Patent application title: COMPOSITION FOR DIAGNOSING ALLERGIES TO MITES, METHOD OF DIAGNOSING ALLERGIES TO MITES, AND COMPOSITION FOR PREVENTING OR TREATING ALLERGIES TO MITES
Inventors:
IPC8 Class: AA61K3817FI
USPC Class:
1 1
Class name:
Publication date: 2019-03-28
Patent application number: 20190091292
Abstract:
Mite proteins according to an aspect may be used in diagnosing allergic
diseases. Results of diagnosing allergic diseases by using the proteins
have high reliability and validity. Further, the proteins may be used in
a composition for preventing or treating allergic diseases.Claims:
1. A method of diagnosing an allergic disease to at least one mite
species, the method comprising: detecting binding of Der f 11, Der f 13,
Der f 14, Der f 32, Der f Alt a 10, or a combination thereof and IgE
antibodies in a biological sample isolated from a subject; diagnosing
with an allergic disease to at least one mite species when a binding
between the IgE antibody and Der f 11, Der f 13, Der f 14, Der f 32, Der
f Alt a 10, or a combination thereof is detected, administrating an
effective amount of Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a
10, or a combination thereof to the subject diagnosed with the allergic
disease to at least one mite species.
2. The method of claim 1, wherein the Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof comprises an amino acid sequence having about 95% or more sequence homology with any one amino acid sequence selected from SEQ ID NOS: 1, 3, 5, 7, and 9.
3. The method of claim 1, further comprising detecting binding of Der f 1, Der f 2, Der f 10, Der f 30, or a combination thereof and IgE antibodies in the biological sample.
4. The method of claim 3, wherein the Der f 1, Der f 2, Der f 10, Der f 30, or a combination thereof comprises an amino acid sequence having about 95% or more sequence homology with any one amino acid sequence selected from SEQ ID NOS: 11, 13, 15, and 17.
5. The method of claim 1, wherein the detecting is performed by immunoassay.
6. The method of claim 1, wherein the at least one mite species is Dermatophagoides farinae, Dermatophagoides pteronyssinus, Euroglyphus maynei, Tyrophagus putrescentiae, Blomia tropicalis, or a combination thereof.
7. The method of claim 1, wherein the allergic disease is allergic asthma, allergic rhinitis, atopic dermatitis, or a combination thereof.
8. The method of claim 1, further comprising administrating an effective amount of Der f 1, Der f 2, Der f 10, Der f 30, or a combination thereof to the subject diagnosed with the allergic disease to at least one mite species.
9. A method of treating an allergic disease to at least one mite species, the method comprising: administrating an effective amount of Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof to a subject diagnosed with an allergic disease to at least one mite species.
10. The method of claim 9, further comprising administrating an effective amount of Der f 1, Der f 2, Der f 10, Der f 30, or a combination thereof to the subject.
Description:
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of Korean Patent Application No. 10-2017-0122870, filed on Sep. 22, 2017, in the Korean Intellectual Property Office, the disclosure of which is incorporated herein in its entirety by reference.
BACKGROUND
1. Field
[0002] The present disclosure relates to a composition and a kit for diagnosing allergies to mites, a method of diagnosing allergies to mites, and a composition for preventing or treating allergies to mites.
2. Description of the Related Art
[0003] House dust mites (HDM) are the most ubiquitous indoor aeroallergen worldwide. Sensitization due to chronic and continuous exposure to allergens causes a variety of diseases throughout one's lifetime, starting from a young age. Sensitization to HDM may cause allergic rhinitis (AR), allergic asthma (AA), and atopic dermatitis (AD).
[0004] Major species of pathogenic mites causing allergic diseases include Dermatophagoides farinae (D. farinae) and Dermatophagoides pteronyssinus (D. pteronyssinus). These two species account for about 90% of HDM allergies. Sensitization profiles of HDM show geographical variations. D. farina is predominant in dry regions, while D. pteronyssinus lives in humid regions. In Korea, most of the patients sensitized to storage mites are also sensitized to HDM, and thus they tend to show cross-reactivity.
[0005] Recently, it has been reported that various components of HDM, for example, mite body, feces, eggs, exuviae, etc., are associated with various allergic diseases, and the respective proteins having various immunological-biological characteristics. For this reason, HDM may cause various diseases during the development of allergies, and HDM may cause various sensitization patterns. Precise identification of sensitization patterns is important for accurate diagnosis and treatment, particularly for allergen specific immunotherapy (AIT).
[0006] Accordingly, the present inventors analyzed IgE reactivities in Korean patients with HDM allergies who showed various clinical signs, and they identified allergens specific to allergic diseases, thereby completing the present disclosure.
SUMMARY
[0007] An aspect provides a composition for diagnosing an allergic disease to at least one mite species.
[0008] Another aspect provides a kit for diagnosing an allergic disease to at least one mite species.
[0009] Still another aspect provides a method of providing information which is needed to diagnose an allergic disease to at least one mite species.
[0010] Still another aspect provides a composition for preventing or treating an allergic disease to at least one mite species.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] These and/or other aspects will become apparent and more readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings in which:
[0012] FIGS. 1A to 1D show differences in IgE reactivities between allergic respiratory disease patients and atopic dermatitis patients, in which FIG. 1A shows a protein profile of Dermatophagoides farinae, FIG. 1B shows IgE reactivity of allergic respiratory disease patients, FIG. 1C shows IgE reactivity of atopic dermatitis-accompanying allergic respiratory disease patients, and FIG. 1D shows IgE reactivity of atopic dermatitis patients;
[0013] FIGS. 2A to 2D show differences in IgE reactivities between allergic respiratory disease patients and allergic dermatitis patients, as analyzed by two-dimensional protein separation, in which FIG. 2A shows a protein profile of Dermatophagoides farinae, FIG. 2B shows IgE reactivity of allergic respiratory disease patients, FIG. 2C shows IgE reactivity of atopic dermatitis-accompanying allergic respiratory disease patients, and FIG. 2D shows IgE reactivity of atopic dermatitis patients;
[0014] FIG. 3 shows results of examining recombinant allergens of Dermatophagoides farinae;
[0015] FIG. 4 shows results of comparing IgE reactivities to mite allergens by ELISA and ImmunoCAP;
[0016] FIGS. 5A and 5B show sensitization profiles of all allergic disease patients and allergic respiratory disease or skin allergic disease patient groups with respect to house dust mite component allergens;
[0017] FIGS. 6A and 6B show the distribution of the number of sensitized component allergens in allergic respiratory disease patients and dermatitis patients; and
[0018] FIG. 7 shows IgE reactivities specific to component allergens in the respective disease groups.
[0019] FIG. 8 show percent (%) of dual sensitizer or multiple sensitizer to sensitized house dust mites component allergens.
DETAILED DESCRIPTION
[0020] An aspect provides a composition for diagnosing allergies to mites, the composition including Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof. The protein may include a polypeptide or a fragment thereof, wherein the polypeptide may include an amino acid sequence having about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence homology with any one amino acid sequence selected from SEQ ID NOS: 1, 3, 5, 7, and 9. The composition may include a polypeptide or a fragment thereof, or a combination thereof, wherein the polypeptide may include an amino acid sequence having about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence homology with any one amino acid sequence selected from SEQ ID NOS: 1, 3, 5, 7, and 9.
[0021] Der f 11 is a fragment of paramyosin and has about 98 kDa. Der f 11 may include an amino acid sequence registered as GenBank Accession number AAK39511.1, European Nucleotide Archive number A1008864, or UniProtKB Accession number Q967Z0, or an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 19, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number AF352244, or a nucleotide sequence of SEQ ID NO: 2. Der f 13 is a fatty acid-binding protein and has about 15 kDa. Der f 13 may include an amino acid sequence registered as GenBank Accession number AAP35078, European Nucleotide Archive number AAP35078.1, or UniProtKB Accession Number Q1M2P5, or an amino acid sequence of SEQ ID NO: 3, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number AY283293, or a nucleotide sequence of SEQ ID NO: 4. Der f 14 is a fragment of apolipophorin and has about 177 kDa. Der f 14 may include an amino acid sequence registered as GenBank Accession number BAA04558, European Nucleotide Archive number P39673, or UniProtKB Accession Number Q94507, or an amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 20, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number D17686, or a nucleotide sequence of SEQ ID NO: 6. Der f 32 is secreted inorganic pyrophosphatase and has about 35 kDa. Der f 32 may include an amino acid sequence registered as GenBank Accession number A1008849.1, or European Nucleotide Archive number A1008849, or an amino acid sequence of SEQ ID NO: 7, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number KM009993, or a nucleotide sequence of SEQ ID NO: 8. Der f Alt a 10 is aldehyde dehydrogenase and has about 53 kDa. Der f Alt a 10 may include an amino acid sequence registered as UniProtKB Accession Number A1KXH7 or European Nucleotide Archive number AAP35081, or an amino acid sequence of SEQ ID NO: 9, or an amino acid sequence which is encoded by a nucleotide sequence registered as European Nucleotide Archive number AY283296, or a nucleotide sequence of SEQ ID NO: 10.
[0022] The composition may include Der f 1, Der f 2, Der f 10, Der f 30, ora combination thereof. The protein may include a polypeptide or a fragment thereof, wherein the polypeptide may include an amino acid sequence having about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence homology with any one amino acid sequence selected from SEQ ID NOS: 11, 13, 15, and 17. The composition may include a polypeptide or a fragment thereof, or a combination thereof, wherein the polypeptide may include an amino acid sequence having about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or 100% sequence homology with any one amino acid sequence selected from SEQ ID NOS: 11, 13, 15, and 17.
[0023] Der f 1 is cysteine protease and has 27 kDa. Der f 1 may include an amino acid sequence registered as GenBank Accession number BAC53948, or UniProtKB Accession Number Q58A71, or an amino acid sequence of SEQ ID NO: 11 or SEQ ID NO: 21, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number AB034946 or a nucleotide sequence of SEQ ID NO: 12 or SEQ ID NO: 22. Der f 2 is an NPC2 family and has 15 kDa. Der f 2 may include an amino acid sequence registered as GenBank Accession number BAA01240 or UniProtKB Accession Number Q00855, or an amino acid sequence of SEQ ID NO: 13, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number D10448 or a nucleotide sequence of SEQ ID NO: 14. Der f 10 is tropomyosin and has 37 kDa. Der f 10 may include an amino acid sequence registered as GenBank Accession number BAA04557 or UniProtKB Accession Number Q23939, or an amino acid sequence of SEQ ID NO: 15, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number D17682 or a nucleotide sequence of SEQ ID NO: 16. Der f 30 is ferritin and has 16 kDa. Der f 30 may include an amino acid sequence registered as GenBank Accession number GC56219.1 or UniProtKB Accession Number L7UZ91, or an amino acid sequence of SEQ ID NO: 17, or an amino acid sequence which is encoded by a nucleotide sequence registered as GenBank Accession number KC305503 or a nucleotide sequence of SEQ ID NO: 18.
[0024] The "homology" means a percentage of identity between nucleotide sequences of two polynucleotides or between amino acid sequences of two polypeptides. A sequence homology between one moiety and another moiety may be determined by technologies known in the art, and for example, determined by a BLAST algorithm as disclosed in a literature [see Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)] or by Pearson's FASTA [see Methods Enzymol., 183, 63(1990)].
[0025] The "fragment" means a part of a polypeptide, not the whole polypeptide, and reacts with IgE antibody to induce an antigen-antibody reaction. The protein may be, derived from a mite, an allergen causing an allergic disease. The protein may be a mite body, feces, egg, or exuviae, or a combination thereof.
[0026] The protein may be recombinantly prepared using animal cells or bacteria. The protein may include an additional amino acid sequence. The protein may include, for example, an additional amino acid sequence at the N-terminus and/or C-terminus of a polypeptide having an amino acid sequence of SEQ ID NO: 1 or a fragment thereof. The additional amino acid sequence may be added in order to purify the recombinantly prepared protein, for example, in order to apply the protein to affinity column chromatography. The bacteria may be microorganisms of the genus Escherichia, and for example, E. coli. The bacteria may be Pichia. With regard to the composition, when the protein is recombinantly prepared and expressed in bacteria, the protein may be obtained by introducing into the bacteria a polynucleotide having a nucleotide sequence encoding a polypeptide or a fragment thereof, wherein the polypeptide includes an amino acid sequence having about 95% or more sequence homology with the amino acid sequence of the above SEQ ID NO. The polynucleotide having the nucleotide sequence may be codon-optimized for the bacteria.
[0027] Introduction of the polynucleotide into bacteria may be, for example, introduction of the polynucleotide in the form of an expression cassette or introduction of the polynucleotide itself. The expression cassette may include all elements required for autonomous expression of the polynucleotide. The expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of a self-replicable expression vector. The vector may be an expression vector known in the art. For introduction of the polynucleotide itself, the polynucleotide may be operably linked to a sequence needed for expression in a host cell to be introduced. The bacteria into which the polynucleotide is introduced may be transformed bacteria.
[0028] Culturing of the bacteria for the production of the recombinant protein may be performed according to appropriate media and culture conditions known in the art. Those skilled in the art may easily modify the culture process depending on a selected strain. The culture method may include batch culture, continuous culture, and fed-batch culture, but is not limited thereto. Various methods of culturing microorganisms are disclosed in, for example, Biochemical Engineering, James M. Lee, Prentice-Hall International Editions.
[0029] The media may include a variety of carbon sources, nitrogen sources, and trace elements. Carbon sources that are applicable to media for culturing microorganisms may include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid, but are not limited thereto. These carbon sources may be used alone or in combination thereof. Nitrogen sources that are applicable to media for culturing microorganisms may include organic nitrogen sources such as peptone, yeast extract, meat extract, malt extract, corn steep liquor, and soybean meal, and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, but are not limited thereto. These nitrogen sources may be used alone or in combination thereof. Phosphorus sources that are applicable to media for culturing microorganisms may include potassium phosphate monobasic, potassium phosphate dibasic, and corresponding sodium-containing salts. The media may further include a metal salt such as magnesium sulfate or iron sulfate. In addition, the media may include amino acids, vitamins, appropriate precursors, etc. The media for culturing microorganisms or individual components may be added to culture media in a batch or continuous manner.
[0030] The "allergen" means an antigen that causes an allergic disease or an antigen that is a cause of an allergic disease. Once antibodies are produced in a human body by intake or contact of any kind of a substance containing the allergen, an antigen-antibody reaction may occur by re-intake or re-contact of the same substance.
[0031] With regard to the composition, since the protein is an allergen which is a cause of allergies to mites, allergies to mites may be diagnosed by examining an antigen-antibody reaction between the protein and IgE antibodies in a biological sample isolated from a subject.
[0032] The "diagnosis" means confirming the presence or characteristics of pathological state. Therefore, the diagnosis of allergies to mites means confirming or predicting occurrence of allergies to mites or possibility of occurrence of allergies to mites.
[0033] The "antibody" is, a term known in the art, a specific polypeptide directed against an antigenic region, or a fragment thereof. The IgE antibody is a sensitizing antibody produced by an allergen, and produced by plasma cells, and binds to a receptor on the surface of mast cells or basophils. IgE antibody may cause anaphylaxis (a specific symptom caused by an antigen-antibody reaction).
[0034] The mite may be a house dust mite, a storage mite, or a combination thereof. The mite may be Dermatophagoides farina, Dermatophagoides pteronyssinus, Euroglyphus maynei, Tyrophagus putrescentiae, Blomia tropicalis, or a combination thereof. That is, since there is cross-reactivity between mites, the allergic disease may be caused by Dermatophagoides farinae, Dermatophagoides pteronyssinus, Euroglyphus maynei, Tyrophagus putrescentiae, Blomia tropicalis, or a combination thereof.
[0035] The allergic disease may be targeted to a people including Korean. The allergic disease may be allergic asthma, allergic rhinitis, atopic dermatitis, or a combination thereof. When a positive reaction is detected in the binding between IgE antibody in a sample and Der f 1, Der f 2, or a combination thereof, the sample may be diagnosed with allergic disease. When a positive reaction is detected in the binding between IgE antibody in a sample and Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof, the sample may be diagnosed with allergic dermatitis. When a negative reaction is detected in the binding between IgE antibody in a sample and Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof, the sample may be diagnosed with allergic respiratory disease.
[0036] Clinical symptoms of a patient may be accurately predicted and appropriate immunotherapy may be applied to the patient by monitoring allergen sensitization patterns and profiles during progression of allergic reaction.
[0037] Another aspect provides a kit for diagnosing allergies to mites, the kit including Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof.
[0038] The kit may include Der f 1, Der f 2, Der f 10, Der f 30, or a combination thereof.
[0039] The protein, polypeptide or fragment thereof, composition, mite, diagnosis of allergies are the same as described above.
[0040] The kit may be manufactured into many different kinds of known kits. For example, the kit may be a kit for immunoassay, which may qualitatively or quantitatively analyze reactivity between the protein and IgE antibodies in a biological sample isolated from a subject.
[0041] The kit may include a solid substrate which is coated with the protein, anti-IgE antibody which is able to bind to IgE antibodies in a biological sample isolated from a subject and is conjugated with a label generating a detectable signal, and a reagent which is needed to detect an antigen (allergen)-antibody (IgE) reaction. The solid substrate may be hydrocarbon polymers (e.g., polystyrene, polypropylene, etc.), glass, metals, or gels. The solid substrate may be a microtiter plate. The label generating a detectable signal may include a chemical (e.g., biotin, etc.), an enzyme (e.g., alkaline phosphatase, 3-galactosidase, horseradish peroxidase, Cytochrome P450, etc.), a radioactive substance, a fluorescent substance (e.g., fluorescein, etc.), a luminescent substance, a chemiluminescent substance, and fluorescence resonance energy transfer (FRET), but is not limited thereto. Various labels and labeling methods are described in Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999. The kit may be manufactured to have a plurality of separate packages or compartments including the above-described components.
[0042] Still another aspect provides a method of detecting binding of Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof and IgE antibodies in a biological sample isolated from a subject, in order to provide information needed for diagnosis of allergies to mites.
[0043] The method may include detecting binding of Der f 1, Der f 2, Der f 10, Der f 30, or a combination thereof and IgE antibodies in a biological sample isolated from a subject.
[0044] The protein, polypeptide or fragment thereof, composition, mite, and diagnosis of allergies are the same as described above.
[0045] The "subject" means a subject who is examined or predicted in order to confirm whether or not having an allergic disease to at least one mite species or having possibility of an allergic disease to at least one mite species. The subject may be a vertebrate, specifically a mammal, an amphibian, a reptile, a bird, etc., and more specifically a mammal, for example, a human (Homo sapiens). The human may be a Korean people.
[0046] The "biological sample" may include tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine, etc., which is separated from the subject, but is not limited thereto.
[0047] The method may be performed by immunoassay (antigen-antibody reaction). The immunoassay may include radioimmunoassay, radioimmuno-precipitation, immuno-precipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, immunofluorescence staining, and immunoaffinity purification, but is not limited thereto. The immunoassay is described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Fla., 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J. M. ed., Humana Press, N J, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which may be served as a reference.
[0048] For example, when the method is performed by the radioimmunoassay method, an antibody (IgE-specific antibody) labeled with a radioisotope (e.g., C.sup.14, I.sup.125, P.sup.32, S.sup.35, etc.) may be used. In the method, antibody bound with the above-described label generating a detectable signal may be also used. For example, when the method is performed by the ELISA method, the method may include (i) coating a surface of a solid substrate with the identified protein; (ii) adding a biological sample isolated from a subject to the coated solid substrate; (iii) reacting the resultant of (ii) with an anti-IgE secondary antibody conjugated with an enzyme; and (iv) measuring activity of the enzyme. The enzyme conjugated to the secondary antibody may include an enzyme catalyzing colorimetric, fluorometric, luminescence, or infra-red reactions, but is not limited thereto, and for example, alkaline phosphatase, .beta.-galactosidase, horseradish peroxidase, luciferase, or Cytochrome P450. When alkaline phosphatase is used as the enzyme conjugated to the secondary antibody, a colorimetric substrate such as bromochloroindolyl phosphate, nitro blue tetrazolium, naphthol-AS-B1-phosphate, or enhanced chemifluorescence (ECF) may be used as a substrate. When horseradish peroxidase is used, chloronaphtol, aminoethylcarbazol, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorufin benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), p-phenylenediamine-HCl and pyrocatechol (HYR), tetramethylbenzidine (TMB), 2,2'-azine-di[3-ethylbenzthiazoline sulfonate (ABTS), o-phenylenediamine, naphthol/pyronine, glucose oxidase and t-nitroblue tetrazolium (t-NBT) or m-phenazine methosulfate (m-PMS) may be used as a substrate.
[0049] Providing information needed for diagnosis of allergies to mites may be for prediction or diagnosis of relative risk of allergies to mites. When a positive reaction is detected in biding between IgE antibody and Der f 1, Der f 2, or a combination thereof, it may be determined that the subject belongs to a high risk group for the development of allergies to mites. When a positive reaction is detected in biding between IgE antibody and Der f 11, Der f 13, Der f 14, Der f 32, Der f Alta 10, ora combination thereof, it may be determined that the subject belongs to a high risk group for the development of atopic dermatitis to mites. When a negative reaction is detected in biding between IgE antibody and Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof, it may be determined that the subject belongs to a high risk group for the development of allergic respiratory diseases to mites.
[0050] In the method, measurement of the final enzymatic activity or measurement of the signal may be performed according to various methods known in the art. The detection of the signal indicates binding of the protein and IgE in the biological sample isolated from the subject, and this information may be utilized in diagnosing allergies to mites.
[0051] Still another aspect provides a composition for preventing or treating allergies to mites, the composition including Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof.
[0052] The composition may include Der f 1, Der f 2, Der f 10, Der f 30, ora combination thereof.
[0053] The composition may be an immunotherapy composition for preventing or treating allergies to mites.
[0054] The "immunotherapy (allergen immunotherapy)" means a therapy of reducing sensitivity or hypersensitivity to a specific allergen by administering an allergen which is a cause of allergic disease to the subject via injection, starting with a low dose, with gradual increases in dose for a predetermined period. That is, the immunotherapy means a hyposensitization therapy for a causative allergen. The immunotherapy may be performed via subcutaneous injection and/or respiratory tract. Such an immunotherapy may be a therapy consisting of two phases: an initial therapy of reaching a maintenance dose by gradually increasing a dose of allergen, starting from a low dose, and a maintenance therapy of maintaining the dose for 3 years to 5 years; a therapy of administering a high dose of allergen for a day to a week immediately before the season; or a therapy of administering a low dose of allergen for several years. Through the immunotherapy of administering the protein or the composition, manifestation of symptoms by antigen-antibody reactions may be prevented or inhibited at the time of subsequent exposure to the allergen. In other words, since the protein is a cause of allergies to mites, the protein may be used in the immunotherapy for preventing or treating allergies to mites.
[0055] The composition may be a pharmaceutical composition. The pharmaceutical composition may include the allergen which is the active ingredient in an amount of about 0.0001% by weight to about 50% by weight, with respect to the total weight of the composition. For administration, the pharmaceutical composition may be prepared by further including one or more pharmaceutically acceptable carriers, in addition to the above-described active ingredient. The pharmaceutically acceptable carrier may include a saline solution, sterilized water, Ringer's solution, buffered saline, a dextrose solution, a maltodextrin solution, glycerol, ethanol, liposome, and a mixture of one or more thereof. As needed, other common additives such as an antioxidant, a buffer solution, a bacteriostatic agent, etc. may be added. Further, the composition may be formulated into injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets by additionally adding a diluent, a dispersant, a surfactant, a binder, and a lubricant. It is also possible to bind such carriers with a target organ-specific antibody or other ligands so that they may act specifically on a target organ. Furthermore, the composition may be formulated depending on diseases or ingredients according to an appropriate method known in the art or a method described in a literature (Remington's Pharmaceutical Science, Mack Publishing Company, Easton Pa.).
[0056] The pharmaceutical composition may be formulated for oral, topical, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, or transdermal administration. The pharmaceutical composition may be administered orally or parenterally at the time of clinical administration. Upon parenteral administration, the pharmaceutical composition may be administered intranasally, sublingually, or intratracheally, or by intraperitoneal, intrarectal, subcutaneous, intravenous, intramuscular, intracerebrovascular, or intrathoracic injection. The administration subject may be a mammal such as a human, a pig, a cow, a horse, a dog, a cat, or an experimental animal, e.g., a mouse, a rat, a rabbit, a guinea pig, or a hamster. An administration dosage of the composition to be used may be controlled by various parameters, in particular, the mode of administration or duration of treatment. In addition, a range thereof may be controlled depending on the subject's body weight, age, sex, health status, diet, excretion rate, and severity of allergy symptoms to mites. A daily dose may be about 0.0001 mg/kg to about 100 mg/kg, or about 0.001 mg/kg to about 10 mg/kg once or several times a day. By identifying sensitization profiles between respiratory diseases and skin diseases induced by mites, more accurate diagnosis and immunotherapy are possible.
[0057] The mite proteins according to an aspect may be used in diagnosing allergic diseases. Results of diagnosing allergic diseases by using the proteins have high reliability and validity. Further, the proteins may be used in a composition for preventing or treating allergic diseases.
[0058] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects of the present description. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
[0059] Hereinafter, the present disclosure will be described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the present disclosure is not intended to be limited by these Examples.
Example 1. Identification of Pathogenesis-Related Protein Molecules in Mites and Analysis of Reactivities Thereof in Allergic Disease Patients
[0060] 1. Selection of Patients and Statistical Analysis in Allergic Rhinitis, Allergic Asthma, or Atopic Dermatitis Patients
[0061] This study was approved by the Institutional Review Board of Yonsei University Health System (4-2013-0397), and conducted in the Allergy and Asthma Clinic of Severance Hospital. Selection criteria for HDM allergy patients are as follows: 1) patients aged 6 to 80 years, 2) patients (AA, AR, or AD) who were diagnosed with HDM allergic disease by allergists, and 3) HDM sensitization confirmed by skin prick test (SPT) for D. farinae or specific IgE (sIgE) detection. Patients under ATI treatment were excluded. Subsequently, the patients were divided into three groups: 1) patients only with allergic respiratory disease, 2) patients with both allergic respiratory disease and atopic dermatitis, and 3) patients only with atopic dermatitis. 20 persons were selected as controls. All participants signed a written consent form. Blood samples were collected from all the subjects, and stored at about -70.degree. C. for further experiments.
[0062] Statistical data of 160 HDM allergy patients are shown in Table 1 below. In the following Table 1, age and wheal size are presented as the mean.+-.standard deviation. The mean age of the patients was about 26.7 years. Of the three groups classified by clinical diagnosis, the atopic dermatitis patient group was younger (P<0.001) and showed higher sIgE titers than the allergic respiratory disease patient group. Allergic conjunctivitis, food allergy, and drug allergy were common in the allergic respiratory disease patient group, as compared with the atopic dermatitis patient group. The atopic dermatitis patient group showed the highest value in total IgE titer (p<0.001). There was no difference in the size of wheal to D. farinae between groups. However, the atopic dermatitis patient group showed the highest value in sIgE titer of D. farinae (p<0.001).
TABLE-US-00001 TABLE 1 Total AA/AR AA/AR + AD AD (n = 160) (n = 67) (n = 41) (n = 52) P value Age (year) 26.7 .+-. 15.7 33.6 .+-. 17.9 21.1 .+-. 10.9 22.2 .+-. 12.4 <0.001 Male:Female 97:63 38:29 27:14 32:20 0.573 Diagnosis, n(%) Allergic asthma (AA) 68(42.5) 49(72.1) 19(46.3) 0(0) <0.001 Allergic rhinitis (AR) 102(63.8) 65(97.0) 37(90.2) 0(0) <0.001 Atopic dermatitis (AD) 93(58.1) 0(0).sup. 41(100) 52(100) <0.001 Allergic conjunctivitis 33(20.6) 17(25.4) 14(34.1) .sup. 2(3.8) 0.001 Food allergy 18(11.3) 14(20.9) 1(2.4) .sup. 3(5.8) 0.002 Drug allergy 4(2.5) 4(6.0) 0(0).sup. 0(0) 0.031 Total IgE (kU/L) 1513.7 .+-. 1637.4 547.9 .+-. 585.1 1910.8 .+-. 1859.2 2146.9 .+-. 1747.4 <0.001 D. farinae sensitization Wheal size(mm) 8.4 .+-. 5.7 8.5 .+-. 6.0 8.0 .+-. 5.5 8.2 .+-. 3.8 0.875 sIgE titer (kU.sub.A/L) 53.6 .+-. 41.1 31.8 .+-. 29.9 64.3 .+-. 43.1 73.2 .+-. 39.2 <0.001
[0063] 2. Skin Prick Test (SPT) of Allergic Disease Patients
[0064] 53 kinds of aeroallergens (HDM, tree pollen, grass pollen, weed pollen, mold, dander, and cockroach) were used to perform a skin prick test. A saline solution containing 0.3% phenol and 50% glycerol was used as a negative control, and a saline solution containing 0.1% histamine (Allergy Therapeutics, Worthing, UK) was used as a positive control. Administration of drugs which may influence SPT was stopped for all patients. 15 minutes after allergen administration, results of SPT were analyzed. A wheal larger than 3 mm was determined as a positive reaction.
[0065] 3. Analysis of Characteristics and IgE Reactivity of D. farinae (I)
[0066] Standardized D. farinae extract (20 .mu.g, Yonsei Allergy Institute, Seoul, Korea) was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using a 15% gel. Subsequently, separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes (0.45 .mu.m, GE Water & Process Technologies, Trevose, Pa., USA). The membranes were incubated in 3% skim milk overnight to block non-specific binding. Then, sera of patients were added thereto, followed by incubation at 37.degree. C. overnight. Next, 1:1000-diluted mouse anti-human IgE (Southern Biotech, Birmingham, Ala.) was added and incubated for 1 hour. Next, nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Promega, Madison, Wis.) were used for color development.
[0067] Differences in IgE reactivity between allergic respiratory disease patient and atopic dermatitis patient are shown in FIG. 1. FIG. 1A is an image showing separation of proteins of D. farinae under denaturation conditions. FIG. 1B shows IgE reactivities of sera collected from the subjects with respiratory allergy. Referring to FIG. 1B, a clear single band of 14 kDa was detected. Referring to FIGS. 1C and 1D, the atopic dermatitis patient group showed multiple IgE reactivities to mite proteins having different sizes, as compared with the allergic respiratory disease patient group.
[0068] 4. Analysis of Characteristics and IgE Reactivity of D. farinae (II)
[0069] Mite extract was desalted using trichloroacetic acid, and two-dimensional gel electrophoresis was performed. 0.1 mg of HDM extract was subjected to electrophoresis on an isoelectric focusing gel of pH 3 to pH 10, and separated on a 15% sodium dodecyl sulfate polyacrylamide gel. The separated proteins were stained with Coomassie blue or transferred to a PVDF membrane (Millipore, Billerica, USA), followed by immunoblotting. Thereafter, IgE reactive components were examined in pooled sera of 10 subjects (1:4). IgE antibody was detected by alkaline phosphatase-conjugated goat anti-human IgE (1:1000) (Sigma-Aldrich). Next, nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate were used for color development. In order to identify IgE antibody-reactive proteins, LC-equipped ESI-MS/MS was performed in ProteomeTech (Seoul, Korea). Amino acid sequences of HDM-related proteins identified by this analysis were used to produce HDM CRD allergens.
[0070] In order to examine validity of the proteins detected in SDS-PAGE, two-dimensional electrophoresis and Western blotting were performed, and shown in FIG. 2. FIG. 2A shows results of separating proteins of D. farinae under denaturation conditions. Results of identifying proteins which specifically reacted with IgE antibody in each patient group are shown in FIGS. 2B to 2D. As shown in FIG. 2B, clear spots of 14 kDa were detected in the allergic asthma or allergic rhinitis patient group. Referring to FIGS. 2C and 2D, the atopic dermatitis patient group tended to react various HDM proteins, as compared with the allergic respiratory disease patient group. The spots indicated by arrows were analyzed by LC-equipped ESI-MS/MS. A1 spot in the allergic asthma or allergic rhinitis patient group was identified as Der f 2. 10 to 13 kinds of different allergens were identified in the atopic dermatitis patient group. 14 kinds of spots were detected in the atopic dermatitis-accompanying allergic asthma or allergic rhinitis patient group (B1 to B14 spots of FIG. 2). 13 kinds of spots were detected in the atopic dermatitis patient group (C1 to C13 spots of FIG. 2). HDM-related CRD allergens among 28 kinds of spots are as follows: Der f 1, Der f 2, Der f 11, Der f 13, Der f 14, Der f 30, and Der f Alt a 10. Results of identifying spots in two-dimensional electrophoresis are shown in Table 2 below.
TABLE-US-00002 TABLE 2 point Identification (origin) Weight Score A1 Der f 2 14,026 333 Der f 13 14,971 103 B1 Nesprin-1 129,899 66 (Cerapachys biroi) B2 Der f 1 23,763 100 B4 Nesprin-1 129,899 59 (Cerapachys biroi) B6 Der f 1 23,763 209 Der f 32 33,951 70 B7 Der f 1 23,763 145 B8 Der f 1 23,763 208 B9 Der f 1 23,763 179 B10 Der f Alt a 10 allergen 54,162 83 B11 Der f 30 19,770 169 B12 Der f 30 19,770 248 B13 Der f 30 19,770 137 B14 AGAP009853-PA-like 46,460 58 protein(Anopheles sinensis) C1 Der p 14 190,542 97 C2 Der f 11 102,407 510 C3 Mag 3 allergen 40,520 79 C4 Der f 11 102,407 1,055 C6 Der f 14 39,643 295 C9 Alpha-enolase 47,214 62 C10 Not detected C11 Der f 14 39,643 65 C12 Der f 14 39,643 93 C13 Cytochrome P450 101,332 60 3A9(Crassostrea gigas)
[0071] 5. Preparation of HDM Component Allergens
[0072] Based on amino acid sequences of the analyzed allergens, recombinant allergens were prepared as follows.
[0073] Recombinant Der f 1, Der f 2, and Der f 10 were prepared as follows. A mutant Der f 1 pro-form having a histidine tag at the C-terminus was prepared in a Pichia expression system. Der f 2 derived from inclusion body and Der f 10 derived from a soluble fraction were expressed in E. coli, and purified using a Ni-nitrilotriacetic acid (NTA) resin (Qiagen, Valencia, Calif.). Der f 14 and Der f 11 were prepared as peptide fragments. Since peptide fragments of Der f 14 degraded by protease are more allergenic than non-fragmented Der f 14, partial C-terminal sequences of Der f 14 were prepared and expressed. Der f 11 was prepared by expressing Der f 11 peptide fragment which is known as an immunodominant peptide. In order to clone Der f 11 peptide fragment, Der f 13, Der f 14 peptide fragment, Der f 30, Der f 32, and Der f Alt a 10, total RNA was isolated from mites, and the isolated total RNA was used to synthesize cDNA. Based on sequences registered in GenBank, oligonucleotide primer sets specific to respective allergens were prepared, and the primer sets and the synthesized cDNA were used to amplify coding regions of the respective allergens by polymerase chain reaction (PCR). Sequences of the oligonucleotide primer sets for amplification and expression, and host cells, which were used in the cloning of the allergens, are shown in Table 3 below. In Table 3, * represents the peptide fragment. cDNA fragment of each allergen was ligated with a pEXP5NT TOPO vector (Invitrogen, Carlsbad, Calif.), and this vector was transformed into E. coli BL21(DE3) or Pichia. 1 mM isopropyl-1-thio-.beta.-D-galactopyranoside was added to induce expression of the recombinant allergens. Subsequently, Ni-NTA resin (Qiagen) was used to purify the recombinant proteins. All recombinant allergens, excluding Der f 11 peptide fragment, were separated from inclusion bodies, and separated on a SDS-polyacrylamide gel under reducing conditions, and protein concentrations were quantified by Bradford assay. SDS-PAGE results of the recombinant mite allergens prepared in this study are shown in FIG. 3. rDer f 1 is cysteine protease and has about 27 kDa. rDer f 2 is a NPC2 family and has about 15 kDa. rDer f 10 is tropomyosin and has about 37 kDa. rDer f 11 is a fragment of paramyosin and has about 98 kDa. rDer f 13 is a fatty acid-binding protein and has about 15 kDa. rDer f 14 is a fragment of apolipophorin and has about 177 kDa. rDer f 30 is ferritin and has about 16 kDa. rDer f 32 is secreted inorganic pyrophosphatase and has about 35 kDa. rDer f Alt a 10 is aldehyde dehydrogenase and has a homology with a fungus allergen Alt a 10 and has about 54 kDa.
TABLE-US-00003 TABLE 3 Allergen Host cell Primer Sequence 5'-3' rDer f 1 Pichia Forward 5'-CTCGAGCGTCCAGCTTCAATCAAAACT-3' (SEQ ID NO: 22) Reverse 5'- GGCCGCTTAGTGATGGTGATGGTGATGCGCG CCGCGTGATGGTG-3' (SEQ ID NO: 23) rDer f 2 E. coli Forward 5'-GATCAAGTCGATGTTAAAG-3' (SEQ ID NO: 24) Reverse 5'-TCAAACAATGTTTTTTGT-3' (SEQ ID NO: 25) rDer f 10 E. coli Forward 5'-ATGGAGGCCATCAAGAAA-3' (SEQ ID NO: 26) Reverse 5'-CTGTCTGCGTAATATGAAAG-3' (SEQ ID NO: 27) rDer f 11* E. coli Forward 5'-cacattgaatcggaagaaacg-3' (SEQ ID NO: 28) Reverse 5'-TgATTCTAATTCCACTTCCAA-3' (SEQ ID NO: 29) E. coli Forward 5'-ATggCAAgCATTgAAggTAA-3' (SEQ ID NO: 30) Reverse 5'-TTAgATTCgTTTATATgTTC-3' (SEQ ID NO: 31) rDer f 13 E. coli Forward 5'-atggatccgtcaacattgag-3' (SEQ ID NO: 32) Reverse 5'-TCAgTTgTCTTCgACgATgAAATT-3' (SEQ ID NO: 33) rDer f 14* E. coli Forward 5'-ATggCTgCTAATCCTgAATC-3' (SEQ ID NO: 34) Reverse 5'-TTACgATgAATgCAATgTATgAC-3' (SEQ ID NO: 35) rDer f 30 E. coli Forward 5'-ATgTCTACTACAAATTATTC-3' (SEQ ID NO: 36) Reverse 5'-TTAgATCAATTTAACATgATgCC-3' (SEQ ID NO: 37) rDer f 32 Pichia Forward 5'-ATggCCCAAgTggAAgTAAAA-3' (SEQ ID NO: 38) Reverse 5'-CTAATTTAAATTCgAATTTTTATTC-3' (SEQ ID NO: 39) rDer f Alt a E. coli Forward 5'-atggcccaagtggaagtaaaatatac-3' (SEQ ID NO: 10 40) Reverse 5'-CTAATTTAAATTCgAATTTTTATTC-3' (SEQ ID NO: 41)
[0074] 6. Protein Profiling of D. farinae Component Allergens
[0075] Serum sIgE was detected using ImmunoCAP (ThermoFisher Scientific, Uppsala, Sweden). IgE titers higher than 0.35 kU.sub.A/L were considered positive. sIgE to total D. farinae extract and sIgE to Der p 1, Der p 2, and Der p 10 which are commercially available mite component allergens were measured.
[0076] To compare IgE reactivities to the component allergens, ELISA and ImmunoCAP were performed. Since the recombinant component allergens of D. farinae cannot be used in ImmunoCAP, Der p 2 was used. FIG. 4 shows data showing a comparison of IgE reactivities to mite allergens in ELISA and ImmunoCAP. As shown in FIG. 4, Der f 2 ELISA data showed a significant correlation with Der p 2 IgE titers detected by ImmunoCAP (R.sup.2=0.82).
[0077] 7. Sensitization Profiling of D. farinae Component Allergens
[0078] 2 .mu.g/ml of the recombinant protein was dissolved in a 0.05 M carbonate buffer solution at pH 9.6, and coated onto a microplate, followed by incubation at 4.degree. C. overnight. The incubated plate was washed with a phosphate buffered saline solution containing 0.05% Tween 20 (PBST), and the plate was incubated with PBST containing 3% skim milk to block non-specific binding. A serum sample was diluted with PBST containing 1% bovine serum albumin at 1:4, and dispensed into the plate, followed by incubation for 1 hour. Subsequently, biotin-conjugated goat anti-human IgE (1:1,000) (Vector, Burlingame, Calif.) and streptavidin peroxidase (1:1,000) (Sigma-Aldrich) were added to detect IgE antibody. Subsequently, 3,3',5,5'-tetramethylbenzidine (Kirkegaard and Perry Laboratories, Gaithersburg, Md.) was used for color development. 0.5 M H.sub.2SO.sub.4 was added and absorbance at 450 nm was measured. Mean absorbance value of negative controls and standard deviations of triplicate experiments were determined as cut-off value.
[0079] IgE reactivities of the respective component allergens are shown in FIG. 5. As shown in FIG. 5A, about 91% of the patients of Group 1 (allergic respiratory disease patient group) or Group 2 (allergic dermatitis patient group) were sensitized to major allergens. Only 14 patients (8.8%) were sensitized to minor allergens. Sensitization profiles of the respective groups are shown in FIG. 5B. The atopic dermatitis patient group showed higher sensitization rates of Der f 11, Der f 13, Der f 14, Der f 32, and Der f Alt 10 than the allergic respiratory disease patient group.
[0080] As shown in FIG. 6, the number of sensitized allergens was different between the groups. The allergic dermatitis patients tended to be sensitized to various mite component allergens. As shown in FIG. 6A, the atopic dermatitis-accompanying allergic asthma or allergic rhinitis patients showed the largest number of sensitized allergens. As shown in FIG. 6B, about 80.6% patients of the allergic respiratory disease patient group were sensitized to two kinds of allergens. However, about 54% of the atopic dermatitis patients were sensitized to three to five kinds of allergens. The atopic dermatitis patient group showed the highest optical density of the major allergen (Der f 1 or Der f 2), which was measured by ELISA. Further, the atopic dermatitis patient group showed the highest IgE reactivities of Der f 11, 13, 14, 32, and Alt a 10. Patients sensitized to minor allergy antigens tended to be sensitized to various HDM component allergens. Referring to FIG. 8, it was found that Der f 11, Der f 13, and Der f Alt a 10 antigens (sensitizers) were all multiple antigens.
TABLE-US-00004 TABLE 4 Total AA/AR AA/AR + AD AD (n = 160) (n = 67) (n = 41) (n = 52) P value Der f 1, n(%) 141(88.1%) 55(82.1%) 40(97.6%) 46(88.5%) 0.054 Der f 2, n(%) 125(78.1%) 47(70.1%) 35(85.4%) 43(82.7%) 0.112 Der f 1 or 2, n(%) 146(91.3%) 57(85.1%) 40(97.6%) 49(94.2%) 0.070 Der f 10, n(%) 23(14.4%) 8(11.9%) 7(17.1%) 8(15.4%) 0.738 Der f 11, n(%) 17(10.6%) 3(4.5%) 4(9.8%) 10(19.2%) 0.034 Der f 13, n(%) 31(19.4%) 3(4.5%) 15(36.6%) 13(25.0%) <0.001 Der f 14, n(%) 35(21.9%) 5(7.5%) 17(41.5%) 13(25.0%) <0.001 Der f 30, n(%) 17(10.6%) 3(4.5%) 5(12.2%) 9(17.3%) 0.074 Der f 32, n(%) 40(25.0%) 5(7.5%) 18(43.9%) 17(32.7%) <0.001 Der f Alt a 10, n(%) 29(18.1%) 2(3.0%) 10(24.4%) 17(32.7%) <0.001
[0081] 8. Statistical Analysis
[0082] The above results were analyzed using IBM SPSS Statistics (IBM Corp Armonk, N.Y.) for Windows Version 23.0. For comparisons of parameters, Kruskal-Wallis test, Fisher's exact test, or Pearson's chi-squared test was used. Non-parametric continuous data were analyzed by Kruskal-Wallis test, and categorical data were analyzed by Fisher's exact test or Pearson's chi-squared test. For multiple comparisons between groups, Dunn test was performed after Kruskal-Wallis test. P<0.05 was considered statistically significant.
[0083] In this study, proteome and allergenome of house dust mite were analyzed, and sensitization profiles of allergic respiratory disease patients and allergic dermatitis (atopic dermatitis) patients were investigated. As a result, allergic respiratory disease patients were sensitized to Der f 1 and Der f 2 which are the major allergens. In contrast, patients with allergic dermatitis symptoms showed multiple sensitization to minor allergens as well as major allergens. The composition for diagnosing allergic diseases to mites includes Der f 11, Der f 13, Der f 14, Der f 32, Der f Alta 10, ora combination thereof, and therefore, atopic dermatitis patient group may be sensitized to an allergen of Der f 11, Der f 13, Der f 14, Der f 32, Der f Alt a 10, or a combination thereof, and the atopic dermatitis patient group showed about 2 times or higher, about 2.5 times or higher, about 3 times or higher, about 3.5 times or higher, about 4 times or higher, about 4.5 times or higher, or about 5 times or higher sensitization rates to the allergen than the patient group only with allergic asthma or allergic rhinitis, or a normal group. Further, allergic dermatitis patients showed IgE sensitization to various mite component allergens and high sIgE reactivities.
[0084] It should be understood that embodiments described herein should be considered in a descriptive sense only and not for purposes of limitation. Descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments.
[0085] While one or more embodiments have been described with reference to the figures, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the disclosure as defined by the following claims.
Sequence CWU
1
1
411876PRTArtificial SequenceDer f 11 1Met Ser Ala Arg Thr Ala Lys Tyr Met
Tyr Arg Ser Ser Gly Ala Gly 1 5 10
15 Ala Ser Gly Asp Ile Ser Val Glu Tyr Gly Thr Asp Leu Gly
Ala Leu 20 25 30
Thr Arg Leu Glu Asp Lys Ile Arg Leu Leu Ser Asp Asp Leu Glu Ser
35 40 45 Glu Arg Glu Met
Arg Gln Arg Ile Glu Arg Glu Lys Ala Glu Leu Gln 50
55 60 Ile Gln Val Met Ser Leu Gly Glu
Arg Leu Glu Glu Ala Glu Gly Ser 65 70
75 80 Ser Glu Ser Val Thr Glu Met Asn Lys Lys Arg Asp
Ser Glu Leu Ala 85 90
95 Lys Leu Arg Lys Leu Leu Glu Asp Val His Ile Glu Ser Glu Glu Thr
100 105 110 Ala His His
Leu Arg Gln Lys His Gln Ala Ala Ile Gln Glu Met Gln 115
120 125 Asp Gln Leu Asp Gln Leu Gln Lys
Ala Lys Asn Lys Ser Asp Lys Glu 130 135
140 Lys Gln Lys Phe Gln Ala Glu Val Phe Glu Leu Leu Ala
Gln Leu Glu 145 150 155
160 Thr Ala Asn Lys Glu Lys Leu Thr Ala Leu Lys Asn Val Glu Lys Leu
165 170 175 Glu Tyr Thr Val
His Glu Leu Asn Ile Lys Ile Glu Glu Ile Asn Arg 180
185 190 Thr Val Ile Glu Leu Thr Ser His Lys
Gln Arg Leu Ser Gln Glu Asn 195 200
205 Thr Glu Leu Ile Lys Glu Val His Glu Val Lys Leu Gln Leu
Asp Asn 210 215 220
Ala Asn His Leu Lys Thr Gln Ile Ala Gln Gln Leu Glu Asp Thr Arg 225
230 235 240 His Arg Leu Glu Glu
Glu Glu Arg Lys Arg Ala Ser Leu Glu Asn His 245
250 255 Ala His Thr Leu Glu Val Glu Leu Glu Ser
Leu Lys Val Gln Leu Asp 260 265
270 Glu Glu Ser Glu Ala Arg Leu Glu Leu Glu Arg Gln Leu Thr Lys
Ala 275 280 285 Asn
Gly Asp Ala Ala Ser Trp Lys Ser Lys Tyr Glu Ala Glu Leu Gln 290
295 300 Ala His Ala Asp Glu Val
Glu Glu Leu Arg Arg Lys Met Ala Gln Lys 305 310
315 320 Ile Ser Glu Tyr Glu Glu Gln Leu Glu Ala Leu
Leu Asn Lys Cys Ser 325 330
335 Ser Leu Glu Lys Gln Lys Ser Arg Leu Gln Ser Glu Val Glu Val Leu
340 345 350 Ile Met
Asp Leu Glu Lys Ala Thr Ala His Ala Gln Gln Leu Glu Lys 355
360 365 Arg Val Ala Gln Leu Glu Lys
Ile Asn Leu Asp Leu Lys Asn Lys Leu 370 375
380 Glu Glu Val Thr Met Leu Met Glu Gln Ala Gln Lys
Glu Leu Arg Val 385 390 395
400 Lys Ile Ala Glu Leu Gln Lys Leu Gln His Glu Tyr Glu Lys Leu Arg
405 410 415 Asp Gln Arg
Asp Gln Leu Ala Arg Glu Asn Lys Lys Leu Thr Asp Asp 420
425 430 Leu Ala Glu Ala Lys Ser Gln Leu
Asn Asp Ala His Arg Arg Ile His 435 440
445 Glu Gln Glu Ile Glu Ile Lys Arg Leu Glu Asn Glu Arg
Asp Glu Leu 450 455 460
Ser Ala Ala Tyr Lys Glu Ala Glu Thr Leu Arg Lys Gln Glu Glu Ala 465
470 475 480 Lys Asn Gln Arg
Leu Ile Ala Glu Leu Ala Gln Val Arg His Asp Tyr 485
490 495 Glu Lys Arg Leu Ala Gln Lys Asp Glu
Glu Ile Glu Ala Leu Arg Lys 500 505
510 Gln Tyr Gln Ile Glu Ile Glu Gln Leu Asn Met Arg Leu Ala
Glu Ala 515 520 525
Glu Ala Lys Leu Lys Thr Glu Ile Ala Arg Leu Lys Lys Lys Tyr Gln 530
535 540 Ala Gln Ile Thr Glu
Leu Glu Leu Ser Leu Asp Ala Ala Asn Lys Ala 545 550
555 560 Asn Ile Asp Leu Gln Lys Thr Ile Lys Lys
Gln Ala Leu Gln Ile Thr 565 570
575 Ala Glu Leu Gln Ala His Tyr Asp Glu Val His Arg Gln Leu Gln
Gln 580 585 590 Ala
Val Asp Gln Leu Gly Val Thr Gln Arg Arg Cys Gln Ala Leu Gln 595
600 605 Ala Glu Leu Glu Glu Met
Arg Ile Ala Leu Glu Gln Ala Asn Arg Ala 610 615
620 Lys Arg Gln Ala Glu Gln Leu His Glu Glu Ala
Val Val Arg Val Asn 625 630 635
640 Glu Leu Thr Thr Ile Asn Val Asn Leu Ala Ser Ala Lys Ser Lys Leu
645 650 655 Glu Ser
Glu Phe Ser Ala Leu Gln Ala Asp Tyr Asp Glu Val His Lys 660
665 670 Glu Leu Arg Ile Ser Asp Glu
Arg Val Gln Lys Leu Thr Ile Glu Leu 675 680
685 Lys Ser Thr Lys Asp Leu Leu Ile Glu Glu Gln Glu
Arg Leu Val Lys 690 695 700
Leu Glu Thr Val Lys Lys Ser Leu Glu Gln Glu Val Arg Thr Leu His 705
710 715 720 Val Arg Ile
Glu Glu Val Glu Ala Asn Ala Leu Ala Gly Gly Lys Arg 725
730 735 Val Ile Ala Lys Leu Glu Ser Arg
Ile Arg Asp Val Glu Ile Glu Val 740 745
750 Glu Glu Glu Arg Arg Arg His Ala Glu Thr Asp Lys Met
Leu Arg Lys 755 760 765
Lys Asp His Arg Val Lys Glu Leu Leu Leu Gln Asn Glu Glu Asp His 770
775 780 Lys Gln Ile Gln
Leu Leu Gln Glu Met Thr Asp Lys Leu Asn Glu Lys 785 790
795 800 Val Lys Val Tyr Lys Arg Gln Met Gln
Glu Gln Glu Gly Met Ser Gln 805 810
815 Gln Asn Leu Thr Arg Val Arg Arg Phe Gln Arg Glu Leu Glu
Ala Ala 820 825 830
Glu Asp Arg Ala Asp Gln Ala Glu Ser Asn Leu Ser Phe Ile Arg Ala
835 840 845 Lys His Arg Ser
Trp Val Thr Thr Ser Gln Val Pro Gly Gly Thr Arg 850
855 860 Gln Val Phe Thr Thr Gln Glu Glu
Thr Thr Asn Tyr 865 870 875
22631DNAArtificial SequenceDer f 11 2atgtcggcac gtacagctaa atatatgtac
cgatccagtg gtgctggtgc ctctggtgat 60atttccgttg aatatggtac cgatttaggt
gccttaactc gacttgagga caaaatccga 120ttgttatccg atgatttgga atccgaacgt
gaaatgcgac aacgtatcga acgtgaaaag 180gccgaattac agatccaagt gatgagcctt
ggtgaacgtt tagaagaggc cgaaggatca 240agcgaaagtg ttaccgaaat gaacaaaaaa
agagattccg aattggcaaa attgagaaaa 300ttgttggaag atgttcacat tgaatcggaa
gaaacggccc atcatttgcg acagaaacat 360caggctgcca tccaggaaat gcaagatcaa
cttgaccaat tgcaaaaagc gaaaaataaa 420tcggataaag agaagcaaaa atttcaggct
gaagtttttg aattattagc tcaattggaa 480acggccaata aggaaaaatt aacggcattg
aaaaatgtag aaaaattgga atataccgta 540catgaattga atatcaaaat cgaagaaatc
aaccgtacgg tcattgaatt aacatcacat 600aaacaacgtt taagtcagga gaataccgaa
ttgatcaaag aagttcacga agttaaatta 660caattggaca atgcaaacca tttgaagaca
cagattgccc aacaattaga agacactcga 720catcgtttgg aagaagagga acgaaaacgt
gccagtctcg aaaatcatgc ccatacattg 780gaagtggaat tagaatcatt gaaagtacaa
ttggacgaag aatccgaggc tcgtcttgag 840cttgaacgtc aattgaccaa agccaatggc
gatgctgcat catggaagtc caaatacgaa 900gctgaattgc aagcacatgc cgatgaagtt
gaagaacttc gtcgtaaaat ggctcaaaag 960atttcggaat acgaagaaca attggaagcc
ttattgaata aatgcagttc attggagaaa 1020caaaaatctc gacttcaaag cgaagttgaa
gttttgatta tggatcttga aaaagcgaca 1080gcacatgcac aacaattaga aaaacgtgtt
gctcaattgg aaaagattaa tcttgatttg 1140aagaataaat tggaagaggt taccatgttg
atggaacaag cacagaaaga acttcgagtc 1200aagattgctg aattacagaa attgcaacat
gaatatgaaa aattacgtga tcaacgtgat 1260caattggcac gtgaaaacaa gaaacttaca
gacgatcttg ccgaagctaa atcacaattg 1320aacgatgctc accgtagaat ccatgaacaa
gaaattgaaa tcaaacgatt agagaatgaa 1380cgtgatgaat tatcggctgc ctataaagaa
gcagaaacat tgagaaaaca agaagaggcc 1440aaaaatcaac gattgattgc cgaattggca
caggtacgac atgattatga aaaacgtttg 1500gcacaaaaag atgaagaaat tgaagcattg
cgcaaacaat atcaaattga aattgaacaa 1560cttaacatgc gattggccga ggctgaagct
aaactcaaga ccgaaattgc acgattgaag 1620aaaaaatacc aggcacagat taccgaattg
gaattgtcat tggatgcagc caataaggct 1680aatatcgatt tgcaaaagac tattaaaaaa
caagctcttc aaattacggc ggagctccaa 1740gcacattatg atgaagttca tcgtcaattg
caacaagcag tggatcaatt gggtgttaca 1800caacgacgat gccaagcatt gcaagccgaa
ttggaagaga tgcgtattgc attggaacag 1860gctaatcgtg ctaaaagaca agccgaacaa
ttgcatgaag aagctgttgt acgtgttaac 1920gaacttacca caattaacgt caatttggca
tcggctaaaa gtaaattgga atcagaattc 1980tctgcacttc aagctgatta cgatgaagta
cataaagaac ttagaatttc tgatgaacga 2040gtacagaaac ttacaattga actcaaatct
actaaagatt tgttgatcga agaacaagaa 2100cgattggtta aattggaaac agtgaaaaaa
tcattggaac aagaggtacg aacattgcat 2160gtccgtattg aagaggtcga agccaatgca
ttggccggtg gtaaacgtgt cattgccaaa 2220ttggaaagcc gaattcgtga tgttgaaatt
gaagttgaag aagaacgacg acgacatgcc 2280gaaacggaca aaatgttacg taaaaaggat
catcgtgtca aggaattgtt gttgcaaaat 2340gaggaggacc ataaacaaat tcaattgcta
caggaaatga ctgataaatt gaatgaaaag 2400gtcaaagttt acaaacgaca gatgcaagaa
caggagggaa tgagccaaca gaatttgaca 2460cgtgtcagac gattccaacg tgaattggaa
gcagccgaag atcgtgccga tcaagctgaa 2520tcgaacttat cgttcattcg tgctaaacat
cgttcatggg ttaccacaag ccaggttcca 2580ggcggtaccc gacaagtgtt cacgacgcaa
gaagaaacaa ccaattatta a 26313131PRTArtificial SequenceDer f 13
3Met Ala Ser Ile Glu Gly Lys Tyr Lys Leu Glu Lys Ser Glu Lys Phe 1
5 10 15 Asp Glu Phe Leu
Asp Lys Leu Gly Val Gly Phe Met Val Lys Thr Ala 20
25 30 Ala Lys Thr Leu Lys Pro Thr Phe Glu
Val Ala Ile Glu Asn Asp Gln 35 40
45 Tyr Ile Phe Arg Ser Leu Ser Thr Phe Lys Asn Thr Glu Ala
Lys Phe 50 55 60
Lys Leu Gly Glu Glu Phe Glu Glu Asp Arg Ala Asp Gly Lys Arg Val 65
70 75 80 Lys Thr Val Ile Gln
Lys Glu Gly Asp Asn Lys Phe Val Gln Thr Gln 85
90 95 Phe Gly Asp Lys Glu Val Lys Ile Ile Arg
Glu Phe Asn Gly Asp Glu 100 105
110 Val Val Val Thr Ala Ser Cys Asp Gly Val Thr Ser Val Arg Thr
Tyr 115 120 125 Lys
Arg Ile 130 4396DNAArtificial SequenceDer f 13 4atggcaagca
ttgaaggtaa atataaattg gaaaaatcgg aaaaattcga tgaatttctc 60gacaaattgg
gcgtcggttt tatggtgaaa acggcagcta aaacattgaa accaacattt 120gaagtggcaa
ttgaaaatga ccaatacatt ttccgttcat taagtacgtt caaaaatact 180gaagctaaat
tcaaattggg cgaagaattc gaagaagatc gtgccgatgg taaacgagtg 240aaaacggtca
tccaaaaaga aggtgacaat aaatttgttc aaacacaatt cggtgataaa 300gaagtgaaaa
ttattcgtga attcaatggc gatgaagttg ttgtgactgc atcctgtgat 360ggtgtcactt
ccgttcgaac atataaacga atctaa
3965341PRTArtificial SequenceDer f 14 5Phe Val Met Lys Arg Glu Pro Leu
Arg Phe Arg Asp Ile Thr Val Glu 1 5 10
15 Gly Asn Glu Asn Ala Tyr Ile Lys Asn Gly Lys Leu His
Leu Ser Leu 20 25 30
Met Asp Pro Ser Thr Leu Ser Leu Val Thr Lys Ala Asp Gly Lys Ile
35 40 45 Asp Met Thr Val
Asp Leu Ile Ser Pro Val Thr Lys Arg Ala Ser Leu 50
55 60 Lys Ile Asp Ser Lys Lys Tyr Asn
Leu Phe His Glu Gly Glu Leu Ser 65 70
75 80 Ala Ser Ile Val Asn Pro Arg Leu Ser Trp His Gln
Tyr Thr Lys Arg 85 90
95 Asp Ser Arg Glu Tyr Lys Ser Asp Val Glu Leu Ser Leu Arg Ser Ser
100 105 110 Asp Ile Ala
Leu Lys Ile Thr Met Pro Asp Tyr Asn Ser Lys Ile His 115
120 125 Tyr Ser Arg Gln Gly Asp Gln Ile
Asn Met Asp Ile Asp Gly Thr Leu 130 135
140 Ile Glu Gly His Ala Gln Gly Thr Ile Arg Glu Gly Lys
Ile His Ile 145 150 155
160 Lys Gly Arg Gln Thr Asp Phe Glu Ile Glu Ser Asn Tyr Arg Tyr Glu
165 170 175 Asp Gly Lys Leu
Ile Ile Glu Pro Val Lys Ser Glu Asn Gly Lys Leu 180
185 190 Glu Gly Val Leu Ser Arg Lys Val Pro
Ser His Leu Thr Leu Glu Thr 195 200
205 Pro Arg Val Lys Met Asn Met Lys Tyr Asp Arg Tyr Ala Pro
Val Lys 210 215 220
Val Phe Lys Leu Asp Tyr Asp Gly Ile His Phe Glu Lys His Thr Asp 225
230 235 240 Ile Glu Tyr Glu Pro
Gly Val Arg Tyr Lys Ile Ile Gly Asn Gly Lys 245
250 255 Leu Lys Asp Asp Gly Arg His Tyr Ser Ile
Asp Val Gln Gly Ile Pro 260 265
270 Arg Lys Ala Phe Asn Leu Asp Ala Asp Leu Met Asp Phe Lys Leu
Lys 275 280 285 Val
Ser Lys Pro Glu Asp Ser Asn Lys Ala Gln Phe Ser Tyr Thr Phe 290
295 300 Asn Glu Tyr Thr Glu Thr
Glu Glu Tyr Glu Phe Asp Pro His Arg Ala 305 310
315 320 Tyr Tyr Val Asn Trp Leu Ser Ser Ile Arg Lys
Tyr Ile Gln Asn Phe 325 330
335 Ile Val Glu Asp Asn 340 61144DNAArtificial
SequenceDer f 14 6tttgtcatga aacgagaacc attgcgattc agagacatca ctgtcgaagg
aaacgaaaat 60gcctatatca aaaatggcaa acttcatttg tcgcttatgg atccgtcaac
attgagttta 120gtcacgaaag ccgatggaaa aatcgacatg acagtagact tgatatcgcc
agtcacaaaa 180cgtgcatcgt tgaaaattga ttcaaagaaa tacaaccttt tccatgaagg
tgaattgagt 240gcatcgatcg taaacccacg attgtcatgg catcaataca cgaaacgcga
ttctcgtgaa 300tacaagagtg atgtagaact atcgttgcga tcgtcggaca ttgctctcaa
gattacgatg 360cctgattata attcgaaaat tcattattca cgacaaggtg atcaaatcaa
catggacatc 420gatggtacat tgatcgaagg tcatgcacaa ggaaccatca gagaaggtaa
aatccacatt 480aaaggtagac aaactgattt cgagatcgaa tccaactacc gatacgaaga
tggcaaacta 540atcatcgaac cggtcaagag tgaaaatggc aaattggaag gcgttctttc
ccgtaaggtg 600ccatcacatc tgacactaga aacaccacga gtcaagatga atatgaaata
tgatcgatat 660gcaccagtca aagtgttcaa attggattat gatggcatcc acttcgagaa
acataccgat 720attgaatacg aacctggcgt tcgatacaag atcatcggca atggaaaact
caaggatgat 780ggccgccact attctatcga tgtgcaaggt attccacgca aagcattcaa
tctggacgct 840gacttgatgg atttcaaact gaaagtgagc aagccagaag atagcaataa
agctcaattc 900agctacacat tcaacgaata taccgagacc gaagaatatg aattcgatcc
acatcgtgcc 960tattatgtta attggttgag ttccattcgc aaatacatcc agaatttcat
cgtcgaagac 1020aactgaacac cattaatgca cattgattga gaatgcaatg agcaaatgtc
ttcattgatt 1080cattcgatta ttccattctc taatttttat atctattgac ttgtaataaa
atctaaagga 1140aaac
11447296PRTArtificial SequenceDer f 32 7Met Ser Thr Thr Asn
Tyr Ser Val Asp His Arg Gly Ser Phe Asn Ser 1 5
10 15 Leu Asp Tyr Arg Ile Tyr Phe Lys Asp Asn
Ser Asn Gly Lys Ile Ile 20 25
30 Ser Pro Trp His Asp Ile Pro Leu Phe Val Asp Lys Ser Ala Lys
His 35 40 45 Tyr
Asn Met Val Val Glu Ile Pro Arg Trp Thr Asn Glu Lys Met Glu 50
55 60 Ile Ala Thr Ala Glu Pro
Met Ser Pro Ile Lys Gln Asp Ile Lys Lys 65 70
75 80 Gly Ala Leu Arg Tyr Val Lys Asn Val Phe Pro
His Lys Gly Tyr Ile 85 90
95 Trp Asn Tyr Gly Ala Phe Pro Gln Thr Trp Glu Asn Pro Asn His Ile
100 105 110 Asp Gln
Asp Thr Lys Thr Lys Gly Asp Asn Asp Pro Ile Asp Val Ile 115
120 125 Glu Ile Gly Ser Arg Val Ala
Lys Arg Gly Asp Val Val Pro Val Lys 130 135
140 Ile Leu Gly Thr Ile Ala Leu Ile Asp Glu Gly Glu
Thr Asp Trp Lys 145 150 155
160 Ile Ile Ala Ile Asp Thr Arg Asp Glu Leu Ala Ser Gln Met Asn Asn
165 170 175 Val Asp Asp
Val Glu Lys Leu Leu Pro Gly Leu Leu Arg Ala Thr Val 180
185 190 Glu Trp Phe Lys Ile Tyr Lys Ile
Pro Asp Gly Lys Pro Ala Asn Lys 195 200
205 Phe Ala Phe Asn Gly Glu Ala Lys Asp Arg Glu Phe Ala
Glu Lys Ile 210 215 220
Val Glu Glu Thr His Gln Tyr Trp Gln Glu Met Met Glu Asn Lys Ser 225
230 235 240 Gly Glu His Lys
Leu Asp Leu Lys Asn Val Thr Leu Gly Asn Ser Phe 245
250 255 Ser Ile Asn Asp Glu Gln Ala Lys Gln
Phe Leu Glu Thr Arg Pro Ser 260 265
270 Ser Asp Ala Val Glu Pro Thr Pro Ile Ala Asp Gln Val Ala
Ile Asp 275 280 285
Lys Trp His His Val Lys Leu Ile 290 295
8891DNAArtificial SequenceDer f 32 8atgtctacta caaattattc tgttgatcat
cgtggttcct ttaattctct tgattatcgt 60atttatttca aagataatag caatggaaag
ataattagtc cttggcacga tatcccattg 120tttgtcgata aatcggccaa acattacaat
atggttgttg aaattccacg ctggactaat 180gaaaaaatgg aaattgctac tgccgaacca
atgtcaccaa ttaaacaaga cataaaaaaa 240ggtgcattac gttatgtgaa aaatgttttc
cctcataaag gttacatatg gaattatggt 300gcatttccac aaacatggga aaatccgaat
catattgatc aagacactaa aacaaaaggc 360gataatgatc caattgatgt gattgaaatt
ggatcacgtg ttgctaaacg tggtgatgtc 420gtaccggtaa aaatactcgg aacaattgca
ttgatcgatg aaggtgaaac tgattggaaa 480atcatcgcta ttgatacacg tgatgaattg
gcctcccaaa tgaataatgt tgatgatgtt 540gaaaaattat tacccggctt acttcgagct
acagttgaat ggtttaaaat ttataaaata 600cctgatggta aaccggcaaa taaatttgcc
tttaatggtg aagctaaaga tcgtgaattt 660gctgaaaaaa tcgttgaaga aacacatcaa
tattggcaag aaatgatgga aaacaaatcc 720ggtgaacata aattggattt gaaaaatgta
actttgggta attcattttc gatcaatgat 780gaacaagcaa aacaattttt ggaaacacga
ccatctagtg atgctgttga accaacacca 840attgctgatc aagtggccat cgataaatgg
catcatgtta aattgatcta a 8919490PRTArtificial SequenceDer f
Alt a 10 9Met Ala Gln Val Glu Val Lys Tyr Thr Gln Ile Phe Ile Asn Asn Glu
1 5 10 15 Trp His
Asp Ser Ile Ser Gly Lys Thr Phe Glu Thr Ile Asn Pro Phe 20
25 30 Thr Glu Glu Lys Leu Ala Asn
Val Gln Glu Gly Asp Lys Ala Asp Ile 35 40
45 Asp Arg Ala Val Val Ala Ala Val Asp Ala Phe Arg
Phe Asp Ser Pro 50 55 60
Trp Arg Gln Met Asp Ala Ser Gln Arg Gly His Leu Leu Tyr Arg Leu 65
70 75 80 Ala Asp Leu
Ile Glu Arg Asp Gln Asp Tyr Ile Ala Ser Leu Glu Ser 85
90 95 Met Asp Asn Gly Lys Pro Lys Thr
Met Ala Leu Phe Asp Val Asp Leu 100 105
110 Ala Ile Lys Val Phe Arg Tyr Tyr Ala Gly Tyr Ala Asp
Lys Ile His 115 120 125
Gly Lys Thr Ile Pro Ala Asp Gly Lys Val Phe Ala Phe Thr Arg Ile 130
135 140 Glu Pro Val Gly
Ile Cys Gly Gln Ile Val Pro Trp Asn Phe Pro Phe 145 150
155 160 Leu Met Ala Ser Trp Lys Phe Gly Pro
Ala Leu Cys Ala Gly Asn Thr 165 170
175 Val Val Leu Lys Pro Ala Glu Gln Thr Pro Leu Ser Ala Leu
Tyr Leu 180 185 190
Ala Ser Leu Thr Lys Glu Gly Gly Phe Pro Pro Gly Val Val Asn Val
195 200 205 Val Pro Gly Phe
Gly Glu Thr Ala Gly Ala Ala Leu Val Asp Asn Pro 210
215 220 Lys Val Asp Lys Ile Ala Phe Thr
Gly Ser Thr Glu Ile Gly Lys Leu 225 230
235 240 Ile Met Arg Asn Gly Ser His Ser Met Lys Arg Ile
Thr Leu Glu Leu 245 250
255 Gly Gly Lys Ser Pro Leu Val Val Thr Glu Asn Val Glu Asp Ile Ala
260 265 270 Gln Ala Ala
Arg Thr Ala Gln Asp Ser Cys Phe Leu Asn Met Gly Gln 275
280 285 Cys Cys Cys Ala Gly Thr Arg Thr
Phe Val His Glu Ser Ile Tyr Asp 290 295
300 Glu Phe Val Lys His Ser Val Glu Tyr Cys Gln Ser His
Val Phe Gly 305 310 315
320 Asn Pro Phe Asp Ser Lys Thr Ala Phe Gly Pro Gln Val Asp Lys Ile
325 330 335 Gln Met Asn Arg
Ile Leu Glu Met Ile Glu Ser Gly Lys Gln Glu Gly 340
345 350 Ala Arg Cys Val Ala Gly Gly Asn Arg
Met Asp Lys Arg Gly Tyr Phe 355 360
365 Val Glu Pro Thr Val Phe Ala Asp Val Thr Asp Gly Met Arg
Ile Ala 370 375 380
Arg Glu Glu Ile Phe Gly Pro Val Gln Gln Ile Leu Lys Tyr Lys Thr 385
390 395 400 Leu Asp Glu Val Ile
Glu Arg Cys Asn Asp Thr Asn Tyr Gly Leu Gly 405
410 415 Ser Ala Ile Leu Thr Asn Asp Ile Asn Glu
Ala Met Lys Phe Ser Arg 420 425
430 Ser Ile Arg Ala Gly Ser Val Trp Ile Asn Ile Pro Tyr Met Ile
Pro 435 440 445 Val
Ser Val Gln Thr Pro Phe Gly Gly Phe Lys Glu Ser Gly Val Gly 450
455 460 Arg Glu Leu Gly Glu Asp
Gly Leu Arg Gly Tyr Gly Glu Ile Lys Thr 465 470
475 480 Val Val Ile Met Asp Arg Glu Lys Lys Met
485 490 101597DNAArtificial SequenceDer f Alt
a 10 10aaaattcgaa ataccatggc ccaagtggaa gtaaaatata ctcagatttt catcaacaat
60gaatggcacg attcgattag tggtaaaaca ttcgaaacaa tcaatccatt tactgaggaa
120aaattggcca atgtacaaga gggtgataaa gccgatatag atcgtgctgt tgttgcggct
180gttgatgcat ttcgttttga ttcaccatgg cgacagatgg atgcatcaca acgtggtcat
240ctgctatatc gtcttgctga tcttattgaa agagatcaag attatattgc tagcctggaa
300agtatggata atggtaaacc aaaaacaatg gcattgttcg atgttgattt ggccatcaaa
360gtttttcgtt attatgccgg ttatgctgat aaaattcatg gtaaaaccat tccagcagat
420ggcaaagtgt tcgcttttac acgaattgaa cctgttggta tttgtggtca aatcgttccg
480tggaattttc cgtttttaat ggctagttgg aaatttggac cagcattgtg tgccggaaat
540accgtcgtat tgaaaccagc tgaacagaca ccgttaagcg ctctatattt ggccagttta
600actaaagaag gtggatttcc acccggtgtg gtcaatgtgg tacctggttt cggtgaaaca
660gccggtgcag ctttagttga taatccaaaa gtcgataaaa ttgctttcac tggttcaacg
720gaaatcggta aattaatcat gcgaaatggt tcacattcaa tgaaacgaat cacactggaa
780ttgggtggta aatcaccatt ggtagtaact gaaaatgttg aagatattgc acaagctgca
840cgtacagcac aagattcatg tttcctgaat atgggccaat gttgttgtgc cggtacccga
900acatttgttc atgaatcaat ctatgatgaa tttgttaaac attcagtgga atattgtcag
960tcacatgtat ttggcaatcc attcgattca aaaactgcat tcggtccaca agtggataaa
1020atccagatga atcgaatact tgaaatgatt gaatctggta aacaggaagg tgcccgttgt
1080gttgccggtg gtaatcgtat ggataaacgt ggatatttcg ttgaaccaac tgtttttgcc
1140gatgttaccg atgggatgcg aattgcacgt gaagaaattt ttggtccagt acaacagatt
1200cttaaatata aaacactgga tgaagttatt gaacgttgta atgatacaaa ttatggtcta
1260ggatcggcta tactcaccaa tgatattaat gaagcaatga aattttcacg tagtattcgt
1320gctggttccg tttggatcaa tataccatac atgataccgg ttagtgtaca aacaccattc
1380ggtggtttca aagaaagtgg tgttggccgc gaacttggtg aagatggtct tcgtggttat
1440ggtgaaatta aaactgttgt cattatggat cgtgaaaaga aaatgtaaag aaaaaccgaa
1500aaaaaaaatt tttcctattt caacaaacag ttgaaatata tccattttat ccagaataaa
1560aattcgaatt taaattagaa aaaaaaaaaa aaaaaaa
159711321PRTArtificial SequenceDer f 1 11Met Lys Phe Val Leu Ala Ile Ala
Ser Leu Leu Val Leu Ser Thr Val 1 5 10
15 Tyr Ala Arg Pro Ala Ser Ile Lys Thr Phe Glu Glu Phe
Lys Lys Ala 20 25 30
Phe Asn Lys Asn Tyr Ala Thr Val Glu Glu Glu Glu Val Ala Arg Lys
35 40 45 Asn Phe Leu Glu
Ser Leu Lys Tyr Val Glu Ala Asn Lys Gly Ala Ile 50
55 60 Asn His Leu Ser Asp Leu Ser Leu
Asp Glu Phe Lys Asn Arg Tyr Leu 65 70
75 80 Met Ser Ala Glu Ala Phe Glu Gln Leu Lys Thr Gln
Phe Asp Leu Asn 85 90
95 Ala Glu Thr Ser Ala Cys Arg Ile Asn Ser Val Asn Val Pro Ser Glu
100 105 110 Leu Asp Leu
Arg Ser Leu Arg Thr Val Thr Pro Ile Arg Met Gln Gly 115
120 125 Gly Cys Gly Ser Cys Trp Ala Phe
Ser Gly Val Ala Ala Thr Glu Ser 130 135
140 Ala Tyr Leu Ala Tyr Arg Asn Thr Ser Leu Asp Leu Ser
Glu Gln Glu 145 150 155
160 Leu Val Asp Cys Ala Ser Gln His Gly Cys His Gly Asp Thr Ile Pro
165 170 175 Arg Gly Ile Glu
Tyr Ile Gln Gln Asn Gly Val Val Glu Glu Arg Ser 180
185 190 Tyr Pro Tyr Val Ala Arg Glu Gln Gln
Cys Arg Arg Pro Asn Ser Gln 195 200
205 His Tyr Gly Ile Ser Asn Tyr Cys Gln Ile Tyr Pro Pro Asp
Val Lys 210 215 220
Gln Ile Arg Glu Ala Leu Thr Gln Thr His Thr Ala Ile Ala Val Ile 225
230 235 240 Ile Gly Ile Lys Asp
Leu Arg Ala Phe Gln His Tyr Asp Gly Arg Thr 245
250 255 Ile Ile Gln His Asp Asn Gly Tyr Gln Pro
Asn Tyr His Ala Val Asn 260 265
270 Ile Val Gly Tyr Gly Ser Thr Gln Gly Val Asp Tyr Trp Ile Val
Arg 275 280 285 Asn
Ser Trp Asp Thr Thr Trp Gly Asp Ser Gly Tyr Gly Tyr Phe Gln 290
295 300 Ala Gly Asn Asn Leu Met
Met Ile Glu Gln Tyr Pro Tyr Val Val Ile 305 310
315 320 Met 121081DNAArtificial SequenceDer f 1
12tttttttttt tttttttcca tcaaaattaa aaattcatca aaaatgaaat tcgttttggc
60cattgcctct ttgttggtat tgagcactgt ttatgctcgt ccagcttcaa tcaaaacttt
120tgaagaattc aaaaaagcct tcaacaaaaa ctatgccacc gttgaagagg aagaagttgc
180ccgtaaaaac tttttggaat cattgaaata tgttgaagct aacaaaggtg ccatcaacca
240tttgtccgat ttgtcattgg atgaattcaa aaaccgttat ttgatgagtg ctgaagcttt
300tgaacaactc aaaactcaat tcgatttgaa tgccgaaaca agcgcttgcc gtatcaattc
360ggttaacgtt ccatcggaat tggatttacg atcactgcga actgtcactc caatccgtat
420gcaaggaggc tgtggttcat gttgggcttt ctctggtgtc gccgcaactg aatcagctta
480tttggcctac cgtaacacgt ctttggatct ttctgaacag gaactcgtcg attgcgcatc
540tcaacacgga tgtcacggcg atacaatacc aagaggcatc gaatacatcc aacaaaatgg
600tgtcgttgaa gaaagaagct atccatacgt tgcacgagaa caacaatgcc gacgaccaaa
660ttcgcaacat tacggtatct caaactactg ccaaatttat ccaccagatg tgaaacaaat
720ccgtgaagct ttgactcaaa cacacacagc tattgccgtc attattggca ttaaagattt
780gagagctttt caacattatg atggacgaac aatcattcaa catgacaatg gttatcaacc
840aaactatcat gccgtcaaca ttgtcggtta cggaagtaca caaggcgtcg attattggat
900cgtacgaaac agttgggata ctacctgggg tgatagcgga tacggatatt tccaagccgg
960aaacaacctc atgatgatcg aacaatatcc atatgttgta atcatgtgaa catttgaaat
1020tgaatatatt tatttgtttt caaaataaaa acaactactc ttgcgagtat tttttacttt
1080t
108113146PRTArtificial SequenceDer f 13 13Met Ile Ser Lys Ile Leu Cys Leu
Ser Leu Leu Val Ala Ala Val Val 1 5 10
15 Ala Asp Gln Val Asp Val Lys Asp Cys Ala Asn Asn Glu
Ile Lys Lys 20 25 30
Val Met Val Asp Gly Cys His Gly Ser Asp Pro Cys Ile Ile His Arg
35 40 45 Gly Lys Pro Phe
Thr Leu Glu Ala Leu Phe Asp Ala Asn Gln Asn Thr 50
55 60 Lys Thr Ala Lys Ile Glu Ile Lys
Ala Ser Leu Asp Gly Leu Glu Ile 65 70
75 80 Asp Val Pro Gly Ile Asp Thr Asn Ala Cys His Phe
Met Lys Cys Pro 85 90
95 Leu Val Lys Gly Gln Gln Tyr Asp Ile Lys Tyr Thr Trp Asn Val Pro
100 105 110 Lys Ile Ala
Pro Lys Ser Glu Asn Val Val Val Thr Val Lys Leu Ile 115
120 125 Gly Asp Asn Gly Val Leu Ala Cys
Ala Ile Ala Thr His Gly Lys Ile 130 135
140 Arg Asp 145 14528DNAArtificial SequenceDer f 2
14aaaaaaaaac aacataaccg aaaatgattt ccaaaatctt gtgcctttca ttgttggtag
60cagccgttgt tgccgatcaa gtcgatgtta aagattgtgc caacaatgaa atcaaaaaag
120taatggtcga tggttgccat ggttctgatc catgcatcat ccatcgtggt aaaccattca
180ctttggaagc cttattcgat gccaaccaaa acactaaaac cgctaaaatt gaaatcaaag
240ccagcctcga tggtcttgaa attgatgttc ccggtatcga taccaatgct tgccatttta
300tgaaatgtcc attggttaaa ggtcaacaat atgatatcaa atatacatgg aatgtgccga
360aaattgcacc aaaatctgaa aacgttgtcg ttacagtcaa acttatcggt gataatggtg
420ttttggcttg cgctattgct acccatggta aaatccgtga ttaaaaaaaa ataaataaga
480aaattttcac caacatcgaa caaaattcaa taaccaaaat ttgaatcc
52815299PRTArtificial SequenceDer f 10 15Phe Phe Phe Val Ala Ala Lys Gln
Gln Gln Gln Pro Ser Thr Lys Met 1 5 10
15 Glu Ala Ile Lys Lys Lys Met Gln Ala Met Lys Leu Glu
Lys Asp Asn 20 25 30
Ala Ile Asp Arg Ala Glu Ile Ala Glu Gln Lys Ala Arg Asp Ala Asn
35 40 45 Leu Arg Ala Glu
Lys Ser Glu Glu Glu Val Arg Ala Leu Gln Lys Lys 50
55 60 Ile Gln Gln Ile Glu Asn Glu Leu
Asp Gln Val Gln Glu Gln Leu Ser 65 70
75 80 Ala Ala Asn Thr Lys Leu Glu Glu Lys Glu Lys Ala
Leu Gln Thr Ala 85 90
95 Glu Gly Asp Val Ala Ala Leu Asn Arg Arg Ile Gln Leu Ile Glu Glu
100 105 110 Asp Leu Glu
Arg Ser Glu Glu Arg Leu Lys Ile Ala Thr Ala Lys Leu 115
120 125 Glu Glu Ala Ser Gln Ser Ala Asp
Glu Ser Glu Arg Met Arg Lys Met 130 135
140 Leu Glu His Arg Ser Ile Thr Asp Glu Glu Arg Met Asp
Gly Leu Glu 145 150 155
160 Asn Gln Leu Lys Glu Ala Arg Met Met Ala Glu Asp Ala Asp Arg Lys
165 170 175 Tyr Asp Glu Val
Ala Arg Lys Leu Ala Met Val Glu Ala Asp Leu Glu 180
185 190 Arg Ala Glu Glu Arg Ala Glu Thr Gly
Glu Ser Lys Ile Val Glu Leu 195 200
205 Glu Glu Glu Leu Arg Val Val Gly Asn Asn Leu Lys Ser Leu
Glu Val 210 215 220
Ser Glu Glu Lys Ala Gln Gln Arg Glu Glu Ala Tyr Glu Gln Gln Ile 225
230 235 240 Arg Ile Met Thr Ala
Lys Leu Lys Glu Ala Glu Ala Arg Ala Glu Phe 245
250 255 Ala Glu Arg Ser Val Gln Lys Leu Gln Lys
Glu Val Asp Arg Leu Glu 260 265
270 Asp Glu Leu Val His Glu Lys Glu Lys Tyr Lys Ser Ile Ser Asp
Glu 275 280 285 Leu
Asp Gln Thr Phe Ala Glu Leu Thr Gly Tyr 290 295
16988DNAArtificial SequenceDer f 10 16ttttttttcg ttgcagctaa
acaacaacaa caaccatcaa caaaaatgga ggccatcaag 60aaaaaaatgc aggcaatgaa
gctcgagaaa gataatgcta tcgatcgagc tgaaattgcc 120gaacaaaaag cccgtgatgc
taatctacgt gccgaaaagt ctgaggaaga agttcgtgca 180ttacagaaaa aaatccaaca
aattgaaaat gaattggatc aggtccaaga acaattatcg 240gctgccaata caaaattgga
ggaaaaggaa aaagccctac agaccgctga aggtgatgtt 300gcagcattga atcgtcgtat
tcaattgatt gaagaagatt tggaacgatc agaagaacga 360cttaagattg ctacagccaa
attggaagag gcatcacaat ctgccgatga atctgaacgt 420atgcgtaaaa tgcttgaaca
tcgatccatc accgatgaag aacgtatgga tggtttggaa 480aatcaactta aagaagcccg
tatgatggcc gaagatgctg atagaaaata tgatgaagtt 540gcccgtaaat tggcaatggt
tgaagccgat ttggaacgtg ctgaagaacg tgccgaaacc 600ggtgaatcga aaattgttga
actcgaagaa gaattacgtg ttgtcggtaa caatctcaaa 660tcattggaag ttagcgaaga
gaaagctcaa caacgtgaag aagcctatga acaacagatc 720cgtataatga cggctaaact
taaagaagcc gaagcacgtg ccgaatttgc tgaacgttcg 780gtacaaaaac tccagaaaga
agtcgatcgt ttggaagacg aattggtcca cgaaaaggaa 840aaatacaaat ccatctccga
cgaattggac cagacatttg ccgaacttac tggttattaa 900taataattct ttcatattac
gcagacagaa ttttcgatta tttttaacaa caccaccacc 960accagcaaca gcaacaacga
aaaatcac 98817171PRTArtificial
SequenceDer f 30 17Met Ala Ala Asn Pro Glu Ser Thr Thr Lys Thr Ser Arg
Val Arg Met 1 5 10 15
Asn Ile Gln Ile Asn Leu Glu Phe Tyr Ala Ser Tyr Val Tyr Gln Gln
20 25 30 Met Ala Tyr His
Phe Asn Arg Asp Asp Val Ala Leu Pro Gly Phe Glu 35
40 45 Lys Phe Phe Asp Val Ser Ser Lys Glu
Glu Arg Glu His Ala Glu Arg 50 55
60 Phe Met Lys Leu Gln Asn Gln Arg Gly Gly Arg Ile Val
Leu Asp Asp 65 70 75
80 Ile His Lys Pro Gln Gln Gln Asp Trp Ser Ser Gly Leu Glu Ala Met
85 90 95 Arg Ala Ala Leu
Glu Leu Glu Lys Thr Val Asn Gln Ala Leu Leu Asp 100
105 110 Leu His Ala Val Ala Thr Lys His Asn
Asp Ala Gln Phe Ala Asp Phe 115 120
125 Ile Glu Thr His Tyr Leu Thr Glu Gln Val Glu Ala Ile Lys
Lys Leu 130 135 140
Ala Asp Tyr Ile Thr Asn Leu Glu Arg Cys Gly Pro Gly Leu Gly Glu 145
150 155 160 Tyr Leu Phe Asp Arg
His Thr Leu His Ser Ser 165 170
18516DNAArtificial SequenceDer f 30 18atggctgcta atcctgaatc aacaaccaaa
acttcacgtg tacgaatgaa tattcaaatt 60aatttggagt tctatgcatc ctatgtatat
caacagatgg cctatcattt taatcgtgat 120gatgttgcat tgcctggttt tgaaaaattt
ttcgatgtat catccaaaga agaacgtgaa 180cacgctgaac gttttatgaa attacagaat
caacgtggtg gacgtattgt attggatgat 240attcataaac cgcaacaaca agattggtca
tcaggattgg aagcaatgcg tgctgcattg 300gaattggaaa aaacagtcaa tcaggcattg
ttggatttgc atgccgttgc caccaaacac 360aatgatgcac aatttgctga ttttattgaa
acacattatc taactgaaca agtggaagcc 420atcaagaaat tggctgatta tattaccaat
ttggaacgtt gtggccccgg acttggtgaa 480tatctttttg atcgtcatac attgcattca
tcgtaa 51619161PRTArtificial SequenceDer f
11 fragment 19His Ile Glu Ser Glu Glu Thr Ala His His Leu Arg Gln Lys His
Gln 1 5 10 15 Ala
Ala Ile Gln Glu Met Gln Asp Gln Leu Asp Gln Leu Gln Lys Ala
20 25 30 Lys Asn Lys Ser Asp
Lys Glu Lys Gln Lys Phe Gln Ala Glu Val Phe 35
40 45 Glu Leu Leu Ala Gln Leu Glu Thr Ala
Asn Lys Glu Lys Leu Thr Ala 50 55
60 Leu Lys Asn Val Glu Lys Leu Glu Tyr Thr Val His Glu
Leu Asn Ile 65 70 75
80 Lys Ile Glu Glu Ile Asn Arg Thr Val Ile Glu Leu Thr Ser His Lys
85 90 95 Gln Arg Leu Ser
Gln Glu Asn Thr Glu Leu Ile Lys Glu Val His Glu 100
105 110 Val Lys Leu Gln Leu Asp Asn Ala Asn
His Leu Lys Thr Gln Ile Ala 115 120
125 Gln Gln Leu Glu Asp Thr Arg His Arg Leu Glu Glu Glu Glu
Arg Lys 130 135 140
Arg Ala Ser Leu Glu Asn His Ala His Thr Leu Glu Val Glu Leu Glu 145
150 155 160 Ser
20309PRTArtificial SequenceDer f 14 fragment 20Met Asp Pro Ser Thr Leu
Ser Leu Val Thr Lys Ala Asp Gly Lys Ile 1 5
10 15 Asp Met Thr Val Asp Leu Ile Ser Pro Val Thr
Lys Arg Ala Ser Leu 20 25
30 Lys Ile Asp Ser Lys Lys Tyr Asn Leu Phe His Glu Gly Glu Leu
Ser 35 40 45 Ala
Ser Ile Val Asn Pro Arg Leu Ser Trp His Gln Tyr Thr Lys Arg 50
55 60 Asp Ser Arg Glu Tyr Lys
Ser Asp Val Glu Leu Ser Leu Arg Ser Ser 65 70
75 80 Asp Ile Ala Leu Lys Ile Thr Met Pro Asp Tyr
Asn Ser Lys Ile His 85 90
95 Tyr Ser Arg Gln Gly Asp Gln Ile Asn Met Asp Ile Asp Gly Thr Leu
100 105 110 Ile Glu
Gly His Ala Gln Gly Thr Ile Arg Glu Gly Lys Ile His Ile 115
120 125 Lys Gly Arg Gln Thr Asp Phe
Glu Ile Glu Ser Asn Tyr Arg Tyr Glu 130 135
140 Asp Gly Lys Leu Ile Ile Glu Pro Val Lys Ser Glu
Asn Gly Lys Leu 145 150 155
160 Glu Gly Val Leu Ser Arg Lys Val Pro Ser His Leu Thr Leu Glu Thr
165 170 175 Pro Arg Val
Lys Met Asn Met Lys Tyr Asp Arg Tyr Ala Pro Val Lys 180
185 190 Val Phe Lys Leu Asp Tyr Asp Gly
Ile His Phe Glu Lys His Thr Asp 195 200
205 Ile Glu Tyr Glu Pro Gly Val Arg Tyr Lys Ile Ile Gly
Asn Gly Lys 210 215 220
Leu Lys Asp Asp Gly Arg His Tyr Ser Ile Asp Val Gln Gly Ile Pro 225
230 235 240 Arg Lys Ala Phe
Asn Leu Asp Ala Asp Leu Met Asp Phe Lys Leu Lys 245
250 255 Val Ser Lys Pro Glu Asp Ser Asn Lys
Ala Gln Phe Ser Tyr Thr Phe 260 265
270 Asn Glu Tyr Thr Glu Thr Glu Glu Tyr Glu Phe Asp Pro His
Arg Ala 275 280 285
Tyr Tyr Val Asn Trp Leu Ser Ser Ile Arg Lys Tyr Ile Gln Asn Phe 290
295 300 Ile Val Glu Asp Asn
305 21321PRTArtificial SequenceDer f 1 mutant 21Met Lys
Phe Val Leu Ala Ile Ala Ser Leu Leu Val Leu Ser Thr Val 1 5
10 15 Tyr Ala Arg Pro Ala Ser Ile
Lys Thr Phe Glu Glu Phe Lys Lys Ala 20 25
30 Phe Asn Lys Asn Tyr Ala Thr Val Glu Glu Glu Glu
Val Ala Arg Lys 35 40 45
Asn Phe Leu Glu Ser Leu Lys Tyr Val Glu Ala Asn Lys Gly Ala Ile
50 55 60 Asn His Leu
Ser Asp Leu Ser Leu Asp Glu Phe Lys Asn Arg Tyr Leu 65
70 75 80 Met Ser Ala Glu Ala Phe Glu
Gln Leu Lys Thr Gln Phe Asp Leu Asn 85
90 95 Ala Glu Thr Ser Ala Cys Arg Ile Asn Ser Val
Asn Val Pro Ser Glu 100 105
110 Leu Asp Leu Arg Ser Leu Arg Thr Val Thr Pro Ile Arg Met Gln
Gly 115 120 125 Gly
Cys Gly Ser Cys Trp Ala Phe Ser Gly Val Ala Ala Thr Glu Ser 130
135 140 Ala Tyr Leu Ala Tyr Arg
Gln Thr Ser Leu Asp Leu Ser Glu Gln Glu 145 150
155 160 Leu Val Asp Cys Ala Ser Gln His Gly Cys His
Gly Asp Thr Ile Pro 165 170
175 Arg Gly Ile Glu Tyr Ile Gln Gln Asn Gly Val Val Glu Glu Arg Ser
180 185 190 Tyr Pro
Tyr Val Ala Arg Glu Gln Gln Cys Arg Arg Pro Asn Ser Gln 195
200 205 His Tyr Gly Ile Ser Asn Tyr
Cys Gln Ile Tyr Pro Pro Asp Val Lys 210 215
220 Gln Ile Arg Glu Ala Leu Thr Gln Thr His Thr Ala
Ile Ala Val Ile 225 230 235
240 Ile Gly Ile Lys Asp Leu Arg Ala Phe Gln His Tyr Asp Gly Arg Thr
245 250 255 Ile Ile Gln
His Asp Asn Gly Tyr Gln Pro Asn Tyr His Ala Val Asn 260
265 270 Ile Val Gly Tyr Gly Ser Thr Gln
Gly Val Asp Tyr Trp Ile Val Arg 275 280
285 Asn Ser Trp Asp Thr Thr Trp Gly Asp Ser Gly Tyr Gly
Tyr Phe Gln 290 295 300
Ala Gly Asn Asn Leu Met Met Ile Glu Gln Tyr Pro Tyr Val Val Ile 305
310 315 320 Met
2227DNAArtificial SequencerDer f 1 primer 22ctcgagcgtc cagcttcaat caaaact
272344DNAArtificial SequencerDer
f 1 primer 23ggccgcttag tgatggtgat ggtgatgcgc gccgcgtgat ggtg
442419DNAArtificial SequencerDer f 2 primer 24gatcaagtcg
atgttaaag
192518DNAArtificial SequencerDer f 2 primer 25tcaaacaatg ttttttgt
182618DNAArtificial
SequencerDer f 10 primer 26atggaggcca tcaagaaa
182720DNAArtificial SequencerDer f 10 primer
27ctgtctgcgt aatatgaaag
202821DNAArtificial SequencerDer f 11 primer 28cacattgaat cggaagaaac g
212921DNAArtificial
SequencerDer f 11 primer 29tgattctaat tccacttcca a
213020DNAArtificial SequencerDer f 11 primer
30atggcaagca ttgaaggtaa
203120DNAArtificial SequencerDer f 11 primer 31ttagattcgt ttatatgttc
203220DNAArtificial
SequencerDer f 13 primer 32atggatccgt caacattgag
203324DNAArtificial SequencerDer f 13 primer
33tcagttgtct tcgacgatga aatt
243420DNAArtificial SequencerDer f 14 primer 34atggctgcta atcctgaatc
203523DNAArtificial
SequencerDer f 14 primer 35ttacgatgaa tgcaatgtat gac
233620DNAArtificial SequencerDer f 30 primer
36atgtctacta caaattattc
203723DNAArtificial SequencerDer f 30 primer 37ttagatcaat ttaacatgat gcc
233821DNAArtificial
SequencerDer f 32 primer 38atggcccaag tggaagtaaa a
213925DNAArtificial SequencerDer f 32 primer
39ctaatttaaa ttcgaatttt tattc
254026DNAArtificial SequencerDer f Alt a 10 primer 40atggcccaag
tggaagtaaa atatac
264125DNAArtificial SequencerDer f Alt a 10 primer 41ctaatttaaa
ttcgaatttt tattc 25
User Contributions:
Comment about this patent or add new information about this topic: