Patent application title: GAMMA-SECRETASE INHIBITION REDUCE APOC3 LEVELS AND PLASMA TRIGLYCERIDES
Inventors:
IPC8 Class: AA61K3155FI
USPC Class:
1 1
Class name:
Publication date: 2019-03-28
Patent application number: 20190091234
Abstract:
A method of reducing a subject's plasma triglyceride level, comprising
administering to a subject in need thereof a gamma-secretase inhibitor in
an amount effective to reduce the subject's plasma triglyceride level.Claims:
1. A method of reducing a subject's plasma triglyceride level, comprising
administering to a subject in need thereof a gamma-secretase inhibitor in
an amount effective to reduce the subject's plasma triglyceride level.
2. A method of treating a subject afflicted with hypertriglyceridemia, comprising administering to the subject a gamma-secretase inhibitor in an amount effective to treat the subject.
3. The method of claim 1 or claim 2, wherein the administration reduces the subject's serum triglyceride level.
4. The method of claim 3, wherein the administration reduces the triglyceride level in the subject's very low-density lipoprotein (VLDL) serum fraction.
5. The method of claim 3, wherein the administration reduces the subject's serum triglyceride level and serum apolipoprotein C3 (ApoC3) level.
6. A method of reducing a subject's plasma glucose level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's glucose level.
7. The method of any one of claims 1-6, wherein administration of the gamma-secretase inhibitor inhibits whole-body gamma-secretase.
8. The method of any one of claims 1-6, wherein administration of the gamma-secretase inhibitor inhibits liver gamma-secretase without significantly inhibiting gamma-secretase elsewhere in the subject.
9. The method of any one of claims 1-6, wherein the administration of the gamma-secretase inhibitor targets the gamma-secretase inhibitor to the liver.
10. The method of claim 10, wherein the administration of the gamma-secretase inhibitor targets the gamma-secretase inhibitor to hepatocytes.
11. The method of any one of claims 8-10, wherein the gamma-secretase inhibitor is (i) coupled to a ligand molecule targeted to a receptor on a hepatic cell, or (ii) administered by a bio-nanocapsule.
12. The method of any one of claims 8-11, wherein gastrointestinal Notch inhibition is substantially uninhibited.
13. The method of any one of claims 1-12, wherein the gamma-secretase inhibitor is a small molecule inhibitor, an oligonucleotide or an adenoviral vector.
14. The method of claim 13, wherein the gamma-secretase inhibitor is an oligonucleotide.
15. The method of claim 14, wherein the oligonucleotide is an antisense oligonucleotide, an RNA-interference inducing compound, or a ribozyme.
16. The method of claim 14 or claim 15, wherein the oligonucleotide is targeted to hepatocytes.
17. The method of any one of claims 14-16, wherein the oligonucleotide comprises 1, 2, 3, 4, or 5 or more stretches of nucleotides in a sequence that is complementary to nicastrin-encoding mRNA, presenilin 1-encoding mRNA and presenilin 2-encoding mRNA, or APH1A-encoding mRNA and API1B-encoding mRNA, wherein each stretch of complementary continguous nucleotides is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
18. The method of any one of claims 14-17, wherein the oligonucleotide is modified to increase its stability in vivo.
19. The method of claim 13, wherein the gamma-secretase inhibitor is a small molecule inhibitor.
20. The method of claim 19, wherein the small molecule inhibitor is 2,2-dimethyl-N-((S)-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-N'-(2,2- ,3,3,3-pentafluoro-propyl)-malonamide, (S)-2-((S)-5,7-difluoro-1,2,3,4-tetrahydronaphthalen-3-ylamino)-N-(1-(2-m- ethyl-1-(neopentylamino)propan-2-yl)-1H-imidazol-4-yl)pentanamide, bis(fluoroalkyl)-1,4- benzodiazepinone, (2S)-2-hydroxy-3-methyl-N-((1S)-1-methyl-2-{[(1S)-3-methyl-2-oxo-2,3,4,5-- tetrahydro-1H-3-benzazepin-1-yl]amino}-2- oxoethyl)butanamide, cis-3-[4-[(4-chlorophenyl)sulfonyl]-4-(2,5-difluorophenyl)cyclohexyl] propanoic acid, dual anti-platelet study, bis(fluoroalkyl)-1,4-benzodiazepinone, or N-[(1S)-2-[[(7S)-6,7-dihydro-5-methyl-6-oxo-5H-dibenz[b, d]azepin-7-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluoro-benzeneacetamide.
21. The method of any one of claims 1-20, wherein the subject is obese.
22. The method of any one of claims 1-21, wherein the subject has hypertriglyceridemia.
23. The method of claim 22, wherein the hypertriglyceridemia is obesity-induced hypertriglyceridemia.
24. The method of any one of claims 1-23, wherein the subject has fatty liver disease.
25. The method of claims 24, wherein the subject has non-alcoholic fatty liver disease.
26. The method of any one of claims 1-25, wherein the subject has atherosclerosis.
27. The method of any one of claims 1-26, wherein the subject has coronary heart disease.
28. The method of any one of claims 1-27, wherein the subject has diabetes.
29. The method of claim 28, wherein the subject has Type 2 Diabetes.
30. The method of any one of claims 1-29, wherein the subject is a human.
31. The method of any one of claims 1-30, wherein the subject's plasma triglyceride level is >150 mg/dL.
32. The method of any one of claims 1-30, wherein the subject's plasma triglyceride level is >500 mg/dL, about 200 to 499 mg/dL, or about 150 to 199 mg/dL.
33. The method of any one of claims 1-32, wherein the subject's plasma triglyceride level is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, relative to the level prior to administration of the gamma-secretase inhibior.
34. The method of any one of claims 1-33, wherein the subject's glucose level while fasting is >100 mg/dl,.
35. The method of any one of claims 1-33, wherein the subject's glucose level two hours after eating is >140 mg/dL.
36. The method of any one of claims 1-35, wherein the subject's plasma triglyceride level is reduced by at least 5%, at least 10%, at least 15%, at least 20%, or at least 25%, relative to the level prior to administration of the gamma-secretase inhibitor.
Description:
[0001] This application claims the priority of U.S. Provisional
Application No. 62/032,324, filed Aug. 1, 2014, and U.S. Provisional
Application No. 61/936,279, filed Feb. 5, 2014 the contents of which are
hereby incorporated by reference.
[0003] This application incorporates-by-reference nucleotide and/or amino acid sequences which are present in the file named "150204_0575_86108-A-PCT_SequenceListing_MW.txt," which is 161 kilobytes in size, and which was created Feb. 4, 2015 in the IBM-PC machine format, having an operating system compatibility with MS-Windows, which is contained in the text file filed Feb. 4, 2015 as part of this application.
[0004] All publications and other references mentioned herein are incorporated by reference in their entirety, as if each individual publication or reference were specifically and individually indicated to be incorporated by reference. Publications and references cited herein are not admitted to be prior art.
BACKGROUND OF THE INVENTION
[0005] Obesity has reached epidemic status in the United States. The Centers for Disease Control has stated that more than 1/3 of American adults are obese, and estimated the medical costs attributable to obesity at $147 billion in 2008, a number that is likely to be significantly higher today and in the future. One of the core components of obesity-induced metabolic syndrome is excess plasma triglycerides. Elevated plasma triglyceride level, or hypertriglyceridemia, is an independent risk factor for coronary heart disease, above and beyond other obesity-related complications (e.g., high LDL cholesterol, low HDL cholesterol and Type 2 Diabetes). Many patients are unable to get to plasma triglyceride targets with currently available therapies.
[0006] Thus, new therapies for reducing plasma triglycerides are needed.
SUMMARY OF THE INVENTION
[0007] The invention provides a method of reducing a subject's plasma triglyceride level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's plasma triglyceride level.
[0008] The invention also provides a method of treating a subject afflicted with hypertriglyceridemia, comprising administering to the subject a gamma-secretase inhibitor in an amount effective to treat the subject.
[0009] The invention also provides a method of reducing a subject's plasma glucose level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's glucose level.
[0010] The invention also provides a method of reducing a subject's ApoC3 level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's ApoC3 level.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1: Bifurcation model of hepatic insulin signaling illustrating how reduction in Notch signaling with .gamma.-secretase inhibitor (GSI) treatment blocks mTorc1 activation, and tumorigenesis.
[0012] FIG. 2: Gamma-secretase inhibitors (GSIs) are pharmacologic inhibitors of Notch signaling.
[0013] FIG. 3: Plasma glucose levels of GSI and vehicle treated mice. *p<0.05**p<0.01***p<0.001 vs. vehicle.
[0014] FIG. 4: Serum triglyceride levels in mice treated with GSI or vehicle only. *p<0.05**p<0.01***p<0.001 vs. vehicle.
[0015] FIG. 5: VLDL, LDL, and HDL fraction serum triglyceride levels of mice administered GSI or vehicle only. *p<0.05**p<0.01***p<0.001 vs. vehicle.
[0016] FIG. 6: Lower plasma TG levels with low dose DBZ not associated with apparent GI toxicity. *p<0.05**p<0.01***p<0.001 vs. vehicle.
[0017] FIG. 7: Time course of plasma triglyceride levels of mice administered GSI or vehicle only.
[0018] FIG. 8: Time course of plasma triglyceride excursion following lipid gavage in mice administered GSI or vehicle only. *p<0.05**p<0.01***p<0.001 vs. vehicle.
[0019] FIG. 9: Glucose tolerance test (GTT) and pyruvate tolerance test (PTT) plots for control and L-Ncst mice. *p<0.05**p<0.01***p<0.001 vs. Cre-.
[0020] FIG. 10: Serum triglyceride levels for fasted and refed chow-fed L-Ncst mice.
[0021] FIG. 11: Serum lipid levels for control and L-Ncst mice. *p<0.05**p<0.01***p<0.001 vs. Cre-.
[0022] FIG. 12: Triglyceride levels by plasma fraction for control and L-Ncst mice. *p<0.05**p<0.01***p<0.001 vs. Cre-.
[0023] FIG. 13: Plasma triglyceride levels of fasted and refed control and L-Ncst mice. *p<0.05**p<0.01***p<0.001 vs. Cre-.
[0024] FIG. 14: Serum triglyceride levels in HFD-fed control and L-Ncst mice.
[0025] FIG. 15: Time course of serum triglyceride levels in control and L-Ncst mice. *p<0.05**p<0.01***p<0.001 vs. Cre-.
[0026] FIG. 16: Relative gene expression levels of fasted and refed control and L-Ncst mice.
[0027] FIG. 17: Western blot for ApoC3 serum levels in HFD-fed control and L-Ncst mice.
[0028] FIG. 18: Western blot for ApoC3 levels in HDL and VLDL serum fractions in HFD-fed control and L-Ncst mice.
[0029] FIG. 19: Western blot for hepatic ApoC3 levels in control and L-Ncst mice.
[0030] FIG. 20: Western blot for hepatic ApoC3 levels in L-Ncst mice.
[0031] FIG. 21: mRNA expression of Nicastrin and ApoC3 in fasted and refed control and L-Ncst mice.
[0032] FIG. 22: Correlation between ApoC3 (hepatic Apoc3 mRNA, hepatic ApoC3 protein, and serum ApoC3) with Plasma triglyceride.
[0033] FIG. 23: Serum triglyceride levels in HFD-fed control and L-Ncst mice following liver ApoC3 knockdown by adeno-delivered shRNA. *p<0.05**p<0.01***p<0.001 vs. Cre-.
[0034] FIG. 24: Adenoviral transduction of L-Ncst mice with ApoC3 increases plasma TG to levels comparable to Cre- control mice. p<0.05**p<0.01***p<0.001 vs. Cre-Ad-GFP mice.
[0035] FIG. 25: shRNA-mediated knockdown of Nicastrin (sequence of shRNA: CTCCTTCCACAATCGGTATTA) in rat hepatocytes reduces ApoC3 secretion.
DETAILED DESCRIPTION OF THE INVENTION
[0036] The invention provides a method of reducing a subject's plasma triglyceride level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's plasma triglyceride level.
[0037] The invention also provides a method of treating a subject afflicted with hypertriglyceridemia, comprising administering to the subject a gamma-secretase inhibitor in an amount effective to treat the subject.
[0038] In some embodiments, the administration reduces the triglyceride level in the subject's very low-density lipoprotein (VLDL) plasma fraction.
[0039] In some embodiments, the administration reduces the subject's plasma triglyceride level and apolipoprotein C3 (ApoC3) level.
[0040] In some embodiments, the administration reduces the subject's plasma triglyceride level and serum apolipoprotein C3 (ApoC3) level.
[0041] In some embodiments, the administration reduces the subject's serum triglyceride level.
[0042] In some embodiments, the administration reduces the triglyceride level in the subject's very low-density lipoprotein (VLDL) serum fraction.
[0043] In some embodiments, the administration reduces the subject's serum triglyceride level and apolipoprotein C3 (ApoC3) level.
[0044] In some embodiments, the administration reduces the subject's serum triglyceride level and serum apolipoprotein C3 (ApoC3) level.
[0045] The invention also provides a method of reducing a subject's ApoC3 level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's ApoC3 level.
[0046] In some embodiments, the administration reduces the subject's hepatic ApoC3 level.
[0047] In some embodiments, the administration reduces the subject's plasma ApoC3 level.
[0048] In some embodiments, the administration reduces subject's serum ApoC3 level.
[0049] In some embodiments, the administration reduces the ApoC3 level in the subject's HDL or VLDL serum fraction.
[0050] In some embodiments, the administration reduces the ApoC3 level in the subject's VLDL serum fraction.
[0051] In some embodiments, the administration reduces the subject's serum ApoC3 level and serum triglyceride level.
[0052] The invention also provides a method of reducing a subject's plasma glucose level, comprising administering to a subject in need thereof a gamma-secretase inhibitor in an amount effective to reduce the subject's glucose level.
[0053] In some embodiments, the administration the gamma-secretase inhibitor inhibits whole-body gamma-secretase.
[0054] In some embodiments, the administration of the gamma-secretase inhibitor inhibits liver gamma-secretase without significantly inhibiting gamma-secretase elsewhere in the subject.
[0055] In an embodiment, administration of the gamma-secretase inhibitor inhibits liver gamma-secretase without significantly inhibiting whole-body gamma-secretase.
[0056] In some embodiments, the administration of the gamma-secretase inhibitor targets the gamma-secretase inhibitor to the liver.
[0057] In some embodiments, the administration of the gamma-secretase inhibitor targets the gamma-secretase inhibitor to hepatocytes.
[0058] In some embodiments, the gamma-secretase inhibitor is (i) coupled to a ligand molecule targeted to a receptor on a hepatic cell, or (ii) administered by a bio-nanocapsule.
[0059] In some embodiments, the gastrointestinal Notch inhibition is substantially uninhibited.
[0060] In some embodiments, the gamma-secretase inhibitor is a small molecule inhibitor, an antisense oligonucleotide, or an adenoviral vector.
[0061] In some embodiments, the gamma-secretase inhibitor is a small molecule inhibitor, an oligonucleotide or an adenoviral vector.
[0062] In some embodiments, the gamma-secretase inhibitor is an oligonucleotide.
[0063] In some embodiments, the oligonucleotide is an antisense oligonucleotide, an RNA-interference inducing compound, or a ribozyme.
[0064] In some embodiments, the oligonucleotide is targeted to hepatocytes.
[0065] In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, or 5 or more stretches of nucleotides in a sequence that is complementary to nicastrin-encoding mRNA, presenilin 1-encoding mRNA and presenilin 2-encoding mRNA, or APH1A-encoding mRNA and APH1B-encoding mRNA, wherein each stretch of complementary continguous nucleotides is at least at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
[0066] In some embodiments, the oligonucleotide comprises 1, 2, 3, 4, or 5 or more stretches of nucleotides in a sequence that is complementary to nicastrin-encoding mRNA, presenilin 1-encoding mRNA, presenilin 2-encoding mRNA, APH1A-encoding mRNA, or APH1B-encoding mRNA, wherein each stretch of complementary continguous nucleotides is at least at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
[0067] In some embodiments, the oligonucleotide is modified to increase its stability in vivo.
[0068] In some embodiment the small molecule inhibitor is 804929097, PF-3084014, BMS-708163, LY450139, or MK-0752.
[0069] In some embodiments, the gamma-secretase inhibitor is a small molecule inhibitor.
[0070] In some embodiments, the small molecule inhibitor is 2,2-dimethyl-N-((S)-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-N'-(2,2- ,3,3,3-pentafluoro-propyl)-malonamide, (S)-2-((S)- 5,7-difluoro-1,2,3,4-tetrahydronaphthalen-3-ylamino)-N-(1-(2-methyl-1-(ne- opentylamino)propan-2-yl)-1H-imidazol-4-yl)pentanamide, bis(fluoroalkyl)-1,4-benzodiazepinone, (2S)-2-hydroxy-3-methyl-N-((1S)-1-methyl-2-{[(1S)-3-methyl-2-oxo-2,3,4,5-- tetrahydro-1H-3-benzazepin-1-yl]amino}-2-oxoethyl)butanamide, cis-3-[4-[(4-chlorophenyl)sulfonyl]-4-(2,5-difluorophenyl)cyclohexyl] propanoic acid, dual anti-platelet study, bis(fluoroalkyl)-1,4-benzodiazepinone, or N-[1S)-2-[[(7S)-6,7-dihydro-5-methyl-6-oxo-5H-dibenz[b,d]azepin-7-yl]amin- o]-1-methyl-2-oxoethyl]-3,5-difluoro-benzeneacetamide.
[0071] In some embodiments, the subject is obese.
[0072] In some embodiments, the subject has hypertriglyceridemia.
[0073] In some embodiments, the hypertriglyceridemia is obesity-induced hypertriglyceridemia.
[0074] In some embodiments, the subject has fatty liver disease.
[0075] In some embodiments, the subject has non-alcoholic fatty liver disease.
[0076] In some embodiments, the subject has atherosclerosis.
[0077] In some embodiments, the subject has coronary heart disease.
[0078] In some embodiments, the subject has diabetes.
[0079] In some embodiments, the subject has Type 2 Diabetes.
[0080] In some embodiments, the subject is a human.
[0081] In some embodiments, the subject's plasma triglyceride level is >150 mg/dL.
[0082] In some embodiments, the subject's plasma triglyceride level is >500 mg/dL, about 200 to 499 mg/dL, or about 150 to 199 mg/dL.
[0083] In some embodiments, the subject's plasma triglyceride level is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, relative to the level prior to administration of the gamma-secretase inhibitor.
[0084] In some embodiments, the subject's serum triglyceride level is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, relative to the level prior to administration of the gamma-secretase inhibitor.
[0085] In some embodiments, the subject's glucose level while fasting is >100 mg/dL.
[0086] In some embodiments, the subject's glucose level two hours after eating is >140 mg/dL.
[0087] In some embodiments, the subject's plasma triglyceride level is reduced by at least 5%, at least 10%, at least 15%, at least 20%, or at least 25%, relative to the level prior to administration of the gamma-secretase inhibitor.
[0088] In some embodiments, the subject's serum triglyceride level is reduced by at least 5%, at least 10%, at least 15%, at least 20%, or at least 25%, relative to the level prior to administration of the gamma-secretase inhibitor.
[0089] Each embodiment disclosed herein is contemplated as being applicable to each of the other disclosed embodiments. Thus, all combinations of the various elements described herein are within the scope of the invention.
[0090] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which this invention belongs.
Terms
[0091] As used herein, "about" in the context of a numerical value or range means .+-.10% of the numerical value or range recited or claimed, unless the context requires a more limited range.
[0092] As used herein, "effective" when referring to an amount of a gamma-secretase inhibitor refers to the quantity of gamma-secretase inhibitor which is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this invention.
[0093] As used herein, "treating a subject afflicted with hypertriglyceridemia" encompasses, e.g., reducing the subject's plasma or serum triglyceride level to less than 500 mg/dL, less than 200 mg/dL or less than 150 mg/dL.
[0094] As used herein, "a subject in need thereof" encompasses, e.g., a subject with plasma or serum triglyceride level greater than 150 mg/dL, greater than 200 mg/dL, or to greater than 500 mg/dL.
[0095] As used herein, a "gamma-secretase inhibitor" is an agent which reduces in vivo activity of a gamma-secretase complex. A gamma-secretase inhibitor may be, e.g., a small molecule, an anti-sense oligonucleotide, or an adenoviral vector.
Methods of Inhibiting Gamma-Secretase
[0096] In some embodiments, each compound administered to the subject is, independently, an organic compound having a molecular weight less than 1000 Daltons, a DNA aptamer, an RNA aptamer, a polypeptide, an antibody, an oligonucleotide, an interfering RNA (RNAi) molecule, a ribozyme, or a small molecule inhibitor.
[0097] In some embodiments, a compound that is capable of inhibiting gamma-secretase is administered to the subject.
[0098] In some embodiments, the compound which is capable of inhibiting gamma-secretase is an organic compound having a molecular weight less than 1000 Daltons.
Small Molecule Inhibitor
[0099] A small molecule inhibitor may administered herein to inhibit activity of gamma-secretase.
[0100] As used herein, "RO4929097" refers to 2,2-dimethyl-N-((S)-6-oxo-6,7-dihydro-5H-dibenzo[b,d]azepin-7-yl)-N'-(2,2- ,3,3,3-pentafluoro-propyl)-malonamide. The CAS Registry Number for RO4929097 is 847925-91-1. The structure of RO4929097 is:
##STR00001##
[0101] As used herein, "PF-3084014" refers to (S)-2-((S)-5,7-difluoro-1,2,3,4-tetrahydronaphthalen-3-ylamino)-N-(1-(2-m- ethyl-1-(neopentylamino)propan-2-yl)-1H- imidazol-4-yl)pentanamide. The CAS Registry Number for PF-03084014 is 865773-15-5. The structure of PF-03084014 is:
##STR00002##
[0102] As used herein, "BMS-708163" refers to (R)-2-(4-chloro-N-(2-fluoro-4-(1,2,4-oxadiazol-3-yl)benzyl)phenylsulfonam- ido)-5,5,5-trifluoropentanamide. The CAS Registry Number for BMS-708163 is 1146699-66-2. The structure of BMS-708163 is:
##STR00003##
[0103] As used herein, "LY450139" refers to (2S)-2-hydroxy-3-methyl-N-((1S)-1-methyl-2-{[(1S)-3-methyl-2-oxo-2,3,4,5-- tetrahydro-1H-3- benzazepin-1-yl]amino}-2-oxoethyl)butanamide. The CAS Registry Number for LY450139 is 425386-60-3. The structure of LY450139 is:
##STR00004##
[0104] As used herein, "MK-0752" refers to cis-3-[4-[(4-chlorophenyl)sulfonyl]-4-(2,5-difluorophenyl)cyclohexyl] propanoic acid. The CAS Registry Number for MK0752 is 471905-41-6. The structure of MK0752 is:
##STR00005##
[0105] As used herein, dual anti-platelet study or "DAFT" refers to N-[N-(3,5-difluorophenacetyl)-1-alanyl]-S-phenylglycine t-butyl ester. The CAS Registry Number for DAFT is 208255-80-5. The structure of DAFT is:
##STR00006##
[0106] As used herein, "BMS-906024" refers to bis(fluoroalkyl)-1,4-benzodiazepinone. The CAS Registry Number for BMS-906024 is 1401066-79-2. The structure of BMS-906024 is:
##STR00007##
[0107] As used herein, dibenzazepine or "YO-01027", refers to N-[(1S)-2-[[(7S)-6,7-dihydro-5-methyl-6-oxo-5H-dibenz[b,d]azepin-7-yl]ami- no]-1-methyl-2-oxoethyl]-3,5-difluoro-benzeneacetamide. The CAS Registry Number for dibenzazepine is 209984-56-5. The structure of dibenzazepine is:
##STR00008##
[0108] Non-limiting examples of gamma-secretase modulators which are described, for example, in the publication, Bergmans and Strooper, 2010, of which are hereby incorporated by reference in their entireties.
[0109] Non-limiting examples of gamma-secretase inhibitors which are described, for example, in the following publications: Andersson and Lendahl, 2014, Bergmans and De Strooper, 2010, Real et al., 2009, all of which are hereby incorporated by reference in their entireties.
Inhibiting Expression of Gamma-Secretase
[0110] In some embodiments, the compound which is capable of inhibiting gamma-secretase expression silences expression of a gene or silences transcription.
Oligonucleotide
[0111] Non-limiting examples of oligonucleotides capable of inhibition gamma-seretase expression include antisense oligonucleotides, ribozymes, and RNA interference molecules.
[0112] The amino acid sequence of nicastrin, NCSTN, is accessible in public databases by the GenBank accession number Q92542, and is set forth herein as SEQ ID NO: 1. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number AF240468, and is set forth herein as SEQ ID NO: 2. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number AK296153 and is set forth herein as SEQ ID NO: 3. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number AK299142, and is set forth herein as SEQ ID NO: 4. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number AK310741, and is set forth herein as SEQ ID NO: 5. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number AK314764 and is set forth herein as SEQ ID NO: 6. The nucleotide sequence of NCSTN is also accessible in public databases by the accession number AY359120, and is set forth herein as SEQ ID NO: 7. The nucleotide sequence of NCSTN is also accessible in public databases by the Genbank accession number BC047621, and is set forth herein as SEQ ID NO: 8. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number BC100024, and is set forth herein as SEQ ID NO: 9. The nucleotide sequence of NCSTN is also accessible in public databases by the GenBank accession number CN429672, and is set forth herein as SEQ ID NO: 10. The nucleotide sequence of nicastrin, NCSTN, is accessible in public databases by the GenBank accession number D87442, and is set forth herein as SEQ ID NO: 11.
[0113] The amino acid sequence of present in 1, PSEN1, is accessible in public databases by the GenBank accession number P49768, and is set forth herein as SEQ ID NO: 12. The amino acid sequence of PSEN1 is also accessible in public databases by the GenBank accession number AAL16811, and is set forth herein as SEQ ID NO: 13. The amino acid sequence which encodes NCSTN is accessible in public databases by the GenBank accession number CAA07825, and is set forth herein as SEQ ID NO: 14. The amino acid sequence of PSEN1 is also accessible in public databases by the GenBank accession number BAD96893, and is set forth herein as SEQ ID NO: 15. The amino acid sequence of PSEN1 is also accessible in public databases by the GenBank accession number BAH14071, and is set forth herein as SEQ ID NO: 16. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number BAG35430, and is set forth herein as SEQ ID NO: 17. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number AAH11729, and is set forth herein as SEQ ID NO: 18. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number AAB46416, and is set forth herein as SEQ ID NO: 19. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number AAB46370, and is set forth herein as SEQ ID NO: 20. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number AAB05894, and is set forth herein as SEQ ID NO: 21. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number AAB05895, and is set forth herein as SEQ ID NO: 22. The amino acid sequence which encodes PSEN1 is also accessible in public databases by the GenBank accession number CAA07825, and is set forth herein as SEQ ID NO: 23.
[0114] The amino acid sequence of presenilin 2, PSEN2, is accessible in public databases by the GenBank accession number P49810, and is set forth herein as SEQ ID NO: 24. The amino acid sequence of presenilin 2, PSEN2, is accessible in public databases by the GenBank accession number AAL16812, and is set forth herein as SEQ ID NO: 25. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number BAF84988, and is set forth herein as SEQ ID NO: 26. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number BAG62735, and is set forth herein as SEQ ID NO: 27. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number AAH06365, and is set forth herein as SEQ ID NO: 28. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number AAP35630, and is set forth herein as SEQ ID NO: 29. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number AAB59557, and is set forth herein as SEQ ID NO: 30. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number AAC42012, and is set forth herein as SEQ ID NO: 31. The amino acid sequence of PSEN2 is also accessible in public databases by the GenBank accession number AAC50290, and is set forth herein as SEQ ID NO: 32.
[0115] The amino acid sequence of APH1A gamma secretase subunit, APH1A, is accessible in public databases by the GenBank accession number Q96BI3, and is set forth herein as SEQ ID NO: 33. The amino acid sequence of APH1A is accessible in public databases by the GenBank accession number AAD34072, and is set forth herein as SEQ ID NO: 34. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAN63816, and is set forth herein as SEQ ID NO: 35. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAG51389, and is set forth herein as SEQ ID NO: 36. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAC11529, and is set forth herein as SEQ ID NO: 37. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAG52142, and is set forth herein as SEQ ID NO: 38. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAG60040, and is set forth herein as SEQ ID NO: 39. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAG60962, and is set forth herein as SEQ ID NO: 40. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAG60993, and is set forth herein as SEQ ID NO: 41. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number BAG62329, and is set forth herein as SEQ ID NO: 42. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number CAE11677, and is set forth herein as SEQ ID NO: 43. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number CAE11678, and is set forth herein as SEQ ID NO: 44. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAM61955, and is set forth herein as SEQ ID NO: 45. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAN61956, and is set forth herein as SEQ ID NO: 46. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAQ89310, and is set forth herein as SEQ ID NO: 47. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAH01230, and is set forth herein as SEQ ID NO: 48. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAH08732, and is set forth herein as SEQ ID NO: 49. The amino acid sequence of APH1A is also accessible in public databases by the GenBank accession number AAH09501, and is set forth herein as SEQ ID NO: 50.
[0116] The amino acid sequence of APH1B gamma secretase subunit, APH1B, is accessible in public databases by the accession number Q8WW43, and is set forth herein as SEQ ID NO: 51. The amino acid sequence of APH1B is also accessible in public databases by the accession number BAD95573, and is set forth herein as SEQ ID NO: 52. The amino acid sequence of APH1B is also accessible in public databases by the accession number BAE02660, and is set forth herein as SEQ ID NO: 53. The amino acid sequence of APH1B is also accessible in public databases by the accession number AAN63817, and is set forth herein as SEQ ID NO: 54. The amino acid sequence of APH1B is also accessible in public databases by the accession number BAF83893, and is set forth herein as SEQ ID NO: 55. The amino acid sequence of APH1B is also accessible in public databases by the accession number CA366606, and is set forth herein as SEQ ID NO: 56. The amino acid sequence of APH1B is also accessible in public databases by the accession number AAQ89061, and is set forth herein as SEQ ID NO: 57. The amino acid sequence of APH1B is also accessible in public databases by the accession number AAH20905, and is set forth herein as SEQ ID NO: 58.
[0117] In some embodiments, the compound which is capable of inhibiting gamma-secretase expression is an antisense oligonucleotide, a ribozyme, or an RNA interference molecule.
Antisense Oligonucleotide
[0118] Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of target gene products in the cell.
[0119] Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters.
[0120] Modifications of gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (Nicholls et al., 1993, J Immunol Meth 165:81-91). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
[0121] Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a target polynucleotide. Antisense oligonucleotides which comprise, for example, 1, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a target polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent nucleotides, can provide sufficient, targeting specificity for a target mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length. Noncomplementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular target polynucleotide sequence. Antisense oligonucleotides can be modified without affecting their ability to hybridize to a target polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art.
Ribozymes
[0122] Ribozymes are RNA molecules with catalytic activity (Uhlmann et al., 1987, Tetrahedron. Lett. 215, 3539-3542). Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art. The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences. The coding sequence of a polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art. For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target RNA.
[0123] Specific ribozyme cleavage sites within an RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
[0124] Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease target gene expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or VAS element, and a transcriptional teminator signal, for controlling transcription of ribozymes in the cells (U.S. Pat. No. 5,641,673). Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.
RNA Interference
[0125] An interfering RNA RNAi molecule involves mRNA degradation. The use of RNAi has been described in Fire et al., 1998, Carthew et al., 2001, and Elbashir et al., 2001, the contents of which are incorporated herein by reference.
[0126] Interfering RNA or small inhibitory RNA (RNAi) molecules include short interfering RNAs (siRNAs), repeat-associated siRNAs (rasiRNAs), and micro-RNAs (miRNAs) in all stages of processing, including shRNAs, pri-miRNAs, and pre-miRNAs. These molecules have different origins: siRNAs are processed from double-stranded precursors (dsRNAs) with two distinct strands of base-paired RNA; siRNAs that are derived from repetitive sequences in the genome are called rasiRNAs; miRNAs are derived from a single transcript that forms base-paired hairpins. Base pairing of siRNAs and miRNAs can be perfect (i.e., fully complementary) or imperfect, including bulges in the duplex region.
[0127] Interfering RNA molecules encoded by recombinase-dependent transgenes of the invention can be based on existing shRNA, siRNA, piwi-interacting RNA (piRNA), micro RNA (miRNA), double-stranded RNA (dsRNA), antisense RNA, or any other RNA species that can be cleaved inside a cell to form interfering RNAs, with compatible modifications described herein.
[0128] As used herein, an "shRNA molecule" includes a conventional stem-loop shRNA, which forms a precursor miRNA (pre-miRNA). "shRNA" also includes micro-RNA embedded shRNAs (miRNA-based shRNAs), wherein the guide strand and the passenger strand of the miRNA duplex are incorporated into an existing (or natural) miRNA or into a modified or synthetic (designed) miRNA. When transcribed, a shRNA may form a primary miRNA (pri-miRNA) or a structure very similar to a natural pri-miRNA. The pri-miRNA is subsequently processed by Drosha and its cofactors into pre-miRNA. Therefore, the term "shRNA" includes pri-miRNA (shRNA-mir) molecules and pre-miRNA molecules.
[0129] A "stem-loop structure" refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand or duplex (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (loop portion). The terms "hairpin" and "fold-back" structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and the term is used consistently with its known meaning in the art. As is known in the art, the secondary structure does not require exact base-pairing. Thus, the stem can include one or more base mismatches or bulges. Alternatively, the base-pairing can be exact, i.e. not include any mismatches.
[0130] "RNAi-expressing construct" or "RNAi construct" is a generic term that includes nucleic acid preparations designed to achieve an RNA interference effect. An RNAi-expressing construct comprises an RNAi molecule that can be cleaved in vivo to form an siRNA or a mature shRNA. For example, an RNAi construct is an expression vector capable of giving rise to a siRNA or a mature shRNA in vivo. Non-limiting examples of vectors that may be used in accordance with the present invention are described herein and will be well known to a person having ordinary skill in the art. Exemplary methods of making and delivering long or short RNAi constructs can be found, for example, in WO001/68836 and WO01/75164.
[0131] RNAi is a powerful tool for in vitro and in vivo studies of gene function in mammalian cells and for therapy in both human and veterinary contexts. Inhibition of a target gene is sequence-specific in that gene sequences corresponding to a portion of the RNAi sequence, and the target gene itself, are specifically targeted for genetic inhibition. Multiple mechanisms of utilizing RNAi in mammalian cells have been described. The first is cytoplasmic delivery of siRNA molecules, which are either chemically synthesized or generated by DICER-digestion of dsRNA. These siRNAs are introduced into cells using standard transfection methods. The siRNAs enter the RISC to silence target mRNA expression.
[0132] Another mechanism is nuclear delivery, via viral vectors, of gene expression cassettes expressing a short hairpin RNA (shRNA). The shRNA is modeled on micro interfering RNA (miRNA), an endogenous trigger of the RNAi pathway (Lu et al., 2005, Advances in Genetics 54: 117-142, Fewell et al., 2006, Drug Discovery Today 11: 975-982). Conventional shRNAs, which mimic pre-miRNA, are transcribed by RNA Polymerase II or III as single-stranded molecules that form stem-loop structures. Once produced, they exit the nucleus, are cleaved by DICER, and enter the RISC as siRNAs.
[0133] Another mechanism is identical to the second mechanism, except that the shRNA is modeled on primary miRNA (shRNAmir), rather than pre-miRNA transcripts (Fewell et al., 2006). An example is the miR-30 miRNA construct. The use of this transcript produces a more physiological shRNA that reduces toxic effects.
[0134] The shRNAmir is first cleaved to produce shRNA, and then cleaved again by DICER to produce siRNA. The siRNA is then incorporated into the RISC for target mRNA degradation. However, aspects of the present invention relate to RNAi molecules that do not require DICER cleavage. See, e.g., U.S. Pat. No. 8,273,871, the entire contents of which are incorporated herein by reference.
[0135] For mRNA degradation, translational repression, or deadenylation, mature miRNAs or siRNAs are loaded into the RNA Induced Silencing Complex (RISC) by the RISC-loading complex (RLC). Subsequently, the guide strand leads the RISC to cognate target mRNAs in a sequence-specific manner and the Slicer component of RISC hydrolyses the phosphodiester bound coupling the target mRNA nucleotides paired to nucleotide 10 and 11 of the RNA guide strand. Slicer forms together with distinct classes of small RNAs the RNAi effector complex, which is the core of RISC. Therefore, the "guide strand" is that portion of the double-stranded RNA that associates with RISC, as opposed to the "passenger strand," which is not associated with RISC.
[0136] It is not necessary that there be perfect correspondence of the sequences, but the correspondence must be sufficient to enable the RNA to direct RNAi inhibition by cleavage or blocking expression of the target mRNA. In preferred RNA molecules, the number of nucleotides which is complementary to a target sequence is 16 to 29, 18 to 23, or 21-23, or 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
[0137] Isolated RNA molecules can mediate RNAi. That is, the isolated RNA molecules of the present invention mediate degradation or block expression of mRNA that is the transcriptional product of the gene. For convenience, such mRNA may also be referred to herein as mRNA to be degraded. The terms RNA, RNA molecule(s), RNA segment(s) and RNA fragment(s) may be used interchangeably to refer to RNA that mediates RNA interference. These terms include double-stranded RNA, small interfering RNA (siRNA), hairpin RNA, single-stranded RNA, isolated RNA (partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA), as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the RNA or internally (at one or more nucleotides of the RNA). Nucleotides in the RNA molecules of the present invention can also comprise nonstandard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. Collectively, all such altered RNAi molecules are referred to as analogs or analogs of naturally-occurring RNA. RNA of the present invention need only be-sufficiently similar to natural RNA that it has the ability to mediate RNAi.
[0138] As used herein the phrase "mediate RNAi" refers to and indicates the ability to distinguish which mRNA molecules are to be afflicted with the RNAi machinery or process. RNA that mediates RNAi interacts with the RNAi machinery such that it directs the machinery to degrade particular mRNAs or to otherwise reduce the expression of the target protein. In one embodiment, the present invention relates to RNA molecules that direct cleavage of specific mRNA to which their sequence corresponds. It is not necessary that there be perfect correspondence of the sequences, but the correspondence must be sufficient to enable the RNA to direct RNAi inhibition by cleavage or blocking expression of the target mRNA.
[0139] In some embodiments, an RNAi molecule of the invention is introduced into a mammalian cell in an amount sufficient to attenuate target gene expression in a sequence specific manner. The RNAi molecules of the invention can be introduced into the cell directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to the cell. In certain embodiments the RNAi molecule can be a synthetic RNAi molecule, including RNAi molecules incorporating modified nucleotides, such as those with chemical modifications to the 2'-OH group in the ribose sugar backbone, such as 2'-O-methyl (2'OMe), 2'-fluoro (2' F) substitutions, and those containing 2'OMe, or 2'F, or 2'-deoxy, or "locked nucleic acid" (LNA) modifications. In some embodiments, an RNAi molecule of the invention contains modified nucleotides that increase the stability or half-life of the RNAi molecule in vivo and/or in vitro. Alternatively, the RNAi molecule can comprise one or more aptamers, which interact(s) with a target of interest to form an aptamer:target complex. The aptamer can be at the 5' or the 3' end of the RNAi molecule. Aptamers can be developed through the SELEX screening process and chemically synthesized. An aptamer is generally chosen to preferentially bind to a target. Suitable targets include small organic molecules, polynucleotides, polypeptides, and proteins. Proteins can be cell surface proteins, extracellular proteins, membrane proteins, or serum proteins, such as albumin. Such target molecules may be internalized by a cell, thus effecting cellular uptake of the shRNA. Other potential targets include organelles, viruses, and cells.
[0140] As noted above, the RNA molecules of the present invention in general comprise an RNA portion and some additional portion, for example a deoxyribonucleotide portion. The total number of nucleotides in the RNA molecule is suitably less than in order to be effective mediators of RNAi. In preferred RNA molecules, the number of nucleotides is 16 to 29, more preferably 18 to 23, and most preferably 21-23.
Adenoviral Vector
[0141] An adenoviral vecor encodes an oligonucleotide. The use of adenoviral vectors in gene therapy and tissue-specific targeting has been described in Beatty and Curiel, 2012, Barnett et al., 2002, and Rots et al., 2003, the contents of which are incorporated herein by reference.
Methods of Administration
[0142] "Administering" compounds in embodiments of the invention can be effected or performed using any of the various methods and delivery systems known to those skilled in the art. The administering can be, for example, intravenous, oral; intramuscular, intravascular, intra-arterial, intracoronary, intramyocardial, intraperitoneal, and subcutaneous. Other non-limiting examples include topical administration, or coating of a device to be placed within the subject.
Injectable Drug Delivery
[0143] Injectable drug delivery systems may be employed in the methods described herein include solutions, suspensions, gels.
Oral Drug Delivery
[0144] Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc). Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums, zanthans, cellulosics and sugars), humectants (e.g.; sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid), anti-caking agents, coating agents, and chelating agents (e.g., EDTA).
[0145] For oral administration in liquid dosage form, a gamma-secretase inhibitor may be combined with any oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like.
Naked Administration
[0146] The compounds used in embodiments of the present invention can be administered by naked administration.
Pharmaceutically Acceptable Carrier
[0147] The compounds used in embodiments of the present invention can be administered in a pharmaceutically acceptable carrier. As used herein, a "pharmaceutically acceptable carrier" is a pharmaceutically acceptable solvent, suspending agent or vehicle, for delivering the compounds to the subject. The carrier may be liquid or solid and is selected with the planned manner of administration in mind. Liposomes such as small unilamellar vesicles, large unilamallar vesicles, and multilamellar vesicles are also a pharmaceutically acceptable carrier. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines. The compounds may be administered as components of tissue-targeted emulsions. Examples of lipid carriers for antisense delivery are disclosed in U.S. Pat. Nos. 5,855,911 and 5,417,978, which are incorporated herein by reference. The compounds used in the methods of the present invention can be administered in admixture with suitable pharmaceutica diluents, extenders, excipients, or carriers (collectively referred to herein as a pharmaceutically acceptable carrier) suitably selected with respect to the intended form of administration and as consistent with conventional pharmaceutical practices. The unit will be in a form suitable for oral, rectal, topical, intravenous or direct injection or parenteral administration. The compounds can be administered alone or mixed with a pharmaceutically acceptable carrier. This carrier can be a solid or liquid, and the type of carrier is generally chosen based on the type of administration being used. The active agent can be co-administered in the form of a tablet or capsule, liposome, as an agglomerated powder or in a liquid form. Examples of suitable solid carriers include lactose, sucrose, gelatin and agar. Capsule or tablets can be easily formulated and can be made easy to swallow or chew; other solid forms include granules, and bulk powders. Tablets may contain suitable binders, lubricants, diluents, disintegrating agents, coloring agents, flavoring agents, flow-inducing agents, and melting agents. Examples of suitable liquid dosage forms include solutions or suspensions in water, pharmaceutically acceptable fats and oils, alcohols or other organic solvents, including esters, emulsions, syrups or elixirs, suspensions, solutions and/or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules. Such liquid dosage forms may contain, for example, suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, thickeners, and melting agents. Oral dosage forms optionally contain flavorants and coloring agents. Parenteral and intravenous forms may also include minerals and other materials to make them compatible with the type of injection or delivery system chosen.
[0148] A compound of the invention can be administered in a mixture with suitable pharmaceutical diluents, extenders, excipients, or carriers (collectively referred to herein as a pharmaceutically acceptable carrier) suitably selected with respect to the intended form of administration and as consistent with conventional pharmaceutical practices. The unit will be in a form suitable for oral, rectal, topical, intravenous or direct injection or parenteral administration. The compounds can be administered alone but are generally mixed with a pharmaceutically acceptable carrier. This carrier can be a solid or liquid, and the type of carrier is generally chosen based on the type of administration being used. In one embodiment the carrier can be a monoclonal antibody. The active agent can be co-administered in the form of a tablet or capsule, liposome, as an agglomerated powder or in a liquid form. Examples of suitable solid carriers include lactose, sucrose, gelatin and agar. Capsule or tablets can be easily formulated and can be made easy to swallow or chew; other solid forms include granules, and bulk powders. Tablets may contain suitable binders, lubricants, diluents, disintegrating agents, coloring agents, flavoring agents, flow-inducing agents, and melting agents. Examples of suitable liquid dosage forms include solutions or suspensions in water, pharmaceutically acceptable fats and oils, alcohols or other organic solvents, including esters, emulsions, syrups or elixirs, suspensions, solutions and/or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules. Such liquid dosage forms may contain, for example, suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, thickeners, and melting agents. Oral dosage forms optionally contain flavorants and coloring agents. Parenteral and intravenous forms may also include minerals and other materials to make them compatible with the type of injection or delivery system chosen.
[0149] Specific examples of pharmaceutical acceptable carriers and excipients that may be used to formulate oral dosage forms of the present invention are described in U.S. Pat. No. 3,903,297, issued Sep. 2, 1975.
Tablets
[0150] Tablets may contain suitable binders, lubricants, disintegrating agents, coloring agents, flavoring agents, flow-inducing agents, and melting agents. For instance, for oral administration in the dosage unit form of a tablet or capsule, the active drug component can be combined with an oral, non-toxic, pharmaceutically acceptable, inert carrier such as lactose, gelatin, agar, starch, sucrose, glucose, methyl cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, mannitol, sorbitol and the like. Suitable binders include starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth, or sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes, and the like. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like.
Specific Administration To Liver
[0151] Embodiments of the invention relate to specific administration to the liver or hepatocytes.
[0152] In some embodiments, a compound may specifically target the liver.
[0153] In some embodiments, a compound may specifically target hepatocytes.
[0154] In some embodiments, a compound may be specifically targeted to the liver by coupling the compound to ligand molecules, targeting the compound to a receptor on a hepatic cell, or administering the compound by a bio-nanocapsule.
[0155] A compound of the invention can also be administered by coupling of ligand molecules, such as coupling or targeting moieties on preformed nanocarriers, such as (PGA-PLA nanoparticles, PLGA nanoparticles, cyclic RGD-doxorubicin-nanoparticles, and poly(ethylene glycol)-coated biodegradable nanoparticles), by the post-insertion method, by the Avidin-Biotin complex, or before nanocarriers formulation, or by targeting receptors present on various hepatic cell, such as Asialoglycoproein receptor (ASGP-R), HDL-R, LDL-R, IgA-R, Scavenger R, Transferrin R, and Insulin R, as described in: Mishra et al., (2013) Efficient Hepatic Delivery of Drugs: Novel Strategies and Their Significance, BioMed Research International 2013: 382184, dx.doi.org/10.1155/2013/382184, the entire contents of which are incorporated herein by reference.
[0156] A compound of the invention can also be administered by bio-nanocapsule, as described in: Yu et al., (2005) The Specific delivery of proteins to human liver cells by engineered bio-nanocapsules, FEBS Journal 272: 3651-3660, dx.doi.org/10.1111/j.1742-4658.2005.04790.x, the entire contents of which are incorporated herein by reference.
[0157] In some embodiments, an oligonucleotide specifically targets the liver.
[0158] In some embodiments, an oligonucleotide specifically targets hepatocytes.
[0159] Antisense oligonucleotides of the invention can also be targeted to hepatocytes, as described in: Prakash et al., (2014) Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice, Nucleic Acids Research 42(13): 8796-8807, dx.doi.org/10,1093/nar/gku531, the entire contents of which are incorporated herein by reference.
[0160] As used herein, the term "effective amount" refers to the quantity of a component that is sufficient to treat a subject without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this invention, i.e. a therapeutically effective amount. The specific effective amount will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of subject being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.
[0161] Techniques and compositions for making dosage forms useful in the present invention are described in the following references: 7 Modern Pharmaceutics, Chapters 9 and 10 (Banker & Rhodes, Editors, 1979); Pharmaceutical Dosage Forms: Tablets (Lieberman et al., 1981); Ansel, Introduction to Pharmaceutical Dosage Forms 2nd Edition (1976); Remington's Pharmaceutical Sciences, 17th ed. (Mack Publishing Company, Easton, Pa., 1985); Advances in Pharmaceutical Sciences (David Ganderton, Trevor Jones, Eds., 1992); Advances in Pharmaceutical Sciences Vol. 7. (David Ganderton, Trevor Jones, James McGinity, Eds., 1995); Aqueous Polymeric Coatings for Pharmaceutical Dosage Forms (Drugs and the Pharmaceutical Sciences, Series 36 (James McGinity, Ed., 1989); Pharmaceutical Particulate Carriers: Therapeutic Applications: Drugs and the Pharmaceutical Sciences, Vol 61 (Alain Rolland, Ed., 1993); Drug Delivery to the Gastrointestinal Tract (Ellis Horwood Books in the Biological Sciences. Series in Pharmaceutical Technology; J. G. Hardy, S. S. Davis, Clive G. Wilson, Eds.); Modem Pharmaceutics Drugs and the Pharmaceutical Sciences, Vol 40 (Gilbert S. Banker, Christopher T. Rhodes, Eds.). All of the aforementioned publications are incorporated by reference herein.
[0162] The dosage of a compound of the invention administered in treatment will vary depending upon factors such as the pharmacodynamic characteristics of the compound and its mode and route of administration; the age, sex, metabolic rate, absorptive efficiency, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment being administered; the frequency of treatment with; and the desired therapeutic effect.
[0163] A dosage unit of the compounds of the invention may comprise a compound alone, or mixtures of a compound with additional compounds used to treat cancer. The compounds can be administered in oral dosage forms as tablets, capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups, and emulsions. The compounds may also be administered in intravenous (bolus or infusion), intraperitoneal, subcutaneous, or intramuscular form, or introduced directly, e.g. by injection or other methods, into the eye, all using dosage forms well known to those of ordinary skill in the pharmaceutical arts.
[0164] In an embodiment, the gamma-secretase inhibitor may be administered once a day, twice a day, every other day, once weekly, or twice weekly.
[0165] In an embodiment, 0.01 to 1000 mg of a gamma-secretase inhibitor is administered per administration.
[0166] A subject's triglyceride level may be expressed herein as plasma triglyceride or serum triglyceride.
[0167] A subject's apolipoprotein C3 (ApoC3) level may be expressed herein as plasma ApoC3 or serum ApoC3.
[0168] Where a range is given in the specification it is understood that the range includes all integers and 0.1 units within that range, and any sub-range thereof. For example, a range of 1 to 5 is a disclosure of 1.0, 1.1, 1.2, etc.
[0169] This invention will be better understood by reference to the Examples which follow, but those skilled in the art will readily appreciate that the specific experiments detailed are only illustrative of the invention as described more fully in the claims which follow thereafter.
Example 1. Pharmacologic Notch Inhibition Decreases Blood Glucose in Lean and Obese Mice Without Affecting Weight
[0170] The Notch signaling pathway is a highly conserved cell signaling system present in most multicellular organisms. Notch signaling is well-established as critical for cell-cell communication and control of differentiation during normal development. Notch signaling is frequently upregulated in tumors, and a variety of Notch inhibitors are in clinical development, some as advanced as Phase I/II trials, for cancer. Notch stimulates mTorc1 activity in T-cell leukemia, and reduction in Notch signaling with gamma-secretase inhibitor (GSI) treatment blocks mTorc1 activation, and tumorigenesis, as illustrated in FIG. 1. Gamma-secretase inhibitors (GSIs) are pharmacologic inhibitors of Notch signaling (FIG. 2).
[0171] There are interactions between Notch signaling and key metabolic mediators of obesity-related disease, and hepatic Notch signaling is elevated in mouse models and patients with Type 2 Diabetes (T2D) and non-alcoholic fatty liver disease (NAFLD). We hypothesized that Notch may reciprocally affect FoxO1- or mTorc1-dependent signaling, and thus carbon flux towards glucose and lipid production, and hypothesized that Notch inhibitors may be repurposed for treatment of diabetes and fatty liver disease.
[0172] Lean mice, diet induced obese (DIO) mice, and leptin-deficient obese (ob/ob) mice were administered either vehicle or GSI. GSI treatment decreased blood glucose in lean and obese mice without affecting weight as shown in Table 1.
TABLE-US-00001 TABLE 1 Lean mice, diet induced obese (DIO) mice, and leptin- deficient obese (ob/ob) mice administered gamma secretase inhibitor (GSI), dibenzazepine (DBZ). Vehicle control for all experiments is normal saline containing 0.5% methoxycellulose/0.1% Tween-80. Weight Glucose Insulin Cohort Treatment (grams) (mg/dl) (ng/ml) lean vehicle 22 .+-. 0.5 79 .+-. 4 0.4 .+-. 0.15 GSI 22 .+-. 0.6 64 .+-. 2 *** 0.49 .+-. 0.04 DIO vehicle 34 .+-. 0.9 135 .+-. 12 1.62 .+-. 1.18 GSI 33 .+-. 0.7 72 .+-. 5 *** 1.3 .+-. 0.32 ob/ob vehicle 49 .+-. 0.9 313 .+-. 33 23.2 .+-. 3.11 GSI 48 .+-. 0.9 98 .+-. 6 *** 15.6 .+-. 3.25 * * p < 0.05 ** p < 0.01 *** p < 0.001 vs. vehicle
[0173] GSI (which will be used interchangeably with the specific drug name, dibenzazepine, DBZ) treatment reduced both both fasted as well as refed (or exogenous) glucose in DIO mice as compared to vehicle (normal saline containing 0.5% methoxycellulose/0.1% Tween-80) (FIG. 3). Treatment of mice with the gamma-secretase inhibitor, dibenzazepine (DBZ) reduces fasted or refed plasma glucose (FIG. 3 Panel A), and improves glucose clearance (FIG. 3 Panel B).
Example 2. GSI Lowers Serum Triglycerides (TG)
[0174] Mice were administered GSI or vehicle alone to determine the effect of GSI treatment on serum triglyceride levels.
[0175] Mice administered GSI had lower plasma triglycerides than mice administered vehicle alone (FIG. 4). DBZ-treated obese mice, diet-induced obese (DIO) and leptin-deficient obese (ob/ob), show lower plasma triglyceride (TG) as compared to vehicle treatment. Analysis of VLDL, LDL, and HDL fractions showed that GSI lowered triglycerides in the VLDL fraction (FIG. 5). Lower plasma TG levels with low dose DNZ was not associated with apparent gastrointestinal (GI) toxicity (FIG. 6).
[0176] DBZ-induced lower plasma TG in diet-induced obese (DIO) and leptin-deficient obese (ob/ob) mice is in the VLDL fraction. GSI treated mice showed normal triglyceride secretion (FIG. 7). Normal plasma TG levels after lipoprotein lipase inhibition with Poloxamer 407 (P407) indicates that DBZ does not affect TG secretion. GSI treated mice showed less plasma triglyceride excursion after lipid gavage compared to mice administered vehicle only (FIG. 8). Lower plasma TG levels after oral olive oil gavage indicates that DBZ increases TG clearance. The combination of these pieces of data (normal TG secretion, less fasted TG and lower TG in serum after gavage) suggests either: (1) Adipose phenotype, i.e., less lipolysis of fat stores, or (2) Liver phenotype, i.e., increased TG uptake from circulation. To differentiate these--we created a liver-specific gamma-secretase knockout mouse.
Example 3. Hepatocyte-Specific Gamma-Secretase Deficiency Reduces Plasma Triglycerides
[0177] To elucidate the mechanism of the results of Example 2, a mouse that had gamma-secretase deficiency specifically in hepatocytes was created (Albumin-cre:Nicastrin fl/fl mice, henceforth L-Ncst).
[0178] L-Ncst mice showed similar glucose improvement to GSI-treated mice according to glucose tolerance test (GTT) and pyruvate tolerance test (PTT) (FIG. 9). L-Ncst (hepatocyte-specific gamma-secretase knockout) mice showed improved glucose clearance as compared to Cre- control mice, similar GSI-treatment, when challenged with either an intraperitoneal glucose (GTT) or pyruvate (PTT) load.
[0179] Chow-fed L-Ncst mice had lower plasma TG (FIG. 10). These data prove that liver .gamma.-secretase is involved in TG clearance from circulation, or in the production of a secreted protein (hepatokine) that alters TG metabolism. Of these, the likeliest target is ApoC3, an apolipoprotein produced exclusively in liver that has been proven to affect TGs. People or mice with ApoC3 deficiency show very low plasma TG, and low risk for coronary disease (CAD). Conversely, excessive production of ApoC3 is associated with high serum TG and excess CAD.
[0180] High fat diet (HFD) fed L-Ncst mice had lower refed serum triglycerides compared to control mice (FIG. 11). L-Ncst mice showed lower serum TG compared to Cre- control mice, similar to GSI-treated mice. HFD feeding increased the difference between Cre- and L-Ncst mice in serum TG. Lower p triglycerides were observed in the VLDL fraction (FIG. 12). As with GSI treatment, reduced plasma TG seen in L-Ncst mice as compared to Cre- control mice is in the VLDL fraction. Both fasted, but more markedly refed plasma triglycerides, were lower in L-Ncst mice compared to control mice (FIG. 13). Both fasted and refed serum TG are lower in L-Ncst mice than in Cre- control mice. Triglyceride secretion was unchanged in HFD-fed L-Ncst mice compared to control mice (FIG. 14). As with GSI treatment, comparable serum TG levels after lipoprotein lipase inhibition with Poloxamer 407 (P407) indicates that L-Ncst mice show similar TG secretion as Cre- control mice. As with GSI treatment, serum TG levels after olive oil gavage in L-Ncst mice as compared to Cre- controls proves that L-Ncst mice show increased TG clearance (FIG. 15).
Example 4. Lower Serum TG Observed in L-Ncst Mice is by Lower ApoC3
[0181] A gene expression analysis of hepatic genes that affect serum triglycerides showed that only Apoc3 expression was altered in the L-Ncst mice (FIG. 16). Serum ApoC3 levels were lower in HFD-fed L-Ncst mice compared to Cre- control mice (FIG. 17). Serum levels of the apolipoprotein ApoC3 levels were lower in both HDL and VLDL fractions in HFD-fed L-Ncst mice compared to Cre- control mice (FIG. 18). Hepatic ApoC3 levels were also decreased in L-Ncst mice compared to control mice (FIG. 19).
[0182] In fasted and refed L-Ncst mice, ApoC3 protein expression was was decreased in serum and liver compared to fasted and refed control mice (FIG. 20). Serum levels of the apolipoprotein ApoC3 were lower in L-Ncst mice even though liver mRNA and protein for ApoC3 were unaffected. Also, Psen2 protein expression was was decreased in liver, but no change in hepatic protein, ApoB100/48 in fasted and refed L-Ncst mice compared to control mice. Correspondingly, there was no change in Apoc3 mRNA in chow-fed L-Ncst mice (FIG. 21).
[0183] Serum ApoC3 correlated with plasma TG, but hepatic ApoC3 and Apoc3 mRNA did not correlate with plasma TG (FIG. 22). These data suggest that liver gamma-secretase is involved in either ApoC3 secretion or clearance from circulation, as only serum ApoC3 (but not hepatic Apoc3 mRNA or hepatic ApoC3 protein) are reduced in L-Ncst mice.
Example 5. Adenoviral Transduction of Cre- Control and L-Ncst Mice and shRNA Mediated Knockdown in Rat Hepatocytes
[0184] Liver ApoC3 knockdown (with adeno-delivered shRNA) eliminates difference between HFD-fed Cre- and L-Ncst mice (FIG. 23). Serum, but not hepatic, ApoC3 protein levels correlate with plasma TG. These data prove that lower serum TG observed in L-Ncst mice is by lower ApoC3. Future work will be to determine the mechanism by which this happens.
[0185] Adenoviral transduction of L-Ncst mice with ApoC3 increases serum TG to levels comparable to Cre- control mice (FIG. 24). shRNA-mediated knockdown of Nicastrin (sequence of shRNA: CTCCTTCCACAATCGGTATTA) in rat hepatocytes reduces ApoC3 secretion (FIG. 25).
Discussion
[0186] Hypertriglyceridemia is not easily treated. Currently available therapies include fibrates (fenofibrate, gemfibrozil) and other less potent triglyceride-lowering agents such as bile acid sequesterants, niacin and statins. Fibrates have been shown to reduce cardiovascular risk, but many patients are unable to reach plasma triglyceride treatment goals with these medications. As such, novel molecular targets to reduce plasma triglycerides have been long-sought.
[0187] Recent work has shown that the liver-secreted apolipoprotein, ApoC3, may impact plasma triglyceride levels. Humans with genetic variants that confer partial ApoC3 deficiency, including several Amish and Ashkenazi Jewish populations, exhibit lower plasma triglyceride levels, leading to lower risk of coronary heart disease (Pollin T I, Science, 2008). These human studies have been confirmed with mouse data--ApoC3 knockout mice demonstrate markedly lower plasma triglyceride levels (Jong et al, J Lipid Res, 2001), whereas mouse models of ApoC3 overexpression given rise to massive hypertriglyceridemia and excess atherosclerosis (Masucci-Magoulas L, et al, Science, 1997). This data was so compelling that various pharmaceutical companies are targeting ApoC3 as a potentially novel means to reduce plasma triglycerides (Gaudet D et al., N Engl J Med, 2014), and hopefully reduce atherosclerosis and consequent coronary heart disease.
[0188] The above Examples show that inhibition of the gamma-secretase complex in liver reduces both liver and circulating ApoC3, leading to lower plasma triglycerides. Gamma-secretase is a enzymatic complex composed of targeting (Nicastrin), catalytic (Presenlin) as well as regulatory subunits (Aph1, PEN2) (Tolia and De Strooper, Semin Cell Dev Biol, 2009). This enzyme is the prototype for intramembrane proteases, and its known targets include Notch receptors, Alzheimer's precursor protein (APP), and others (De Strooper and Annaert, Annu Rev Cel Dev Biol, 2010). Gamma-secretase inhibitors were developed, in part, to reduce APP cleavage to beta-amyloid, in a failed attempt to treat Alzheimer's disease (De Strooper B et al., Nat Rev Neurol, 2010). The (Andersson and Lendahl, Nat Rev Drug Disc, 2014), and perhaps even for Alzheimer's Disease (Imbimbo B P et al., Expert Opin Investig Drugs, 2011), but unlikely for chronic treatment of hypertriglyceridemia. As such, liver-specific inhibitors of the gamma-secretase, by methods described above, would be advantageous to maintain efficacy while limiting or even eliminating GI toxicity.
REFERENCES
[0189] Andersson E R and Lendahl U. Therapeutic modulation of Notch signaling--are we there yet? Nature Reviews Drug Discovery 13: 357-378 (2014).
[0190] Bergmans B A and De Strooper B. Gamma-secretases: from cell biology to therapeutic strategies. Lancet Neurol 9: 215-226 (2010).
[0191] Chan S M, Weng A P, Tibshirani R, Aster J C, and Utz P J. Notch signals positively regulate activity of the mTOR pathway in T-cell acute lumphoblastic leukemia. Blood 110(1): 278-286 (2007).
[0192] De Strooper and Annaert W. Novel research horizons for presenilins and gamma-secretase in cel biology. Annu Rev Cell Dev Biol 26: 235-260 (2010).
[0193] De Strooper B, Vassar R, and Golde T. The secretases: enzymes with therapeutic potential in Alzheimer disease. Nat Rev Neural 6(2): 99-107 (2010).
[0194] Efferson C L, Einkwlmann C T, Ware C, Sullivan T, Giampaoli S, Tammam J, Patel S, Mesiti G, Reilly J F, Gibson R E, Buser C, Yeatman T, Coppola D, Winter C, Clark E A, Draetta G F, Strack P R, and Majumder P K. Downregulation of Notch pathway by a gamma-secretase inhibitor attenuates AKT/mammalian target of rapamycin signaling and glucose uptake in an ERBB2 transgenix breast cancer model. Cancer Res 70(6): 2476-2484 (2010).
[0195] Gaudet D, Brisson D, Trembley K, Alexander V J, Singleton W, Hughes S G, Geary R S, Baker B F, Graham M J, Crooke R M, and Witzum J L. Targeting APOC3 in the familial chylomicronemia syndrome. N Engl J Med 371(3):2200-2206 (2014).
[0196] Jong M C, Rensen P C, Dahlmans V E, van der Boom H, Berkel T J, and Havekes L M. Apolipoprotein C-III deficiency accelerates triglyceride hydrolysis by lipoprotein lipase in wild-type and apoE knockoutmice. J Lipid Res 42(10): 1578-1585 (2001).
[0197] Kitamura T, Kitamura Y I, Funahashi Y, Shawber C J, Castrillon D H, Kollipara R, DePinho R A, Kitajewski J, and Accili D. A Foxo/Notch pathway controls myogenic differentiation and fiber type specification. J Clin Invest 117(9): 2477-2485 (2007).
[0198] Li S, Brown M S, Goldstein J L. Bifurcation of insulin signaling pathway in rat liver: mTORC1 required for stimulation of lipogenesis, but not inhibition of gluconeogenesis. Proc Natl Acad Sci USA 107(8):3441-3446 (2010).
[0199] Masucci-Magoulas L, Goldberg I J, Bisgaier C L, Serajuddin H, Francone O L, Breslow J L, Tall A R. A mouse model with features of familial combine hyperlipidemia. Science 275(5298): 391-394 (1997).
[0200] Mishra N, Yadav N P, Rai V K, Sinha P, Yadav K S, Jain S, and Arora S. Efficient Hepatic Delivery of Drugs: Novel Strategies and Their Significance. BioMed Research International 2013: 382184 (2013).
[0201] Pollin T I, Damcott C M, Shen H, Ott S H, Horenstein R B, Post W, McLenithan J C, Bielak L F, Peyser P A, Mitchell B D, Miller M, O'Connell J R, Shuldiner A R. A null mutation in human APOC3 confer a favorable lipid profile and apparent cardioprotection. Science 322(5908): 1702-1705 (2008).
[0202] Prakash T P, Graham J, Yu J, Carty R, Low A, Chappell A, Schmidt K, Zhao C, Aghajan M, Murray H F, Riney S, Booten S L, Murray S F, Gaus H, Crosby J, Lima W F, Guo S, Monia B P, Swayze E E, and Seth P P. Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice. Nucleic Acids Research 42(13): 8796-8807 (2014).
[0203] Real P J, Tosello V, Palmero T, Castillo M, Hernando E, de Stanchina E, Sulis M L, Barnes K, Sawai C, Homminga I, Meijerink J, Aifantis I, Basso G, Cordon-Cardo C, Ai W, and Ferrando A. Gamma secretase inhibitors reverse glucocorticoid resistance in T-ALL. Nat. Med 15(1): 50-58 (2009).
[0204] Sengupta S, Peterson T R, Laplante M, Oh S, Sabatini D M. mTORC1 controls fasting-induced ketogenesis and its modulation by ageing. Nature 468(7327): 1100-1104 (2010).
[0205] Tolia A and De Strooper B. Structure and function of gamma-secretase. Semin Cell Dev Biol 20(2): 211-218 (2009).
[0206] Valenti L, Mendoza R M, Rametta R, Maggioni M, Kitajewski C, Shawber C J, and Pajvani U B. Hepatic notch signaling correlates with insulin resistance and nonalcoholic fatty liver disease. Diabetes 62(12): 4052-4062 (2013).
[0207] Yu D, Amano C, Fukuda T, Yamada T, Kuroda S, Tanizawa K, Kondo A, Ueda M, Yamada H, Tada H, and Seno M. The specific delivery of proteins to human liver cells by engineered bio-nanocapsules. FEBS Journal 272: 3651-3660 (2005).
Sequence CWU
1
1
581709PRTHomo sapiens 1Met Ala Thr Ala Gly Gly Gly Ser Gly Ala Asp Pro Gly
Ser Arg Gly1 5 10 15Leu
Leu Arg Leu Leu Ser Phe Cys Val Leu Leu Ala Gly Leu Cys Arg 20
25 30Gly Asn Ser Val Glu Arg Lys Ile
Tyr Ile Pro Leu Asn Lys Thr Ala 35 40
45Pro Cys Val Arg Leu Leu Asn Ala Thr His Gln Ile Gly Cys Gln Ser
50 55 60Ser Ile Ser Gly Asp Thr Gly Val
Ile His Val Val Glu Lys Glu Glu65 70 75
80Asp Leu Gln Trp Val Leu Thr Asp Gly Pro Asn Pro Pro
Tyr Met Val 85 90 95Leu
Leu Glu Ser Lys His Phe Thr Arg Asp Leu Met Glu Lys Leu Lys
100 105 110Gly Arg Thr Ser Arg Ile Ala
Gly Leu Ala Val Ser Leu Thr Lys Pro 115 120
125Ser Pro Ala Ser Gly Phe Ser Pro Ser Val Gln Cys Pro Asn Asp
Gly 130 135 140Phe Gly Val Tyr Ser Asn
Ser Tyr Gly Pro Glu Phe Ala His Cys Arg145 150
155 160Glu Ile Gln Trp Asn Ser Leu Gly Asn Gly Leu
Ala Tyr Glu Asp Phe 165 170
175Ser Phe Pro Ile Phe Leu Leu Glu Asp Glu Asn Glu Thr Lys Val Ile
180 185 190Lys Gln Cys Tyr Gln Asp
His Asn Leu Ser Gln Asn Gly Ser Ala Pro 195 200
205Thr Phe Pro Leu Cys Ala Met Gln Leu Phe Ser His Met His
Ala Val 210 215 220Ile Ser Thr Ala Thr
Cys Met Arg Arg Ser Ser Ile Gln Ser Thr Phe225 230
235 240Ser Ile Asn Pro Glu Ile Val Cys Asp Pro
Leu Ser Asp Tyr Asn Val 245 250
255Trp Ser Met Leu Lys Pro Ile Asn Thr Thr Gly Thr Leu Lys Pro Asp
260 265 270Asp Arg Val Val Val
Ala Ala Thr Arg Leu Asp Ser Arg Ser Phe Phe 275
280 285Trp Asn Val Ala Pro Gly Ala Glu Ser Ala Val Ala
Ser Phe Val Thr 290 295 300Gln Leu Ala
Ala Ala Glu Ala Leu Gln Lys Ala Pro Asp Val Thr Thr305
310 315 320Leu Pro Arg Asn Val Met Phe
Val Phe Phe Gln Gly Glu Thr Phe Asp 325
330 335Tyr Ile Gly Ser Ser Arg Met Val Tyr Asp Met Glu
Lys Gly Lys Phe 340 345 350Pro
Val Gln Leu Glu Asn Val Asp Ser Phe Val Glu Leu Gly Gln Val 355
360 365Ala Leu Arg Thr Ser Leu Glu Leu Trp
Met His Thr Asp Pro Val Ser 370 375
380Gln Lys Asn Glu Ser Val Arg Asn Gln Val Glu Asp Leu Leu Ala Thr385
390 395 400Leu Glu Lys Ser
Gly Ala Gly Val Pro Ala Val Ile Leu Arg Arg Pro 405
410 415Asn Gln Ser Gln Pro Leu Pro Pro Ser Ser
Leu Gln Arg Phe Leu Arg 420 425
430Ala Arg Asn Ile Ser Gly Val Val Leu Ala Asp His Ser Gly Ala Phe
435 440 445His Asn Lys Tyr Tyr Gln Ser
Ile Tyr Asp Thr Ala Glu Asn Ile Asn 450 455
460Val Ser Tyr Pro Glu Trp Leu Ser Pro Glu Glu Asp Leu Asn Phe
Val465 470 475 480Thr Asp
Thr Ala Lys Ala Leu Ala Asp Val Ala Thr Val Leu Gly Arg
485 490 495Ala Leu Tyr Glu Leu Ala Gly
Gly Thr Asn Phe Ser Asp Thr Val Gln 500 505
510Ala Asp Pro Gln Thr Val Thr Arg Leu Leu Tyr Gly Phe Leu
Ile Lys 515 520 525Ala Asn Asn Ser
Trp Phe Gln Ser Ile Leu Arg Gln Asp Leu Arg Ser 530
535 540Tyr Leu Gly Asp Gly Pro Leu Gln His Tyr Ile Ala
Val Ser Ser Pro545 550 555
560Thr Asn Thr Thr Tyr Val Val Gln Tyr Ala Leu Ala Asn Leu Thr Gly
565 570 575Thr Val Val Asn Leu
Thr Arg Glu Gln Cys Gln Asp Pro Ser Lys Val 580
585 590Pro Ser Glu Asn Lys Asp Leu Tyr Glu Tyr Ser Trp
Val Gln Gly Pro 595 600 605Leu His
Ser Asn Glu Thr Asp Arg Leu Pro Arg Cys Val Arg Ser Thr 610
615 620Ala Arg Leu Ala Arg Ala Leu Ser Pro Ala Phe
Glu Leu Ser Gln Trp625 630 635
640Ser Ser Thr Glu Tyr Ser Thr Trp Thr Glu Ser Arg Trp Lys Asp Ile
645 650 655Arg Ala Arg Ile
Phe Leu Ile Ala Ser Lys Glu Leu Glu Leu Ile Thr 660
665 670Leu Thr Val Gly Phe Gly Ile Leu Ile Phe Ser
Leu Ile Val Thr Tyr 675 680 685Cys
Ile Asn Ala Lys Ala Asp Val Leu Phe Ile Ala Pro Arg Glu Pro 690
695 700Gly Ala Val Ser Tyr70522949DNAHomo
sapiens 2tctgcagaat tcggcttgcg cctggaaaca cgaacttccg gtctcttagg
ctccgggcca 60cagagacggt gtcagtggta gcctagagag gccgctaaca gacaggagcc
gaacgggggc 120ttccgctcag cagagaggca agatggctac ggcagggggt ggctctgggg
ctgacccggg 180aagtcggggt ctccttcgcc ttctgtcttt ctgcgtccta ctagcaggtt
tgtgcagggg 240aaactcagtg gagaggaaga tatatatccc cttaaataaa acagctccct
gtgttcgcct 300gctcaacgcc actcatcaga ttggctgcca gtcttcaatt agtggagaca
caggggttat 360ccacgtagta gagaaagagg aggacctaca gtgggtattg actgatggcc
ccaacccccc 420ttacatggtt ctgctggaga gcaagcattt taccagggat ttaatggaga
agctgaaagg 480gagaaccagc cgaattgctg gtcttgcagt gtccttgacc aagcccagtc
ctgcctcagg 540cttctctcct agtgtacagt gcccaaatga tgggtttggt gtttactcca
attcctatgg 600gccagagttt gctcactgca gagaaataca gtggaattcg ctgggcaatg
gtttggctta 660tgaagacttt agtttcccca tctttcttct tgaagatgaa aatgaaacca
aagtcatcaa 720gcagtgctat caagatcaca acctgagtca gaatggctca gcaccaacct
tcccactatg 780tgccatgcag ctcttttcac acatgcatgc tgtcatcagc actgccacct
gcatgcggcg 840cagctccatc caaagcacct tcagcatcaa cccagaaatc gtctgtgacc
ccctgtctga 900ttacaatgtg tggagcatgc taaagcctat aaatacaact gggacattaa
agcctgacga 960cagggttgtg gttgctgcca cccggctgga tagtcgttcc tttttctgga
atgtggcccc 1020aggggctgaa agcgcagtgg cttcctttgt cacccagctg gctgctgctg
aagctttgca 1080aaaggcacct gatgtgacca ccctgccccg caatgtcatg tttgtcttct
ttcaagggga 1140aacttttgac tacattggca gctcgaggat ggtctacgat atggagaagg
gcaagtttcc 1200cgtgcagtta gagaatgttg actcatttgt ggagctggga caggtggcct
taagaacttc 1260attagagctt tggatgcaca cagatcctgt ttctcagaaa aatgagtctg
tacggaacca 1320ggtggaggat ctcctggcca cattggagaa gagtggtgct ggtgtccctg
ctgtcatcct 1380caggaggcca aatcagtccc agcctctccc accatcttcc ctgcagcgat
ttcttcgagc 1440tcgaaacatc tctggcgttg ttctggctga ccactctggt gccttccata
acaaatatta 1500ccagagtatt tacgacactg ctgagaacat taatgtgagc tatcccgaat
ggctgagccc 1560tgaagaggac ctgaactttg taacagacac tgccaaggcc ctggcagatg
tggccacggt 1620gctgggacgt gctctgtatg agcttgcagg aggaaccaac ttcagcgaca
cagttcaggc 1680tgatccccaa acggttaccc gcctgctcta tgggttcctg attaaagcca
acaactcatg 1740gttccagtct atcctcaggc aggacctaag gtcctacttg ggtgacgggc
ctcttcaaca 1800ttacatcgct gtctccagcc ccaccaacac cacttatgtt gtacagtatg
ccttggcaaa 1860tttgactggc acagtggtca acctcacccg agagcagtgc caggatccaa
gtaaagtccc 1920aagtgaaaac aaggatctgt atgagtactc atgggtccag ggccctttgc
attctaatga 1980gacggaccga ctcccccggt gtgtgcgttc tactgcacga ttagccaggg
ccttgtctcc 2040tgcctttgaa ctgagtcagt ggagctctac tgaatactct acatggactg
agagccgctg 2100gaaagatatc cgtgcccgga tatttctcat cgccagcaaa gagcttgagt
tgatcaccct 2160gacagtgggc ttcggcatcc tcatcttctc cctcatcgtc acctactgca
tcaatgccaa 2220agctgatgtc cttttcattg ctccccggga gccaggagct gtgtcatact
gagsaggacc 2280scagcttttc ttgccagctc agcagttcac ttcctagagc atctgtccca
ctgggacaca 2340accactaatt tgtcactgga acctccctgg gcctgtctca gattgggatt
aacataaaag 2400agtggaacta tccaaaagag acagggagaa ataaataaat tgcctccctt
cctccgctcc 2460cctttcccat caccccttcc ccatttcctc ttccttctct actcatgcca
gattttggga 2520ttacaaatag aagcttcttg ctcctgttta actccctagt tacccaccct
aatttgccct 2580tcaggaccct tctacttttt ccttcctgcc ctgtacctct ctctgctcct
cacccccacc 2640cctgtaccca gccaccttcc tgactgggaa ggacataaaa ggtttaatgt
cagggtcaaa 2700ctacattgag cccctgagga caggggcatc tctgggctga gcctactgtc
tccttcccac 2760tgtcctttct ccaggccctc agatggcaca ttagggtggg cgtgctgcgg
gtgggtatcc 2820cacctccagc ccacagtgct cagttgtact ttttattaag ctgtaatatc
tatttttgtt 2880tttgtctttt tcctttattc tttttgtaaa tatatatata atgagtttca
ttaaaataga 2940ttatcccac
294931912DNAHomo sapiens 3ttactccaat tcctatgggc cagagtttgc
tcactgcaga gaaatacagt ggaattcgct 60gggcaatggt ttggcttatg aagactttag
tttccccatc tttcttcttg aagatgaaaa 120tgaaaccaaa gtcatcaagc agaaatcgtc
tgtgaccccc tgtctgatta caatgtgtgg 180agcatgctaa agcctataaa tacaactggg
acattaaagc ctgacgacag ggttgtggtt 240gctgccaccc ggctggatag tcgttccttt
ttctggaatg tggccccagg ggctgaaagc 300gcagtggctt cctttgtcac ccagctggct
gctgctgaag ctttgcaaaa ggcacctgat 360gtgaccaccc tgccccgcaa tgtcatgttt
gtcttctttc aaggggaaac ttttgactac 420attggcagct cgaggatggt ctacgatatg
gagaagggca agtttcccgt gcagttagag 480aatgttgact catttgtgga gctgggacag
gtggccttaa gaacttcatt agagctttgg 540atgcacacag atcctgtttc tcagaaaaat
gagtctgtac ggaaccaggt ggaggatctc 600ctggccacat tggagaagag tggtgctggt
gtccctgctg tcatcctcag gaggccaaat 660cagtcccagc ctctcccacc atcttccctg
cagcgatttc ttcgagctcg aaacatctct 720ggcgttgttc tggctgacca ctctggtgcc
ttccataaca aatattacca gagtatttac 780gacactgctg agaacattaa tgtgagctat
cccgaatggc tgagccctga agaggacctg 840aactttgtaa cagacactgc caaggccctg
gcagatgtgg ccacggtgct gggacgtgct 900ctgtatgagc ttgcaggagg aaccaacttc
agcgacacag ttcaggctga tccccaaacg 960gttacccgcc tgctctatgg gttcctgatt
aaagccaaca actcatggtt ccagtctatc 1020ctcaggcagg acctaaggtc ctacttgggt
gacgggcctc ttcaacatta catcgctgtc 1080tccagcccca ccaacaccac ttatgttgta
cagtatgcct tggcaaattt gactggcaca 1140gtggtcaacc tcacccgaga gcagtgccag
gatccaagta aagtcccaag tgaaaacaag 1200gatctgtatg agtactcatg ggtccagggc
cctttgcatt ctaatgagac ggaccgactc 1260ccccggtgtg tgcgttctac tgcacgatta
gccagggcct tgtctcctgc ctttgaactg 1320agtcagtgga gctctactga atactctaca
tggactgaga gccgctggaa agatatccgt 1380gcccggatat ttctcatcgc cagcaaagag
cttgagttga tcaccctgac agtgggcttc 1440ggcatcctca tcttctccct catcgtcacc
tactgcatca atgccaaagc tgatgtcctt 1500ttcattgttc cccgggagcc aggagctgtg
tcatactgag gaggacccca gcttttcttg 1560ccagctcagc agttcacttc ctagagcatc
tgtcccactg ggacacaacc actaatttgt 1620cactggaacc tccctgggcc tgtctcagat
tgggattaac ataaaagagt ggaactatcc 1680aaaagagaca gggagaaata aataaattgc
ctcccttcct ccgctcccct ttcccatcac 1740cccttcccca tttcctcttc cttctctact
catgccagat tttgggatta caaatagaag 1800cttcttgctc ctgtttaact ccctagttac
ccaccctaat ttgcccttca ggacccttct 1860actttttcct tcctgccctg tacctctctc
tgctcctcac ccccacccct gt 191241979DNAHomo sapiens 4agagaggcaa
gatggctacg gcagggggtg gctctggggc tgacccggga agtcggggtc 60tccttcgcct
tctgtctttc tgcgtcctac tagcaggttt gtgcagggga aactcagtgg 120agaggaagat
atatatcccc ttaaataaaa cagctccctg tgttcgcctg ctcaacgcca 180ctcatcagat
tggctgccag tcttcaatta gtggagacac aggggttatc cacgtagtag 240agaaagagga
ggacctacag tgggtattga ctgatggccc caacccccct tacatggttc 300tgctggagag
caagcatttt accagggatt taatggagaa gctgaaaggg agaaccagcc 360gaattgctgg
tcttgcagtg tccttgacca agcccagtcc tgcctcaggc ttctctccta 420gtgtacagtg
cccaaatgat gggtttggtg tttactccaa ttcctatggg ccagagtttg 480ctcactgcag
agaaatacag tggaattcgc tgggcaatgg tttggcttat gaagacttta 540gtttccccat
ctttcttctt gaagatgaaa atgaaaccaa agtcatcaag caggaaactt 600ttgactacat
tggcagctcg aggatggtct acgatatgga gaagggcaag tttcccgtgc 660agttagagaa
tgttgactca tttgtggagc tgggacaggt ggccttaaga acttcattag 720agcttttgat
gcacacagat cctgtttctc agaaaaatga gtctgtacgg aaccaggtgg 780aggatctcct
ggccacattg gagaagagtg gtgctggtgt ccctgctgtc atcctcagga 840ggccaaatca
gtcccagcct ctcccaccat cttccctgca gcgatttctt cgagctcgaa 900acatctctgg
cgttgttctg gctgaccacc ctggtgcctt ccataacaaa tattaccaga 960gtatttacga
cactgctgag aacattaatg tgagctatcc cgaatggctg agccctgaag 1020aggacctgaa
ctttgtaaca gacactgcca aggccctggc agatgtggcc acggtgctgg 1080gacgtgctct
gtatgagctt gcaggaggaa ccaacttcag cgacacagtt caggctgatc 1140cccaaacggt
tacccgcctg ctctatgggt tcctgattaa agccaacaac tcatggttcc 1200agtctatcct
caggcaggac ctaaggtcct acttgggtga cgggcctctt caacattaca 1260tcgctgtctc
cagccccacc aacaccactt atgttgtaca gtatgccttg gcaaatttga 1320ctggcacagt
ggtcaacctc acccgagagc agtgccagga tccaagtaaa gtcccaagtg 1380aaaacaagga
tctgtatgag tactcatggg tccagggccc tttgcattct aatgagacgg 1440accgactccc
ccggtgtgtg cgttctactg cacgattagc cagggccttg tctcctgcct 1500ttgaactgag
ccagtggagc tctactgaat actctacatg gactgagagc cgctggaaag 1560atatccgtgc
ccggatattt ctcatcgcca gcaaagagct tgagttgatc accctgacag 1620tgggcttcgg
catcctcatc ttctccctca tcgtcaccta ctgcatcaat gccaaagctg 1680atgtcctttt
cattgctccc cgggagccag gagctgtgtc atactgagga ggaccccagc 1740ttttcttgcc
agctcagcag ttcacttcct agagcatctg tcccactggg acacaaccac 1800taatttgtca
ctggaacctc cctgggcctg tctcagattg ggattaacat aaaagagtgg 1860aactatccaa
aagagacagg gagaaataaa taaattgcct cccttcctcc gctccccttt 1920cccatcaccc
cttccccatt tcctcttcct tctctactca tgccagattt tgggattac 19795580DNAHomo
sapiens 5cgctcagcag agaggcaaga tggctacggc agggggtggc tctggggctg
acccgggaag 60tcggggtctc cttcgccttc tgtctttctg cgtcctacta gcaggcctct
tcctggactt 120cgagcctgac cctctcccac tttgtccaga tgtctcgttt ttcccacaac
cccagccacc 180caccccacag tcgaaaggaa caggtgtgaa agttagcttt cttcctcgcg
tttagacttt 240ttgagacgaa agcaatcttg ttctgtgggt gctgtgcggc gcttaaaagg
tttgtgcagg 300ggaaactcag tggagaggaa gatatatatc cccttaaata aaacagctcc
ctgtgttcgc 360ctgctcaacg ccactcatca gattggctgc cagtcttcaa ttagtggaga
cacaggggtt 420atccacgtag tagagaaaga ggaggaccta cagtgggtat tgactgatgg
ccccaacccc 480ccttacatgg ttctgctgga gagcaagcat tttaccaggg atttaatgga
gaagctgaaa 540gggagaacca gccgaattgc tggtcttgca gtgtccttga
58062161DNAHomo sapiens 6aacgggggct tccgctcagc agagaggcaa
gatggctacg gcagggggtg gctctggggc 60tgacccggga agtcggggtc tccttcgcct
tctgtctttc tgcgtcctac tagcaggttt 120gtgcagggga aactcagtgg agaggaagat
atatatcccc ttaaataaaa cagctccctg 180tgttcgcctg ctcaacgcca ctcatcagat
tggctgccag tcttcaatta gtggagacac 240aggggttatc cacgtagtag agaaagagga
ggacctacag tgggtattga ctgatggccc 300caacccccct tacatggttc tgctggagag
caagcatttt accagggatt taatggagaa 360gctgaaaggg agaaccagcc gaattgctgg
tcttgcagtg tccttgacca agcccagtcc 420tgcctcaggc ttctctccta gtgtacagtg
cccaaatgat gggtttggtg tttactccaa 480ttcctatggg ccagagtttg ctcactgcag
agaaatacag tggaattcgc tgggcaatgg 540tttggcttat gaagacttta gtttccccat
ctttcttctt gaagatgaaa atgaaaccaa 600agtcatcaag cagtgctatc aagatcacaa
cctgagtcag aatggctcag caccaacctt 660cccactatgc gccatgcagc tcttttcaca
catgcatgct gtcatcagca ctgccacctg 720catgcggcgc agctccatcc aaagcacctt
cagcatcaac ccagaaatcg tctgtgaccc 780cctgtctgat tacaatgtgt ggagcatgct
aaagcctata aatacaactg ggacattaaa 840gcctgacgac agggttgtgg ttgctgccac
ccggctggat agtcgttcct ttttctggaa 900tgtggcccca ggggctgaaa gcgcagtggc
ttcctttgtc acccagctgg ctgctgctga 960agctttgcaa aaggcacctg atgtgaccac
cctgccccgc aatgtcatgt ttgtcttctt 1020tcaaggggaa acttttgact acattggcag
ctcgaggatg gtctacgata tggagaaggg 1080caagtttccc gtgcagttag agaatgttga
ctcatttgtg gagctgggac aggtggcctt 1140aagaacttca ttagagcttt ggatgcacac
agatcctgtt tctcagaaaa atgagtctgt 1200acggaaccag gtggaggatc tcctggccac
attggagaag agtggtgctg gtgtccctgc 1260tgtcatcctc aggaggccaa atcagtccca
gcctctccca ccatcttccc tgcagcgatt 1320tcttcgagct cgaaacatct ctggcgttgt
tctggctgac cactctggtg ccttccataa 1380caaatattac cagagtattt acgacactgc
tgagaacatt aatgtgagct atcccgaatg 1440gctgagccct gaagaggacc tgaactttgt
aacagacact gccaaggccc tggcagatgt 1500ggccacggtg ctgggacgtg ctctgtatga
gcttgcagga ggaaccaact tcagcgacac 1560agttcaggct gatccccaaa cggttacccg
cctgctctat gggttcctga ttaaagccaa 1620caactcatgg ttccagtcta tcctcaggca
ggacctaagg tcctacttgg gtgacgggcc 1680tcttcaacat tacatcgctg tctccagccc
caccaacacc acttatgttg tacagtatgc 1740cttggcgaat ttgactggca cagtggtcaa
cctcacccga gagcagtgcc aggatccaag 1800taaagtccca agtgaaaaca aggatctgta
tgagtactca tgggtccagg gccctttgca 1860ttctaatgag acggaccgac tcccccggtg
tgtgcgttct actgcacgat tagccagggc 1920cttgtctcct gcctttgaac tgagtcagtg
gagctctact gaatactcta catggactga 1980gagccgctgg aaagatatcc gtgcccggat
atttctcatc gccagcaaag agcttgagtt 2040gatcaccctg acagtgggct tcggcatcct
catcttctcc ctcatcgtca cctactgcat 2100caatgccaaa gctgatgtcc ttttcattgc
tccccgggag ccaggagctg tgtcatactg 2160a
216172806DNAHomo
sapiensmisc_feature(2157)..(2157)n is a, c, g, or t 7gatggctacg
gcagggggtg gctctggggc tgacccggga agtcggggtc tccttcgcct 60tctgtctttc
tgcgtcctac tagcaggttt gtgcagggga aactcagtgg agaggaagat 120atatatcccc
ttaaataaaa cagctccctg tgttcgcctg ctcaacgcca ctcatcagat 180tggctgccag
tcttcaatta gtggagacac aggggttatc cacgtagtag agaaagagga 240ggacctacag
tgggtattga ctgatggccc caacccccct tacatggttc tgctggagag 300caagcatttt
accagggatt taatggagaa gctgaaaggg agaaccagcc gaattgctgg 360tcttgcagtg
tccttgacca agcccagtcc tgcctcaggc ttctctccta gtgtacagtg 420cccaaatgat
gggtttggtg tttactccaa ttcctatggg ccagagtttg ctcactgcag 480agaaatacag
tggaattcgc tgggcaatgg tttggcttat gaagacttta gtttccccat 540ctttcttctt
gaagatgaaa atgaaaccaa agtcatcaag cagtgctatc aagatcacaa 600cctgagtcag
aatggctcag caccaacctt cccactatgt gccatgcagc tcttttcaca 660catgcatgct
gtcatcagca ctgccacctg catgcggcgc agctccatcc aaagcacctt 720cagcatcaac
ccagaaatcg tctgtgaccc cctgtctgat tacaatgtgt ggagcatgct 780aaagcctata
aatacaactg ggacattaaa gcctgacgac agggttgtgg ttgctgccac 840ccggctggat
agtcgttcct ttttctggaa tgtggcccca ggggctgaaa gcgcagtggc 900ttcctttgtc
acccagctgg ctgctgctga agctttgcaa aaggcacctg atgtgaccac 960cctgccccgc
aatgtcatgt ttgtcttctt tcaaggggaa acttttgact acattggcag 1020ctcgaggatg
gtctacgata tggagaaggg caagtttccc gtgcagttag agaatgttga 1080ctcatttgtg
gagctgggac aggtggcctt aagaacttca ttagagcttt ggatgcacac 1140agatcctgtt
tctcagaaaa atgagtctgt acggaaccag gtggaggatc tcctggccac 1200attggagaag
agtggtgctg gtgtccctgc tgtcatcctc aggaggccaa atcagtccca 1260gcctctccca
ccatcttccc tgcagcgatt tcttcgagct cgaaacatct ctggcgttgt 1320tctggctgac
cactctggtg ccttccataa caaatattac cagagtattt acgacactgc 1380tgagaacatt
aatgtgagct atcccgaatg gctgagccct gaagaggacc tgaactttgt 1440aacagacact
gccaaggccc tggcagatgt ggccacggtg ctgggacgtg ctctgtatga 1500gcttgcagga
ggaaccaact tcagcgacac agttcaggct gatccccaaa cggttacccg 1560cctgctctat
gggttcctga ttaaagccaa caactcatgg ttccagtcta tcctcaggca 1620ggacctaagg
tcctacttgg gtgacgggcc tcttcaacat tacatcgctg tctccagccc 1680caccaacacc
acttatgttg tacagtatgc cttggcaaat ttgactggca cagtggtcaa 1740cctcacccga
gagcagtgcc aggatccaag taaagtccca agtgaaaaca aggatctgta 1800tgagtactca
tgggtccagg gccctttgca ttctaatgag acggaccgac tcccccggtg 1860tgtgcgttct
actgcacgat tagccagggc cttgtctcct gcctttgaac tgagtcagtg 1920gagctctact
gaatactcta catggactga gagccgctgg aaagatatcc gtgcccggat 1980atttctcatc
gccagcaaag agcttgagtt gatcaccctg acagtgggct tcggcatcct 2040catcttctcc
ctcatcgtca cctactgcat caatgccaaa gctgatgtcc ttttcattgc 2100tccccgggag
ccaggagctg tgtcatactg aggaggaccc cagcttttct tgccagntca 2160gcagttcact
tcctagagca tctgtcccac tgggacacaa ccactaattt gtcactggaa 2220cctccctggg
cctgtctcag attgggatta acataaaaga gtggaactat ccaaaagaga 2280cagggagaaa
taaataaatt gcctcccttc ctccgctccc ctttcccatc accccttccc 2340catttcctct
tccttctcta ctcatgccag attttgggat tacaaataga agcttcttgc 2400tcctgtttaa
ctccctagtt acccacccta atttgccctt caggaccctt ctactttttc 2460cttcctgccc
tgtacctctc tctgctcctc acccccaccc ctgtacccag ccaccttcct 2520gactgggaag
gacataaaag gtttaatgtc agggtcaaac tacattgagc ccctgaggac 2580aggggcatct
ctgggctgag cctactgtct ccttcccact gtcctttctc caggccctca 2640gatggcacat
tagggtgggc gtgctgcggg tgggtatccc acctccagcc cacagtgctc 2700agttgtactt
tttattaagc tgtaatatct atttttgttt ttgtcttttt cctttattct 2760ttttgtaaat
atatatataa tgagtttcat taaaatagat tatccc 280683041DNAHomo
sapiens 8agagacggtg tcagtggtag cctagagagg ccgctaacag acaggagccg
aacgggggct 60tccgctcagc agagaggcaa gatggctacg gcagggggtg gctctggggc
tgacccggga 120agtcggggtc tccttcgcct tctgtctttc tgcgtcctac tagcagtgtc
actgtcaatg 180gcgctacatg gactttgtaa taaccctttg aggcacatag ctgggtgcca
tgtagaacat 240gtatctgtta cgataagtgt gtgcccaaga aatcagaaga atggacttta
atctcatttt 300agaaagtttg tgcaggggaa actcagtgga gaggaagata tatatcccct
taaataaaac 360agctccctgt gttcgcctgc tcaacgccac tcatcagatt ggctgccagt
cttcaattag 420tggagacaca ggggttatcc acgtagtaga gaaagaggag gacctacagt
gggtattgac 480tgatggcccc aacccccctt acatggttct gctggagagc aagcatttta
ccagggattt 540aatggagaag ctgaaaggga gaaccagccg aattgctggt cttgcagtgt
ccttgaccaa 600gcccagtcct gcctcaggct tctctcctag tgtacagtgc ccaaatgatg
ggtttggtgt 660ttactccaat tcctatgggc cagagtttgc tcactgcaga gaaatacagt
ggaattcgct 720gggcaatggt ttggcttatg aagactttag tttccccatc tttcttcttg
aagatgaaaa 780tgaaaccaaa gtcatcaagc agtgctatca agatcacaac ctgagtcaga
atggctcagc 840accaaccttc ccactatgtg ccatgcagct cttttcacac atgcatgctg
tcatcagcac 900tgccacctgc atgcggcgca gctccatcca aagcaccttc agcatcaacc
cagaaatcgt 960ctgtgacccc ctgtctgatt acaatgtgtg gagcatgcta aagcctataa
atacaactgg 1020gacattaaag cctgacgaca gggttgtggt tgctgccacc cggctggata
gtcgttcctt 1080tttctggaat gtggccccag gggctgaaag cgcagtggct tcctttgtca
cccagctggc 1140tgctgctgaa gctttgcaaa aggcacctga tgtgaccacc ctgccccgca
atgtcatgtt 1200tgtcttcttt caaggggaaa cttttgacta cattggcagc tcgaggatgg
tctacgatat 1260ggagaagggc aagtttcccg tgcagttaga gaatgttgac tcatttgtgg
agctgggaca 1320ggtggcctta agaacttcat tagagctttg gatgcacaca gatcctgttt
ctcagaaaaa 1380tgagtctgta cggaaccagg tggaggatct cctggccaca ttggagaaga
gtggtgctgg 1440tgtccctgct gtcatcctca ggaggccaaa tcagtcccag cctctcccac
catcttccct 1500gcagcgattt cttcgagctc gaaacatctc tggcgttgtt ctggctgacc
actctggtgc 1560cttccataac aaatattacc agagtattta cgacactgct gagaacatta
atgtgagcta 1620tcccgaatgg ctgagccctg aagaggacct gaactttgta acagacactg
ccaaggccct 1680ggcagatgtg gccacggtgc tgggacgtgc tctgtatgag cttgcaggag
gaaccaactt 1740cagcgacaca gttcaggctg atccccaaac ggttacccgc ctgctctatg
ggttcctgat 1800taaagccaac aactcatggt tccagtctat cctcaggcag gacctaaggt
cctacttggg 1860tgacgggcct cttcaacatt acatcgctgt ctccagcccc accaacacca
cttatgttgt 1920acagtatgcc ttggcaaatt tgactggcac agtggtcaac ctcacccgag
agcagtgcca 1980ggatccaagt aaagtcccaa gtgaaaacaa ggatctgtat gagtactcat
gggtccaggg 2040ccctttgcat tctaatgaga cggaccgact cccccggtgt gtgcgttcta
ctgcacgatt 2100agccagggcc ttgtctcctg cctttgaact gagtcagtgg agctctactg
aatactctac 2160atggactgag agccgctgga aagatatcca tgcccggata tttctcatcg
ccagcaaaga 2220gcttgagttg atcaccctga cagtgggctt cggcatcctc atcttctccc
tcatcgtcac 2280ctactgcatc aatgccaaag ctgatgtcct tttcattgct ccccgggagc
caggagctgt 2340gtcatactga ggaggacccc agcttttctt gccagctcag cagttcactt
cctagagcat 2400ctgtcccact gggacacaac cactaatttg tcactggaac ctccctgggc
ctgtctcaga 2460ttgggattaa cataaaagag tggaactatc caaaagagac agggagaaat
aaataaattg 2520cctcccttcc tccgctcccc tttcccatca ccccttcccc atttcctctt
ccttctctac 2580tcatgccaga ttttgggatt acaaatagaa gcttcttgct cctgtttaac
tccctagtta 2640cccaccctaa tttgcccttc aggacccttc tactttttcc ttcctgccct
gtacctctct 2700ctgctcctca cccccacccc tgtacccagc caccttcctg actgggaagg
acataaaagg 2760tttaatgtca gggtcaaact acattgagcc cctgaggaca ggggcatctc
tgggctgagc 2820ctactgtctc cttcccactg tcctttctcc aggccctcag atggcacatt
agggtgggcg 2880tgctgcgggt gggtatccca cctccagccc acagtgctca gttgtacttt
ttattaagct 2940gtaatatcta tttttgtttt tgtctttttc ctttattctt tttgtaaata
tatatataat 3000gagtttcatt aaaatagatt atcccaaaaa aaaaaaaaaa a
304192821DNAHomo sapiens 9tggctacggc agggggtggc tctggggctg
acccgggaag tcggggtctc cttcgccttc 60tgtctttctg cgtcctacta gcaggtttgt
gcaggggaaa ctcagtggag aggaagatat 120atatcccctt aaataaaaca gctccctgtg
ttcgcctgct caacgccact catcagattg 180gctgccagtc ttcaattagt ggagacacag
gggttatcca cgtagtagag aaagaggagg 240acctacagtg ggtattgact gatggcccca
acccccctta catggttctg ctggagagca 300agcattttac cagggattta atggagaagc
tgaaagggag aaccagccga attgctggtc 360ttgcagtgtc cttgaccaag cccagtcctg
cctcaggctt ctctcctagt gtacagtgcc 420caaatgatgg gtttggtgtt tactccaatt
cctatgggcc agagtttgct cactgcagag 480aaatacagtg gaattcgctg ggcaatggtt
tggcttatga agactttagt ttccccatct 540ttcttcttga agatgaaaat gaaaccaaag
tcatcaagca gtgctatcaa gatcacaacc 600tgagtcagaa tggctcagca ccaaccttcc
cactatgtgc catgcagctc ttttcacaca 660tgcatgctgt catcagcact gccacctgca
tgcggcgcag ctccatccaa agcaccttca 720gcatcaaccc agaaatcgtc tgtgaccccc
tgtctgatta caatgtgtgg agcatgctaa 780agcctataaa tacaactggg acattaaagc
ctgacgacag ggttgtggtt gctgccaccc 840ggctggatag tcgttccttt ttctggaatg
tggccccagg ggctgaaagc gcagtggctt 900cctttgtcac ccagctggct gctgctgaag
ctttgcaaaa ggcacctgat gtgaccaccc 960tgccccgcaa tgtcatgttt gtcttctttc
aaggggaaac ttttgactac attggcagct 1020cgaggatggt ctacgatgga gaagggcaag
tttcccgtgc agttagagaa tgttgactca 1080tttgtggagc tgggacaggt ggccttaaga
acttcattag agctttggat gcacacagat 1140cctgtttctc agaaaaatga gtctgtacgg
aaccaggtgg aggatctcct ggccacattg 1200gagaagagtg gtgctggtgt ccctgctgtc
atcctcagga ggccaaatca gtcccagcct 1260ctcccaccat cttccctgca gcgatttctt
cgagctcgaa acatctctgg cgttgttctg 1320gctgaccact ctggtgcctt ccataacaaa
tattaccaga gtatttacga cactgctgag 1380aacattaatg tgagctatcc cgaatggctg
agccctgaag aggacctgaa ctttgtaaca 1440gacactgcca aggccctggc agatgtggcc
acggtgctgg gacgtgctct gtatgagctt 1500gcaggaggaa ccaacttcag cgacacagtt
caggctgatc cccaaacggt tacccgcctg 1560ctctatgggt tcctgattaa agccaacaac
tcatggttcc agtctatcct caggcaggac 1620ctaaggtcct acttgggtga cgggcctctt
caacattaca tcgctgtctc cagccccacc 1680aacaccactt atgttgtaca gtatgccttg
gcaaatttga ctggcacagt ggtcaacctc 1740acccgagagc agtgccagga tccaagtaaa
gtcccaagtg aaaacaagga tctgtatgag 1800tactcatggg tccagggccc tttgcattct
aatgagacgg accgactccc ccggtgtgtg 1860cgttctactg cacgattagc cagggccttg
tctcctgcct ttgaactgag tcagtggagc 1920tctactgaat actctacatg gactgagagc
cgctggaaag atatccgtgc ccggatattt 1980ctcatcgcca gcaaagagct tgagttgatc
accctgacag tgggcttcgg catcctcatc 2040ttctccctca tcgtcaccta ctgcatcaat
gccaaagctg atgtcctttt cattgctccc 2100cgggagccag gagctgtgtc atactgagga
ggaccccagc ttttcttgcc agctcagcag 2160ttcacttcct agagcatctg tcccactggg
acacaaccac taatttgtca ctggaacctc 2220cctgggcctg tctcagattg ggattaacat
aaaagagtgg aactatccaa aagagacagg 2280gagaaataaa taaattgcct cccttcctcc
gctccccttt cccatcaccc cttccccatt 2340tcctcttcct tctctactca tgccagattt
tgggattaca aatagaagct tcttgctcct 2400gtttaactcc ctagttaccc accctaattt
gcccttcagg acccttctac tttttccttc 2460ctgccctgta cctctctctg ctcctcaccc
ccacccctgt acccagccac cttcctgact 2520gggaaggaca taaaaggttt aatgtcaggg
tcaaactaca ttgagcccct gaggacaggg 2580gcatctctgg gctgagccta ctgtctcctt
cccactgtcc tttctccagg ccctcagatg 2640gcacattagg gtgggcgtgc tgcgggtggg
tatcccacct ccagcccaca gtgctcagtt 2700gtacttttta ttaagctgta atatctattt
ttgtttttgt ctttttcctt tattcttttt 2760gtaaatatat atataatgag tttcattaaa
atagattatc ccaaaaaaaa aaaaaaaaaa 2820a
282110557DNAHomo sapiens 10aactatccaa
aagagacagg gagaaataaa taaattgcct cccttcctcc gctccccttt 60cccatcaccc
cttccccatt tcctcttcct tctctactca tgccagattt tgggattaca 120aatagaagct
tcttgctcct gtttaactcc ctagttaccc accctaattt gcccttcagg 180acccttctac
tttttccttc ctgccctgta cctctctctg ctcctcaccc ccacccctgt 240acccagccac
cttcctgact gggaaggaca taaaaggttt aatgtcaggg tcaaactaca 300ttgagcccct
gaggacaggg gcatctctgg gctgagccta ctgtctcctt cccactgtcc 360tttctccagg
ccctcagatg gcacattagg gtgggcgtgc tgcgggtggg tatcccacct 420ccagcccaca
gtgctcagtt gtacttttta ttaagctgga atatctattt ttgtttttgt 480ctttttcctt
tattcttttt gtaaatatat atataatgag tttcattaaa atagattatc 540ccacacgaaa
aaaaaaa
557112805DNAHomo sapiens 11ggctacggca gggggtggct ctggggctga cccgggaagt
cggggtctcc ttcgccttct 60gtctttctgc gtcctactag caggtttgtg caggggaaac
tcagtggaga ggaagatata 120tatcccctta aataaaacag ctccctgtgt tcgcctgctc
aacgccactc atcagattgg 180ctgccagtct tcaattagtg gagacacagg ggttatccac
gtagtagaga aagaggagga 240cctacagtgg gtattgactg atggccccaa ccccccttac
atggttctgc tggagagcaa 300gcattttacc agggatttaa tggagaagct gaaagggaga
accagccgaa ttgctggtct 360tgcagtgtcc ttgaccaagc ccagtcctgc ctcaggcttc
tctcctagtg tacagtgccc 420aaatgatggg tttggtgttt actccaattc ctatgggcca
gagtttgctc actgcagaga 480aatacagtgg aattcgctgg gcaatggttt ggcttatgaa
gactttagtt tccccatctt 540tcttcttgaa gatgaaaatg aaaccaaagt catcaagcag
tgctatcaag atcacaacct 600gagtcagaat ggctcagcac caaccttccc actatgtgcc
atgcagctct tttcacacat 660gcatgctgtc atcagcactg ccacctgcat gcggcgcagc
tccatccaaa gcaccttcag 720catcaaccca gaaatcgtct gtgaccccct gtctgattac
aatgtgtgga gcatgctaaa 780gcctataaat acaactggga cattaaagcc tgacgacagg
gttgtggttg ctgccacccg 840gctggatagt cgttcctttt tctggaatgt ggccccaggg
gctgaaagcg cagtggcttc 900ctttgtcacc cagctggctg ctgctgaagc tttgcaaaag
gcacctgatg tgaccaccct 960gccccgcaat gtcatgtttg tcttctttca aggggaaact
tttgactaca ttggcagctc 1020gaggatggtc tacgatatgg agaagggcaa gtttcccgtg
cagttagaga atgttgactc 1080atttgtggag ctgggacagg tggccttaag aacttcatta
gagctttgga tgcacacaga 1140tcctgtttct cagaaaaatg agtctgtacg gaaccaggtg
gaggatctcc tggccacatt 1200ggagaagagt ggtgctggtg tccctgctgt catcctcagg
aggccaaatc agtcccagcc 1260tctcccacca tcttccctgc agcgatttct tcgagctcga
aacatctctg gcgttgttct 1320ggctgaccac tctggtgcct tccataacaa atattaccag
agtatttacg acactgctga 1380gaacattaat gtgagctatc ccgaatggct gagccctgaa
gaggacctga actttgtaac 1440agacactgcc aaggccctgg cagatgtggc cacggtgctg
ggacgtgctc tgtatgagct 1500tgcaggagga accaacttca gcgacacagt tcaggctgat
ccccaaacgg ttacccgcct 1560gctctatggg ttcctgatta aagccaacaa ctcatggttc
cagtctatcc tcaggcagga 1620cctaaggtcc tacttgggtg acgggcctct tcaacattac
atcgctgtct ccagccccac 1680caacaccact tatgttgtac agtatgcctt ggcaaatttg
actggcacag tggtcaacct 1740cacccgagag cagtgccagg atccaagtaa agtcccaagt
gaaaacaagg atctgtatga 1800gtactcatgg gtccagggcc ctttgcattc taatgagacg
gaccgactcc cccggtgtgt 1860gcgttctact gcacgattag ccagggcctt gtctcctgcc
tttgaactga gtcagtggag 1920ctctactgaa tactctacat ggactgagag ccgctggaaa
gatatccgtg cccggatatt 1980tctcatcgcc agcaaagagc ttgagttgat caccctgaca
gtgggcttcg gcatcctcat 2040cttctccctc atcgtcacct actgcatcaa tgccaaagct
gatgtccttt tcattgctcc 2100ccgggagcca ggagctgtgt catactgagg aggaccccag
cttttcttgc cagctcagca 2160gttcacttcc tagagcatct gtcccactgg gacacaacca
ctaatttgtc actggaacct 2220ccctgggcct gtctcagatt gggattaaca taaaagagtg
gaactatcca aaagagacag 2280ggagaaataa ataaattgcc tcccttcctc cgctcccctt
tcccatcacc ccttccccat 2340ttcctcttcc ttctctactc atgccagatt ttgggattac
aaatagaagc ttcttgctcc 2400tgtttaactc cctagttacc caccctaatt tgcccttcag
gacccttcta ctttttcctt 2460cctgccctgt acctctctct gctcctcacc cccacccctg
tacccagcca ccttcctgac 2520tgggaaggac ataaaaggtt taatgtcagg gtcaaactac
attgagcccc tgaggacagg 2580ggcatctctg ggctgagcct actgtctcct tcccactgtc
ctttctccag gccctcagat 2640ggcacattag ggtgggcgtg ctgcgggtgg gtatcccacc
tccagcccac agtgctcagt 2700tgtacttttt attaagctgt aatatctatt tttgtttttg
tctttttcct ttattctttt 2760tgtaaatata tatataatga gtttcattaa aatagattat
cccac 280512467PRTHomo sapiens 12Met Thr Glu Leu Pro
Ala Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met1 5
10 15Ser Glu Asp Asn His Leu Ser Asn Thr Val Arg
Ser Gln Asn Asp Asn 20 25
30Arg Glu Arg Gln Glu His Asn Asp Arg Arg Ser Leu Gly His Pro Glu
35 40 45Pro Leu Ser Asn Gly Arg Pro Gln
Gly Asn Ser Arg Gln Val Val Glu 50 55
60Gln Asp Glu Glu Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys65
70 75 80His Val Ile Met Leu
Phe Val Pro Val Thr Leu Cys Met Val Val Val 85
90 95Val Ala Thr Ile Lys Ser Val Ser Phe Tyr Thr
Arg Lys Asp Gly Gln 100 105
110Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg
115 120 125Ala Leu His Ser Ile Leu Asn
Ala Ala Ile Met Ile Ser Val Ile Val 130 135
140Val Met Thr Ile Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr
Lys145 150 155 160Val Ile
His Ala Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu Phe Phe
165 170 175Phe Ser Phe Ile Tyr Leu Gly
Glu Val Phe Lys Thr Tyr Asn Val Ala 180 185
190Val Asp Tyr Ile Thr Val Ala Leu Leu Ile Trp Asn Phe Gly
Val Val 195 200 205Gly Met Ile Ser
Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala 210
215 220Tyr Leu Ile Met Ile Ser Ala Leu Met Ala Leu Val
Phe Ile Lys Tyr225 230 235
240Leu Pro Glu Trp Thr Ala Trp Leu Ile Leu Ala Val Ile Ser Val Tyr
245 250 255Asp Leu Val Ala Val
Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val 260
265 270Glu Thr Ala Gln Glu Arg Asn Glu Thr Leu Phe Pro
Ala Leu Ile Tyr 275 280 285Ser Ser
Thr Met Val Trp Leu Val Asn Met Ala Glu Gly Asp Pro Glu 290
295 300Ala Gln Arg Arg Val Ser Lys Asn Ser Lys Tyr
Asn Ala Glu Ser Thr305 310 315
320Glu Arg Glu Ser Gln Asp Thr Val Ala Glu Asn Asp Asp Gly Gly Phe
325 330 335Ser Glu Glu Trp
Glu Ala Gln Arg Asp Ser His Leu Gly Pro His Arg 340
345 350Ser Thr Pro Glu Ser Arg Ala Ala Val Gln Glu
Leu Ser Ser Ser Ile 355 360 365Leu
Ala Gly Glu Asp Pro Glu Glu Arg Gly Val Lys Leu Gly Leu Gly 370
375 380Asp Phe Ile Phe Tyr Ser Val Leu Val Gly
Lys Ala Ser Ala Thr Ala385 390 395
400Ser Gly Asp Trp Asn Thr Thr Ile Ala Cys Phe Val Ala Ile Leu
Ile 405 410 415Gly Leu Cys
Leu Thr Leu Leu Leu Leu Ala Ile Phe Lys Lys Ala Leu 420
425 430Pro Ala Leu Pro Ile Ser Ile Thr Phe Gly
Leu Val Phe Tyr Phe Ala 435 440
445Thr Asp Tyr Leu Val Gln Pro Phe Met Asp Gln Leu Ala Phe His Gln 450
455 460Phe Tyr Ile46513378PRTHomo sapiens
13Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met1
5 10 15Ser Glu Asp Asn His Leu
Ser Asn Thr Val Arg Ser Gln Asn Asp Asn 20 25
30Arg Glu Arg Gln Glu His Asn Asp Arg Arg Ser Leu Gly
His Pro Glu 35 40 45Pro Leu Ser
Asn Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val Glu 50
55 60Gln Asp Glu Glu Glu Asp Glu Glu Leu Thr Leu Lys
Tyr Gly Ala Lys65 70 75
80His Val Ile Met Leu Phe Val Pro Val Thr Leu Cys Met Val Val Val
85 90 95Val Ala Thr Ile Lys Ser
Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln 100
105 110Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr Glu Thr
Val Gly Gln Gly 115 120 125Ala Leu
His Ser Ile Leu Asn Ala Ala Ile Met Ile Ser Val Ile Val 130
135 140Val Met Thr Ile Leu Leu Val Val Leu Tyr Lys
Tyr Arg Cys Tyr Lys145 150 155
160Val Ile His Ala Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu Phe Phe
165 170 175Phe Ser Phe Ile
Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala 180
185 190Val Asp Tyr Ile Thr Val Ala Leu Leu Ile Trp
Asn Phe Gly Val Val 195 200 205Gly
Met Ile Ser Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala 210
215 220Tyr Leu Ile Met Ile Ser Ala Leu Met Ala
Leu Val Phe Ile Lys Tyr225 230 235
240Leu Pro Glu Trp Thr Ala Trp Leu Ile Leu Ala Val Ile Ser Val
Tyr 245 250 255Asp Leu Val
Ala Val Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val 260
265 270Glu Thr Ala Gln Glu Arg Asn Glu Thr Leu
Phe Pro Ala Leu Ile Tyr 275 280
285Ser Ser Thr Met Val Trp Leu Val Asn Met Ala Glu Gly Asp Pro Glu 290
295 300Ala Gln Arg Arg Val Ser Lys Asn
Ser Lys Tyr Asn Ala Glu Arg Ala305 310
315 320Cys Leu Pro Pro Ala Ala Ile Asn Leu Leu Ser Ile
Ala Pro Met Ala 325 330
335Pro Arg Leu Phe Met Pro Lys Gly Ala Cys Arg Pro Thr Ala Gln Lys
340 345 350Gly Ser His Lys Thr Leu
Leu Gln Arg Met Met Met Ala Gly Ser Val 355 360
365Arg Asn Gly Lys Pro Arg Gly Thr Val Ile 370
37514184PRTHomo sapiens 14Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr
Phe Gln Asn Ala Gln Met1 5 10
15Ser Glu Asp Asn His Leu Ser Asn Thr Val Arg Ser Gln Asn Asp Asn
20 25 30Arg Glu Arg Gln Glu His
Asn Asp Arg Arg Ser Leu Gly His Pro Glu 35 40
45Pro Leu Ser Asn Gly Arg Pro Gln Gly Asn Ser Arg Gln Val
Val Glu 50 55 60Gln Asp Glu Glu Glu
Asp Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys65 70
75 80His Val Ile Met Leu Phe Val Pro Val Thr
Leu Cys Met Val Val Val 85 90
95Val Ala Thr Ile Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln
100 105 110Leu Ile Tyr Thr Pro
Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg 115
120 125Ala Leu His Ser Ile Leu Asn Ala Ala Ile Met Ile
Ser Val Ile Val 130 135 140Val Met Thr
Ile Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr Lys145
150 155 160Val Ser Met Arg His Arg Ser
Leu Leu Ser Thr Leu Phe Phe Leu Trp 165
170 175Leu Gly Ile Leu Val Thr Val Thr
18015463PRTHomo sapiens 15Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe Gln
Asn Ala Gln Met1 5 10
15Ser Glu Asp Asn His Leu Ser Asn Thr Asn Asp Asn Arg Glu Arg Gln
20 25 30Glu His Asn Asp Arg Arg Ser
Leu Gly His Pro Glu Pro Leu Ser Asn 35 40
45Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val Glu Gln Asp Glu
Glu 50 55 60Glu Asp Glu Glu Leu Thr
Leu Lys Tyr Gly Ala Lys His Val Ile Met65 70
75 80Leu Phe Val Pro Val Thr Leu Cys Met Val Val
Val Val Ala Thr Ile 85 90
95Lys Ser Val Ser Phe Tyr Thr Pro Lys Asp Gly Gln Leu Ile Tyr Thr
100 105 110Pro Phe Thr Glu Asp Thr
Glu Thr Val Gly Gln Arg Ala Leu His Ser 115 120
125Ile Leu Asn Ala Ala Ile Met Ile Ser Val Ile Val Val Met
Thr Ile 130 135 140Leu Leu Val Val Leu
Tyr Lys Tyr Arg Cys Tyr Lys Val Ile His Ala145 150
155 160Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu
Phe Phe Phe Ser Phe Ile 165 170
175Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala Val Asp Tyr Ile
180 185 190Thr Val Ala Leu Leu
Ile Trp Asn Phe Gly Val Val Gly Met Ile Ser 195
200 205Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala
Tyr Leu Ile Met 210 215 220Ile Ser Ala
Leu Met Ala Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp225
230 235 240Thr Ala Trp Leu Ile Leu Ala
Val Ile Ser Val Tyr Asp Leu Val Ala 245
250 255Val Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val
Glu Thr Ala Gln 260 265 270Glu
Arg Asn Glu Thr Leu Phe Pro Ala Leu Ile Tyr Ser Ser Thr Met 275
280 285Val Trp Leu Val Asn Met Ala Glu Gly
Asp Pro Gly Ala Gln Arg Arg 290 295
300Val Ser Lys Asn Ser Lys Tyr Asn Ala Glu Ser Thr Glu Arg Glu Ser305
310 315 320Gln Asp Thr Val
Ala Glu Asn Asp Asp Gly Gly Phe Ser Glu Glu Trp 325
330 335Glu Ala Gln Arg Asp Ser His Leu Gly Pro
His Arg Ser Thr Pro Glu 340 345
350Ser Arg Ala Ala Val Gln Glu Leu Ser Ser Ser Ile Leu Ala Gly Glu
355 360 365Asp Pro Glu Glu Arg Gly Val
Lys Leu Gly Leu Gly Asp Phe Ile Phe 370 375
380Tyr Ser Val Leu Val Gly Lys Ala Ser Ala Thr Ala Ser Gly Asp
Trp385 390 395 400Asn Thr
Thr Ile Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys Leu
405 410 415Thr Leu Leu Leu Leu Ala Ile
Phe Lys Lys Ala Leu Pro Ala Leu Pro 420 425
430Ile Ser Ile Thr Phe Gly Leu Val Phe Tyr Phe Ala Thr Asp
Tyr Leu 435 440 445Val Gln Pro Phe
Met Asp Gln Leu Ala Phe His Gln Phe Tyr Ile 450 455
46016264PRTHomo sapiens 16Met Thr Glu Leu Pro Ala Pro Leu
Ser Tyr Phe Gln Asn Ala Gln Met1 5 10
15Ser Glu Asp Asn His Leu Ser Asn Thr Asn Asp Asn Arg Glu
Arg Gln 20 25 30Glu His Asn
Asp Arg Arg Ser Leu Gly His Pro Glu Pro Leu Ser Asn 35
40 45Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val
Glu Gln Asp Glu Glu 50 55 60Glu Asp
Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys His Val Ile Met65
70 75 80Leu Phe Val Pro Val Thr Leu
Cys Met Val Trp Leu Val Asn Met Ala 85 90
95Glu Gly Asn Pro Glu Ala Gln Arg Arg Val Ser Lys Asn
Ser Lys Tyr 100 105 110Asn Ala
Glu Ser Thr Glu Arg Glu Ser Gln Asp Thr Val Ala Glu Asn 115
120 125Asp Asp Gly Gly Phe Ser Glu Glu Trp Glu
Ala Gln Arg Asp Ser His 130 135 140Leu
Gly Pro His Arg Ser Thr Pro Glu Ser Arg Ala Ala Val Gln Glu145
150 155 160Leu Ser Ser Ser Ile Leu
Ala Gly Glu Asp Pro Glu Glu Arg Gly Val 165
170 175Lys Leu Gly Leu Gly Asp Phe Ile Phe Tyr Ser Val
Leu Val Gly Lys 180 185 190Ala
Ser Ala Thr Ala Ser Gly Asp Trp Asn Thr Thr Ile Ala Cys Phe 195
200 205Val Ala Ile Leu Ile Gly Leu Cys Leu
Thr Leu Leu Leu Leu Ala Ile 210 215
220Phe Lys Lys Ala Leu Pro Ala Leu Pro Ile Ser Ile Thr Phe Gly Leu225
230 235 240Val Phe Tyr Phe
Ala Thr Asp Tyr Leu Val Gln Pro Phe Met Asp Gln 245
250 255Leu Ala Phe His Gln Phe Tyr Ile
26017467PRTHomo sapiens 17Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe
Gln Asn Ala Gln Met1 5 10
15Ser Glu Asp Asn His Leu Ser Asn Thr Val Arg Ser Gln Asn Asp Asn
20 25 30Arg Glu Arg Gln Glu His Asn
Asp Arg Arg Ser Leu Gly His Pro Glu 35 40
45Pro Leu Ser Asn Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val
Glu 50 55 60Gln Asp Glu Glu Glu Asp
Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys65 70
75 80His Val Ile Met Leu Phe Val Pro Val Thr Leu
Cys Met Val Val Val 85 90
95Val Ala Thr Ile Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln
100 105 110Leu Ile Tyr Thr Pro Phe
Thr Glu Asp Thr Glu Thr Val Gly Gln Arg 115 120
125Ala Leu His Ser Ile Leu Asn Ala Ala Ile Met Ile Ser Val
Ile Val 130 135 140Val Met Thr Ile Leu
Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr Lys145 150
155 160Val Ile His Ala Trp Leu Ile Ile Ser Ser
Leu Leu Leu Leu Phe Phe 165 170
175Phe Ser Phe Ile Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala
180 185 190Val Asp Tyr Ile Thr
Val Ala Leu Leu Ile Trp Asn Phe Gly Val Val 195
200 205Gly Met Ile Ser Ile His Trp Lys Gly Pro Leu Arg
Leu Gln Gln Ala 210 215 220Tyr Leu Ile
Met Ile Ser Ala Leu Met Ala Leu Val Phe Ile Lys Tyr225
230 235 240Leu Pro Glu Trp Thr Ala Trp
Leu Ile Leu Ala Val Ile Ser Val Tyr 245
250 255Asp Leu Val Ala Val Leu Cys Pro Lys Gly Pro Leu
Arg Met Leu Val 260 265 270Glu
Thr Ala Gln Glu Arg Asn Glu Thr Leu Phe Pro Ala Leu Ile Tyr 275
280 285Ser Ser Thr Met Val Trp Leu Val Asn
Met Ala Glu Gly Asp Pro Glu 290 295
300Ala Gln Arg Arg Val Ser Lys Asn Ser Lys Tyr Asn Ala Glu Ser Thr305
310 315 320Glu Arg Glu Ser
Gln Asp Thr Val Ala Glu Asn Asp Asp Gly Gly Phe 325
330 335Ser Glu Glu Trp Glu Ala Gln Arg Asp Ser
His Leu Gly Pro His Arg 340 345
350Ser Thr Pro Glu Ser Arg Ala Ala Val Gln Glu Leu Ser Ser Ser Ile
355 360 365Leu Ala Gly Glu Asp Pro Glu
Glu Arg Gly Val Lys Leu Gly Leu Gly 370 375
380Asp Phe Ile Phe Tyr Ser Val Leu Val Gly Lys Ala Ser Ala Thr
Ala385 390 395 400Ser Gly
Asp Trp Asn Thr Thr Ile Ala Cys Phe Val Ala Ile Leu Ile
405 410 415Gly Leu Cys Leu Thr Leu Leu
Leu Leu Ala Ile Phe Lys Lys Ala Leu 420 425
430Pro Ala Leu Pro Ile Ser Ile Thr Phe Gly Leu Val Phe Tyr
Phe Ala 435 440 445Thr Asp Tyr Leu
Val Gln Pro Phe Met Asp Gln Leu Ala Phe His Gln 450
455 460Phe Tyr Ile46518463PRTHomo sapiens 18Met Thr Glu
Leu Pro Ala Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met1 5
10 15Ser Glu Asp Asn His Leu Ser Asn Thr
Asn Asp Asn Arg Glu Arg Gln 20 25
30Glu His Asn Asp Arg Arg Ser Leu Gly His Pro Glu Pro Leu Ser Asn
35 40 45Gly Arg Pro Gln Gly Asn Ser
Arg Gln Val Val Glu Gln Asp Glu Glu 50 55
60Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys His Val Ile Met65
70 75 80Leu Phe Val Pro
Val Thr Leu Cys Met Val Val Val Val Ala Thr Ile 85
90 95Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp
Gly Gln Leu Ile Tyr Thr 100 105
110Pro Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg Ala Leu His Ser
115 120 125Ile Leu Asn Ala Ala Ile Met
Ile Ser Val Ile Val Val Met Thr Ile 130 135
140Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr Lys Val Ile His
Ala145 150 155 160Trp Leu
Ile Ile Ser Ser Leu Leu Leu Leu Phe Phe Phe Ser Phe Ile
165 170 175Tyr Leu Gly Glu Val Phe Lys
Thr Tyr Asn Val Ala Val Asp Tyr Ile 180 185
190Thr Val Ala Leu Leu Ile Trp Asn Phe Gly Val Val Gly Met
Ile Ser 195 200 205Ile His Trp Lys
Gly Pro Leu Arg Leu Gln Gln Ala Tyr Leu Ile Met 210
215 220Ile Ser Ala Leu Met Ala Leu Val Phe Ile Lys Tyr
Leu Pro Glu Trp225 230 235
240Thr Ala Trp Leu Ile Leu Ala Val Ile Ser Val Tyr Asp Leu Val Ala
245 250 255Val Leu Cys Pro Lys
Gly Pro Leu Arg Met Leu Val Glu Thr Ala Gln 260
265 270Glu Arg Asn Glu Thr Leu Phe Pro Ala Leu Ile Tyr
Ser Ser Thr Met 275 280 285Val Trp
Leu Val Asn Met Ala Glu Gly Asp Pro Glu Ala Gln Arg Arg 290
295 300Val Ser Lys Asn Ser Lys Tyr Asn Ala Glu Ser
Thr Glu Arg Glu Ser305 310 315
320Gln Asp Thr Val Ala Glu Asn Asp Asp Gly Gly Phe Ser Glu Glu Trp
325 330 335Glu Ala Gln Arg
Asp Ser His Leu Gly Pro His Arg Ser Thr Pro Glu 340
345 350Ser Arg Ala Ala Val Gln Glu Leu Ser Ser Ser
Ile Leu Ala Gly Glu 355 360 365Asp
Pro Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp Phe Ile Phe 370
375 380Tyr Ser Val Leu Val Gly Lys Ala Ser Ala
Thr Ala Ser Gly Asp Trp385 390 395
400Asn Thr Thr Ile Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys
Leu 405 410 415Thr Leu Leu
Leu Leu Ala Ile Phe Lys Lys Ala Leu Pro Ala Leu Pro 420
425 430Ile Ser Ile Thr Phe Gly Leu Val Phe Tyr
Phe Ala Thr Asp Tyr Leu 435 440
445Val Gln Pro Phe Met Asp Gln Leu Ala Phe His Gln Phe Tyr Ile 450
455 46019467PRTHomo sapiens 19Met Thr Glu Leu
Pro Ala Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met1 5
10 15Ser Glu Asp Asn His Leu Ser Asn Thr Val
Arg Ser Gln Asn Asp Asn 20 25
30Arg Glu Arg Gln Glu His Asn Asp Arg Arg Ser Leu Gly His Pro Glu
35 40 45Pro Leu Ser Asn Gly Arg Pro Gln
Gly Asn Ser Arg Gln Val Val Glu 50 55
60Gln Asp Glu Glu Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys65
70 75 80His Val Ile Met Leu
Phe Val Pro Val Thr Leu Cys Met Val Val Val 85
90 95Val Ala Thr Ile Lys Ser Val Ser Phe Tyr Thr
Arg Lys Asp Gly Gln 100 105
110Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg
115 120 125Ala Leu His Ser Ile Leu Asn
Ala Ala Ile Met Ile Ser Val Ile Val 130 135
140Val Met Thr Ile Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr
Lys145 150 155 160Val Ile
His Ala Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu Phe Phe
165 170 175Phe Ser Phe Ile Tyr Leu Gly
Glu Val Phe Lys Thr Tyr Asn Val Ala 180 185
190Val Asp Tyr Ile Thr Val Ala Leu Leu Ile Trp Asn Phe Gly
Val Val 195 200 205Gly Met Ile Ser
Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala 210
215 220Tyr Leu Ile Met Ile Ser Ala Leu Met Ala Leu Val
Phe Ile Lys Tyr225 230 235
240Leu Pro Glu Trp Thr Ala Trp Leu Ile Leu Ala Val Ile Ser Val Tyr
245 250 255Asp Leu Val Ala Val
Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val 260
265 270Glu Thr Ala Gln Glu Arg Asn Glu Thr Leu Phe Pro
Ala Leu Ile Tyr 275 280 285Ser Ser
Thr Met Val Trp Leu Val Asn Met Ala Glu Gly Asp Pro Glu 290
295 300Ala Gln Arg Arg Val Ser Lys Asn Ser Lys Tyr
Asn Ala Glu Ser Thr305 310 315
320Glu Arg Glu Ser Gln Asp Thr Val Ala Glu Asn Asp Asp Gly Gly Phe
325 330 335Ser Glu Glu Trp
Glu Ala Gln Arg Asp Ser His Leu Gly Pro His Arg 340
345 350Ser Thr Pro Glu Ser Arg Ala Ala Val Gln Glu
Leu Ser Ser Ser Ile 355 360 365Leu
Ala Gly Glu Asp Pro Glu Glu Arg Gly Val Lys Leu Gly Leu Gly 370
375 380Asp Phe Ile Phe Tyr Ser Val Leu Val Gly
Lys Ala Ser Ala Thr Ala385 390 395
400Ser Gly Asp Trp Asn Thr Thr Ile Ala Cys Phe Val Ala Ile Leu
Ile 405 410 415Gly Leu Cys
Leu Thr Leu Leu Leu Leu Ala Ile Phe Lys Lys Ala Leu 420
425 430Pro Ala Leu Pro Ile Ser Ile Thr Phe Gly
Leu Val Phe Tyr Phe Ala 435 440
445Thr Asp Tyr Leu Val Gln Pro Phe Met Asp Gln Leu Ala Phe His Gln 450
455 460Phe Tyr Ile46520463PRTHomo sapiens
20Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met1
5 10 15Ser Glu Asp Asn His Leu
Ser Asn Thr Asn Asp Asn Arg Glu Arg Gln 20 25
30Glu His Asn Asp Arg Arg Ser Leu Gly His Pro Glu Pro
Leu Ser Asn 35 40 45Gly Arg Pro
Gln Gly Asn Ser Arg Gln Val Val Glu Gln Asp Glu Glu 50
55 60Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys
His Val Ile Met65 70 75
80Leu Phe Val Pro Val Thr Leu Cys Met Val Val Val Val Ala Thr Ile
85 90 95Lys Ser Val Ser Phe Tyr
Thr Arg Lys Asp Gly Gln Leu Ile Tyr Thr 100
105 110Pro Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg
Ala Leu His Ser 115 120 125Ile Leu
Asn Ala Ala Ile Met Ile Ser Val Ile Val Val Met Thr Ile 130
135 140Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr
Lys Val Ile His Ala145 150 155
160Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu Phe Phe Phe Ser Phe Ile
165 170 175Tyr Leu Gly Glu
Val Phe Lys Thr Tyr Asn Val Ala Val Asp Tyr Ile 180
185 190Thr Val Ala Leu Leu Ile Trp Asn Leu Gly Val
Val Gly Met Ile Ser 195 200 205Ile
His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala Tyr Leu Ile Met 210
215 220Ile Ser Ala Leu Met Ala Leu Val Phe Ile
Lys Tyr Leu Pro Glu Trp225 230 235
240Thr Ala Trp Leu Ile Leu Ala Val Ile Ser Val Tyr Asp Leu Val
Ala 245 250 255Val Leu Cys
Pro Lys Gly Pro Leu Arg Met Leu Val Glu Thr Ala Gln 260
265 270Glu Arg Asn Glu Thr Leu Phe Pro Ala Leu
Ile Tyr Ser Ser Thr Met 275 280
285Val Trp Leu Val Asn Met Ala Glu Gly Asp Pro Glu Ala Gln Arg Arg 290
295 300Val Ser Lys Asn Ser Lys Tyr Asn
Ala Glu Ser Thr Glu Arg Glu Ser305 310
315 320Gln Asp Thr Val Ala Glu Asn Asp Asp Gly Gly Phe
Ser Glu Glu Trp 325 330
335Glu Ala Gln Arg Asp Ser His Leu Gly Pro His Arg Ser Thr Pro Glu
340 345 350Ser Arg Ala Ala Val Gln
Glu Leu Ser Ser Ser Ile Leu Ala Gly Glu 355 360
365Asp Pro Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp Phe
Ile Phe 370 375 380Tyr Ser Val Leu Val
Gly Lys Ala Ser Ala Thr Ala Ser Gly Asp Trp385 390
395 400Asn Thr Thr Ile Ala Cys Phe Val Ala Ile
Leu Ile Gly Leu Cys Leu 405 410
415Thr Leu Leu Leu Leu Ala Ile Phe Lys Lys Ala Leu Pro Ala Leu Pro
420 425 430Ile Ser Ile Thr Phe
Gly Leu Val Phe Tyr Phe Ala Thr Asp Tyr Leu 435
440 445Val Gln Pro Phe Met Asp Gln Leu Ala Phe His Gln
Phe Tyr Ile 450 455 46021463PRTHomo
sapiens 21Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe Gln Asn Ala Gln
Met1 5 10 15Ser Glu Asp
Asn His Leu Ser Asn Thr Asn Asp Asn Arg Glu Arg Gln 20
25 30Glu His Asn Asp Arg Arg Ser Leu Gly His
Pro Glu Pro Leu Ser Asn 35 40
45Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val Glu Gln Asp Glu Glu 50
55 60Glu Asp Glu Glu Leu Thr Leu Lys Tyr
Gly Ala Lys His Val Ile Met65 70 75
80Leu Phe Val Pro Val Thr Leu Cys Met Val Val Val Val Ala
Thr Ile 85 90 95Lys Ser
Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln Leu Ile Tyr Thr 100
105 110Pro Phe Thr Glu Asp Thr Glu Thr Val
Gly Gln Arg Ala Leu His Ser 115 120
125Ile Leu Asn Ala Ala Ile Met Ile Ser Val Ile Val Val Met Thr Ile
130 135 140Leu Leu Val Val Leu Tyr Lys
Tyr Arg Cys Tyr Lys Val Ile His Ala145 150
155 160Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu Phe Phe
Phe Ser Phe Ile 165 170
175Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala Val Asp Tyr Ile
180 185 190Thr Val Ala Leu Leu Ile
Trp Asn Phe Gly Val Val Gly Met Ile Ser 195 200
205Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala Tyr Leu
Ile Met 210 215 220Ile Ser Ala Leu Met
Ala Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp225 230
235 240Thr Ala Trp Leu Ile Leu Ala Val Ile Ser
Val Tyr Asp Leu Val Ala 245 250
255Val Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val Glu Thr Ala Gln
260 265 270Glu Arg Asn Glu Thr
Leu Phe Pro Ala Leu Ile Tyr Ser Ser Thr Met 275
280 285Val Trp Leu Val Asn Met Ala Glu Gly Asp Pro Glu
Ala Gln Arg Arg 290 295 300Val Ser Lys
Asn Ser Lys Tyr Asn Ala Glu Ser Thr Glu Arg Glu Ser305
310 315 320Gln Asp Thr Val Ala Glu Asn
Asp Asp Gly Gly Phe Ser Glu Glu Trp 325
330 335Glu Ala Gln Arg Asp Ser His Leu Gly Pro His Arg
Ser Thr Pro Glu 340 345 350Ser
Arg Ala Ala Val Gln Glu Leu Ser Ser Ser Ile Leu Ala Gly Glu 355
360 365Asp Pro Glu Glu Arg Gly Val Lys Leu
Gly Leu Gly Asp Phe Ile Phe 370 375
380Tyr Ser Val Leu Val Gly Lys Ala Ser Ala Thr Ala Ser Gly Asp Trp385
390 395 400Asn Thr Thr Ile
Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys Leu 405
410 415Thr Leu Leu Leu Leu Ala Ile Phe Lys Lys
Ala Leu Pro Ala Leu Pro 420 425
430Ile Ser Ile Thr Phe Gly Leu Val Phe Tyr Phe Ala Thr Asp Tyr Leu
435 440 445Val Gln Pro Phe Met Asp Gln
Leu Ala Phe His Gln Phe Tyr Ile 450 455
46022374PRTHomo sapiens 22Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe
Gln Asn Ala Gln Met1 5 10
15Ser Glu Asp Asn His Leu Ser Asn Thr Asn Asp Asn Arg Glu Arg Gln
20 25 30Glu His Asn Asp Arg Arg Ser
Leu Gly His Pro Glu Pro Leu Ser Asn 35 40
45Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val Glu Gln Asp Glu
Glu 50 55 60Glu Asp Glu Glu Leu Thr
Leu Lys Tyr Gly Ala Lys His Val Ile Met65 70
75 80Leu Phe Val Pro Val Thr Leu Cys Met Val Val
Val Val Ala Thr Ile 85 90
95Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln Leu Ile Tyr Thr
100 105 110Pro Phe Thr Glu Asp Thr
Glu Thr Val Gly Gln Arg Ala Leu His Ser 115 120
125Ile Leu Asn Ala Ala Ile Met Ile Ser Val Ile Val Val Met
Thr Ile 130 135 140Leu Leu Val Val Leu
Tyr Lys Tyr Arg Cys Tyr Lys Val Ile His Ala145 150
155 160Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu
Phe Phe Phe Ser Phe Ile 165 170
175Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala Val Asp Tyr Ile
180 185 190Thr Val Ala Leu Leu
Ile Trp Asn Phe Gly Val Val Gly Met Ile Ser 195
200 205Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala
Tyr Leu Ile Met 210 215 220Ile Ser Ala
Leu Met Ala Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp225
230 235 240Thr Ala Trp Leu Ile Leu Ala
Val Ile Ser Val Tyr Asp Leu Val Ala 245
250 255Val Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val
Glu Thr Ala Gln 260 265 270Glu
Arg Asn Glu Thr Leu Phe Pro Ala Leu Ile Tyr Ser Ser Thr Met 275
280 285Val Trp Leu Val Asn Met Ala Glu Gly
Asp Pro Glu Ala Gln Arg Arg 290 295
300Val Ser Lys Asn Ser Lys Tyr Asn Ala Glu Arg Ala Cys Leu Pro Pro305
310 315 320Ala Ala Ile Asn
Leu Leu Ser Ile Ala Pro Met Ala Pro Arg Leu Phe 325
330 335Met Pro Lys Gly Ala Cys Arg Pro Thr Ala
Gln Lys Gly Ser His Lys 340 345
350Thr Leu Leu Gln Arg Met Met Met Ala Gly Ser Val Arg Asn Gly Lys
355 360 365Pro Arg Gly Thr Val Ile
37023463PRTHomo sapiens 23Met Thr Glu Leu Pro Ala Pro Leu Ser Tyr Phe Gln
Asn Ala Gln Met1 5 10
15Ser Glu Asp Asn His Leu Ser Asn Thr Asn Asp Asn Arg Glu Arg Gln
20 25 30Glu His Asn Asp Arg Arg Ser
Leu Gly His Pro Glu Pro Leu Ser Asn 35 40
45Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val Glu Gln Asp Glu
Glu 50 55 60Glu Asp Glu Glu Leu Thr
Leu Lys Tyr Gly Ala Lys His Val Ile Met65 70
75 80Leu Phe Val Pro Val Thr Leu Cys Met Val Val
Val Val Ala Thr Ile 85 90
95Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln Leu Ile Tyr Thr
100 105 110Pro Phe Thr Glu Asp Thr
Glu Thr Val Gly Gln Arg Ala Leu His Ser 115 120
125Ile Leu Asn Ala Ala Ile Met Ile Ser Val Ile Val Val Met
Thr Ile 130 135 140Leu Leu Val Val Leu
Tyr Lys Tyr Arg Cys Tyr Lys Val Ile His Ala145 150
155 160Trp Leu Ile Ile Ser Ser Leu Leu Leu Leu
Phe Phe Phe Ser Phe Ile 165 170
175Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala Val Asp Tyr Ile
180 185 190Thr Val Ala Leu Leu
Ile Trp Asn Phe Gly Val Val Gly Met Ile Ser 195
200 205Ile His Trp Lys Gly Pro Leu Arg Leu Gln Gln Ala
Tyr Leu Ile Met 210 215 220Ile Ser Ala
Leu Met Ala Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp225
230 235 240Thr Ala Trp Leu Ile Leu Ala
Val Ile Ser Val Tyr Asp Leu Val Ala 245
250 255Val Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val
Glu Thr Ala Gln 260 265 270Glu
Arg Asn Glu Thr Leu Phe Pro Ala Leu Ile Tyr Ser Ser Thr Met 275
280 285Val Trp Leu Val Asn Met Ala Glu Gly
Asp Pro Glu Ala Gln Arg Arg 290 295
300Val Ser Lys Asn Ser Lys Tyr Asn Ala Glu Ser Thr Glu Arg Glu Ser305
310 315 320Gln Asp Thr Val
Ala Glu Asn Asp Asp Gly Gly Phe Ser Glu Glu Trp 325
330 335Glu Ala Gln Arg Asp Ser His Leu Gly Pro
His Arg Ser Thr Pro Glu 340 345
350Ser Arg Ala Ala Val Gln Glu Leu Ser Ser Ser Ile Leu Ala Gly Glu
355 360 365Asp Pro Glu Glu Arg Gly Val
Lys Leu Gly Leu Gly Asp Phe Ile Phe 370 375
380Tyr Ser Val Leu Val Gly Lys Ala Ser Ala Thr Ala Ser Gly Asp
Trp385 390 395 400Asn Thr
Thr Ile Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys Leu
405 410 415Thr Leu Leu Leu Leu Ala Ile
Phe Lys Lys Ala Leu Pro Ala Leu Pro 420 425
430Ile Ser Ile Thr Phe Gly Leu Val Phe Tyr Phe Ala Thr Asp
Tyr Leu 435 440 445Val Gln Pro Phe
Met Asp Gln Leu Ala Phe His Gln Phe Tyr Ile 450 455
46024448PRTHomo sapiens 24Met Leu Thr Phe Met Ala Ser Asp
Ser Glu Glu Glu Val Cys Asp Glu1 5 10
15Arg Thr Ser Leu Met Ser Ala Glu Ser Pro Thr Pro Arg Ser
Cys Gln 20 25 30Glu Gly Arg
Gln Gly Pro Glu Asp Gly Glu Asn Thr Ala Gln Trp Arg 35
40 45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu Asp
Pro Asp Arg Tyr Val 50 55 60Cys Ser
Gly Val Pro Gly Arg Pro Pro Gly Leu Glu Glu Glu Leu Thr65
70 75 80Leu Lys Tyr Gly Ala Lys His
Val Ile Met Leu Phe Val Pro Val Thr 85 90
95Leu Cys Met Ile Val Val Val Ala Thr Ile Lys Ser Val
Arg Phe Tyr 100 105 110Thr Glu
Lys Asn Gly Gln Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr 115
120 125Pro Ser Val Gly Gln Arg Leu Leu Asn Ser
Val Leu Asn Thr Leu Ile 130 135 140Met
Ile Ser Val Ile Val Val Met Thr Ile Phe Leu Val Val Leu Tyr145
150 155 160Lys Tyr Arg Cys Tyr Lys
Phe Ile His Gly Trp Leu Ile Met Ser Ser 165
170 175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile Tyr Leu
Gly Glu Val Leu 180 185 190Lys
Thr Tyr Asn Val Ala Met Asp Tyr Pro Thr Leu Leu Leu Thr Val 195
200 205Trp Asn Phe Gly Ala Val Gly Met Val
Cys Ile His Trp Lys Gly Pro 210 215
220Leu Val Leu Gln Gln Ala Tyr Leu Ile Met Ile Ser Ala Leu Met Ala225
230 235 240Leu Val Phe Ile
Lys Tyr Leu Pro Glu Trp Ser Ala Trp Val Ile Leu 245
250 255Gly Ala Ile Ser Val Tyr Asp Leu Val Ala
Val Leu Cys Pro Lys Gly 260 265
270Pro Leu Arg Met Leu Val Glu Thr Ala Gln Glu Arg Asn Glu Pro Ile
275 280 285Phe Pro Ala Leu Ile Tyr Ser
Ser Ala Met Val Trp Thr Val Gly Met 290 295
300Ala Lys Leu Asp Pro Ser Ser Gln Gly Ala Leu Gln Leu Pro Tyr
Asp305 310 315 320Pro Glu
Met Glu Glu Asp Ser Tyr Asp Ser Phe Gly Glu Pro Ser Tyr
325 330 335Pro Glu Val Phe Glu Pro Pro
Leu Thr Gly Tyr Pro Gly Glu Glu Leu 340 345
350Glu Glu Glu Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp
Phe Ile 355 360 365Phe Tyr Ser Val
Leu Val Gly Lys Ala Ala Ala Thr Gly Ser Gly Asp 370
375 380Trp Asn Thr Thr Leu Ala Cys Phe Val Ala Ile Leu
Ile Gly Leu Cys385 390 395
400Leu Thr Leu Leu Leu Leu Ala Val Phe Lys Lys Ala Leu Pro Ala Leu
405 410 415Pro Ile Ser Ile Thr
Phe Gly Leu Ile Phe Tyr Phe Ser Thr Asp Asn 420
425 430Leu Val Arg Pro Phe Met Asp Thr Leu Ala Ser His
Gln Leu Tyr Ile 435 440
44525390PRTHomo sapiens 25Met Leu Thr Phe Met Ala Ser Asp Ser Glu Glu Glu
Val Cys Asp Glu1 5 10
15Arg Thr Ser Leu Met Ser Ala Glu Ser Pro Thr Pro Arg Ser Cys Gln
20 25 30Glu Gly Arg Gln Gly Pro Glu
Asp Gly Glu Asn Thr Ala Gln Trp Arg 35 40
45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu Asp Pro Asp Arg Tyr
Val 50 55 60Cys Ser Gly Val Pro Gly
Arg Pro Pro Gly Leu Glu Glu Glu Leu Thr65 70
75 80Leu Lys Tyr Gly Ala Lys His Val Ile Met Leu
Phe Val Pro Val Thr 85 90
95Leu Cys Met Ile Val Val Val Ala Thr Ile Lys Ser Val Arg Phe Tyr
100 105 110Thr Glu Lys Asn Gly Gln
Leu Ile Tyr Thr Thr Phe Thr Glu Asp Thr 115 120
125Pro Ser Val Gly Gln Arg Leu Leu Asn Ser Val Leu Asn Thr
Leu Ile 130 135 140Met Ile Ser Val Ile
Val Val Met Thr Ile Phe Leu Val Val Leu Tyr145 150
155 160Lys Tyr Arg Cys Tyr Lys Phe Ile His Gly
Trp Leu Ile Met Ser Ser 165 170
175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile Tyr Leu Gly Glu Val Leu
180 185 190Lys Thr Tyr Asn Val
Ala Met Asp Tyr Pro Thr Leu Leu Leu Thr Val 195
200 205Trp Asn Phe Gly Ala Val Gly Met Val Cys Ile His
Trp Lys Gly Pro 210 215 220Leu Val Leu
Gln Gln Ala Tyr Leu Ile Met Ile Ser Ala Leu Met Ala225
230 235 240Leu Val Phe Ile Lys Tyr Leu
Pro Glu Trp Ser Ala Trp Val Ile Leu 245
250 255Gly Ala Ile Ser Val Tyr Asp Leu Val Ala Val Leu
Cys Pro Lys Gly 260 265 270Pro
Leu Arg Met Leu Val Glu Thr Ala Gln Glu Arg Asn Glu Pro Ile 275
280 285Phe Pro Ala Leu Ile Tyr Leu Ser Ala
Met Val Trp Thr Val Gly Met 290 295
300Ala Lys Leu Asp Pro Ser Ser Gln Gly Ala Leu Gln Leu Pro Tyr Asp305
310 315 320Pro Glu Met Glu
Glu Asp Ser Tyr Asp Ser Phe Gly Glu Pro Ser Tyr 325
330 335Pro Glu Val Phe Glu Pro Pro Leu Thr Gly
Tyr Pro Gly Glu Glu Leu 340 345
350Glu Glu Glu Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp Phe Ile
355 360 365Phe Tyr Ser Val Leu Val Gly
Lys Ala Ala Ala Thr Gly Ser Gly Asp 370 375
380Trp Asn Thr Thr Leu Ala385 39026447PRTHomo
sapiens 26Met Leu Thr Phe Met Ala Ser Asp Ser Glu Glu Glu Val Cys Asp
Glu1 5 10 15Arg Thr Ser
Leu Met Ser Ala Glu Ser Pro Thr Pro Arg Ser Cys Gln 20
25 30Glu Gly Arg Gln Gly Pro Glu Asp Gly Glu
Asn Thr Ala Gln Trp Arg 35 40
45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu Asp Pro Asp Arg Tyr Val 50
55 60Cys Ser Gly Val Pro Gly Arg Pro Pro
Gly Leu Glu Glu Glu Leu Thr65 70 75
80Leu Lys Tyr Gly Ala Lys His Val Ile Met Leu Phe Val Pro
Val Thr 85 90 95Leu Cys
Met Ile Val Val Val Ala Thr Ile Lys Ser Val Arg Phe Tyr 100
105 110Thr Glu Lys Asn Gly Gln Leu Ile Tyr
Thr Pro Phe Thr Glu Asp Thr 115 120
125Pro Ser Val Gly Gln Arg Leu Leu Asn Ser Val Leu Asn Thr Leu Ile
130 135 140Met Ile Ser Val Ile Val Val
Met Thr Ile Phe Leu Val Val Leu Tyr145 150
155 160Lys Tyr Arg Cys Tyr Lys Phe Ile His Gly Trp Leu
Ile Met Ser Ser 165 170
175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile Tyr Leu Gly Glu Val Leu
180 185 190Lys Thr Tyr Asn Val Ala
Met Asp Tyr Pro Thr Leu Leu Leu Thr Val 195 200
205Trp Asn Phe Gly Ala Val Gly Met Val Cys Ile His Trp Lys
Gly Pro 210 215 220Leu Val Leu Gln Gln
Ala Tyr Leu Ile Met Ile Ser Ala Leu Met Ala225 230
235 240Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp
Ser Ala Trp Val Ile Leu 245 250
255Gly Ala Ile Ser Val Tyr Asp Leu Val Ala Val Leu Cys Pro Lys Gly
260 265 270Pro Leu Arg Met Leu
Val Glu Thr Ala Gln Glu Arg Asn Glu Pro Ile 275
280 285Phe Pro Ala Leu Ile Tyr Ser Ser Ala Met Val Trp
Thr Val Gly Met 290 295 300Ala Lys Leu
Asp Pro Ser Ser Gln Gly Ala Leu Gln Leu Pro Tyr Asp305
310 315 320Pro Glu Met Glu Asp Ser Tyr
Asp Ser Phe Gly Glu Pro Ser Tyr Pro 325
330 335Glu Val Phe Glu Pro Pro Leu Thr Gly Tyr Pro Gly
Glu Glu Leu Glu 340 345 350Glu
Glu Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp Phe Ile Phe 355
360 365Tyr Ser Val Leu Val Gly Lys Ala Ala
Ala Thr Gly Ser Gly Asp Trp 370 375
380Asn Thr Thr Leu Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys Leu385
390 395 400Thr Leu Leu Leu
Leu Ala Val Phe Lys Lys Ala Leu Pro Ala Leu Pro 405
410 415Ile Ser Ile Thr Phe Gly Leu Ile Phe Tyr
Phe Ser Thr Asp Asn Leu 420 425
430Val Arg Pro Phe Met Asp Thr Leu Ala Ser His Gln Leu Tyr Ile
435 440 44527359PRTHomo sapiens 27Met Leu
Phe Val Pro Val Thr Leu Cys Met Ile Val Val Val Ala Thr1 5
10 15Ile Lys Ser Val Arg Phe Tyr Thr
Glu Lys Asn Gly Gln Leu Ile Tyr 20 25
30Thr Pro Phe Thr Glu Asp Thr Pro Ser Val Gly Gln Arg Leu Leu
Asn 35 40 45Ser Val Leu Asn Thr
Leu Ile Met Ile Ser Val Ile Val Val Met Thr 50 55
60Ile Phe Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr Lys Phe
Ile His65 70 75 80Gly
Trp Leu Ile Met Ser Ser Leu Met Leu Leu Phe Leu Phe Thr Tyr
85 90 95Ile Tyr Leu Gly Glu Val Leu
Lys Thr Tyr Asn Val Ala Met Asp Tyr 100 105
110Pro Thr Leu Leu Leu Thr Val Trp Asn Phe Gly Ala Val Gly
Met Val 115 120 125Cys Ile His Trp
Lys Gly Pro Leu Val Leu Gln Gln Ala Tyr Leu Ile 130
135 140Met Ile Ser Ala Leu Met Ala Leu Val Phe Ile Lys
Tyr Leu Pro Glu145 150 155
160Trp Ser Ala Trp Val Ile Leu Gly Ala Ile Ser Val Tyr Asp Leu Val
165 170 175Ala Val Leu Cys Pro
Lys Gly Pro Leu Arg Met Leu Val Glu Thr Ala 180
185 190Gln Glu Arg Asn Glu Pro Ile Phe Pro Ala Leu Ile
Tyr Ser Ser Ala 195 200 205Met Val
Trp Thr Val Gly Met Ala Lys Leu Asp Pro Ser Ser Gln Gly 210
215 220Ala Leu Gln Leu Pro Tyr Asp Pro Glu Met Glu
Glu Asp Ser Tyr Asp225 230 235
240Ser Phe Gly Glu Pro Ser Tyr Pro Glu Val Phe Glu Pro Pro Leu Thr
245 250 255Gly Tyr Pro Gly
Glu Glu Leu Glu Glu Glu Glu Glu Arg Gly Val Lys 260
265 270Leu Gly Leu Gly Asp Phe Ile Phe Tyr Ser Val
Leu Val Gly Lys Ala 275 280 285Ala
Ala Thr Gly Ser Gly Asp Trp Asn Thr Thr Leu Ala Cys Phe Val 290
295 300Ala Ile Leu Ile Gly Leu Cys Leu Thr Leu
Leu Leu Leu Ala Val Phe305 310 315
320Lys Lys Ala Leu Pro Ala Leu Pro Ile Ser Ile Thr Phe Gly Leu
Ile 325 330 335Phe Tyr Phe
Ser Thr Asp Asn Leu Val Arg Pro Phe Met Asp Thr Leu 340
345 350Ala Ser His Gln Leu Tyr Ile
35528448PRTHomo sapiens 28Met Leu Thr Phe Met Ala Ser Asp Ser Glu Glu Glu
Val Cys Asp Glu1 5 10
15Arg Thr Ser Leu Met Ser Ala Glu Ser Pro Thr Pro Arg Ser Cys Gln
20 25 30Glu Gly Arg Gln Gly Pro Glu
Asp Gly Glu Asn Thr Ala Gln Trp Arg 35 40
45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu Asp Pro Asp Arg Tyr
Val 50 55 60Cys Ser Gly Val Pro Gly
Arg Pro Pro Gly Leu Glu Glu Glu Leu Thr65 70
75 80Leu Lys Tyr Gly Ala Lys His Val Ile Met Leu
Phe Val Pro Val Thr 85 90
95Leu Cys Met Ile Val Val Val Ala Thr Ile Lys Ser Val Arg Phe Tyr
100 105 110Thr Glu Lys Asn Gly Gln
Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr 115 120
125Pro Ser Val Gly Gln Arg Leu Leu Asn Ser Val Leu Asn Thr
Leu Ile 130 135 140Met Ile Ser Val Ile
Val Val Met Thr Ile Phe Leu Val Val Leu Tyr145 150
155 160Lys Tyr Arg Cys Tyr Lys Phe Ile His Gly
Trp Leu Ile Met Ser Ser 165 170
175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile Tyr Leu Gly Glu Val Leu
180 185 190Lys Thr Tyr Asn Val
Ala Met Asp Tyr Pro Thr Leu Leu Leu Thr Val 195
200 205Trp Asn Phe Gly Ala Val Gly Met Val Cys Ile His
Trp Lys Gly Pro 210 215 220Leu Val Leu
Gln Gln Ala Tyr Leu Ile Met Ile Ser Ala Leu Met Ala225
230 235 240Leu Val Phe Ile Lys Tyr Leu
Pro Glu Trp Ser Ala Trp Val Ile Leu 245
250 255Gly Ala Ile Ser Val Tyr Asp Leu Val Ala Val Leu
Cys Pro Lys Gly 260 265 270Pro
Leu Arg Met Leu Val Glu Thr Ala Gln Glu Arg Asn Glu Pro Ile 275
280 285Phe Pro Ala Leu Ile Tyr Ser Ser Ala
Met Val Trp Thr Val Gly Met 290 295
300Ala Lys Leu Asp Pro Ser Ser Gln Gly Ala Leu Gln Leu Pro Tyr Asp305
310 315 320Pro Glu Met Glu
Glu Asp Ser Tyr Asp Ser Phe Gly Glu Pro Ser Tyr 325
330 335Pro Glu Val Phe Glu Pro Pro Leu Thr Gly
Tyr Pro Gly Glu Glu Leu 340 345
350Glu Glu Glu Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp Phe Ile
355 360 365Phe Tyr Ser Val Leu Val Gly
Lys Ala Ala Ala Thr Gly Ser Gly Asp 370 375
380Trp Asn Thr Thr Leu Ala Cys Phe Val Ala Ile Leu Ile Gly Leu
Cys385 390 395 400Leu Thr
Leu Leu Leu Leu Ala Val Phe Lys Lys Ala Leu Pro Ala Leu
405 410 415Pro Ile Ser Ile Thr Phe Gly
Leu Ile Phe Tyr Phe Ser Thr Asp Asn 420 425
430Leu Val Arg Pro Phe Met Asp Thr Leu Ala Ser His Gln Leu
Tyr Ile 435 440 44529448PRTHomo
sapiens 29Met Leu Thr Phe Met Ala Ser Asp Ser Glu Glu Glu Val Cys Asp
Glu1 5 10 15Arg Thr Ser
Leu Met Ser Ala Glu Ser Pro Thr Pro Arg Ser Cys Gln 20
25 30Glu Gly Arg Gln Gly Pro Glu Asp Gly Glu
Asn Thr Ala Gln Trp Arg 35 40
45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu Asp Pro Asp Arg Tyr Val 50
55 60Cys Ser Gly Val Pro Gly Arg Pro Pro
Gly Leu Glu Glu Glu Leu Thr65 70 75
80Leu Lys Tyr Gly Ala Lys His Val Ile Met Leu Phe Val Pro
Val Thr 85 90 95Leu Cys
Met Ile Val Val Val Ala Thr Ile Lys Ser Val Arg Phe Tyr 100
105 110Thr Glu Lys Asn Gly Gln Leu Ile Tyr
Thr Pro Phe Thr Glu Asp Thr 115 120
125Pro Ser Val Gly Gln Arg Leu Leu Asn Ser Val Leu Asn Thr Leu Ile
130 135 140Met Ile Ser Val Ile Val Val
Met Thr Ile Phe Leu Val Val Leu Tyr145 150
155 160Lys Tyr Arg Cys Tyr Lys Phe Ile His Gly Trp Leu
Ile Met Ser Ser 165 170
175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile Tyr Leu Gly Glu Val Leu
180 185 190Lys Thr Tyr Asn Val Ala
Met Asp Tyr Pro Thr Leu Leu Leu Thr Val 195 200
205Trp Asn Phe Gly Ala Val Gly Met Val Cys Ile His Trp Lys
Gly Pro 210 215 220Leu Val Leu Gln Gln
Ala Tyr Leu Ile Met Ile Ser Ala Leu Met Ala225 230
235 240Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp
Ser Ala Trp Val Ile Leu 245 250
255Gly Ala Ile Ser Val Tyr Asp Leu Val Ala Val Leu Cys Pro Lys Gly
260 265 270Pro Leu Arg Met Leu
Val Glu Thr Ala Gln Glu Arg Asn Glu Pro Ile 275
280 285Phe Pro Ala Leu Ile Tyr Ser Ser Ala Met Val Trp
Thr Val Gly Met 290 295 300Ala Lys Leu
Asp Pro Ser Ser Gln Gly Ala Leu Gln Leu Pro Tyr Asp305
310 315 320Pro Glu Met Glu Glu Asp Ser
Tyr Asp Ser Phe Gly Glu Pro Ser Tyr 325
330 335Pro Glu Val Phe Glu Pro Pro Leu Thr Gly Tyr Pro
Gly Glu Glu Leu 340 345 350Glu
Glu Glu Glu Glu Arg Gly Val Lys Leu Gly Leu Gly Asp Phe Ile 355
360 365Phe Tyr Ser Val Leu Val Gly Lys Ala
Ala Ala Thr Gly Ser Gly Asp 370 375
380Trp Asn Thr Thr Leu Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys385
390 395 400Leu Thr Leu Leu
Leu Leu Ala Val Phe Lys Lys Ala Leu Pro Ala Leu 405
410 415Pro Ile Ser Ile Thr Phe Gly Leu Ile Phe
Tyr Phe Ser Thr Asp Asn 420 425
430Leu Val Arg Pro Phe Met Asp Thr Leu Ala Ser His Gln Leu Tyr Ile
435 440 44530448PRTHomo sapiens 30Met
Leu Thr Phe Met Ala Ser Asp Ser Glu Glu Glu Val Cys Asp Glu1
5 10 15Arg Thr Ser Leu Met Ser Ala
Glu Ser Pro Thr Pro Arg Ser Cys Gln 20 25
30Glu Gly Arg Gln Gly Pro Glu Asp Gly Glu Asn Thr Ala Gln
Trp Arg 35 40 45Ser Gln Glu Asn
Glu Glu Asp Gly Glu Glu Asp Pro Asp Arg Tyr Val 50 55
60Cys Ser Gly Val Pro Gly Arg Pro Pro Gly Leu Glu Glu
Glu Leu Thr65 70 75
80Leu Lys Tyr Gly Ala Lys His Val Ile Met Leu Phe Val Pro Val Thr
85 90 95Leu Cys Met Ile Val Val
Val Ala Thr Ile Lys Ser Val Arg Phe Tyr 100
105 110Thr Glu Lys Asn Gly Gln Leu Ile Tyr Thr Thr Phe
Thr Glu Asp Thr 115 120 125Pro Ser
Val Gly Gln Arg Leu Leu Asn Ser Val Leu Asn Thr Leu Ile 130
135 140Met Ile Ser Val Ile Val Val Met Thr Ile Phe
Leu Val Val Leu Tyr145 150 155
160Lys Tyr Arg Cys Tyr Lys Phe Ile His Gly Trp Leu Ile Met Ser Ser
165 170 175Leu Met Leu Leu
Phe Leu Phe Thr Tyr Ile Tyr Leu Gly Glu Val Leu 180
185 190Lys Thr Tyr Asn Val Ala Met Asp Tyr Pro Thr
Leu Leu Leu Thr Val 195 200 205Trp
Asn Phe Gly Ala Val Gly Met Val Cys Ile His Trp Lys Gly Pro 210
215 220Leu Val Leu Gln Gln Ala Tyr Leu Ile Met
Ile Ser Ala Leu Met Ala225 230 235
240Leu Val Phe Ile Lys Tyr Leu Pro Glu Trp Ser Ala Trp Val Ile
Leu 245 250 255Gly Ala Ile
Ser Val Tyr Asp Leu Val Ala Val Leu Cys Pro Lys Gly 260
265 270Pro Leu Arg Met Leu Val Glu Thr Ala Gln
Glu Arg Asn Glu Pro Ile 275 280
285Phe Pro Ala Leu Ile Tyr Ser Ser Ala Met Val Trp Thr Val Gly Met 290
295 300Ala Lys Leu Asp Pro Ser Ser Gln
Gly Ala Leu Gln Leu Pro Tyr Asp305 310
315 320Pro Glu Met Glu Glu Asp Ser Tyr Asp Ser Phe Gly
Glu Pro Ser Tyr 325 330
335Pro Glu Val Phe Glu Pro Pro Leu Thr Gly Tyr Pro Gly Glu Glu Leu
340 345 350Glu Glu Glu Glu Glu Arg
Gly Val Lys Leu Gly Leu Gly Asp Phe Ile 355 360
365Phe Tyr Ser Val Leu Val Gly Lys Ala Ala Ala Thr Gly Ser
Gly Asp 370 375 380Trp Asn Thr Thr Leu
Ala Cys Phe Val Ala Ile Leu Ile Gly Leu Cys385 390
395 400Leu Thr Leu Leu Leu Leu Ala Val Phe Lys
Lys Ala Leu Pro Ala Leu 405 410
415Pro Ile Ser Ile Thr Phe Gly Leu Ile Phe Tyr Phe Ser Thr Asp Asn
420 425 430Leu Val Arg Pro Phe
Met Asp Thr Leu Ala Ser His Gln Leu Tyr Ile 435
440 44531448PRTHomo sapiens 31Met Leu Thr Phe Met Ala Ser
Asp Ser Glu Glu Glu Val Cys Asp Glu1 5 10
15Arg Thr Ser Leu Met Ser Ala Glu Ser Pro Thr Pro Arg
Ser Cys Gln 20 25 30Glu Gly
Arg Gln Gly Pro Glu Asp Gly Glu Asn Thr Ala Gln Trp Arg 35
40 45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu
Asp Pro Asp Arg Tyr Val 50 55 60Cys
Ser Gly Val Pro Gly Arg Pro Pro Gly Leu Glu Glu Glu Leu Thr65
70 75 80Leu Lys Tyr Gly Ala Lys
His Val Ile Met Leu Phe Val Pro Val Thr 85
90 95Leu Cys Met Ile Val Val Val Ala Thr Ile Lys Ser
Val Arg Phe Tyr 100 105 110Thr
Glu Lys Asn Gly Gln Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr 115
120 125Pro Ser Val Gly Gln Arg Leu Leu Asn
Ser Val Leu Asn Thr Leu Ile 130 135
140Met Ile Ser Val Ile Val Val Met Thr Ile Phe Leu Val Val Leu Tyr145
150 155 160Lys Tyr Arg Cys
Tyr Lys Phe Ile His Gly Trp Leu Ile Met Ser Ser 165
170 175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile
Tyr Leu Gly Glu Val Leu 180 185
190Lys Thr Tyr Asn Val Ala Met Asp Tyr Pro Thr Leu Leu Leu Thr Val
195 200 205Trp Asn Phe Gly Ala Val Gly
Met Val Cys Ile His Trp Lys Gly Pro 210 215
220Leu Val Leu Gln Gln Ala Tyr Leu Ile Met Ile Ser Ala Leu Met
Ala225 230 235 240Leu Val
Phe Ile Lys Tyr Leu Pro Glu Trp Ser Ala Trp Val Ile Leu
245 250 255Gly Ala Ile Ser Val Tyr Asp
Leu Val Ala Val Leu Cys Pro Lys Gly 260 265
270Pro Leu Arg Met Leu Val Glu Thr Ala Gln Glu Arg Asn Glu
Pro Ile 275 280 285Phe Pro Ala Leu
Ile Tyr Ser Ser Ala Met Val Trp Thr Val Gly Met 290
295 300Ala Lys Leu Asp Pro Ser Ser Gln Gly Ala Leu Gln
Leu Pro Tyr Asp305 310 315
320Pro Glu Met Glu Glu Asp Ser Tyr Asp Ser Phe Gly Glu Pro Ser Tyr
325 330 335Pro Glu Val Phe Glu
Pro Pro Leu Thr Gly Tyr Pro Gly Glu Glu Leu 340
345 350Glu Glu Glu Glu Glu Arg Gly Val Lys Leu Gly Leu
Gly Asp Phe Ile 355 360 365Phe Tyr
Ser Val Leu Val Gly Lys Ala Ala Ala Thr Gly Ser Gly Asp 370
375 380Trp Asn Thr Thr Leu Ala Cys Phe Val Ala Ile
Leu Ile Gly Leu Cys385 390 395
400Leu Thr Leu Leu Leu Leu Ala Val Phe Lys Lys Ala Leu Pro Ala Leu
405 410 415Pro Ile Ser Ile
Thr Phe Gly Leu Ile Phe Tyr Phe Ser Thr Asp Asn 420
425 430Leu Val Arg Pro Phe Met Asp Thr Leu Ala Ser
His Gln Leu Tyr Ile 435 440
44532442PRTHomo sapiens 32Met Leu Thr Phe Met Ala Ser Asp Ser Glu Glu Glu
Val Cys Asp Glu1 5 10
15Arg Thr Ser Leu Met Ser Ala Glu Ser Pro Thr Pro Arg Ser Cys Gln
20 25 30Glu Gly Arg Gln Gly Pro Glu
Asp Gly Glu Asn Thr Ala Gln Trp Arg 35 40
45Ser Gln Glu Asn Glu Glu Asp Gly Glu Glu Asp Pro Asp Arg Tyr
Val 50 55 60Cys Ser Gly Val Pro Gly
Arg Pro Pro Gly Leu Glu Glu Glu Leu Thr65 70
75 80Leu Lys Tyr Gly Ala Lys His Val Ile Met Leu
Phe Val Pro Val Thr 85 90
95Leu Cys Met Ile Val Val Val Ala Thr Ile Lys Ser Val Arg Phe Tyr
100 105 110Thr Glu Lys Asn Gly Gln
Leu Ile Tyr Thr Pro Phe Thr Glu Asp Thr 115 120
125Pro Ser Val Gly Gln Arg Leu Leu Asn Ser Val Leu Asn Thr
Leu Ile 130 135 140Met Ile Ser Val Ile
Val Val Met Thr Ile Phe Leu Val Val Leu Tyr145 150
155 160Lys Tyr Arg Cys Tyr Lys Phe Ile His Gly
Trp Leu Ile Met Ser Ser 165 170
175Leu Met Leu Leu Phe Leu Phe Thr Tyr Ile Tyr Leu Gly Glu Val Leu
180 185 190Lys Thr Tyr Asn Val
Ala Met Asp Tyr Pro Thr Leu Leu Leu Thr Val 195
200 205Trp Asn Phe Gly Ala Val Gly Met Val Cys Ile His
Trp Lys Gly Pro 210 215 220Leu Val Leu
Gln Gln Ala Tyr Leu Ile Met Ile Ser Ala Leu Met Ala225
230 235 240Leu Val Phe Ile Lys Tyr Leu
Pro Glu Trp Ser Ala Trp Val Ile Leu 245
250 255Gly Ala Ile Ser Val Tyr Asp Leu Val Ala Val Leu
Cys Pro Lys Gly 260 265 270Pro
Leu Arg Met Leu Val Glu Thr Ala Gln Glu Arg Asn Glu Pro Ile 275
280 285Phe Pro Ala Leu Ile Tyr Ser Ser Ala
Met Val Trp Thr Val Gly Met 290 295
300Ala Lys Leu Asp Pro Ser Ser Gln Gly Ala Leu Gln Leu Pro Tyr Asp305
310 315 320Pro Glu Met Glu
Asp Ser Tyr Asp Ser Phe Gly Glu Pro Ser Tyr Pro 325
330 335Glu Val Phe Glu Pro Pro Leu Thr Gly Tyr
Pro Gly Glu Glu Leu Glu 340 345
350Glu Glu Glu Glu Ser Gln Gly Gly Val Lys Leu Gly Leu Gly Asp Phe
355 360 365Ile Phe Tyr Ser Val Leu Val
Gly Lys Ala Ala Ala Thr Gly Ser Gly 370 375
380Asp Trp Asn Thr Thr Leu Ala Cys Phe Val Ala Ile Leu Ile Gly
Leu385 390 395 400Cys Leu
Thr Leu Leu Leu Leu Ala Val Phe Lys Lys Ala Leu Pro Ala
405 410 415Leu Pro Ile Ser Ile Thr Phe
Gly Leu Ile Phe Tyr Phe Ser Thr Asp 420 425
430Arg Lys His Ser Arg Phe Ile Gln Met Asn 435
44033265PRTHomo sapiens 33Met Gly Ala Ala Val Phe Phe Gly Cys
Thr Phe Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg
Val 20 25 30Ile Ile Leu Val
Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu 35
40 45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr
Asp Arg Ser Asp 50 55 60Ala Arg Leu
Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe
Ala Tyr Tyr Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser
Pro Ile 100 105 110Ser Ile Arg
Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115
120 125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala
Asp Ala Leu Gly Pro 130 135 140Gly Val
Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145
150 155 160Ala Phe Leu Thr Ala Ala Ile
Ile Leu Leu His Thr Phe Trp Gly Val 165
170 175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp
Ala Leu Gly Leu 180 185 190Val
Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile
Tyr Ala Val Thr Val Ser Met 210 215
220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Leu Leu
Cys Arg Arg Gln Glu Asp Ser Arg Val Met Val Tyr 245
250 255Ser Ala Leu Arg Ile Pro Pro Glu Asp
260 26534251PRTHomo sapiens 34Met Gly Ala Ala Val
Phe Phe Gly Cys Thr Phe Val Ala Phe Gly Pro1 5
10 15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly
Asp Pro Leu Arg Val 20 25
30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu
35 40 45Ala Ser Val Val Trp Phe Ile Leu
Val His Val Thr Asp Arg Ser Asp 50 55
60Ala Arg Leu Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65
70 75 80Leu Leu Gln Glu Val
Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys 85
90 95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp
Gly Arg Ser Pro Ile 100 105
110Ser Ile Arg Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile
115 120 125Ser Gly Val Phe Ser Val Ile
Asn Ile Leu Ala Asp Ala Leu Gly Pro 130 135
140Gly Val Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr
Ser145 150 155 160Ala Phe
Leu Thr Ala Ala Ile Ile Leu Leu His Thr Phe Trp Gly Val
165 170 175Val Phe Phe Asp Ala Cys Glu
Arg Arg Arg Tyr Trp Ala Leu Gly Leu 180 185
190Val Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu
Asn Pro 195 200 205Trp Tyr Glu Ala
Ser Leu Leu Pro Ile Tyr Ala Val Thr Val Ser Met 210
215 220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu
Arg Ser Ile Gln225 230 235
240Arg Ser Ser Cys Val Arg Thr Asp Tyr Leu Asp 245
25035251PRTHomo sapiens 35Met Gly Ala Ala Val Phe Phe Gly Cys
Thr Phe Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg
Val 20 25 30Ile Ile Leu Val
Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu 35
40 45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr
Asp Arg Ser Asp 50 55 60Ala Arg Leu
Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe
Ala Tyr Tyr Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser
Pro Ile 100 105 110Ser Ile Arg
Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115
120 125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala
Asp Ala Leu Gly Pro 130 135 140Gly Val
Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145
150 155 160Ala Phe Leu Thr Ala Ala Ile
Ile Leu Leu His Thr Phe Trp Gly Val 165
170 175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp
Ala Leu Gly Leu 180 185 190Val
Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile
Tyr Ala Val Thr Val Ser Met 210 215
220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Ser Cys
Val Arg Thr Asp Tyr Leu Asp 245
25036247PRTHomo sapiens 36Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe Val
Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val
20 25 30Ile Ile Leu Val Ala Gly Ala
Phe Phe Trp Leu Val Ser Leu Leu Leu 35 40
45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr Asp Arg Ser
Asp 50 55 60Ala Arg Leu Gln Tyr Gly
Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr
Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile
100 105 110Ser Ile Arg Gln Met Ala
Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115 120
125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu
Gly Pro 130 135 140Gly Val Val Gly Ile
His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145 150
155 160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu
His Thr Phe Trp Gly Val 165 170
175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu
180 185 190Val Val Gly Ser His
Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val
Thr Val Ser Met 210 215 220Gly Leu Trp
Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Leu Leu Cys Lys Asp
24537247PRTHomo sapiens 37Met Gly Ala Ala Val Phe Phe Gly Cys
Thr Phe Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg
Val 20 25 30Ile Ile Leu Val
Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu 35
40 45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr
Asp Arg Ser Asp 50 55 60Ala Arg Leu
Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe
Ala Tyr Tyr Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser
Pro Ile 100 105 110Ser Ile Arg
Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115
120 125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala
Asp Ala Leu Gly Pro 130 135 140Gly Val
Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145
150 155 160Ala Phe Leu Thr Ala Ala Ile
Ile Leu Leu His Thr Phe Trp Gly Val 165
170 175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp
Ala Leu Gly Leu 180 185 190Val
Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile
Tyr Ala Val Thr Val Ser Met 210 215
220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Leu Leu
Cys Lys Asp 24538247PRTHomo sapiens 38Met Gly Ala Ala Val
Phe Cys Gly Cys Thr Phe Val Ala Phe Gly Pro1 5
10 15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly
Asp Pro Leu Arg Val 20 25
30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu
35 40 45Ala Ser Val Val Trp Phe Ile Leu
Val His Val Thr Asp Arg Ser Asp 50 55
60Ala Arg Leu Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65
70 75 80Leu Leu Gln Glu Val
Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys 85
90 95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp
Gly Arg Ser Pro Ile 100 105
110Ser Ile Arg Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile
115 120 125Ser Gly Val Phe Ser Val Ile
Ser Ile Leu Ala Asp Ala Leu Gly Pro 130 135
140Gly Val Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr
Ser145 150 155 160Ala Phe
Leu Thr Ala Ala Ile Ile Leu Leu His Thr Phe Trp Gly Val
165 170 175Val Phe Phe Asp Ala Cys Glu
Arg Arg Arg Tyr Trp Ala Leu Gly Leu 180 185
190Val Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu
Asn Pro 195 200 205Trp Tyr Glu Ala
Ser Leu Leu Pro Ile Tyr Ala Val Thr Val Ser Met 210
215 220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu
Arg Ser Ile Gln225 230 235
240Arg Ser Leu Leu Cys Lys Asp 24539131PRTHomo sapiens
39Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile Ser Gly Val Phe1
5 10 15Ser Val Ile Asn Ile Leu
Ala Asp Ala Leu Gly Pro Gly Val Val Gly 20 25
30Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser Ala
Phe Leu Thr 35 40 45Ala Ala Ile
Ile Leu Leu His Thr Phe Trp Gly Val Val Phe Phe Asp 50
55 60Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu
Val Val Gly Ser65 70 75
80His Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro Trp Tyr Glu Ala
85 90 95Ser Leu Leu Pro Ile Tyr
Ala Val Thr Val Ser Met Gly Leu Trp Ala 100
105 110Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln
Arg Ser Leu Leu 115 120 125Cys Lys
Asp 13040195PRTHomo sapiens 40Met Gly Ala Ala Val Phe Phe Gly Cys Thr
Phe Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val
20 25 30Ile Ile Leu Val Ala Gly
Arg Cys Ser Ala Leu Pro Thr Thr Ser Cys 35 40
45Leu Ile Ser Gly Leu Ser Phe Gly Ile Ile Ser Gly Val Phe
Ser Val 50 55 60Ile Asn Ile Leu Ala
Asp Ala Leu Gly Pro Gly Val Val Gly Ile His65 70
75 80Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser
Ala Phe Leu Thr Ala Ala 85 90
95Ile Ile Leu Leu His Thr Phe Trp Gly Val Val Phe Phe Asp Ala Cys
100 105 110Glu Arg Arg Arg Tyr
Trp Ala Leu Gly Leu Val Val Gly Ser His Leu 115
120 125Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro Trp Tyr
Glu Ala Ser Leu 130 135 140Leu Pro Ile
Tyr Ala Val Thr Val Ser Met Gly Leu Trp Ala Phe Ile145
150 155 160Thr Ala Gly Gly Ser Leu Arg
Ser Ile Gln Arg Ser Leu Leu Cys Arg 165
170 175Arg Gln Glu Asp Ser Arg Val Met Val Tyr Ser Ala
Leu Arg Ile Pro 180 185 190Pro
Glu Asp 19541114PRTHomo sapiens 41Met Gly Ala Ala Val Phe Phe Gly
Cys Thr Phe Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu
Arg Val 20 25 30Ile Ile Leu
Val Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu 35
40 45Ala Ser Val Val Trp Phe Ile Leu Val His Val
Thr Asp Arg Ser Asp 50 55 60Ala Arg
Leu Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65
70 75 80Leu Leu Gln Glu Val Phe Arg
Phe Ala Tyr Tyr Lys Leu Leu Asn Phe 85 90
95Trp Ser Leu Leu Arg Tyr His Gln Trp Cys Leu Leu Cys
Tyr Gln Tyr 100 105 110Phe
Gly42190PRTHomo sapiens 42Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe Val
Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val
20 25 30Ile Ile Leu Val Ala Gly Lys
Ala Asp Glu Gly Leu Ala Ser Leu Ser 35 40
45Glu Asp Gly Arg Ser Pro Ile Ser Ile Arg Gln Met Ala Tyr Val
Ser 50 55 60Gly Leu Ser Phe Gly Ile
Ile Ser Gly Val Phe Ser Val Ile Asn Ile65 70
75 80Leu Ala Asp Ala Leu Gly Pro Gly Val Val Gly
Ile His Gly Asp Ser 85 90
95Pro Tyr Tyr Phe Leu Thr Ser Ala Phe Leu Thr Ala Ala Ile Ile Leu
100 105 110Leu His Thr Phe Trp Gly
Val Val Phe Phe Asp Ala Cys Glu Arg Arg 115 120
125Arg Tyr Trp Ala Leu Gly Leu Val Val Gly Ser His Leu Leu
Thr Ser 130 135 140Gly Leu Thr Phe Leu
Asn Pro Trp Tyr Glu Ala Ser Leu Leu Pro Ile145 150
155 160Tyr Ala Val Thr Val Ser Met Gly Leu Trp
Ala Phe Ile Thr Ala Gly 165 170
175Gly Ser Leu Arg Ser Ile Gln Arg Ser Leu Leu Cys Lys Asp
180 185 19043247PRTHomo sapiens 43Met
Gly Ala Ala Val Phe Phe Gly Cys Thr Phe Val Ala Phe Gly Pro1
5 10 15Ala Phe Ala Leu Phe Leu Ile
Thr Val Ala Gly Asp Pro Leu Arg Val 20 25
30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp Leu Val Ser Leu
Leu Leu 35 40 45Ala Ser Val Val
Trp Phe Ile Leu Val His Val Thr Asp Arg Ser Asp 50 55
60Ala Arg Leu Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala
Val Ser Val65 70 75
80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys
85 90 95Ala Asp Glu Gly Leu Ala
Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile 100
105 110Ser Ile Arg Gln Met Ala Tyr Val Ser Gly Leu Ser
Phe Gly Ile Ile 115 120 125Ser Gly
Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu Gly Pro 130
135 140Gly Val Val Gly Ile His Gly Asp Ser Pro Tyr
Tyr Phe Leu Thr Ser145 150 155
160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu His Thr Phe Trp Gly Val
165 170 175Val Phe Phe Asp
Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu 180
185 190Val Val Gly Ser His Leu Leu Thr Ser Gly Leu
Thr Phe Leu Asn Pro 195 200 205Trp
Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val Thr Val Ser Met 210
215 220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly
Ser Leu Arg Ser Ile Gln225 230 235
240Arg Ser Leu Leu Cys Lys Asp 24544265PRTHomo
sapiens 44Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe Val Ala Phe Gly
Pro1 5 10 15Ala Phe Ala
Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val 20
25 30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp
Leu Val Ser Leu Leu Leu 35 40
45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr Asp Arg Ser Asp 50
55 60Ala Arg Leu Gln Tyr Gly Leu Leu Ile
Phe Gly Ala Ala Val Ser Val65 70 75
80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr Lys Leu Leu
Lys Lys 85 90 95Ala Asp
Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile 100
105 110Ser Ile Arg Gln Met Ala Tyr Val Ser
Gly Leu Ser Phe Gly Ile Ile 115 120
125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu Gly Pro
130 135 140Gly Val Val Gly Ile His Gly
Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145 150
155 160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu His Thr
Phe Trp Gly Val 165 170
175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu
180 185 190Val Val Gly Ser His Leu
Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195 200
205Trp Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val Thr Val
Ser Met 210 215 220Gly Leu Trp Ala Phe
Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225 230
235 240Arg Ser Leu Leu Cys Arg Arg Gln Glu Asp
Ser Arg Val Met Val Tyr 245 250
255Ser Ala Leu Arg Ile Pro Pro Glu Asp 260
26545247PRTHomo sapiens 45Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe
Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val
20 25 30Ile Ile Leu Val Ala Gly Ala
Phe Phe Trp Leu Val Ser Leu Leu Leu 35 40
45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr Asp Arg Ser
Asp 50 55 60Ala Arg Leu Gln Tyr Gly
Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr
Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile
100 105 110Ser Ile Arg Gln Met Ala
Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115 120
125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu
Gly Pro 130 135 140Gly Val Val Gly Ile
His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145 150
155 160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu
His Thr Phe Trp Gly Val 165 170
175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu
180 185 190Val Val Gly Ser His
Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val
Thr Val Ser Met 210 215 220Gly Leu Trp
Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Leu Leu Cys Lys Asp
24546265PRTHomo sapiens 46Met Gly Ala Ala Val Phe Phe Gly Cys
Thr Phe Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg
Val 20 25 30Ile Ile Leu Val
Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu 35
40 45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr
Asp Arg Ser Asp 50 55 60Ala Arg Leu
Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe
Ala Tyr Tyr Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser
Pro Ile 100 105 110Ser Ile Arg
Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115
120 125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala
Asp Ala Leu Gly Pro 130 135 140Gly Val
Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145
150 155 160Ala Phe Leu Thr Ala Ala Ile
Ile Leu Leu His Thr Phe Trp Gly Val 165
170 175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp
Ala Leu Gly Leu 180 185 190Val
Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile
Tyr Ala Val Thr Val Ser Met 210 215
220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Leu Leu
Cys Arg Arg Gln Glu Asp Ser Arg Val Met Val Tyr 245
250 255Ser Ala Leu Arg Ile Pro Pro Glu Asp
260 26547247PRTHomo sapiens 47Met Gly Ala Ala Val
Phe Phe Gly Cys Thr Phe Val Ala Phe Gly Pro1 5
10 15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly
Asp Pro Leu Arg Val 20 25
30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Leu
35 40 45Ala Ser Val Val Trp Phe Ile Leu
Val His Val Thr Asp Arg Ser Asp 50 55
60Ala Arg Leu Gln Tyr Gly Leu Leu Ile Phe Gly Ala Ala Val Ser Val65
70 75 80Leu Leu Gln Glu Val
Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys 85
90 95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp
Gly Arg Ser Pro Ile 100 105
110Ser Ile Arg Gln Met Ala Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile
115 120 125Ser Gly Val Phe Ser Val Ile
Asn Ile Leu Ala Asp Ala Leu Gly Pro 130 135
140Gly Val Val Gly Ile His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr
Ser145 150 155 160Ala Phe
Leu Thr Ala Ala Ile Ile Leu Leu His Thr Phe Trp Gly Val
165 170 175Val Phe Phe Asp Ala Cys Glu
Arg Arg Arg Tyr Trp Ala Leu Gly Leu 180 185
190Val Val Gly Ser His Leu Leu Thr Ser Gly Leu Thr Phe Leu
Asn Pro 195 200 205Trp Tyr Glu Ala
Ser Leu Leu Pro Ile Tyr Ala Val Thr Val Ser Met 210
215 220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly Ser Leu
Arg Ser Ile Gln225 230 235
240Arg Ser Leu Leu Cys Lys Asp 24548265PRTHomo sapiens
48Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe Val Ala Phe Gly Pro1
5 10 15Ala Phe Ala Leu Phe Leu
Ile Thr Val Ala Gly Asp Pro Leu Arg Val 20 25
30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp Leu Val Ser
Leu Leu Leu 35 40 45Ala Ser Val
Val Trp Phe Ile Leu Val His Val Thr Asp Arg Ser Asp 50
55 60Ala Arg Leu Gln Tyr Gly Leu Leu Ile Phe Gly Ala
Ala Val Ser Val65 70 75
80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys
85 90 95Ala Asp Glu Gly Leu Ala
Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile 100
105 110Ser Ile Arg Gln Met Ala Tyr Val Ser Gly Leu Ser
Phe Gly Ile Ile 115 120 125Ser Gly
Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu Gly Pro 130
135 140Gly Val Val Gly Ile His Gly Asp Ser Pro Tyr
Tyr Phe Leu Thr Ser145 150 155
160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu His Thr Phe Trp Gly Val
165 170 175Val Phe Phe Asp
Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu 180
185 190Val Val Gly Ser His Leu Leu Thr Ser Gly Leu
Thr Phe Leu Asn Pro 195 200 205Trp
Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val Thr Val Ser Met 210
215 220Gly Leu Trp Ala Phe Ile Thr Ala Gly Gly
Ser Ile Arg Ser Ile Gln225 230 235
240Arg Ser Leu Leu Cys Arg Arg Gln Glu Asp Ser Arg Val Met Val
Tyr 245 250 255Ser Ala Leu
Arg Ile Pro Pro Glu Asp 260 26549247PRTHomo
sapiens 49Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe Val Ala Phe Gly
Pro1 5 10 15Ala Phe Ala
Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val 20
25 30Ile Ile Leu Val Ala Gly Ala Phe Phe Trp
Leu Val Ser Leu Leu Leu 35 40
45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr Asp Arg Ser Asp 50
55 60Ala Arg Leu Gln Tyr Gly Leu Leu Ile
Phe Gly Ala Ala Val Ser Val65 70 75
80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr Lys Leu Leu
Lys Lys 85 90 95Ala Asp
Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile 100
105 110Ser Ile Arg Gln Met Ala Tyr Val Ser
Gly Leu Ser Phe Gly Ile Ile 115 120
125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu Gly Pro
130 135 140Gly Val Val Gly Ile His Gly
Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145 150
155 160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu His Thr
Phe Trp Gly Val 165 170
175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu
180 185 190Val Val Gly Ser His Leu
Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195 200
205Trp Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val Thr Val
Ser Met 210 215 220Gly Leu Trp Ala Phe
Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225 230
235 240Arg Ser Leu Leu Cys Lys Asp
24550247PRTHomo sapiens 50Met Gly Ala Ala Val Phe Phe Gly Cys Thr Phe
Val Ala Phe Gly Pro1 5 10
15Ala Phe Ala Leu Phe Leu Ile Thr Val Ala Gly Asp Pro Leu Arg Val
20 25 30Ile Ile Leu Val Ala Gly Ala
Phe Phe Trp Leu Val Ser Leu Leu Leu 35 40
45Ala Ser Val Val Trp Phe Ile Leu Val His Val Thr Asp Arg Ser
Asp 50 55 60Ala Arg Leu Gln Tyr Gly
Leu Leu Ile Phe Gly Ala Ala Val Ser Val65 70
75 80Leu Leu Gln Glu Val Phe Arg Phe Ala Tyr Tyr
Lys Leu Leu Lys Lys 85 90
95Ala Asp Glu Gly Leu Ala Ser Leu Ser Glu Asp Gly Arg Ser Pro Ile
100 105 110Ser Ile Arg Gln Met Ala
Tyr Val Ser Gly Leu Ser Phe Gly Ile Ile 115 120
125Ser Gly Val Phe Ser Val Ile Asn Ile Leu Ala Asp Ala Leu
Gly Pro 130 135 140Gly Val Val Gly Ile
His Gly Asp Ser Pro Tyr Tyr Phe Leu Thr Ser145 150
155 160Ala Phe Leu Thr Ala Ala Ile Ile Leu Leu
His Thr Phe Trp Gly Val 165 170
175Val Phe Phe Asp Ala Cys Glu Arg Arg Arg Tyr Trp Ala Leu Gly Leu
180 185 190Val Val Gly Ser His
Leu Leu Thr Ser Gly Leu Thr Phe Leu Asn Pro 195
200 205Trp Tyr Glu Ala Ser Leu Leu Pro Ile Tyr Ala Val
Thr Val Ser Met 210 215 220Gly Leu Trp
Ala Phe Ile Thr Ala Gly Gly Ser Leu Arg Ser Ile Gln225
230 235 240Arg Ser Leu Leu Cys Lys Asp
24551257PRTHomo sapiens 51Met Thr Ala Ala Val Phe Phe Gly Cys
Ala Phe Ile Ala Phe Gly Pro1 5 10
15Ala Leu Ala Leu Tyr Val Phe Thr Ile Ala Thr Glu Pro Leu Arg
Ile 20 25 30Ile Phe Leu Ile
Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Ile 35
40 45Ser Ser Leu Val Trp Phe Met Ala Arg Val Ile Ile
Asp Asn Lys Asp 50 55 60Gly Pro Thr
Gln Lys Tyr Leu Leu Ile Phe Gly Ala Phe Val Ser Val65 70
75 80Tyr Ile Gln Glu Met Phe Arg Phe
Ala Tyr Tyr Lys Leu Leu Lys Lys 85 90
95Ala Ser Glu Gly Leu Lys Ser Ile Asn Pro Gly Glu Thr Ala
Pro Ser 100 105 110Met Arg Leu
Leu Ala Tyr Val Ser Gly Leu Gly Phe Gly Ile Met Ser 115
120 125Gly Val Phe Ser Phe Val Asn Thr Leu Ser Asp
Ser Leu Gly Pro Gly 130 135 140Thr Val
Gly Ile His Gly Asp Ser Pro Gln Phe Phe Leu Tyr Ser Ala145
150 155 160Phe Met Thr Leu Val Ile Ile
Leu Leu His Val Phe Trp Gly Ile Val 165
170 175Phe Phe Asp Gly Cys Glu Lys Lys Lys Trp Gly Ile
Leu Leu Ile Val 180 185 190Leu
Leu Thr His Leu Leu Val Ser Ala Gln Thr Phe Ile Ser Ser Tyr 195
200 205Tyr Gly Ile Asn Leu Ala Ser Ala Phe
Ile Ile Leu Val Leu Met Gly 210 215
220Thr Trp Ala Phe Leu Ala Ala Gly Gly Ser Cys Arg Ser Leu Lys Leu225
230 235 240Cys Leu Leu Cys
Gln Asp Lys Asn Phe Leu Leu Tyr Asn Gln Arg Ser 245
250 255Arg52216PRTHomo sapiens 52Met Thr Ala Ala
Val Phe Phe Gly Cys Ala Phe Ile Ala Phe Gly Pro1 5
10 15Ala Leu Ala Leu Tyr Val Phe Thr Ile Ala
Thr Glu Pro Leu Arg Ile 20 25
30Ile Phe Leu Ile Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Ile
35 40 45Ser Ser Leu Val Trp Phe Met Ala
Arg Val Ile Ile Asp Asn Lys Asp 50 55
60Gly Pro Thr Gln Lys Tyr Leu Leu Ile Phe Gly Ala Phe Val Ser Val65
70 75 80Tyr Ile Gln Glu Met
Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys 85
90 95Ala Ser Glu Gly Leu Lys Ser Ile Asn Pro Gly
Glu Thr Ala Pro Ser 100 105
110Met Arg Leu Leu Ala Tyr Ala Phe Met Thr Leu Val Ile Ile Leu Leu
115 120 125His Val Phe Trp Gly Ile Val
Phe Phe Asp Gly Cys Glu Lys Lys Lys 130 135
140Trp Gly Ile Leu Leu Ile Val Leu Leu Thr His Leu Leu Val Ser
Ala145 150 155 160Gln Thr
Phe Ile Ser Ser Tyr Tyr Gly Ile Asn Leu Ala Ser Ala Phe
165 170 175Ile Ile Leu Val Leu Met Gly
Thr Trp Ala Phe Leu Ala Ala Gly Gly 180 185
190Ser Cys Arg Ser Leu Lys Leu Cys Leu Leu Cys Gln Asp Lys
Asn Phe 195 200 205Leu Leu Tyr Asn
Gln Arg Ser Arg 210 2155381PRTHomo sapiens 53Met Thr
Ala Ala Val Phe Phe Gly Cys Ala Phe Ile Ala Phe Gly Pro1 5
10 15Ala Leu Ala Leu Tyr Val Phe Thr
Ile Ala Thr Glu Pro Leu Arg Ile 20 25
30Ile Phe Leu Ile Ala Gly Arg Arg Val Glu Thr Cys Lys Asn Thr
Glu 35 40 45Ala Pro Asp Cys Ala
Ser Pro Ser Gly Ser Leu Ser Phe Leu Leu Val 50 55
60Gly Val Ser Thr Asp Phe Val Pro Cys Leu Val His Gly Lys
Ser His65 70 75
80Tyr54257PRTHomo sapiens 54Met Thr Ala Ala Val Phe Phe Gly Cys Ala Phe
Ile Ala Phe Gly Pro1 5 10
15Ala Leu Ala Leu Tyr Val Phe Thr Ile Ala Thr Glu Pro Leu Arg Ile
20 25 30Ile Phe Leu Ile Ala Gly Ala
Phe Phe Trp Leu Val Ser Leu Leu Ile 35 40
45Ser Ser Leu Val Trp Phe Met Ala Arg Val Ile Ile Asp Asn Lys
Asp 50 55 60Gly Pro Thr Gln Lys Tyr
Leu Leu Ile Phe Gly Ala Phe Val Ser Val65 70
75 80Tyr Ile Arg Glu Met Phe Arg Phe Ala Tyr Tyr
Lys Leu Leu Lys Lys 85 90
95Ala Ser Glu Gly Leu Lys Ser Ile Asn Pro Gly Glu Thr Ala Pro Ser
100 105 110Met Arg Leu Leu Ala Tyr
Val Ser Gly Leu Gly Phe Gly Ile Met Ser 115 120
125Gly Val Phe Ser Phe Val Asn Thr Leu Ser Asp Ser Leu Gly
Pro Gly 130 135 140Thr Val Gly Ile His
Gly Asp Ser Pro Gln Phe Phe Leu Tyr Ser Ala145 150
155 160Phe Met Thr Leu Val Ile Ile Leu Leu His
Val Phe Trp Gly Ile Val 165 170
175Phe Phe Asp Gly Cys Glu Lys Lys Lys Trp Gly Ile Leu Leu Ile Val
180 185 190Leu Leu Thr His Leu
Leu Val Ser Ala Gln Thr Phe Ile Ser Ser Tyr 195
200 205Tyr Gly Ile Asn Leu Ala Ser Ala Phe Ile Ile Leu
Val Leu Met Gly 210 215 220Thr Trp Ala
Phe Leu Ala Ala Gly Gly Ser Cys Arg Ser Leu Lys Leu225
230 235 240Cys Leu Leu Cys Gln Asp Lys
Asn Phe Leu Leu Tyr Asn Gln Arg Ser 245
250 255Arg55257PRTHomo sapiens 55Met Thr Ala Ala Val Phe
Phe Gly Cys Ala Phe Ile Ala Phe Gly Pro1 5
10 15Ala Leu Ala Leu Tyr Val Phe Thr Ile Ala Thr Glu
Pro Leu Arg Ile 20 25 30Ile
Phe Leu Ile Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Ile 35
40 45Ser Ser Leu Val Trp Phe Met Ala Arg
Val Ile Ile Asp Asn Lys Asp 50 55
60Gly Pro Thr Gln Lys Tyr Leu Leu Ile Phe Gly Ala Phe Val Ser Val65
70 75 80Tyr Ile Gln Glu Met
Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys 85
90 95Ala Ser Glu Gly Leu Lys Ser Ile Asn Pro Gly
Glu Thr Ala Pro Ser 100 105
110Met Arg Leu Leu Ala Tyr Val Ser Gly Leu Gly Phe Gly Ile Met Ser
115 120 125Gly Val Phe Ser Phe Val Asn
Thr Leu Ser Asp Ser Leu Gly Pro Gly 130 135
140Thr Val Gly Ile His Gly Asp Ser Pro Gln Phe Phe Leu Tyr Ser
Ala145 150 155 160Phe Met
Thr Leu Val Ile Ile Leu Leu His Val Phe Trp Gly Ile Val
165 170 175Phe Phe Asp Gly Cys Glu Lys
Lys Lys Trp Gly Ile Leu Leu Ile Val 180 185
190Leu Leu Thr His Leu Leu Val Ser Ala Gln Thr Phe Ile Ser
Ser Tyr 195 200 205Tyr Gly Ile Asn
Leu Ala Ser Ala Phe Ile Ile Leu Val Leu Met Gly 210
215 220Thr Trp Ala Phe Leu Ala Ala Gly Gly Ser Cys Arg
Ser Leu Lys Leu225 230 235
240Cys Leu Leu Cys Gln Asp Lys Asn Phe Leu Leu Tyr Asn Gln Arg Ser
245 250 255Arg56257PRTHomo
sapiens 56Met Thr Ala Ala Val Phe Phe Gly Cys Ala Phe Ile Ala Phe Gly
Pro1 5 10 15Ala Leu Ala
Leu Tyr Val Phe Thr Ile Ala Thr Glu Pro Leu Arg Ile 20
25 30Ile Phe Leu Ile Ala Gly Ala Phe Phe Trp
Leu Val Ser Leu Leu Ile 35 40
45Ser Ser Leu Val Trp Phe Met Ala Arg Val Ile Ile Asp Asn Lys Asp 50
55 60Gly Pro Thr Gln Lys Tyr Leu Leu Ile
Phe Gly Ala Phe Val Ser Val65 70 75
80Tyr Ile Arg Glu Met Phe Arg Phe Ala Tyr Tyr Lys Leu Leu
Lys Lys 85 90 95Ala Ser
Glu Gly Leu Lys Ser Ile Asn Pro Gly Glu Thr Ala Pro Ser 100
105 110Met Arg Leu Leu Ala Tyr Val Ser Gly
Leu Gly Phe Gly Ile Met Ser 115 120
125Gly Val Phe Ser Phe Val Asn Thr Leu Ser Asp Ser Leu Gly Pro Gly
130 135 140Thr Val Gly Ile His Gly Asp
Ser Pro Gln Phe Phe Leu Tyr Ser Ala145 150
155 160Phe Met Thr Leu Val Ile Ile Leu Leu His Val Phe
Trp Gly Ile Val 165 170
175Phe Phe Asp Gly Cys Glu Lys Lys Lys Trp Gly Ile Leu Leu Ile Val
180 185 190Leu Leu Thr His Leu Leu
Val Ser Ala Gln Thr Phe Ile Ser Ser Tyr 195 200
205Tyr Gly Ile Asn Leu Ala Ser Ala Phe Ile Ile Leu Val Leu
Met Gly 210 215 220Thr Trp Ala Phe Leu
Ala Ala Gly Gly Ser Cys Arg Ser Leu Lys Leu225 230
235 240Cys Leu Leu Cys Gln Asp Lys Asn Phe Leu
Leu Tyr Asn Gln Arg Ser 245 250
255Arg57257PRTHomo sapiens 57Met Thr Ala Ala Val Phe Phe Gly Cys Ala
Phe Ile Ala Phe Gly Pro1 5 10
15Ala Leu Ala Leu Tyr Val Phe Thr Ile Ala Ile Glu Pro Leu Arg Ile
20 25 30Ile Phe Leu Ile Ala Gly
Ala Phe Phe Trp Leu Val Ser Leu Leu Ile 35 40
45Ser Ser Leu Val Trp Phe Met Ala Arg Val Ile Ile Asp Asn
Lys Asp 50 55 60Gly Pro Thr Gln Lys
Tyr Leu Leu Ile Phe Gly Ala Phe Val Ser Val65 70
75 80Tyr Ile Gln Glu Met Phe Arg Phe Ala Tyr
Tyr Lys Leu Leu Lys Lys 85 90
95Ala Ser Glu Gly Leu Lys Ser Ile Asn Pro Gly Glu Thr Ala Pro Ser
100 105 110Met Arg Leu Leu Ala
Tyr Val Ser Gly Leu Gly Phe Gly Ile Met Ser 115
120 125Gly Val Phe Ser Phe Val Asn Thr Leu Ser Asp Ser
Leu Gly Pro Gly 130 135 140Thr Val Gly
Ile His Gly Asp Ser Pro Gln Phe Phe Leu Tyr Ser Ala145
150 155 160Phe Met Thr Leu Val Ile Ile
Leu Leu His Val Phe Trp Gly Ile Val 165
170 175Phe Phe Asp Gly Cys Glu Lys Lys Lys Trp Gly Ile
Leu Leu Ile Val 180 185 190Leu
Leu Thr His Leu Leu Val Ser Ala Gln Thr Phe Ile Ser Ser Tyr 195
200 205Tyr Gly Ile Asn Leu Ala Ser Ala Phe
Ile Ile Leu Val Leu Met Gly 210 215
220Thr Trp Ala Phe Leu Ala Ala Gly Gly Ser Cys Arg Ser Leu Lys Leu225
230 235 240Cys Leu Leu Cys
Gln Asp Lys Asn Phe Leu Leu Tyr Asn Gln Arg Ser 245
250 255Arg58257PRTHomo sapiens 58Met Thr Ala Ala
Val Phe Phe Gly Cys Ala Phe Ile Ala Phe Gly Pro1 5
10 15Ala Leu Ala Leu Tyr Val Phe Thr Ile Ala
Thr Glu Pro Leu Arg Ile 20 25
30Ile Phe Leu Ile Ala Gly Ala Phe Phe Trp Leu Val Ser Leu Leu Ile
35 40 45Ser Ser Leu Val Trp Phe Met Ala
Arg Val Ile Ile Asp Asn Lys Asp 50 55
60Gly Pro Thr Gln Lys Tyr Leu Leu Ile Phe Gly Ala Phe Val Ser Val65
70 75 80Tyr Ile Gln Glu Met
Phe Arg Phe Ala Tyr Tyr Lys Leu Leu Lys Lys 85
90 95Ala Ser Glu Gly Leu Lys Ser Ile Asn Pro Gly
Glu Thr Ala Pro Ser 100 105
110Met Arg Leu Leu Ala Tyr Val Ser Gly Leu Gly Phe Gly Ile Met Ser
115 120 125Gly Val Phe Ser Phe Val Asn
Thr Leu Ser Asp Ser Leu Gly Pro Gly 130 135
140Thr Val Gly Ile His Gly Asp Ser Pro Gln Phe Phe Leu Tyr Ser
Ala145 150 155 160Phe Met
Thr Leu Val Ile Ile Leu Leu His Val Phe Trp Gly Ile Val
165 170 175Phe Phe Asp Gly Cys Glu Lys
Lys Lys Trp Gly Ile Leu Leu Ile Val 180 185
190Leu Leu Thr His Leu Leu Val Ser Ala Gln Thr Phe Ile Ser
Ser Tyr 195 200 205Tyr Gly Ile Asn
Leu Ala Ser Ala Phe Ile Ile Leu Val Leu Met Gly 210
215 220Thr Trp Ala Phe Leu Ala Ala Gly Gly Ser Cys Arg
Ser Leu Lys Leu225 230 235
240Cys Leu Leu Cys Gln Asp Lys Asn Phe Leu Leu Tyr Asn Gln Arg Ser
245 250 255Arg
User Contributions:
Comment about this patent or add new information about this topic: