp Ala Gly Asn
1565 1570 1575 Asp Asp
Leu Phe Gly Gly Gln Gly Asp Asp Thr Tyr Leu Phe Gly 1580
1585 1590 Val Gly Tyr Gly His Asp Thr
Ile Tyr Glu Ser Gly Gly Gly His 1595 1600
1605 Asp Thr Ile Arg Ile Asn Ala Gly Ala Asp Gln Leu
Trp Phe Ala 1610 1615 1620
Arg Gln Gly Asn Asp Leu Glu Ile Arg Ile Leu Gly Thr Asp Asp 1625
1630 1635 Ala Leu Thr Val His
Asp Trp Tyr Arg Asp Ala Asp His Arg Val 1640 1645
1650 Glu Ala Ile His Ala Ala Asn Gln Ala Val
Asp Pro Ala Gly Ile 1655 1660 1665
Glu Lys Leu Val Glu Ala Met Ala Gln Tyr Pro Asp Pro Gly Ala
1670 1675 1680 Ala Ala
Ala Ala Pro Pro Ala Ala Arg Val Pro Asp Thr Leu Met 1685
1690 1695 Gln Ser Leu Ala Val Asn Trp
Arg 1700 1705 45400PRTBordetella bronchiseptica
45Met Gln Gln Ser His Gln Ala Gly Tyr Ala Asn Ala Ala Asp Arg Glu 1
5 10 15 Ser Gly Ile Pro
Ala Ala Val Leu Asp Gly Ile Lys Ala Val Ala Lys 20
25 30 Glu Lys Asn Ala Thr Leu Met Phe Arg
Leu Val Asn Pro His Ser Thr 35 40
45 Ser Leu Ile Ala Glu Gly Val Ala Thr Lys Gly Leu Gly Val
His Ala 50 55 60
Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile Pro Val Asn Pro 65
70 75 80 Asn Leu Ser Lys Leu
Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala 85
90 95 Asn Asn Asp Val Asn Ser Ser Leu Ala His
Gly His Thr Ala Val Asp 100 105
110 Leu Thr Leu Ser Lys Glu Arg Leu Asp Tyr Leu Arg Gln Ala Gly
Leu 115 120 125 Val
Thr Gly Met Ala Asp Asp Val Val Ala Ser Asn His Ala Gly Tyr 130
135 140 Glu Gln Phe Glu Phe Arg
Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145 150
155 160 Val Gln Tyr Arg Arg Lys Gly Gly Asp Asp Phe
Glu Ala Val Lys Val 165 170
175 Ile Gly Asn Ala Ala Gly Ile Pro Leu Thr Ala Asp Ile Asp Met Phe
180 185 190 Ala Ile
Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg Ser Ser 195
200 205 Val Thr Ser Gly Asp Ser Val
Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210 215
220 Ala Ala Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu
Arg Ile Asp Leu 225 230 235
240 Leu Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser Ala Val Gly Thr Glu
245 250 255 Ala Arg Arg
Gln Phe Arg Tyr Asp Gly Glu Met Asn Ile Gly Val Ile 260
265 270 Thr Asp Phe Glu Leu Glu Val Arg
Asn Ala Leu Asn Arg Arg Ala His 275 280
285 Ala Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu
Gln Asn Asn 290 295 300
Pro Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val Ser Ala Thr Gly 305
310 315 320 Glu Ser Gln Met
Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln 325
330 335 Gln Arg Gly Glu Gly Tyr Val Phe Tyr
Glu Asn Arg Ala Tyr Gly Val 340 345
350 Ala Gly Lys Ser Leu Phe Asp Asp Gly Leu Gly Thr Ala Pro
Gly Val 355 360 365
Pro Ser Gly Arg Ser Lys Ser Ser Pro Asp Val Leu Glu Thr Val Pro 370
375 380 Ala Ser Pro Gly Leu
Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln 385 390
395 400 46225PRTBordetella bronchiseptica 46Met
Gln Gln Ser His Gln Ala Gly Tyr Ala Asn Ala Ala Asp Arg Glu 1
5 10 15 Ser Gly Ile Pro Ala Ala
Val Leu Asp Gly Ile Lys Ala Val Ala Lys 20
25 30 Glu Lys Asn Ala Thr Leu Met Phe Arg Leu
Val Asn Pro His Ser Thr 35 40
45 Ser Leu Ile Ala Glu Gly Val Ala Thr Lys Gly Leu Gly Val
His Ala 50 55 60
Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile Pro Val Asn Pro 65
70 75 80 Asn Leu Ser Lys Leu
Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala 85
90 95 Asn Asn Asp Val Asn Ser Ser Leu Ala His
Gly His Thr Ala Val Asp 100 105
110 Leu Thr Leu Ser Lys Glu Arg Leu Asp Tyr Leu Arg Gln Ala Gly
Leu 115 120 125 Val
Thr Gly Met Ala Asp Asp Val Val Ala Ser Asn His Ala Gly Tyr 130
135 140 Glu Gln Phe Glu Phe Arg
Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145 150
155 160 Val Gln Tyr Arg Arg Lys Gly Gly Asp Asp Phe
Glu Ala Val Lys Val 165 170
175 Ile Gly Asn Ala Ala Gly Ile Pro Leu Thr Ala Asp Ile Asp Met Phe
180 185 190 Ala Ile
Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg Ser Ser 195
200 205 Val Thr Ser Gly Asp Ser Val
Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210 215
220 Ala 225 47175PRTBordetella bronchiseptica 47Ala
Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu Arg Ile Asp Leu Leu 1
5 10 15 Trp Lys Ile Ala Arg Ala
Gly Ala Arg Ser Ala Val Gly Thr Glu Ala 20
25 30 Arg Arg Gln Phe Arg Tyr Asp Gly Glu Met
Asn Ile Gly Val Ile Thr 35 40
45 Asp Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala
His Ala 50 55 60
Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu Gln Asn Asn Pro 65
70 75 80 Phe Pro Glu Ala Asp
Glu Lys Ile Phe Val Val Ser Ala Thr Gly Glu 85
90 95 Ser Gln Met Leu Thr Arg Gly Gln Leu Lys
Glu Tyr Ile Gly Gln Gln 100 105
110 Arg Gly Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val
Ala 115 120 125 Gly
Lys Ser Leu Phe Asp Asp Gly Leu Gly Thr Ala Pro Gly Val Pro 130
135 140 Ser Gly Arg Ser Lys Ser
Ser Pro Asp Val Leu Glu Thr Val Pro Ala 145 150
155 160 Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala
Val Glu Arg Gln 165 170
175 48400PRTBordetella bronchiseptica 48 Met Gln Gln Ser His Gln Ala Gly
Tyr Ala Asn Ala Ala Asp Arg Glu 1 5 10
15 Ser Gly Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala
Val Ala Lys 20 25 30
Glu Lys Asn Ala Thr Leu Met Phe Arg Leu Val Asn Pro His Ser Thr
35 40 45 Ser Leu Ile Ala
Glu Gly Val Ala Thr Lys Gly Leu Gly Val His Ala 50
55 60 Lys Ser Ser Asp Trp Gly Leu Gln
Ala Gly Tyr Ile Pro Val Asn Pro 65 70
75 80 Asn Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val
Ile Ala Arg Ala 85 90
95 Asn Asn Asp Val Asn Ser Ser Leu Ala His Gly His Thr Ala Val Asp
100 105 110 Leu Thr Leu
Ser Lys Glu Arg Leu Asp Tyr Leu Arg Gln Ala Gly Leu 115
120 125 Val Thr Gly Met Ala Asp Asp Val
Val Ala Ser Asn His Ala Gly Tyr 130 135
140 Glu Gln Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly
Arg Tyr Ala 145 150 155
160 Val Gln Tyr Arg Arg Lys Gly Gly Asp Asp Phe Glu Ala Val Lys Val
165 170 175 Ile Gly Asn Ala
Ala Gly Ile Pro Leu Thr Ala Cys Thr Asp Met Phe 180
185 190 Ala Ile Met Pro His Leu Ser Asn Phe
Arg Asp Ser Ala Arg Ser Ser 195 200
205 Val Thr Ser Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr
Arg Arg 210 215 220
Ala Ala Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu Arg Ile Asp Leu 225
230 235 240 Leu Trp Lys Ile Ala
Arg Ala Gly Ala Arg Ser Ala Val Gly Thr Glu 245
250 255 Ala Arg Arg Gln Phe Arg Tyr Asp Gly Glu
Met Asn Ile Gly Val Ile 260 265
270 Thr Asp Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala
His 275 280 285 Ala
Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu Gln Asn Asn 290
295 300 Pro Phe Pro Glu Ala Asp
Glu Lys Ile Phe Val Val Ser Ala Thr Gly 305 310
315 320 Glu Ser Gln Met Leu Thr Arg Gly Gln Leu Lys
Glu Tyr Ile Gly Gln 325 330
335 Gln Arg Gly Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val
340 345 350 Ala Gly
Lys Ser Leu Phe Asp Asp Gly Leu Gly Thr Ala Pro Gly Val 355
360 365 Pro Ser Gly Arg Ser Lys Ser
Ser Pro Asp Val Leu Glu Thr Val Pro 370 375
380 Ala Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala
Val Glu Arg Gln 385 390 395
400 491740PRTBordetella parapertussis 49Met Leu Asp Val Trp Phe Leu Gln
Lys Asp Glu Val Leu Ser Ala Thr 1 5 10
15 His Arg Leu Arg Arg Cys Glu Ser Val Gln Ser Thr Thr
Tyr Arg Gln 20 25 30
Ile His Met Gln Gln Ser His Gln Ala Gly Tyr Ala Asn Ala Ala Asp
35 40 45 Arg Glu Ser Gly
Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala Val 50
55 60 Ala Lys Glu Lys Asn Ala Thr Leu
Met Phe Arg Leu Val Asn Pro His 65 70
75 80 Ser Thr Ser Leu Ile Ala Glu Gly Val Ala Thr Lys
Gly Leu Gly Val 85 90
95 His Ala Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile Pro Val
100 105 110 Asn Pro Asn
Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val Ile Ala 115
120 125 Arg Ala Asp Asn Asp Val Asn Ser
Ser Leu Ala His Gly His Thr Ala 130 135
140 Val Asp Leu Thr Leu Ser Lys Glu Arg Leu Asp Tyr Leu
Arg Gln Ala 145 150 155
160 Gly Leu Val Thr Gly Met Ala Asp Gly Val Val Ala Ser Asn His Ala
165 170 175 Gly Tyr Glu Gln
Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly Arg 180
185 190 Tyr Ala Val Gln Tyr Arg Arg Lys Gly
Gly Asp Asp Phe Glu Ala Val 195 200
205 Lys Val Ile Gly Asn Ala Ala Gly Ile Pro Leu Thr Ala Asp
Ile Asp 210 215 220
Met Phe Ala Ile Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg 225
230 235 240 Ser Ser Val Thr Ser
Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr 245
250 255 Arg Arg Ala Ala Ser Glu Ala Thr Gly Gly
Leu Asp Arg Glu Arg Ile 260 265
270 Asp Leu Leu Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser Ala Val
Gly 275 280 285 Thr
Glu Ala Arg Arg Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly 290
295 300 Val Ile Thr Asp Phe Glu
Leu Glu Val Arg Asn Ala Leu Asn Arg Arg 305 310
315 320 Ala His Ala Val Gly Ala Gln Asp Val Val Gln
His Gly Thr Glu Gln 325 330
335 Asn Asn Pro Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val Ser Ala
340 345 350 Thr Gly
Glu Ser Gln Met Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile 355
360 365 Gly Gln Gln Arg Gly Glu Gly
Tyr Val Phe Tyr Glu Asn Arg Ala Tyr 370 375
380 Gly Val Ala Gly Lys Ser Leu Phe Asp Asp Gly Leu
Gly Ala Ala Pro 385 390 395
400 Gly Val Pro Gly Gly Arg Ser Lys Ser Ser Pro Asp Val Leu Glu Thr
405 410 415 Val Pro Ala
Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala Val Glu 420
425 430 Arg Gln Asp Ser Gly Tyr Asp Ser
Leu Asp Gly Val Gly Ser Arg Ser 435 440
445 Phe Ser Leu Gly Glu Val Ser Asp Met Ala Ala Val Glu
Ala Ala Glu 450 455 460
Leu Glu Met Thr Arg Gln Val Leu His Ala Gly Ala Arg Gln Asp Asp 465
470 475 480 Ala Glu Pro Gly
Val Ser Gly Ala Ser Ala His Trp Gly Gln Arg Ala 485
490 495 Leu Gln Gly Ala Gln Ala Val Ala Ala
Ala Gln Arg Leu Val His Ala 500 505
510 Ile Ala Leu Met Thr Gln Phe Gly Arg Ala Gly Ser Thr Asn
Thr Pro 515 520 525
Gln Glu Ala Ala Ser Leu Ser Ala Ala Val Phe Gly Leu Gly Glu Ala 530
535 540 Ser Ser Ala Val Ala
Glu Thr Val Ser Gly Phe Phe Arg Gly Ser Ser 545 550
555 560 Arg Trp Ala Gly Gly Phe Gly Val Ala Gly
Gly Ala Met Ala Leu Gly 565 570
575 Gly Gly Ile Ala Ala Ala Val Gly Ala Gly Met Ser Leu Thr Asp
Asp 580 585 590 Ala
Pro Ala Gly Gln Lys Ala Ala Val Gly Ala Glu Ile Ala Leu Gln 595
600 605 Leu Thr Gly Gly Thr Val
Glu Leu Ala Ser Ser Ile Ala Leu Ala Leu 610 615
620 Ala Ala Ala Arg Gly Val Thr Ser Gly Leu Gln
Val Ala Gly Ala Ser 625 630 635
640 Ala Gly Ala Ala Ala Gly Ala Leu Ala Ala Ala Leu Ser Pro Met Glu
645 650 655 Ile Tyr
Gly Leu Val Gln Gln Ser His Tyr Ala Asp Gln Leu Asp Lys 660
665 670 Leu Ala Gln Glu Ser Ser Ala
Tyr Gly Tyr Glu Gly Asp Ala Leu Leu 675 680
685 Ala Gln Leu Tyr Arg Asp Lys Thr Ala Ala Glu Gly
Ala Val Ala Gly 690 695 700
Val Ser Ala Val Leu Ser Thr Val Gly Ala Ala Val Ser Ile Ala Ala 705
710 715 720 Ala Ala Ser
Val Val Gly Ala Pro Val Ala Val Val Thr Ser Leu Leu 725
730 735 Thr Gly Ala Leu Asn Gly Ile Leu
Arg Gly Val Gln Gln Pro Ile Ile 740 745
750 Glu Lys Leu Ala Asn Asp Tyr Ala Arg Lys Ile Asp Glu
Leu Gly Gly 755 760 765
Pro Gln Ala Tyr Phe Glu Lys Asn Leu Gln Ala Arg His Glu Gln Leu 770
775 780 Ala Asn Ser Asp
Gly Leu Arg Lys Met Leu Ala Asp Leu Gln Ala Gly 785 790
795 800 Trp Asn Ala Ser Ser Val Ile Gly Val
Gln Thr Thr Glu Ile Ser Lys 805 810
815 Ser Ala Leu Glu Leu Ala Ala Ile Thr Gly Asn Ala Asp Asn
Leu Lys 820 825 830
Ser Ala Asp Val Phe Val Asp Arg Phe Ile Gln Gly Glu Arg Val Ala
835 840 845 Gly Gln Pro Val
Val Leu Asp Val Ala Ala Gly Gly Ile Asp Ile Ala 850
855 860 Ser Arg Lys Gly Glu Arg Pro Ala
Leu Thr Phe Ile Thr Pro Leu Ala 865 870
875 880 Ala Pro Gly Glu Glu Gln Arg Arg Arg Thr Lys Thr
Gly Lys Ser Glu 885 890
895 Phe Thr Thr Phe Val Glu Ile Val Gly Lys Gln Asp Arg Trp Arg Ile
900 905 910 Arg Asp Gly
Ala Ala Asp Thr Thr Ile Asp Leu Ala Lys Val Val Ser 915
920 925 Gln Leu Val Asp Ala Asn Gly Val
Leu Lys His Ser Ile Lys Leu Glu 930 935
940 Val Ile Gly Gly Asp Gly Asp Asp Val Val Leu Ala Asn
Ala Ser Arg 945 950 955
960 Ile His Tyr Asp Gly Gly Ala Gly Thr Asn Thr Val Ser Tyr Ala Ala
965 970 975 Leu Gly Arg Gln
Asp Ser Ile Thr Val Ser Ala Asp Gly Glu Arg Phe 980
985 990 Asn Val Arg Lys Gln Leu Asn Asn
Ala Asn Val Tyr Arg Glu Gly Val 995 1000
1005 Ala Thr Gln Lys Thr Ala Tyr Gly Lys Arg Thr
Glu Asn Val Gln 1010 1015 1020
Tyr Arg His Val Glu Leu Ala Arg Val Gly Gln Leu Val Glu Val
1025 1030 1035 Asp Thr Leu
Glu His Val Gln His Ile Ile Gly Gly Ala Gly Asn 1040
1045 1050 Asp Ser Ile Thr Gly Asn Ala His
Asp Asn Phe Leu Ala Gly Gly 1055 1060
1065 Ala Gly Asp Asp Arg Leu Asp Gly Gly Ala Gly Asn Asp
Thr Leu 1070 1075 1080
Val Gly Gly Glu Gly His Asn Thr Val Val Gly Gly Ala Gly Asp 1085
1090 1095 Asp Val Phe Leu Gln
Asp Leu Gly Val Trp Ser Asn Gln Leu Asp 1100 1105
1110 Gly Gly Ala Gly Val Asp Thr Val Lys Tyr
Asn Val His Gln Pro 1115 1120 1125
Ser Glu Glu Arg Leu Glu Arg Met Gly Asp Thr Gly Ile His Ala
1130 1135 1140 Asp Leu
Gln Lys Gly Thr Val Glu Lys Trp Pro Ala Leu Asn Leu 1145
1150 1155 Phe Ser Val Asp His Val Lys
Asn Ile Glu Asn Leu His Gly Ser 1160 1165
1170 Ser Leu Asn Asp Ser Ile Ala Gly Asp Asp Arg Asp
Asn Glu Leu 1175 1180 1185
Trp Gly Asp Asp Gly Asn Asp Thr Ile His Gly Arg Gly Gly Asp 1190
1195 1200 Asp Ile Leu Arg Gly
Gly Leu Gly Leu Asp Thr Leu Tyr Gly Glu 1205 1210
1215 Asp Gly Asn Asp Ile Phe Leu Gln Asp Asp
Glu Thr Val Ser Asp 1220 1225 1230
Asp Ile Asp Gly Gly Ala Gly Leu Asp Thr Val Asp Tyr Ser Ala
1235 1240 1245 Met Ile
His Ala Gly Lys Ile Val Ala Pro His Glu Tyr Gly Phe 1250
1255 1260 Gly Ile Glu Ala Asp Leu Ser
Glu Gly Trp Val Arg Lys Ala Ala 1265 1270
1275 Arg Arg Gly Met Gly Tyr Tyr Asp Ser Val Arg Ser
Val Glu Asn 1280 1285 1290
Val Ile Gly Thr Ser Met Lys Asp Val Leu Ile Gly Asp Ala Gln 1295
1300 1305 Ala Asn Thr Leu Met
Gly Gln Gly Gly Asp Asp Thr Val Arg Gly 1310 1315
1320 Gly Asp Gly Asp Asp Leu Leu Phe Gly Gly
Asp Gly Asn Asp Met 1325 1330 1335
Leu Tyr Gly Asp Ala Gly Asn Asp Thr Leu Tyr Gly Gly Leu Gly
1340 1345 1350 Asp Asp
Thr Leu Glu Gly Gly Ala Gly Asn Asp Trp Phe Gly Gln 1355
1360 1365 Thr Pro Ala Arg Glu His Asp
Val Leu Arg Gly Gly Ala Gly Val 1370 1375
1380 Asp Thr Val Asp Tyr Ser Gln Ala Gly Ala His Ala
Gly Val Ala 1385 1390 1395
Thr Gly Arg Ile Gly Leu Gly Ile Leu Ala Asp Leu Gly Ala Gly 1400
1405 1410 Arg Val Asp Lys Leu
Gly Glu Ala Gly Ser Ser Ala Tyr Asp Thr 1415 1420
1425 Val Ser Gly Ile Glu Asn Val Val Gly Thr
Glu Leu Ala Asp Arg 1430 1435 1440
Ile Thr Gly Asp Ala Gln Ala Asn Val Leu Arg Gly Ala Gly Gly
1445 1450 1455 Ala Asp
Val Leu Ala Gly Gly Glu Gly Asp Asp Val Leu Leu Gly 1460
1465 1470 Gly Glu Gly Asp Asp Gln Leu
Ser Gly Asp Ala Gly Arg Asp Arg 1475 1480
1485 Leu Tyr Gly Glu Ala Gly Asp Asp Trp Phe Phe Gln
Asp Ala Ala 1490 1495 1500
Asn Ala Gly Asn Leu Leu Asp Gly Gly Asp Gly Asn Asp Thr Val 1505
1510 1515 Asp Phe Ser Gly Pro
Gly Arg Gly Leu Asp Ala Gly Ala Lys Gly 1520 1525
1530 Val Phe Leu Ser Leu Gly Lys Gly Phe Ala
Ser Leu Met Asp Glu 1535 1540 1545
Pro Glu Thr Ser Asn Val Leu Arg His Ile Glu Asn Ala Val Gly
1550 1555 1560 Ser Val
Arg Asp Asp Val Leu Ile Gly Asp Ala Gly Ala Asn Val 1565
1570 1575 Leu Asn Gly Leu Ala Gly Asn
Asp Val Leu Ser Gly Gly Ala Gly 1580 1585
1590 Asp Asp Val Leu Leu Gly Asp Glu Gly Ser Asp Leu
Leu Ser Gly 1595 1600 1605
Asp Ala Gly Asn Asp Asp Leu Phe Gly Gly Gln Gly Asp Asp Thr 1610
1615 1620 Tyr Leu Phe Gly Ala
Gly Tyr Gly His Asp Thr Ile Tyr Glu Ser 1625 1630
1635 Gly Gly Gly His Asp Thr Ile Arg Ile Asn
Ala Gly Ala Asp Gln 1640 1645 1650
Leu Trp Phe Ala Arg Gln Gly Asn Asp Leu Glu Ile Arg Ile Leu
1655 1660 1665 Gly Thr
Asp Asp Ala Leu Thr Val His Asp Trp Tyr Arg Asp Ala 1670
1675 1680 Asp His Arg Val Glu Ala Ile
His Ala Ala Asn Gln Ala Ile Asp 1685 1690
1695 Pro Ala Gly Ile Glu Lys Leu Val Glu Ala Met Ala
Gln Tyr Pro 1700 1705 1710
Asp Pro Gly Ala Ala Ala Ala Ala Pro Pro Ala Ala Arg Val Pro 1715
1720 1725 Asp Thr Leu Met Gln
Ser Leu Ala Val Asn Trp Arg 1730 1735
1740 50400PRTBordetella parapertussis 50Met Gln Gln Ser His Gln Ala Gly
Tyr Ala Asn Ala Ala Asp Arg Glu 1 5 10
15 Ser Gly Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala
Val Ala Lys 20 25 30
Glu Lys Asn Ala Thr Leu Met Phe Arg Leu Val Asn Pro His Ser Thr
35 40 45 Ser Leu Ile Ala
Glu Gly Val Ala Thr Lys Gly Leu Gly Val His Ala 50
55 60 Lys Ser Ser Asp Trp Gly Leu Gln
Ala Gly Tyr Ile Pro Val Asn Pro 65 70
75 80 Asn Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val
Ile Ala Arg Ala 85 90
95 Asp Asn Asp Val Asn Ser Ser Leu Ala His Gly His Thr Ala Val Asp
100 105 110 Leu Thr Leu
Ser Lys Glu Arg Leu Asp Tyr Leu Arg Gln Ala Gly Leu 115
120 125 Val Thr Gly Met Ala Asp Gly Val
Val Ala Ser Asn His Ala Gly Tyr 130 135
140 Glu Gln Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly
Arg Tyr Ala 145 150 155
160 Val Gln Tyr Arg Arg Lys Gly Gly Asp Asp Phe Glu Ala Val Lys Val
165 170 175 Ile Gly Asn Ala
Ala Gly Ile Pro Leu Thr Ala Asp Ile Asp Met Phe 180
185 190 Ala Ile Met Pro His Leu Ser Asn Phe
Arg Asp Ser Ala Arg Ser Ser 195 200
205 Val Thr Ser Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr
Arg Arg 210 215 220
Ala Ala Ser Glu Ala Thr Gly Gly Leu Asp Arg Glu Arg Ile Asp Leu 225
230 235 240 Leu Trp Lys Ile Ala
Arg Ala Gly Ala Arg Ser Ala Val Gly Thr Glu 245
250 255 Ala Arg Arg Gln Phe Arg Tyr Asp Gly Asp
Met Asn Ile Gly Val Ile 260 265
270 Thr Asp Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala
His 275 280 285 Ala
Val Gly Ala Gln Asp Val Val Gln His Gly Thr Glu Gln Asn Asn 290
295 300 Pro Phe Pro Glu Ala Asp
Glu Lys Ile Phe Val Val Ser Ala Thr Gly 305 310
315 320 Glu Ser Gln Met Leu Thr Arg Gly Gln Leu Lys
Glu Tyr Ile Gly Gln 325 330
335 Gln Arg Gly Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val
340 345 350 Ala Gly
Lys Ser Leu Phe Asp Asp Gly Leu Gly Ala Ala Pro Gly Val 355
360 365 Pro Gly Gly Arg Ser Lys Ser
Ser Pro Asp Val Leu Glu Thr Val Pro 370 375
380 Ala Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala
Val Glu Arg Gln 385 390 395
400 51225PRTBordetella parapertussis 51Val Gln Ser Thr Thr Tyr Arg Gln
Ile His Met Gln Gln Ser His Gln 1 5 10
15 Ala Gly Tyr Ala Asn Ala Ala Asp Arg Glu Ser Gly Ile
Pro Ala Ala 20 25 30
Val Leu Asp Gly Ile Lys Ala Val Ala Lys Glu Lys Asn Ala Thr Leu
35 40 45 Met Phe Arg Leu
Val Asn Pro His Ser Thr Ser Leu Ile Ala Glu Gly 50
55 60 Val Ala Thr Lys Gly Leu Gly Val
His Ala Lys Ser Ser Asp Trp Gly 65 70
75 80 Leu Gln Ala Gly Tyr Ile Pro Val Asn Pro Asn Leu
Ser Lys Leu Phe 85 90
95 Gly Arg Ala Pro Glu Val Ile Ala Arg Ala Asp Asn Asp Val Asn Ser
100 105 110 Ser Leu Ala
His Gly His Thr Ala Val Asp Leu Thr Leu Ser Lys Glu 115
120 125 Arg Leu Asp Tyr Leu Arg Gln Ala
Gly Leu Val Thr Gly Met Ala Asp 130 135
140 Gly Val Val Ala Ser Asn His Ala Gly Tyr Glu Gln Phe
Glu Phe Arg 145 150 155
160 Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala Val Gln Tyr Arg Arg Lys
165 170 175 Gly Gly Asp Asp
Phe Glu Ala Val Lys Val Ile Gly Asn Ala Ala Gly 180
185 190 Ile Pro Leu Thr Ala Asp Ile Asp Met
Phe Ala Ile Met Pro His Leu 195 200
205 Ser Asn Phe Arg Asp Ser Ala Arg Ser Ser Val Thr Ser Gly
Asp Ser 210 215 220
Val 225 52175PRTBordetella parapertussis 52Ala Ser Glu Ala Thr Gly Gly
Leu Asp Arg Glu Arg Ile Asp Leu Leu 1 5
10 15 Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser Ala
Val Gly Thr Glu Ala 20 25
30 Arg Arg Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly Val Ile
Thr 35 40 45 Asp
Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala His Ala 50
55 60 Val Gly Ala Gln Asp Val
Val Gln His Gly Thr Glu Gln Asn Asn Pro 65 70
75 80 Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val
Ser Ala Thr Gly Glu 85 90
95 Ser Gln Met Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln Gln
100 105 110 Arg Gly
Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val Ala 115
120 125 Gly Lys Ser Leu Phe Asp Asp
Gly Leu Gly Ala Ala Pro Gly Val Pro 130 135
140 Gly Gly Arg Ser Lys Ser Ser Pro Asp Val Leu Glu
Thr Val Pro Ala 145 150 155
160 Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln
165 170 175 53400PRTBordetella
parapertussis 53 Met Gln Gln Ser His Gln Ala Gly Tyr Ala Asn Ala Ala Asp
Arg Glu 1 5 10 15
Ser Gly Ile Pro Ala Ala Val Leu Asp Gly Ile Lys Ala Val Ala Lys
20 25 30 Glu Lys Asn Ala Thr
Leu Met Phe Arg Leu Val Asn Pro His Ser Thr 35
40 45 Ser Leu Ile Ala Glu Gly Val Ala Thr
Lys Gly Leu Gly Val His Ala 50 55
60 Lys Ser Ser Asp Trp Gly Leu Gln Ala Gly Tyr Ile Pro
Val Asn Pro 65 70 75
80 Asn Leu Ser Lys Leu Phe Gly Arg Ala Pro Glu Val Ile Ala Arg Ala
85 90 95 Asp Asn Asp Val
Asn Ser Ser Leu Ala His Gly His Thr Ala Val Asp 100
105 110 Leu Thr Leu Ser Lys Glu Arg Leu Asp
Tyr Leu Arg Gln Ala Gly Leu 115 120
125 Val Thr Gly Met Ala Asp Gly Val Val Ala Ser Asn His Ala
Gly Tyr 130 135 140
Glu Gln Phe Glu Phe Arg Val Lys Glu Thr Ser Asp Gly Arg Tyr Ala 145
150 155 160 Val Gln Tyr Arg Arg
Lys Gly Gly Asp Asp Phe Glu Ala Val Lys Val 165
170 175 Ile Gly Asn Ala Ala Gly Ile Pro Leu Thr
Ala Cys Thr Asp Met Phe 180 185
190 Ala Ile Met Pro His Leu Ser Asn Phe Arg Asp Ser Ala Arg Ser
Ser 195 200 205 Val
Thr Ser Gly Asp Ser Val Thr Asp Tyr Leu Ala Arg Thr Arg Arg 210
215 220 Ala Ala Ser Glu Ala Thr
Gly Gly Leu Asp Arg Glu Arg Ile Asp Leu 225 230
235 240 Leu Trp Lys Ile Ala Arg Ala Gly Ala Arg Ser
Ala Val Gly Thr Glu 245 250
255 Ala Arg Arg Gln Phe Arg Tyr Asp Gly Asp Met Asn Ile Gly Val Ile
260 265 270 Thr Asp
Phe Glu Leu Glu Val Arg Asn Ala Leu Asn Arg Arg Ala His 275
280 285 Ala Val Gly Ala Gln Asp Val
Val Gln His Gly Thr Glu Gln Asn Asn 290 295
300 Pro Phe Pro Glu Ala Asp Glu Lys Ile Phe Val Val
Ser Ala Thr Gly 305 310 315
320 Glu Ser Gln Met Leu Thr Arg Gly Gln Leu Lys Glu Tyr Ile Gly Gln
325 330 335 Gln Arg Gly
Glu Gly Tyr Val Phe Tyr Glu Asn Arg Ala Tyr Gly Val 340
345 350 Ala Gly Lys Ser Leu Phe Asp Asp
Gly Leu Gly Ala Ala Pro Gly Val 355 360
365 Pro Gly Gly Arg Ser Lys Ser Ser Pro Asp Val Leu Glu
Thr Val Pro 370 375 380
Ala Ser Pro Gly Leu Arg Arg Pro Ser Leu Gly Ala Val Glu Arg Gln 385
390 395 400
54269PRTBordetella parapertussis 54Met Arg Cys Thr Arg Ala Ile Arg Gln
Thr Ala Arg Thr Gly Trp Leu 1 5 10
15 Thr Trp Leu Ala Ile Leu Ala Val Thr Ala Pro Met Thr Ser
Pro Ala 20 25 30
Trp Ala Asp Asp Pro Pro Ala Thr Val Tyr Arg Tyr Asp Ser Arg Pro
35 40 45 Pro Glu Asp Val
Phe Gln Asn Gly Phe Thr Ala Trp Gly Asn Asn Asp 50
55 60 Asn Val Leu Glu His Leu Thr Gly
Arg Ser Cys Gln Val Gly Ser Ser 65 70
75 80 Asn Ser Ala Phe Val Ser Thr Ser Ser Ser Arg Arg
Tyr Thr Glu Val 85 90
95 Tyr Leu Glu His Arg Met Gln Glu Ala Val Glu Ala Glu Arg Ala Gly
100 105 110 Arg Gly Thr
Gly His Phe Ile Gly Tyr Ile Tyr Glu Ile Arg Ala Asp 115
120 125 Asn Asn Phe Tyr Gly Ala Ala Ser
Ser Tyr Phe Glu Tyr Val Asp Thr 130 135
140 Tyr Gly Asp Asn Ala Gly Arg Ile Leu Ala Gly Ala Leu
Ala Thr Tyr 145 150 155
160 Gln Ser Glu Tyr Leu Ala His Arg Arg Ile Pro Pro Glu Asn Ile Arg
165 170 175 Thr Val Thr Arg
Val Tyr His Asn Gly Ile Thr Gly Glu Thr Thr Thr 180
185 190 Thr Glu Tyr Pro Asn Leu Arg Tyr Val
Ser Gln Gln Thr Arg Ala Asn 195 200
205 Thr Asn Pro Tyr Thr Ser Arg Arg Ser Thr Ala Ser Ile Val
Gly Thr 210 215 220
Leu Val Arg Met Ala Pro Val Thr Gly Ala Cys Met Ala Arg Gln Ala 225
230 235 240 Glu Ser Pro Glu Ala
Met Ala Ala Trp Ser Glu Arg Thr Gly Glu Ala 245
250 255 Met Val Leu Val Tyr Tyr Glu Ser Ile Ala
Tyr Ser Phe 260 265
55226PRTBordetella parapertussis 55Met Pro Ile Asp Arg Lys Thr Leu Cys
His Leu Leu Ser Val Leu Pro 1 5 10
15 Leu Ala Leu Leu Gly Ser His Val Ala Arg Ala Ser Thr Pro
Gly Ile 20 25 30
Val Ile Pro Pro Gln Glu Gln Ile Thr Gln His Gly Gly Pro Tyr Gly
35 40 45 Arg Cys Ala Asn
Lys Thr Arg Ala Leu Thr Val Ala Glu Leu Arg Gly 50
55 60 Ser Gly Asp Leu Gln Glu Tyr Leu
Arg His Val Thr Arg Gly Trp Ser 65 70
75 80 Ile Phe Ala Leu Tyr Asp Gly Thr Tyr Leu Gly Gly
Glu Tyr Gly Gly 85 90
95 Val Ile Lys Asp Gly Thr Pro Gly Gly Ala Phe Asn Leu Lys Thr Thr
100 105 110 Phe Cys Ile
Met Thr Thr Arg Asn Thr Gly Gln Pro Ala Thr Asp His 115
120 125 Tyr Tyr Ser Asn Val Thr Ala Thr
Arg Leu Leu Ser Ser Thr Asn Ser 130 135
140 Arg Leu Cys Ala Val Phe Val Arg Ser Gly Gln Pro Val
Ile Gly Ala 145 150 155
160 Cys Thr Ser Pro Tyr Asp Gly Lys Tyr Trp Ser Met Tyr Ser Arg Leu
165 170 175 Arg Lys Met Leu
Tyr Leu Ile Tyr Val Ala Gly Ile Ser Val Arg Val 180
185 190 His Val Ser Lys Glu Glu Gln Tyr Tyr
Asp Tyr Glu Asp Ala Thr Phe 195 200
205 Glu Thr Tyr Ala Leu Thr Gly Ile Ser Ile Cys Asn Pro Gly
Ser Ser 210 215 220
Leu Cys 225 56227PRTBordetella parapertussis 56Met Leu Ile Asn Asn
Lys Lys Leu Leu His His Ile Leu Pro Ile Leu 1 5
10 15 Val Leu Ala Leu Leu Gly Met Arg Thr Ala
Gln Ala Val Ala Pro Gly 20 25
30 Ile Val Ile Pro Pro Lys Ala Leu Phe Thr Gln Gln Gly Gly Ala
Tyr 35 40 45 Gly
Arg Cys Pro Asn Gly Thr Arg Ala Leu Thr Val Ala Glu Leu Arg 50
55 60 Gly Asn Ala Glu Leu Gln
Thr Tyr Leu Arg Gln Ile Thr Pro Gly Trp 65 70
75 80 Ser Ile Tyr Gly Leu Tyr Asp Gly Thr Tyr Leu
Gly Gln Ala Tyr Gly 85 90
95 Gly Ile Ile Lys Asp Ala Pro Pro Gly Ala Gly Phe Ile Tyr Arg Glu
100 105 110 Thr Phe
Cys Ile Thr Thr Met Tyr Lys Thr Gly Gln Pro Ala Ala Asp 115
120 125 His Tyr Tyr Ser Lys Val Thr
Ala Thr Arg Leu Leu Ala Ser Thr Asn 130 135
140 Ser Arg Leu Cys Ala Val Phe Val Arg Asp Gly Gln
Ser Val Ile Gly 145 150 155
160 Ala Cys Ala Ser Pro Tyr Glu Gly Arg Tyr Arg Asp Met Tyr Asp Val
165 170 175 Leu Arg Arg
Leu Leu Tyr Met Ile Tyr Met Ser Gly Leu Ala Val Arg 180
185 190 Val His Val Ser Lys Glu Glu Gln
Tyr Tyr Asp Tyr Glu Asp Ala Thr 195 200
205 Phe Gln Thr Tyr Ala Leu Thr Gly Ile Ser Leu Cys Asn
Pro Ala Ala 210 215 220
Ser Ile Cys 225 57152PRTBordetella parapertussis 57Met Leu Arg
Arg Phe Leu Thr Arg Thr Thr Ala Pro Gly Gln Gly Gly 1 5
10 15 Ala Arg Arg Pro Arg Val Arg Ala
Leu Ala Trp Leu Leu Ala Ser Gly 20 25
30 Thr Met Met His Leu His Pro Ala Gln Ala Asp Val Pro
Tyr Val Leu 35 40 45
Val Lys Thr Asn Met Val Val Thr Ser Val Ala Met Lys Pro Tyr Glu 50
55 60 Val Asn Pro Thr
Arg Met Leu Val Cys Gly Ile Ala Ala Lys Leu Gly 65 70
75 80 Ala Thr Ala Ser Ser Pro Asp Ala His
Val Pro Phe Cys Phe Gly Lys 85 90
95 Asp Leu Lys Arg Ser Gly Ser Ser Pro Met Glu Val Met Leu
Arg Ala 100 105 110
Val Phe Met Gln Gln Arg Pro Leu Arg Met Phe Leu Gly Pro Lys Gln
115 120 125 Leu Thr Phe Glu
Gly Lys Pro Ala Leu Glu Leu Ile Arg Met Val Glu 130
135 140 Cys Ser Gly Lys Gln Asp Cys Pro
145 150 58120PRTBordetella parapertussis 58Met
His Thr Ile Ala Ser Ile Leu Leu Ser Val Leu Gly Ile Tyr Ser 1
5 10 15 Pro Ala Asp Val Ala Gly
Leu Pro Thr His Leu Tyr Lys Asn Phe Thr 20
25 30 Val Gln Glu Leu Ala Leu Lys Leu Lys Gly
Lys Asn Gln Glu Phe Cys 35 40
45 Leu Thr Ala Phe Met Pro Gly Arg Ser Leu Val Arg Ala Cys
Leu Ser 50 55 60
Asp Ala Gly His Glu His Asp Thr Trp Phe Asp Thr Met Leu Gly Phe 65
70 75 80 Ala Ile Ser Ala Tyr
Ala Leu Lys Ser Arg Ile Ala Leu Thr Val Glu 85
90 95 Asp Ser Pro Tyr Pro Gly Thr Pro Gly Asp
Leu Leu Glu Leu Gln Ile 100 105
110 Cys Pro Leu Asn Gly Tyr Cys Glu 115
120 593831PRTBordetella parapertussis 59Met Leu Ala Cys Ala Gly Leu Pro
Leu Val Thr His Ala Gln Gly Leu 1 5 10
15 Val Pro Gln Gly Gln Thr Gln Val Leu Gln Gly Gly Asn
Lys Val Pro 20 25 30
Val Val Asn Ile Ala Asn Pro Asn Ser Gly Gly Val Ser His Asn Lys
35 40 45 Phe Gln Gln Phe
Asn Val Ala Asn Pro Gly Val Val Phe Asn Asn Gly 50
55 60 Leu Thr Asp Gly Val Ser Arg Ile
Gly Gly Ala Leu Thr Lys Asn Pro 65 70
75 80 Asn Leu Thr Arg Gln Ala Ser Ala Ile Leu Ala Glu
Val Thr Gly Thr 85 90
95 Ser Pro Ser Arg Leu Ala Gly Thr Leu Glu Val Tyr Gly Lys Gly Ala
100 105 110 Asp Leu Ile
Ile Ala Asn Pro Asn Gly Ile Ser Val Asn Gly Leu Ser 115
120 125 Thr Leu Asn Ala Ser Asn Leu Thr
Leu Thr Thr Gly Arg Pro Ser Val 130 135
140 Asn Gly Gly Arg Ile Gly Leu Asp Val Gln Gln Gly Thr
Val Thr Ile 145 150 155
160 Glu Arg Gly Gly Val Asn Ala Thr Gly Leu Gly Tyr Phe Asp Val Val
165 170 175 Ala Arg Leu Val
Lys Leu Gln Gly Ala Val Ser Thr Glu Gln Gly Lys 180
185 190 Pro Leu Ala Asp Ile Ala Val Val Ala
Gly Ala Asn Arg Tyr Asp His 195 200
205 Ala Thr Arg Arg Ala Thr Pro Ile Ala Ala Gly Ala Arg Gly
Ala Ala 210 215 220
Ala Gly Ala Tyr Ala Ile Asp Gly Thr Ala Ala Gly Ala Met Tyr Gly 225
230 235 240 Lys His Ile Thr Leu
Val Ser Ser Asp Ser Gly Leu Gly Val Arg Gln 245
250 255 Leu Gly Ser Leu Ser Ser Pro Leu Ala Ile
Thr Val Ser Ser Gln Gly 260 265
270 Glu Ile Ala Leu Gly Asp Ala Thr Val Gln Arg Gly Pro Leu Ser
Leu 275 280 285 Lys
Gly Ala Gly Ala Val Ser Ala Gly Lys Leu Ala Ser Gly Gly Ala 290
295 300 Val Ser Val Ala Gly Gly
Gly Ala Val Thr Val Ala Ser Ala Ser Ser 305 310
315 320 Val Gly Asn Leu Ala Val Gln Gly Gly Gly Thr
Val Gln Ala Thr Leu 325 330
335 Leu Asn Ala Gly Gly Thr Leu Gln Val Ser Gly Arg Gln Ala Val Gln
340 345 350 Leu Gly
Thr Ala Ser Ser Arg Gln Val Leu Ser Val Asn Ala Gly Gly 355
360 365 Ala Leu Lys Ala Asp Gln Leu
Ser Ala Thr Gly Arg Leu Glu Val Asp 370 375
380 Gly Lys Gln Ala Val Thr Leu Gly Ser Ala Ala Ser
Gly Asp Ala Leu 385 390 395
400 Ser Val Ser Ala Gly Ala Ala Leu Arg Ala Asp Gln Leu Ser Ala Thr
405 410 415 Gly Arg Leu
Asp Val Asp Gly Lys Gln Ala Val Thr Leu Gly Ser Ala 420
425 430 Ala Ser Gly Asp Ala Leu Ser Val
Ser Ala Gly Ser Ala Leu Arg Ala 435 440
445 Asp Gln Leu Ser Ala Thr Arg Arg Leu Gly Val Asp Gly
Lys Gln Ala 450 455 460
Val Thr Leu Gly Ser Ala Ala Ser Arg Asn Ala Leu Ser Val Arg Ala 465
470 475 480 Gly Gly Ala Leu
Lys Ala Asp Lys Leu Ser Ala Thr Gly Arg Leu Asp 485
490 495 Val Asp Gly Lys Gln Ala Val Thr Leu
Gly Ser Ala Ala Ser Gly Asp 500 505
510 Ala Leu Ser Val Ser Ala Gly Ala Ala Leu Arg Ala Asp Gln
Leu Ser 515 520 525
Ala Thr Arg Arg Leu Gly Val Asp Gly Lys Gln Ala Val Thr Leu Gly 530
535 540 Ser Val Ala Ser Asp
Gly Ala Leu Ser Val Ser Ala Gly Gly Asn Leu 545 550
555 560 Gln Ala Lys Gln Leu Val Ser Asn Ala Gly
Leu Asp Val Arg Gly Gln 565 570
575 Arg Glu Val Ser Leu Glu Ala Ala Ser Ser Gly Asp Ala Leu Ser
Val 580 585 590 Ser
Ala Gly Ala Ala Leu Arg Ala Asp Gln Leu Ser Ala Thr Gly Arg 595
600 605 Leu Asp Val Asp Gly Lys
Gln Ala Val Thr Leu Gly Ser Ala Ala Ser 610 615
620 Gly Asp Ala Leu Ser Val Ser Ala Gly Ala Ala
Leu Arg Ala Asp Gln 625 630 635
640 Leu Ser Ala Thr Gly Arg Leu Asp Val Asp Gly Lys Gln Ala Val Thr
645 650 655 Leu Gly
Ser Ala Ala Ser Gly Asp Ala Leu Ser Val Ser Ala Gly Ala 660
665 670 Ala Leu Arg Ala Asp Gln Leu
Ser Ala Thr Gly Arg Leu Asp Val Asp 675 680
685 Gly Lys Gln Ala Val Thr Leu Gly Ser Ala Ala Ser
Gly Asp Ala Leu 690 695 700
Ser Val Ser Ala Gly Ala Ala Leu Arg Ala Asp Gln Leu Ser Ala Thr 705
710 715 720 Gly Arg Leu
Asp Val Asp Gly Lys Gln Ala Val Thr Leu Gly Ser Ala 725
730 735 Ala Ser Asp Gly Ala Leu Ser Val
Ser Ala Gly Gly Asn Leu Gln Ala 740 745
750 Lys Gln Leu Val Ser Asn Ala Gly Leu Asp Val Arg Gly
Gln Arg Glu 755 760 765
Val Ser Leu Glu Ala Ala Ser Ser Val Arg Gly Met Thr Val Ala Ala 770
775 780 Ala Gly Thr Leu
Ala Ala Arg Asn Leu Gln Ser Gln Gly Ala Ile Arg 785 790
795 800 Ile Gln Gly Gly Gln Ala Val Ser Val
Ala Asn Ala Asn Ser Asp Ala 805 810
815 Glu Leu His Val Ser Gly Arg Gly Gln Val Asp Leu Gly Asp
Leu Ser 820 825 830
Ala Ala Arg Gly Ala Asp Ile Thr Gly Glu Gln Arg Val Ser Ile Gly
835 840 845 Arg Ala His Ser
Asp Gly Asp Val Asn Val Ala Ala Arg Gly Ala Leu 850
855 860 Ser Ile Asp Ser Met Thr Ala Leu
Gly Ala Ile Gly Val Gln Ala Gly 865 870
875 880 Asp Ser Val Ser Ala Lys Asp Met Arg Ser Arg Gly
Ala Val Thr Val 885 890
895 Ser Gly Gly Gly Ser Val Asn Leu Gly Asp Val Gln Ser Asp Gly Gln
900 905 910 Val Arg Ala
Thr Ser Ala Gly Ala Met Thr Val Arg Asp Ala Ala Ala 915
920 925 Ala Ala Asp Leu Ala Leu Gln Ala
Gly Gly Ala Leu Gln Ala Gly Phe 930 935
940 Leu Lys Ser Ala Gly Ala Met Thr Val Asn Gly Arg Asp
Ala Val Arg 945 950 955
960 Leu Asp Gly Ala Gln Ala Gly Gly Gln Leu Arg Val Ser Ser Asp Gly
965 970 975 Gln Ala Ala Leu
Gly Ser Leu Ala Ala Lys Gly Ala Leu Thr Val Ser 980
985 990 Ala Ala Arg Ala Ala Thr Val Ala
Glu Leu Lys Ser Leu Asp Ser Ile 995 1000
1005 Ser Val Thr Gly Gly Glu Arg Val Ser Val Gln
Ser Val Asn Ser 1010 1015 1020
Ala Ser Arg Val Ala Ile Ser Ala His Gly Ala Leu Glu Val Gly
1025 1030 1035 Lys Val Ser
Ala Lys Ser Gly Ile Gly Ile Glu Gly Trp Gly Ala 1040
1045 1050 Val Ala Ala Asp Ser Leu Gly Ser
Asp Gly Ala Ile Ser Val Ser 1055 1060
1065 Gly Arg Asp Ala Val Arg Val Asp His Ala Arg Ser Leu
Ala Asp 1070 1075 1080
Ile Ser Leu Gly Ala Glu Gly Gly Ala Thr Leu Gly Ala Val Glu 1085
1090 1095 Ala Ala Gly Ser Ile
Asp Val Arg Gly Gly Ser Thr Val Ala Ala 1100 1105
1110 Asn Ser Leu Arg Ala Asn Arg Asp Val Arg
Val Ser Gly Lys Asp 1115 1120 1125
Ala Val Arg Val Thr Ala Ala Thr Ser Gly Gly Gly Leu His Val
1130 1135 1140 Ser Ser
Gly Arg Gln Leu Asp Leu Gly Ala Val Gln Ala Arg Gly 1145
1150 1155 Ala Leu Ala Leu Asp Gly Gly
Ala Gly Val Ala Leu Gln Ser Ala 1160 1165
1170 Lys Ala Gly Gly Thr Leu His Val Gln Gly Gly Glu
His Leu Asp 1175 1180 1185
Leu Gly Thr Leu Ala Ala Val Gly Ala Val Asp Val Asn Gly Ala 1190
1195 1200 Gly Asp Val Arg Val
Ala Lys Leu Val Ser Asp Ala Gly Ala Asp 1205 1210
1215 Leu Gln Ala Gly Arg Ser Met Thr Leu Gly
Thr Val Asp Thr Thr 1220 1225 1230
Gly Asp Leu Gln Ala Arg Ala Gln Gln Ala Leu Glu Leu Gly Ser
1235 1240 1245 Val Lys
Thr Glu Gly Gly Leu Gln Ala Ala Ala Gly Gly Ala Phe 1250
1255 1260 Ser Leu Ala Ala Ala Glu Val
Ala Gly Ala Leu Glu Leu Ser Gly 1265 1270
1275 His Gly Val Thr Val Asp Arg Ala Ser Ala Gly Arg
Ala Arg Ile 1280 1285 1290
Asp Ser Thr Gly Ser Val Gly Ile Gly Ala Leu Lys Ala Gly Ala 1295
1300 1305 Val Glu Ala Ala Ser
Pro Arg Arg Ala Arg Arg Ala Leu Arg Gln 1310 1315
1320 Asp Phe Phe Thr Pro Gly Ser Val Val Val
Arg Ala Gln Gly Asn 1325 1330 1335
Val Thr Val Gly Arg Gly Asp Pro His Gln Gly Val Leu Ala Gln
1340 1345 1350 Gly Asp
Ile Val Met Asp Ala Lys Gly Gly Thr Leu Leu Leu Arg 1355
1360 1365 Asn Asp Val Leu Thr Glu Asn
Gly Thr Val Thr Ile Ser Ala Asp 1370 1375
1380 Ser Ala Val Leu Glu His Ser Thr Ile Glu Ser Lys
Ile Ser Gln 1385 1390 1395
Ser Ala Leu Ala Ala Lys Gly Asp Lys Gly Lys Pro Ala Val Ser 1400
1405 1410 Val Lys Val Ala Lys
Lys Leu Phe Leu Asn Gly Thr Leu Arg Ala 1415 1420
1425 Val Asn Asp Asn Glu Glu Thr Met Pro Gly
Arg Gln Ile Asp Val 1430 1435 1440
Val Asp Gly Arg Pro Gln Ile Thr Asp Ala Val Thr Gly Glu Glu
1445 1450 1455 Arg Lys
Asp Glu Ser Val Val Ser Asp Ala Ala Leu Val Ala Asp 1460
1465 1470 Gly Gly Pro Ile Val Val Glu
Ala Gly Glu Leu Val Ser His Ala 1475 1480
1485 Gly Gly Ile Gly Asn Gly Arg Asn Lys Gly Asp Gly
Ala Asp Val 1490 1495 1500
Thr Val Arg Thr Thr Gly Asn Val Met Asn Lys Gly Tyr Ile Ser 1505
1510 1515 Ala Gly Lys Gln Gly
Val Leu Glu Val Gly Gly Thr Leu Thr Asn 1520 1525
1530 Glu Phe Leu Val Ser Ser Asp Gly Thr Gln
Arg Ile Glu Ala Gln 1535 1540 1545
Arg Ile Glu Asn Arg Gly Thr Phe Gln Ser Gln Ala Pro Ala Gly
1550 1555 1560 Thr Ala
Gly Ala Leu Val Val Lys Ala Ala Glu Ala Ile Val His 1565
1570 1575 Asp Gly Val Met Ala Thr Glu
Gly Glu Met Gln Ile Ala Gly Lys 1580 1585
1590 Gly Gly Arg Ser Pro Ala Val Thr Ala Gly Ala Lys
Ala Thr Thr 1595 1600 1605
Ser Ala Asn Lys Leu Ser Ala Asp Val Ala Ser Trp Asp Asn Ala 1610
1615 1620 Gly Ser Leu Asp Ile
Lys Lys Gly Gly Ala Arg Val Thr Ala Thr 1625 1630
1635 Gly Arg Tyr Ala Glu His Gly Lys Val Ser
Ile Gln Gly Asp Tyr 1640 1645 1650
Thr Val Ser Ala Asp Ala Ile Ala Leu Ala Ala Gln Ile Thr Gln
1655 1660 1665 Arg Gly
Gly Ala Ala Asp Leu Thr Ser Gly His Asp Thr Arg Phe 1670
1675 1680 Ser Asn Asn Ile Arg Leu Met
Gly Pro Leu Gln Val Ser Ala Gly 1685 1690
1695 Gly Ala Val Ser Asn Thr Gly Asn Leu Lys Val Arg
Glu Gly Val 1700 1705 1710
Arg Val Thr Ala Ala Ser Phe Asp Asn Glu Ala Gly Ala Glu Val 1715
1720 1725 Met Ala Lys Ser Ala
Ala Leu Thr Thr Ser Gly Ala Val Arg Asn 1730 1735
1740 Ala Gly Lys Met Gln Val Lys Glu Ala Ala
Thr Ile Val Ala Ala 1745 1750 1755
Ser Val Ser Asn Pro Gly Thr Phe Thr Ala Gly Lys Asp Leu Thr
1760 1765 1770 Val Thr
Ser Arg Gly Gly Phe Asp Asn Asp Gly Lys Met Glu Ser 1775
1780 1785 Asn Lys Asp Ile Val Ile Lys
Thr Glu Gln Phe Ser Asn Ala Gly 1790 1795
1800 Ile Leu Asp Ala Lys His Asp Leu Thr Val Thr Ala
Ser Gly Gln 1805 1810 1815
Ala Asp Asn Arg Gly Ser Leu Lys Ala Gly His Asp Phe Thr Val 1820
1825 1830 Gln Ala Gln Arg Ile
Asp Asn Ser Gly Thr Met Ala Ala Gly Tyr 1835 1840
1845 Asp Ala Thr Leu Lys Ala Pro His Leu Arg
Asn Thr Gly Gln Ile 1850 1855 1860
Val Ala Gly His Asp Ile His Ile Ile Asn Ser Ala Lys Leu Glu
1865 1870 1875 Asn Thr
Gly Arg Val Asp Ala Arg Asn Asp Leu Val Leu Asp Val 1880
1885 1890 Glu Asp Phe Thr Asn Thr Gly
Ser Leu Tyr Ala Glu His Asp Ala 1895 1900
1905 Thr Leu Thr Leu Ala Gln Gly Thr Gln Arg Asp Leu
Val Val Asp 1910 1915 1920
Gln Asp His Ile Leu Pro Val Ala Glu Gly Thr Leu Arg Val Lys 1925
1930 1935 Ala Lys Ser Leu Thr
Thr Glu Ile Glu Thr Gly Asn Ser Gly Ser 1940 1945
1950 Leu Ile Ala Glu Val Gln Glu Asn Ile Asp
Asn Lys Gln Ala Ile 1955 1960 1965
Val Val Gly Lys Asp Leu Thr Leu Ser Ser Ala His Gly Asn Val
1970 1975 1980 Ala Asn
Glu Ala Asn Ala Leu Leu Trp Ala Ala Gly Asp Leu Thr 1985
1990 1995 Val Lys Ala Gln Asn Ile Thr
Asn Glu Arg Ala Ala Leu Ile Glu 2000 2005
2010 Ala Gly Gly Asn Ala Arg Leu Thr Ala Ala Val Ala
Leu Leu Asn 2015 2020 2025
Lys Leu Gly Arg Ile Arg Ala Gly Glu Asp Met His Leu Asp Ala 2030
2035 2040 Pro Arg Ile Glu Asn
Thr Ala Lys Leu Ser Gly Glu Val Gln Arg 2045 2050
2055 Lys Gly Val Gln Tyr Val Gly Gly Gly Thr
Tyr Gly Arg Trp Ser 2060 2065 2070
Gly Ile Gly Tyr Val Asn Tyr His Leu Ser Ser Gly Ser Gly Ala
2075 2080 2085 Ile Ala
Ala Pro Trp Tyr Gly Ser Asp Leu Thr Ala Glu Gln Ser 2090
2095 2100 Leu Ile Glu Val Gly Lys Asp
Leu Tyr Leu Asn Ala Gly Ala Arg 2105 2110
2115 Lys Asp Glu His Arg His Leu Leu Asn Glu Gly Val
Ile Gln Ala 2120 2125 2130
Gly Gly His Gly Tyr Ile Gly Gly Asp Val Asp Asn Arg Ser Val 2135
2140 2145 Val Arg Thr Val Ser
Ala Met Glu Tyr Phe Lys Thr Pro Leu Pro 2150 2155
2160 Val Ser Leu Thr Ala Leu Asp Asn Arg Ala
Gly Leu Ser Pro Ala 2165 2170 2175
Thr Trp Asn Phe Gln Ser Thr Tyr Glu Leu Leu Asp Tyr Leu Leu
2180 2185 2190 Asp Gln
Asn Arg Tyr Glu Tyr Ile Trp Gly Leu Tyr Pro Thr Tyr 2195
2200 2205 Thr Glu Trp Ser Val Asn Thr
Leu Lys Asn Leu Asp Leu Gly Tyr 2210 2215
2220 Gln Ala Lys Pro Ala Pro Thr Ala Pro Pro Met Pro
Lys Ala Pro 2225 2230 2235
Glu Leu Asp Leu Arg Gly His Thr Leu Glu Ser Ala Glu Gly Arg 2240
2245 2250 Lys Ile Phe Gly Glu
Tyr Lys Lys Leu Gln Gly Glu Tyr Glu Lys 2255 2260
2265 Ala Lys Thr Ala Val Gln Ala Val Glu Ala
Tyr Gly Glu Ala Thr 2270 2275 2280
Arg Arg Val His Asp Gln Leu Gly Gln Arg Tyr Gly Lys Ala Leu
2285 2290 2295 Gly Gly
Met Asp Ala Glu Thr Lys Glu Val Asp Gly Ile Ile Gln 2300
2305 2310 Ala Phe Ala Ala Asp Leu Arg
Thr Val Tyr Ala Lys Gln Ala Asp 2315 2320
2325 Gln Ala Thr Ile Asp Ala Glu Thr Asp Lys Val Ala
Gln Arg Tyr 2330 2335 2340
Lys Ser Gln Ile Asp Ala Val Arg Leu Gln Ala Ile Gln Pro Gly 2345
2350 2355 Arg Val Thr Leu Ala
Lys Ala Leu Ser Ala Ala Leu Gly Ala Asp 2360 2365
2370 Trp Arg Ala Leu Gly His Ser Gln Leu Met
Gln Arg Trp Lys Asp 2375 2380 2385
Phe Lys Ala Gly Lys Arg Gly Ala Glu Ile Ala Phe Tyr Pro Lys
2390 2395 2400 Glu Gln
Thr Val Leu Ala Ala Gly Ala Gly Leu Thr Leu Ser Asn 2405
2410 2415 Gly Ala Val His Asn Gly Glu
Asn Ala Ala Gln Asn Arg Gly Arg 2420 2425
2430 Pro Glu Asn Leu Lys Ile Gly Ala His Ser Ala Thr
Ser Val Gly 2435 2440 2445
Gly Ser Phe Asp Ala Leu Arg Asp Val Gly Leu Glu Lys Arg Leu 2450
2455 2460 Asp Ile Asp Asp Ala
Leu Ala Ala Val Leu Val Asn Pro His Ile 2465 2470
2475 Phe Thr Arg Ile Gly Ala Val Gln Ala Ser
Leu Ser Asp Ala Ala 2480 2485 2490
Ala Gly Pro Ala Leu Ala Arg Gln Ala Arg Gln Ala Pro Gly Thr
2495 2500 2505 Asp Gly
Met Val Asp Ala Arg Gly Leu Gly Ser Ala Asp Ala Leu 2510
2515 2520 Ala Ser Leu Ala Ser Leu Asp
Ala Ala Gln Gly Leu Glu Val Ser 2525 2530
2535 Gly Arg Arg Asn Ala Gln Val Ala Asp Ala Arg Leu
Ala Gly Pro 2540 2545 2550
Ser Ala Val Ala Ala Pro Ala Val Gly Ala Val Asp Val Gly Val 2555
2560 2565 Glu Pro Val Thr Gly
Asp Gln Val Asp Gln Pro Val Val Ala Val 2570 2575
2580 Gly Leu Glu Gln Pro Val Ala Ala Val Arg
Val Ala Pro Pro Ala 2585 2590 2595
Val Ala Leu Pro Arg Pro Leu Phe Glu Thr Arg Ile Lys Phe Ile
2600 2605 2610 Asp Gln
Ser Lys Phe Tyr Gly Ser Arg Tyr Phe Phe Glu Gln Ile 2615
2620 2625 Gly Tyr Lys Pro Asp Arg Ala
Ala Arg Val Ala Gly Asp Asn Tyr 2630 2635
2640 Phe Asp Thr Thr Leu Val Arg Glu Gln Val Arg Arg
Ala Leu Gly 2645 2650 2655
Gly Tyr Glu Ser Arg Leu Pro Val Arg Gly Val Ala Leu Val Ala 2660
2665 2670 Lys Leu Met Asp Ser
Ala Gly Thr Val Gly Lys Ala Leu Gly Leu 2675 2680
2685 Lys Val Gly Val Ala Pro Thr Glu Gln Gln
Leu Lys Gln Ala Asp 2690 2695 2700
Arg Asp Phe Val Trp Tyr Val Asp Thr Val Ile Asp Gly Gln Lys
2705 2710 2715 Val Leu
Ala Pro Arg Leu Tyr Leu Thr Glu Ala Thr Arg Gln Gly 2720
2725 2730 Ile Thr Asp Gln Tyr Ala Gly
Gly Gly Ala Leu Ile Ala Ser Gly 2735 2740
2745 Gly Asp Val Thr Val Asn Thr Asp Gly His Asp Val
Ser Ser Val 2750 2755 2760
Asn Gly Leu Ile Gln Gly Lys Gly Val Lys Val Asp Ala Gly Lys 2765
2770 2775 Gly Lys Val Leu Val
Ala Asp Asn Lys Gly Met Gly Ser Gly Ile 2780 2785
2790 Glu Ala Asp Asp Glu Val Asp Val Ser Ala
Gln Asp Ile Asp Ile 2795 2800 2805
Glu Gly Gly Lys Leu Arg Gly Lys Asp Val Lys Leu Lys Ala Asp
2810 2815 2820 Thr Val
Lys Val Ala Thr Ser Met Arg Tyr Asp Asp Lys Gly Arg 2825
2830 2835 Leu Ala Ala Arg Gly Asp Gly
Ala Leu Asp Ala Gln Gly Gly Gln 2840 2845
2850 Leu His Ile Glu Ala Lys Arg Leu Glu Thr Ala Gly
Ala Thr Leu 2855 2860 2865
Lys Gly Ser Lys Val Lys Leu Asp Val Asp Asp Val Lys Leu Gly 2870
2875 2880 Gly Val Tyr Glu Ala
Gly Ser Ser Tyr Glu Asn Lys Ser Ser Thr 2885 2890
2895 Pro Leu Gly Ser Leu Phe Ala Ile Leu Ser
Ser Thr Thr Glu Thr 2900 2905 2910
Asn Gln Ser Ala Arg Ala Asn His Tyr Gly Thr Arg Ile Glu Ala
2915 2920 2925 Gly Thr
Leu Glu Gly Lys Met Gln Asn Leu Glu Ile Glu Gly Gly 2930
2935 2940 Ser Val Glu Ala Ala His Thr
Asp Leu Ser Val Ala Arg Asp Ala 2945 2950
2955 Arg Phe Lys Ala Ala Ala Asp Phe Ser His Ala Glu
His Glu Lys 2960 2965 2970
Asp Val Arg Gln Leu Phe Val Ser Ala Lys Val Gly Ala Gly Gly 2975
2980 2985 Tyr Glu Ala Gly Phe
Ser Leu Gly Ser Glu Lys Gly Leu Glu Ala 2990 2995
3000 His Ala Gly Arg Gly Lys Thr Ala Gly Ala
Glu Val Arg Val Gly 3005 3010 3015
Tyr Gln Ala Ser His Glu Gln Ser Ser Glu Thr Glu Lys Ser Tyr
3020 3025 3030 Arg Asn
Ala Asn Leu Asn Phe Gly Gly Gly Ser Val Glu Ala Gly 3035
3040 3045 Asn Val Leu Asp Ile Gly Gly
Ala Asp Ile Asn Arg Asn Arg Tyr 3050 3055
3060 Gly Gly Ala Ala Glu Gly Lys Ala Gly Ala Glu Glu
Ala Leu Arg 3065 3070 3075
Met Arg Ala Lys Lys Val Glu Ser Thr Lys Tyr Val Ser Glu Gln 3080
3085 3090 Thr Ser Gln Ser Ser
Gly Trp Ser Val Glu Val Gly Ala Thr Gly 3095 3100
3105 Ser Ala Arg Ser Ser Val Leu Thr Ala Ala
Thr Arg Leu Gly Asp 3110 3115 3120
Ser Val Ala Gln Asn Val Glu Asp Gly Arg Glu Ile Arg Gly Glu
3125 3130 3135 Leu Met
Ala Ala Gln Ala Ala Ala Glu Ala Thr Gln Leu Val Thr 3140
3145 3150 Ala Asp Thr Ala Ala Leu Ala
Val Ser Leu Gly Ile Ser Ala Asp 3155 3160
3165 Phe Asp Ser Ser Gln Ser Arg Ser Thr Ser Gln Asn
Thr Gln Tyr 3170 3175 3180
Leu Gly Gly Asn Leu Ser Ile Glu Ala Thr Glu Gly Asp Ala Thr 3185
3190 3195 Leu Val Gly Ala Lys
Phe Gly Gly Gly Asp Gln Val Ser Leu Lys 3200 3205
3210 Ala Ala Lys Asn Val Asn Leu Met Ala Ala
Glu Ser Thr Phe Glu 3215 3220 3225
Ser His Ser Glu Ser His Asn Phe His Ala Ser Ala Asp Ala Asn
3230 3235 3240 Leu Gly
Ala Asn Ala Val Gln Gly Ala Val Gly Leu Gly Leu Thr 3245
3250 3255 Ala Gly Met Gly Thr Ser His
Gln Ile Thr Asn Glu Thr Gly Lys 3260 3265
3270 Thr Tyr Ala Gly Thr Ser Val Asp Ala Ala Asn Val
Ser Ile Asp 3275 3280 3285
Ala Gly Lys Asp Leu Asn Leu Ser Gly Ser Arg Val Arg Gly Gln 3290
3295 3300 Arg Val Val Leu Gly
Val Glu Gly Asp Ile Asn Ala Thr Ser Lys 3305 3310
3315 Gln Asp Glu Arg Asn Tyr Asn Ser Ser Gly
Gly Gly Trp Asp Ala 3320 3325 3330
Ser Ala Gly Val Ala Ile Gln Asn Arg Thr Leu Val Ala Pro Val
3335 3340 3345 Gly Ser
Ala Gly Phe Asn Phe Asn Thr Glu His Asp Asn Ser Arg 3350
3355 3360 Leu Thr Asn Asp Gly Ala Ala
Gly Val Val Ala Ser Asp Gly Leu 3365 3370
3375 Thr Gly His Val Lys Gly Asp Ala Asn Leu Thr Gly
Ala Thr Ile 3380 3385 3390
Ala Asp Leu Ser Gly Lys Gly Asn Leu Lys Val Asp Gly Ala Val 3395
3400 3405 Asn Ala Gln Asn Leu
Lys Asp Tyr Arg Asp Lys Asp Gly Gly Ser 3410 3415
3420 Gly Gly Leu Asn Val Gly Ile Ser Ser Thr
Thr Leu Ala Pro Thr 3425 3430 3435
Val Gly Val Ala Phe Gly Arg Val Ala Gly Glu Asp Tyr Gln Ala
3440 3445 3450 Glu Gln
Arg Ala Thr Ile Asp Val Gly Gln Ile Lys Asp Pro Ala 3455
3460 3465 Arg Leu Gln Val Gly Gly Gly
Val Lys Gly Thr Leu Asn Gln Asp 3470 3475
3480 Ala Ala Gln Ala Thr Val Val Gln Arg Asn Lys His
Trp Ala Gly 3485 3490 3495
Gly Gly Ser Glu Phe Ser Val Ala Gly Lys Ser Leu Lys Lys Asn 3500
3505 3510 Gln Val Arg Pro Val
Glu Thr Pro Thr Pro Asp Val Val Asp Gly 3515 3520
3525 Pro Pro Ser Arg Pro Thr Thr Pro Pro Ala
Ser Pro Gln Pro Ile 3530 3535 3540
Arg Ala Thr Val Glu Val Ser Ser Pro Pro Pro Val Ser Val Ala
3545 3550 3555 Thr Val
Glu Val Val Pro Arg Pro Lys Val Glu Thr Ala Gln Pro 3560
3565 3570 Ile Pro Pro Arg Pro Val Ala
Ala Gln Val Val Pro Val Thr Pro 3575 3580
3585 Pro Lys Val Glu Val Ala Lys Val Glu Val Val Pro
Arg Pro Lys 3590 3595 3600
Val Glu Thr Ala Gln Pro Leu Pro Pro Arg Pro Val Val Ala Glu 3605
3610 3615 Arg Val Thr Thr Pro
Ala Val Gln Pro Gln Leu Ala Lys Val Glu 3620 3625
3630 Thr Val Gln Pro Val Lys Pro Glu Thr Ala
Lys Pro Leu Pro Lys 3635 3640 3645
Pro Leu Pro Val Ala Lys Val Thr Glu Ala Pro Pro Pro Val Val
3650 3655 3660 Glu Thr
Ala Gln Pro Leu Pro Pro Val Lys Pro Gln Lys Ala Thr 3665
3670 3675 Pro Gly Pro Val Ala Glu Val
Gly Lys Ala Thr Val Thr Thr Val 3680 3685
3690 Gln Val Gln Ser Ala Pro Pro Lys Pro Ala Pro Val
Ala Lys Gln 3695 3700 3705
Pro Ala Pro Ala Pro Lys Pro Lys Pro Lys Pro Lys Pro Lys Ala 3710
3715 3720 Glu Arg Pro Lys Pro
Gly Lys Thr Thr Pro Leu Ser Gly Arg His 3725 3730
3735 Val Val Gln Gln Gln Val Gln Val Leu Gln
Arg Gln Ala Ser Asp 3740 3745 3750
Ile Asn Asn Thr Lys Ser Leu Pro Gly Gly Lys Leu Pro Lys Pro
3755 3760 3765 Val Thr
Val Lys Leu Thr Asp Glu Asn Gly Lys Pro Gln Thr Tyr 3770
3775 3780 Thr Ile Asn Arg Arg Glu Asp
Leu Met Lys Leu Asn Gly Lys Val 3785 3790
3795 Leu Ser Thr Lys Thr Thr Leu Gly Leu Glu Gln Thr
Phe Arg Leu 3800 3805 3810
Arg Val Glu Asp Ile Gly Gly Lys Asn Tyr Arg Val Phe Tyr Glu 3815
3820 3825 Thr Asn Lys
3830 60209PRTBordetella parapertussis 60Met Lys Gln Val Pro Pro His
Phe Leu Leu Ala Pro Ala Val Leu Ala 1 5
10 15 Gly Val Leu Ala Trp His Ile Pro Ala Arg Ala
Asn Asp Gly Thr Ile 20 25
30 Val Ile Thr Gly Thr Ile Thr Asp Thr Thr Cys Met Val Glu Asp
Pro 35 40 45 Ala
Gly Pro Ser His Thr Lys Val Val Thr Leu Pro Lys Ile Ala Lys 50
55 60 Thr Ala Leu Lys Asn Val
Gly Asp Gln Ala Gly Arg Thr Pro Phe Ile 65 70
75 80 Ile Lys Leu Lys Asp Cys Pro Ser Ser Leu Gly
Asn Gly Val Lys Ala 85 90
95 Tyr Phe Glu Pro Gly Pro Thr Thr Asp Tyr Ser Thr Gly Asp Leu Arg
100 105 110 Ala Tyr
Lys Met Val Tyr Ala Thr Asn Pro Gln Thr Gln Leu Ser Asn 115
120 125 Ile Thr Ala Ala Thr Glu Ala
Gln Gly Val Gln Val Arg Ile Ser Asn 130 135
140 Leu Asn Asp Ser Lys Ile Thr Met Gly Ala Asp Glu
Ala Thr Gln Gln 145 150 155
160 Ala Ala Gly Phe Asp Pro Glu Val Gln Thr Gly Glu Ala Ser Lys Arg
165 170 175 Thr Val Thr
Met Arg Tyr Leu Ala Ser Tyr Val Lys Lys Asn Gly Asn 180
185 190 Val Glu Ala Ser Ala Ile Thr Thr
Tyr Val Gly Phe Ser Val Val Tyr 195 200
205 Pro 61209PRTBordetella parapertussis 61Met Ser Lys
Phe Ser Tyr Pro Ala Leu Arg Thr Ala Leu Ile Leu Ala 1 5
10 15 Ala Ser Pro Val Leu Pro Ala Leu
Ala Asn Asp Gly Thr Ile Val Ile 20 25
30 Thr Gly Ser Ile Ser Asp Gln Thr Cys Val Ile Glu Glu
Pro Ser Ala 35 40 45
Pro Asn His Ile Lys Val Val Gln Leu Pro Lys Ile Ser Lys Asn Ala 50
55 60 Leu Arg Asn Asp
Gly Asp Thr Ala Gly Ala Thr Pro Phe Asp Ile Arg 65 70
75 80 Leu Lys Glu Cys Pro Gln Ala Leu Gly
Ala Leu Lys Leu Tyr Phe Glu 85 90
95 Pro Gly Ile Thr Thr Asn Tyr Asp Thr Gly Asp Leu Ile Ala
Tyr Lys 100 105 110
Gln Ala Tyr Asn Ala Ser Gly Asn Gly Asn Leu Ser Thr Val Ser Ser
115 120 125 Ala Thr Lys Ala
Lys Gly Val Glu Phe Arg Leu Ala Asn Leu Asn Gly 130
135 140 Gln His Ile Arg Met Gly Thr Asp
Glu Thr Thr Gln Ala Ala Gln Thr 145 150
155 160 Phe Thr Gly Thr Asp Val Thr Asn Gly Ser Gly Lys
Thr Thr Lys Ser 165 170
175 Tyr Thr Leu Arg Tyr Leu Ala Ser Tyr Val Lys Lys Pro Lys Glu Asp
180 185 190 Val Asp Ala
Ala Gln Ile Thr Ser Tyr Val Gly Phe Ser Val Val Tyr 195
200 205 Pro 62921PRTBordetella
parapertussis 62Met Asn Met Ser Leu Ser Arg Ile Val Lys Ala Ala Pro Leu
Arg Arg 1 5 10 15
Thr Thr Leu Ala Met Ala Leu Gly Ala Leu Gly Ala Leu Gly Ala Ala
20 25 30 Pro Ala Ala Tyr Ala
Asp Trp Asn Asn Gln Ser Ile Ile Lys Ala Gly 35
40 45 Glu Arg Gln His Gly Ile His Ile Lys
Gln Ser Asp Gly Ala Gly Val 50 55
60 Arg Thr Ala Thr Gly Thr Thr Ile Lys Val Ser Gly Arg
Gln Ala Gln 65 70 75
80 Gly Val Leu Leu Glu Asn Pro Ala Ala Glu Leu Arg Phe Gln Asn Gly
85 90 95 Ser Val Thr Ser
Ser Gly Gln Leu Phe Asp Glu Gly Val Arg Arg Phe 100
105 110 Leu Gly Thr Val Thr Val Lys Ala Gly
Lys Leu Val Ala Asp His Ala 115 120
125 Thr Leu Ala Asn Val Ser Asp Thr Arg Asp Asp Asp Gly Ile
Ala Leu 130 135 140
Tyr Val Ala Gly Glu Gln Ala Gln Ala Ser Ile Ala Asp Ser Thr Leu 145
150 155 160 Gln Gly Ala Gly Gly
Val Arg Val Glu Arg Gly Ala Asn Val Thr Val 165
170 175 Gln Arg Ser Thr Ile Val Asp Gly Gly Leu
His Ile Gly Thr Leu Gln 180 185
190 Pro Leu Gln Pro Glu Asp Leu Pro Pro Ser Arg Val Val Leu Gly
Asp 195 200 205 Thr
Ser Val Thr Ala Val Pro Ala Ser Gly Ala Pro Ala Ala Val Ser 210
215 220 Val Phe Gly Ala Asn Glu
Leu Thr Val Asp Gly Gly His Ile Thr Gly 225 230
235 240 Gly Arg Ala Ala Gly Val Ala Ala Met Asp Gly
Ala Ile Val His Leu 245 250
255 Gln Arg Ala Thr Ile Arg Arg Gly Asp Ala Pro Ala Gly Gly Ala Val
260 265 270 Pro Gly
Gly Ala Val Pro Gly Gly Ala Val Pro Gly Gly Ala Val Pro 275
280 285 Gly Gly Phe Gly Pro Leu Leu
Asp Gly Trp Tyr Gly Val Asp Val Ser 290 295
300 Asp Ser Thr Val Asp Leu Ala Gln Ser Ile Val Glu
Ala Pro Gln Leu 305 310 315
320 Gly Ala Ala Ile Arg Ala Gly Arg Gly Ala Arg Val Thr Val Ser Gly
325 330 335 Gly Ser Leu
Ser Ala Pro His Gly Asn Val Ile Glu Thr Gly Gly Gly 340
345 350 Ala Arg Arg Phe Pro Pro Pro Ala
Ser Pro Leu Ser Ile Thr Leu Gln 355 360
365 Ala Gly Ala Arg Ala Gln Gly Arg Ala Leu Leu Tyr Arg
Val Leu Pro 370 375 380
Glu Pro Val Lys Leu Thr Leu Ala Gly Gly Ala Gln Gly Gln Gly Asp 385
390 395 400 Ile Val Ala Thr
Glu Leu Pro Pro Ile Pro Gly Ala Ser Ser Gly Pro 405
410 415 Leu Asp Val Ala Leu Ala Ser Gln Ala
Arg Trp Thr Gly Ala Thr Arg 420 425
430 Ala Val Asp Ser Leu Ser Ile Asp Asn Ala Thr Trp Val Met
Thr Asp 435 440 445
Asn Ser Asn Val Gly Ala Leu Arg Leu Ala Ser Asp Gly Ser Val Asp 450
455 460 Phe Gln Gln Pro Ala
Glu Ala Gly Arg Phe Lys Val Leu Met Val Asp 465 470
475 480 Thr Leu Ala Gly Ser Gly Leu Phe Arg Met
Asn Val Phe Ala Asp Leu 485 490
495 Gly Leu Ser Asp Lys Leu Val Val Met Arg Asp Ala Ser Gly Gln
His 500 505 510 Arg
Leu Trp Val Arg Asn Ser Gly Ser Glu Pro Ala Ser Ala Asn Thr 515
520 525 Met Leu Leu Val Gln Thr
Pro Arg Gly Ser Ala Ala Thr Phe Thr Leu 530 535
540 Ala Asn Lys Asp Gly Lys Val Asp Ile Gly Thr
Tyr Arg Tyr Arg Leu 545 550 555
560 Ala Ala Asn Gly Asn Gly Gln Trp Ser Leu Val Gly Ala Lys Ala Pro
565 570 575 Ser Ala
Pro Lys Pro Ala Pro Gln Pro Gly Pro Gln Pro Gly Pro Gln 580
585 590 Pro Pro Gln Pro Pro Gln Pro
Pro Gln Arg Gln Pro Glu Ala Pro Ala 595 600
605 Pro Gln Pro Pro Ala Gly Arg Glu Leu Ser Ala Ala
Ala Asn Ala Ala 610 615 620
Val Asn Thr Gly Gly Val Gly Leu Ala Ser Thr Leu Trp Tyr Ala Glu 625
630 635 640 Ser Asn Ala
Leu Ser Lys Arg Leu Gly Glu Leu Arg Leu Asn Pro Asp 645
650 655 Ala Gly Gly Ala Trp Gly Arg Gly
Phe Ala Gln Arg Gln Gln Leu Asp 660 665
670 Asn Arg Ala Gly Arg Arg Phe Asp Gln Lys Val Ala Gly
Phe Glu Leu 675 680 685
Gly Ala Asp His Ala Val Ala Val Ala Gly Gly Arg Trp His Leu Gly 690
695 700 Gly Leu Ala Gly
Tyr Thr Arg Gly Asp Arg Gly Phe Thr Gly Asp Gly 705 710
715 720 Gly Gly His Thr Asp Ser Val His Val
Gly Gly Tyr Ala Thr Tyr Ile 725 730
735 Ala Asn Ser Gly Phe Tyr Leu Asp Ala Thr Leu Arg Ala Ser
Arg Leu 740 745 750
Glu Asn Asp Phe Lys Val Ala Gly Ser Asp Gly Tyr Ala Val Lys Gly
755 760 765 Lys Tyr Arg Thr
His Gly Val Gly Val Ser Leu Glu Ala Gly Arg Arg 770
775 780 Phe Ala His Ala Asp Gly Trp Phe
Leu Glu Pro Gln Ala Glu Leu Ala 785 790
795 800 Val Phe Arg Val Gly Gly Gly Ala Tyr Arg Ala Ala
Asn Gly Leu Arg 805 810
815 Val Arg Asp Glu Gly Gly Ser Ser Val Leu Gly Arg Leu Gly Leu Glu
820 825 830 Val Gly Lys
Arg Ile Glu Leu Ala Gly Gly Arg Gln Val Gln Pro Tyr 835
840 845 Ile Lys Ala Ser Val Leu Gln Glu
Phe Asp Gly Ala Gly Thr Val Arg 850 855
860 Thr Asn Gly Ile Ala His Arg Thr Glu Leu Arg Gly Thr
Arg Ala Glu 865 870 875
880 Leu Gly Leu Gly Met Ala Ala Ala Leu Gly Arg Gly His Ser Leu Tyr
885 890 895 Ala Ser Tyr Glu
Tyr Ser Lys Gly Pro Lys Leu Ala Met Pro Trp Thr 900
905 910 Phe His Ala Gly Tyr Arg Tyr Ser Trp
915 920
User Contributions:
Comment about this patent or add new information about this topic: