Patent application title: IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING COTH
Inventors:
IPC8 Class: AC07K1614FI
USPC Class:
1 1
Class name:
Publication date: 2019-06-27
Patent application number: 20190194301
Abstract:
The invention provided Mucorales CotH antibodies, polypeptides, encoding
nucleic acid molecules, and uses thereof. The Mucorales CotH antibodies,
polypeptides and encoding nucleic acids disclosed herein can be
advantageously used to diagnose, treat or prevent fungal conditions, in
particular mucormycosis.Claims:
1. An isolated, non-naturally occurring anti-Mucorales CotH antibody, or
binding fragment thereof, that (a) specifically binds a peptide having at
least 87% sequence identity to amino acids 1 to 15 of SEQ ID NO: 39 or a
peptide having at least 65% sequence identify to amino acids 1 to 17 of
SEQ ID NO: 40, and (b) specifically binds to a CotH polypeptide on a
fungus of order Mucorales.
2. The antibody of claim 1, wherein the peptide sequence has a least 87% sequence identity to the amino acid sequence of SEQ ID NO: 39 or SEQ ID NO: 40.
3. The antibody of claim 1, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 39.
4. The antibody of claim 1, wherein the peptide consists of the amino acid sequence of SEQ ID NO: 40.
5. The antibody of claim 1, wherein the antibody specifically binds to the amino acid sequence of SEQ ID NO: 39.
6. The antibody of claim 1, wherein the antibody specifically binds to the amino acid sequence of SEQ ID NO: 40.
7. The antibody of claim 1, wherein the fungus is a pathogenic fungus that can cause mucormycosis in a human.
8. The antibody of claim 7, wherein the pathogenic fungus belongs to the family Mucoraceae.
9. The antibody of claim 8, wherein the pathogenic fungus belongs to genus Rhizopus, Rhizomucor, Lichtheimia, Apophysomyces or Mucor.
10. The antibody of claim 9, wherein the pathogenic fungus belongs to the genus Lichtheimia or Mucor.
11. The antibody of claim 7, wherein the pathogenic fungus is a species selected from Lechtheimia corymbifera, Cunninghamella bertholletia, Rhizopus microspores, Mucor racemosus, Mucor circinelloides, Rhizomucor variabilis, Apophysomyces elegans, and Apophysomyces trapeziformis.
12. The antibody of claim 1, wherein the antibody is a monoclonal antibody.
13. The antibody of claim 12, wherein the monoclonal antibody is a humanized antibody.
14. The antibody of claim 12, wherein the monoclonal antibody is a chimeric antibody.
15. The antibody of claim 1, wherein the binding fragment is a single chain antibody.
16. The antibody of claim 1, wherein the antibody comprises a detectable marker.
17. The antibody of claim 1, wherein the antibody abrogates endocytosis of the fungus by a mammalian endothelial cell.
18. An isolated anti-Mucorales CotH antibody, or binding fragment thereof, that (a) specifically binds to a peptide having at least 87% sequence identity to amino acids 1 to 15 of SEQ ID NO: 39 or amino acids 1 to 17 of SEQ ID NO: 40, (b) specifically binds to a CotH polypeptide on a cell surface of a fungus of genus Rhizopus, Rhizomucor, Lichtheimia, Mucor or Cunninghamella, wherein the CotH polypeptide on said cell surface comprises the peptide, and (c) abrogates endocytosis of the fungus by a mammalian endothelial cell, wherein (i) the antibody is a humanized antibody, a chimeric antibody, a CDR-grafted antibody, or a bifunctional antibody, or (ii) the binding fragment is selected from a single chain antibody, Fab, F(ab')2, Fd and an Fv fragment.
19. The antibody of claim 1, wherein the non-naturally occurring antibody, or binding fragment thereof, is selected from a humanized antibody, chimeric antibody, CDR-grafted antibody, a bifunctional antibody, a single chain antibody, Fab, F(ab')2, Fd and an Fv fragment.
20. The antibody of claim 1, wherein the fungus of order Mucorales is a pathogenic fungus of family Cunninghamellaceae.
Description:
RELATED PATENT APPLICATIONS
[0001] This patent application is a continuation of, and claims the benefit of, U.S. patent application Ser. No. 15/043,025 filed Feb. 12, 2016, now pending and entitled IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH, naming Ashraf S. Ibrahim, Mingfu Liu, Teklegiorgis Ghebremariam, Yue Fu, John E. Edwards and Scott Filler as inventors, and designated by Attorney Docket No. 022098-0443421; which claims the benefit of, U.S. patent application Ser. No. 13/620,563 filed Sep. 14, 2012, now U.S. Pat. No. 9,279,002, entitled IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH, naming Ashraf S. Ibrahim, Mingfu Liu, Teklegiorgis Ghebremariam, Yue Fu, John E. Edwards and Scott Filler as inventors, and designated by Attorney Docket No. 022098-0436276; which claims the benefit of U.S. Provisional Patent Application No. 61/535,257, filed Sep. 15, 2011, entitled IMMUNOTHERAPY AND DIAGNOSIS OF MUCORMYCOSIS USING CotH. The entire content of the foregoing applications is incorporated herein by reference, including all text, tables and drawings.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Dec. 11, 2018, is named SeqListingLABioMed0502103.txt and is 179 KB (184,155 bytes) in size.
BACKGROUND OF THE INVENTION
[0004] The present invention relates generally to compositions and methods for detecting, treating and preventing infectious diseases in a patient, and more specifically to compositions and methods that target specific proteins or nucleic acids unique to fungi that cause mucormycosis.
[0005] About 180 of the 250,000 known fungal species are recognized to cause disease (mycosis) in man and animal. Some fungi can establish an infection in all exposed subjects, e.g., the systemic pathogens Histoplasma capsulatum and Coccidioides immitis. Others, such as Candida, Aspergillus species and Zygomycetes are opportunist pathogens which ordinarily cause disease only in a compromised host. Fungi of the class Zygomycetes, order Mucorales, can cause Mucormycosis, a potentially deadly fungal infection in humans. Fungi belonging to the order Mucorales are distributed into at least six families, all of which can cause mucormycosis (Ibrahim et al. Zygomycosis, p. 241-251, In W. E. Dismukes, P. G. Pappas, and J. D. Sobel (ed.), Clinical Mycology, Oxford University Press, New York (2003); Kwon-Chung, K. J., and J. E. Bennett, Mucormycosis, p. 524-559, Medical Mycology, Lea & Febiger, Philadelphia (1992), and Ribes et al. Zygomycetes in Human Disease, Clin Microbiol Rev 13:236-301 (2000)). However, fungi belonging to the family Mucoraceae, and specifically the species Rhizopus oryzae (Rhizopus arrhizus), are by far the most common cause of infection (Ribes et al., supra). Increasing cases of mucormycosis have also been reported due to infection with Cunninghamella spp. in the Cunninghamellaceae family (Cohen-Abbo et al., Clinical Infectious Diseases 17:173-77 (1993); Kontoyianis et al., Clinical Infectious Diseases 18:925-28 (1994); Kwon-Chung et al., American Journal of Clinical Pathology 64:544-48 (1975), and Ventura et al., Cancer 58:1534-36 (1986)). The remaining four families of the Mucorales order are less frequent causes of disease (Bearer et al., Journal of Clinical Microbiology 32:1823-24 (1994); Kamalam and Thambiah, Sabouraudia 18:19-20 (1980); Kemna et al., Journal of Clinical Microbiology 32:843-45 (1994); Lye et al., Pathology 28:364-65 (1996), and Ribes et al., (supra)).
[0006] The agents of mucormycosis almost uniformly affect immunocompromised hosts (Spellberg et al., Clin. Microbiol. Rev. 18:556-69 (2005)). The major risk factors for mucormycosis include uncontrolled diabetes mellitus in ketoacidosis known as diabetes ketoacidosis (DKA), other forms of metabolic acidosis, treatment with corticosteroids, organ or bone marrow transplantation, neutropenia, trauma and burns, malignant hematological disorders, and deferoxamine chelation-therapy in subjects receiving hemodialysis.
[0007] Recent reports have demonstrated a striking increase in the number of reported cases of mucormycosis over the last two decades (Gleissner et al., Leuk. Lymphoma 45(7):1351-60 (2004)). There has also been an alarming rise in the incidence of mucormycosis at major transplant centers. For example, at the Fred Hutchinson Cancer Center, Man et al. have described a greater than doubling in the number of cases from 1985-1989 to 1995-1999 (Man et al., Clin. Infect. Dis. 34(7):909-17 (2002)). Similarly, Kontoyiannis et al. have described a greater than doubling in the incidence of mucormycosis in transplant subjects over a similar time-span (Kontoyiannis et al, Clin. Infect. Dis. 30(6):851-6 (2000)). Given the increasing prevalence of diabetes, cancer, and organ transplantation in the aging United States population, the rise in incidence of mucormycosis is anticipated to continue unabated for the foreseeable future.
[0008] Therefore, there exists a need for compounds and methods that can reduce the risk of mucormycosis pathogenesis and provide effective therapies without adverse effects. The present invention satisfies this need and provides related advantages as well.
SUMMARY OF INVENTION
[0009] In accordance with the present invention, there are provided Mucorales CotH polypeptides and encoding nucleic acid molecules. The Mucorales CotH polypeptides and encoding nucleic acids can be advantageously used to diagnose, treat or prevent fungal conditions, in particular mucormycosis. Furthermore, the Mucorales CotH polypeptides and encoding nucleic acids are useful to generate or screen for agents that can alter Mucorales CotH activity or expression, which can further be used to treat or prevent fungal conditions.
[0010] The invention also provides vectors containing Mucorales CotH nucleic acids, host cells containing such vectors, Mucorales CotH anti-sense nucleic acids and related compositions. The invention additionally provides Mucorales CotH oligonucleotides that can be used to hybridize to or amplify a Mucorales CotH nucleic acid. Anti-Mucorales CotH specific antibodies are also provided. Further provided are kits containing Mucorales CotH nucleic acids or Mucorales CotH specific antibodies. Such kits and reagents can be used to diagnose fungal infection cause by Mucorales organisms. Also provided are pharmaceutical and vaccine compositions.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 shows a FAR-western blot of four open reading frames (ORF) predicted to be cell surface proteins.
[0012] FIG. 2 shows GRP78 binds to germlings but not to spores of R. oryzae.
[0013] FIG. 3 shows expression of the four glycosylphosphatidylinisotol (GPI) anchored proteins predicted to act as ligands to GRP78.
[0014] FIG. 4, panels A and B, show expression of CotH genes in R. oryzae germlings incubated with endothelial cells.
[0015] FIG. 5 shows homology of the 4 putative GPI-anchored proteins to each other and the number of predicted N- and O-glycosylation sites in CotH3.
[0016] FIG. 6, panel A demonstrates the ability of R. oryzae to adhere to human umbilical endothelial cells but not plastic. Further, Saccharomyces cerevisiae doesn't adhere to endothelial cells. Panel B, shows R. oryzae CotH2 and CotH3 enabling S. cerevisiae to bind endothelial cells expressing GRP78.
[0017] FIG. 7 shows CotH3 is conserved among various Mucorales including R. oryzae 99-880, R. oryzae 99-892, Mucor sp., Lichtheimia corymbifera, Cunninghamella bertholetiae and R. microsporus.
[0018] FIG. 8, panels A and B, show S. cerevisiae expressing CotH2 or CotH3 adhere to and invades endothelial cells or CHO cells overexpressing GRP78 but not CHO parent cells.
[0019] FIG. 9 shows the amino acid sequence (SEQ ID NO. 1) and the nucleic acid coding sequence (SEQ ID NO. 2) of CotH1 from R. oryzae.
[0020] FIG. 10 shows the amino acid sequence (SEQ ID NO. 3) and the nucleic acid coding sequence (SEQ ID NO. 4) of CotH2 from R. oryzae.
[0021] FIG. 11 shows the amino acid sequence (SEQ ID NO. 5) and the nucleic acid coding sequence (SEQ ID NO. 6) of CotH3 from R. oryzae.
[0022] FIG. 12 shows the amino acid sequence (SEQ ID NO. 7) and the nucleic acid coding sequence (SEQ ID NO. 8) of RO3G_16295 from R. oryzae.
[0023] FIG. 13 shows detection of CotH3 in sheep's blood spiked with R. oryzae by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
[0024] FIG. 14 shows detection of CotH3 in sheep's blood spiked with Mucor sp. or Lichtheimia corymbifera by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
[0025] FIG. 15 shows detection of CotH3 in sheep's blood spiked with Cunninghamella bertholetiae or R. microsporus by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
[0026] FIG. 16 shows no detection of CotH3 in sheep's blood spiked with Aspergillus fumigates or Candida albicans by PCR using oligonucleotide primers having the nucleic acid sequence of SEQ ID NO: 33 and SEQ ID NO: 34.
[0027] FIG. 17 shows the highest homology of any of the CotH predicted proteins (in this case CotH3 [RO3G_11882] SEQ ID NO: 5) with an amino acid sequence of a protein from Stigmatella aurantiaca (ZP_01460584) (SEQ ID NO: 65).
[0028] FIG. 18 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Talaromyces stipitatus ATCC 10500 (EED23986) protein (SEQ ID NO: 67).
[0029] FIG. 19 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Penicillium marneffei ATCC 18224 (XP_002144175) protein (SEQ ID NO: 68).
[0030] FIG. 20 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Aspergillus niger (XP_001392236) protein (SEQ ID NO: 69).
[0031] FIG. 21 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Aspergillus nidulans (XP_658934) protein (SEQ ID NO: 70).
[0032] FIG. 22 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Ustilago maydis (XP_760027) protein (SEQ ID NO: 71).
[0033] FIG. 23 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Coccidioides immitis (XP_001243211) protein (SEQ ID NO: 72).
[0034] FIG. 24 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Neurospora crassa (XP_956792) protein (SEQ ID NO: 73).
[0035] FIG. 25 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Cryptococcus neoformans (XP_775558) protein (SEQ ID NO: 74).
[0036] FIG. 26 shows an amino acid sequence alignment between the RO3G_16295 protein from R. oryzae (SEQ ID NO: 66) and Streptomyces lividans (EFD65170) protein (SEQ ID NO: 75).
[0037] FIG. 27 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-880 (including introns from Data base) (SEQ ID NO: 9).
[0038] FIG. 28 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-880 (exon only from Data base) (SEQ ID NO: 10).
[0039] FIG. 29 shows an amino acid sequence of CotH3 from Rhizopus oryzae 99-880 (predicted amino acids) (SEQ ID NO: 11).
[0040] FIG. 30 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-880 (including introns from sequenced data) (SEQ ID NO: 12).
[0041] FIG. 31 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-892 (exons only from Sequenced data) (SEQ ID NO: 13).
[0042] FIG. 32 shows a nucleic acid sequence of CotH3 from Rhizopus oryzae 99-892 (including intron from Sequenced data) (SEQ ID NO: 14).
[0043] FIG. 33 shows the predicted amino acid sequence of CotH3 from R. oryzae 99-892 (excluding introns) (SEQ ID NO: 15).
[0044] FIG. 34 shows the predicted amino acid sequence of CotH3 from R. oryzae 99-892 (including introns) (SEQ ID NO: 16).
[0045] FIG. 35 shows a nucleic acid sequence of CotH3 sequence from Mucor sp. 99-932 (exons only from sequenced data) (SEQ ID NO: 17).
[0046] FIG. 36 shows the predicted amino acid sequence of CotH3 from Mucor 99-932 (AA exons only) (SEQ ID NO: 18).
[0047] FIG. 37 shows a nucleic acid sequence of CotH3 from Mucor 99-932 (including introns) (SEQ ID NO: 19).
[0048] FIG. 38 shows the predicted amino acid sequence of CotH3 from Mucor 99-932 (including introns) (SEQ ID NO: 20).
[0049] FIG. 39 shows a nucleic acid sequence of CotH3 from Lichtheimia corymbifera (exons only from sequenced data) (SEQ ID NO: 21).
[0050] FIG. 40 shows the predicted amino acid sequence of CotH3 from Lichtheimia corymbifera (exons only from sequenced data) (SEQ ID NO: 22).
[0051] FIG. 41 shows a nucleic acid sequence of CotH3 from Lichtheimia corymbifera (including introns) (SEQ ID NO: 23).
[0052] FIG. 42 shows the predicted amino acid sequence of CotH3 from Lichtheimia corymbifera (including introns) (SEQ ID NO: 24).
[0053] FIG. 43 shows a nucleic acid sequence of CotH3 sequence from Cunninghamella bertholetiae (exons only) (SEQ ID NO: 25).
[0054] FIG. 44 shows the predicted amino acid sequence of CotH3 from Cunninghamella bertholetiae (exons only from sequenced data) (SEQ ID NO: 26).
[0055] FIG. 45 shows a nucleic acid sequence of CotH3 from Cunninghamella bertholetiae (including introns) (SEQ ID NO: 27).
[0056] FIG. 46 shows the predicted amino acid sequence of CotH3 from Cunninghamella bertholetiae (including introns from sequenced data) (SEQ ID NO: 28).
[0057] FIG. 47 shows a nucleic acid sequence of CotH3 from R. microsporus (exons only from sequenced data) (SEQ ID NO: 29).
[0058] FIG. 48 shows the predicted amino acid sequence of CotH3 from R. microsporus (exons only from sequenced data) (SEQ ID NO: 30).
[0059] FIG. 49 shows a nucleic acid sequence of CotH3 from R. microsporus (including introns, has only one intron) (SEQ ID NO: 31).
[0060] FIG. 50 shows the predicted amino acid sequence of CotH3 from R. microsporus (including introns) (SEQ ID NO: 32).
[0061] FIG. 51, panels A and B, show a FAR western blot of R. oryzae surface proteins that bound to GRP78 (Panel A) and a dendrogram showing the close identity between CotH2 and CotH3 predicated proteins and the divergence of the CotH proteins from the fourth identified ORF widely present in fungi without an identified function (i.e. RO3G_16295) (Panel B).
[0062] FIG. 52, panels A-C, show expression of CotH genes and RO3G_16295 in response to germination and to host cell interaction. All CotH genes were expressed in resting spores but only CotH3 was expressed in germlings of R. oryzae grown in YPD at 37.degree. C. (Panel A). Exposure of R. oryzae germlings to endothelial cells induced expression of only CotH2 and CotH3 genes as determined by RT-PCR (Panel B). Quantification of gene expression of CotH genes in R. oryzae germlings on endothelial cells by qRT-PCR demonstrated 16 and 4 fold increase in expression of CotH3 and CotH2 relative to the non expressed CotH1, respectively. RO3G_16295 was not expressed under any of the conditions tested. * P<0.001 vs. CotH1 expression and **P<0.001 vs. CotH1 and CotH2 expression, by Wilcoxon Rank Sum test (Panel C). N=9 from three independent experiments.
[0063] FIG. 53 shows antibodies raised against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) recognized CotH2 and CotH3 but not CotH1 proteins heterologously expressed by S. cerevisiae. Peptide was coupled with KLH and used to raise rabbit antibodies commercially. S. cerevisiae heterologously expressing CotH proteins were stained with the antibodies then counter stained with FITC labeled anti-rabbit goat antibody prior to visualizing the cells with confocal microscopy.
[0064] FIG. 54, panels A-C, show endothelial cell surface GRP78 binds to S. cerevisiae cells heterologously expressing CotH2 or CotH3 but not CotH1 and S. cerevisiae expressing CotH2 or CotH3 adhered and invaded endothelial cells or CHO cells overexpressing GRP78 but not S. cerevisiae expressing CotH1 or empty plasmid. Endothelial cell surface proteins were labeled with NHS-biotin and then extracted with n-octyl-.beta.-d-glucopyranoside in PBS containing Ca.sup.2+ and Mg.sup.2+ and protease inhibitors. The labeled proteins (250 .mu.g) were incubated with yeast cells (2.times.10.sup.8), then the unbound proteins were removed by extensive rinsing with PBS containing Ca.sup.2+ and Mg.sup.2+. The membrane proteins that remained bound to the organisms were eluted with 6 M urea, separated on 10% SDS-PAGE, and identified by immunoblotting with anti-GRP78 Ab (Panel A). Adherence and endocytosis (determined by differential fluorescence) assays were carried out using endothelial cells (Panel B), or CHO parent cells or those overexpressing GRP78 (Panel C) split on 12-mm glass coverslips. * P<0.001 vs. S. cerevisiae expressing empty plasmid or CotH1 and **P<0.001 vs. CotH1 and CotH2 expression, by Wilcoxon Rank Sum test. N=9 from three independent experiments. Data are expressed as median .+-.interquartile range.
[0065] FIG. 55, panels A and B, show anti-CotH3 Abs (raised against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) block endothelial cell endocytosis of and damage by R. oryzae. Adherence and endocytosis (determined by differential fluorescence) assays were carried out using endothelial cells split on 12-mm glass coverslips, while damage was carried out using the 96-well plate .sup.51Cr-release method. Endothelial cells were incubated with 50 .mu.g/ml anti-CotH3 or with serum from the same rabbit prior to vaccination (control) for 1 hour prior to addition of R. oryzae germlings. Blocking of CotH3 and CotH2 (since the antibodies react to CotH2 proteins) abrogates endocytosis of R. oryzae by endothelial cells (data derived from >700 fungal cells interacting with approximately 200 endothelial cells/each group/experiment, with an average of 59% cells being endocytosed in the control) (Panel A) and reduces the ability of the fungus to cause endothelial cell damage (Panel B). *P<0.01 compared with pre-vaccinated serum or with no serum by Wilcoxon rank-sum test. n=6 slides per group from 3 independent experiments for endocytosis, and n=6 wells per group from 2 independent experiments for damage assay. Data are expressed as median .+-.interquartile range.
[0066] FIG. 56, panels A-C, show RNA-i construct targeting CotH2 and CotH3 inhibits the expression of both genes, reduces CotH2 and CotH3 protein synthesis on the cell surface and has no effect on the growth or the pattern of germination of R. oryzae. R. oryzae was transformed with an RNA-i construct (pRNAi) targeting CotH2 and CotH3 expression or with empty plasmid. Two transformants were shown to have >80% reduction in the expression of CotH2 and CotH3 relative to cells transformed with the empty plasmid as determined by qRT-PCR (Panel A). Flow cytometry testing using anti-CotH antibodies demonstrated reduction in cell surface expression of CotH proteins on R. oryzae cells transformed with the RNA-i construct compared to those transformed with the empty plasmid, wild type cells or negative control (i.e. wild type R. oryzae stained with commercial IgG instead of anti-CotH antibodies) (Panel B). The two transformants with reduced CotH2 and CotH3 expression had similar growth rate (Panel C) as the wild type cells or cells transformed with the empty plasmid.
[0067] FIG. 57, panels A-C, show inhibition of CotH2 and CotH3 expression compromise the ability of R. oryzae to invade and damage endothelial cells and CHO cells overexpressing GRP78. Adherence and endocytosis (determined by differential fluorescence) assays were carried out using endothelial cells split on 12-mm glass coverslips, while damage was carried out using the 96-well plate .sup.51Cr-release method. R. oryzae germlings transformed with the RNA-i construct caused less invasion (Panel A) and damage (Panel B) to endothelial cells when compared to cells transformed with empty plasmid. Transformants with RNA-i targeting CotH2 and CotH3 caused equivalent damage to CHO cells overexpressing GRP78 when compared to CHO parent cells. In contrast, R. oryzae germlings transformed with the empty plasmid or wild type R. oryzae caused significantly more damage to CHO cell overexpressing GRP78 vs. CHO parent cells (Panel C). *P<0.005 compared with empty plasmid, ** P<0.01 vs. wild type or empty plasmid, and P<0.01 vs. CHO parent cells by Wilcoxon rank-sum test. n=6 slides per group from 3 independent experiments for endocytosis, and n=9 wells per group from 3 independent experiments for damage assay. Data are expressed as median .+-.interquartile range.
[0068] FIG. 58, panels A-C, show inhibition of CotH2 and CotH3 expression attenuates virulence of R. oryzae in diabetic ketoacidotic mice. Panel A shows the survival of mice (n=10 for wild type or 9 for RNA-i or empty plasmid transformants) infected intratracheally with one of the three strains. Inhaled inocula were 2.4.times.10.sup.3, 2.8.times.10.sup.3, and 2.5.times.10.sup.3 spores, for wild type, empty plasmid, or RNA-i cells, respectively. * P<0.003 vs. wild type or empty plasmid infected mice by log Rank test. Panel B shows the lung and brain fungal burden of diabetic ketoacidotic mice (n=9 per group) infected intratracheally with wild type (1.7.times.10.sup.3), empty plasmid (3.0.times.10.sup.3) or RNA-i (3.1.times.10.sup.3) cells. Mice were sacrificed on day +2 relative to infection and their organs processed for tissue fungal burden using SYBR green assay. Data are expressed as median .+-.interquartile range. * P<0.001 compared to wild type or empty plasmid infected mice by Wilcoxon Rank Sum test. Panel C shows in vivo expression of CotH genes in lungs and brains harvested from mice infected with wild type, empty plasmid or RNA-i construct as determined by qRT-PCR using specific primers to each of the CotH genes. Data are expressed as mean.+-.SD. * P<0.001 vs. wild type or empty plasmid.
[0069] FIG. 59 shows histopathological examination of lungs harvested from diabetic ketoacidotic mice infected with wild type or R. oryzae transformed with empty plasmid or RNA-i. Periodic acid Schieff (PAS) stained sections demonstrating extensive hyphal elements (arrows) from organs collected from mice infected with wild type or R. oryzae transformed with empty plasmid but not R. oryzae transformed with RNA-i construct.
[0070] FIG. 60 shows passive immunization with antiCotH antibodies raise against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) (A) or peptide MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) (B) protect mice from R. oryzae infection. Diabetic ketoacidotic mice were given 1 mg of antiCotH IgG or pre-vaccination serum (control) 2 hr prior to infecting intratracheally with 2.4.times.10.sup.3 spores of R. oryzae 99-880 (wild type). A second dose of the polyclonal antibody or the pre-vaccination serum was given on day +3 relative to infection. * P<0.03 vs. mice receiving pre-vaccination serum.
[0071] FIG. 61 shows the specificities of the CotH3 molecular beacon detection of different fungal species. The amplification plot was generated in StepOnePlus Real-Time PCR machine (Applied Biosystems). The x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (.DELTA.Rn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples). Signals can be amplified from water samples (0.5 ml) spiked with 10.sup.5 spores of R. oryzae but not Candida albicans or Aspergillus fumigatus.
[0072] FIG. 62 shows the sensitivity of the CotH3 molecular beacon detection of water samples (0.5 ml) spiked with different inocula of R. oryzae 99-880. The amplification plot was generated in StepOnePlus Real-Time PCR machine (Applied Biosystems). The x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (.DELTA.Rn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples).
[0073] FIG. 63 shows the sensitivity and specificity of the CotH3 molecular beacon probe in detection of Rhizopus oryzae spores in blood. The amplification plot was generated in StepOnePlus Real-Time PCR machine (Applied Biosystems). The x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (.DELTA.Rn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples). Blood, is inoculated control. R: R. oryzae 99-880 at different inocula (e.g. R10=R. oryzae 10 spores used to spike 350 .mu.l of blood), A: A. fumigants, C: C. albicans each used to spike 350 .mu.l of blood at 10.sup.5 cells.
[0074] FIG. 64 shows the specificity of the CotH3 molecular beacon probe in detection of Rhizopus. The amplification plot was generated in a StepOnePlus Real-Time PCR machine (Applied Biosystems). The x axis is the time from the initiation of amplification; the y axis is the increase in fluorescence (.DELTA.Rn); threshold fluorescence is shown as the bold horizontal line (It is equal to the average plus 2 times SD for the water negative control samples). Blood: uninoculated blood sample; 99-892: R. oryzae 99-892; ATCC62417: R. microspores ATCC62417; R1000: R. oryzae 99-880. All strains were used to spike blood (350 .mu.l) with 10.sup.3 spores.
DETAILED DESCRIPTION OF THE INVENTION
[0075] The compositions and methods disclosed herein are based, at least in part, on the identification and characterization of cell surface proteins that are uniquely expressed by fungi of the Mucorales order and can facilitate binding of endothelial cells during fungal infections. Mucormycosis, which is mainly caused by Rhizopus oryzae, is characterized by angioinvasion and vascular thrombosis. Interactions between Mucorales and endothelial cells is an important factor in establishing a fungal condition. The recently identified Glucose Regulated Protein 78 (GRP78), a novel host receptor that mediates invasion and subsequent damage of human umbilical vein endothelial cells by R. oryzae germlings, provides a likely target ligand for R. oryzae and other Mucorales species to bind during invasion (Liu et al., J. Clin. Invest. 120:1914-24 (2010)).
[0076] In accordance with the present invention, provided are nucleic acids encoding Mucorales CotH polypeptides and other polypeptides disclosed herein, or functional polypeptide fragments thereof.
[0077] As used herein, the term "Mucorales CotH" refers to sub-family members of the CotH family of proteins, wherein the Mucorales CotH proteins include cell surface proteins expressed by fungi in the Mucorales order that are involved in the process of adherence and invasion of host cells, such as endothelial cell. Because Mucorales CotH proteins are unique to Mucorales, the presence or absence of Mucorales CotH nucleic acid or polypeptide or changes in Mucorales CotH nucleic acid or polypeptide expression can serve as a marker for infection by a Mucorales species, for example, mucormycosis. Thus, the invention includes Mucorales CotH nucleic acids and/or polypeptides that can be used for screening for a fungal condition and/or for developing drug candidates for the treatment of a fungal condition.
[0078] The term "functional," when used herein as a modifier of an Mucorales CotH polypeptide, or polypeptide fragment thereof, refers to a polypeptide that exhibits functional characteristics similar to CotH1, CotH2 and CotH3 as disclosed herein. For example, when CotH3 or CotH2 were expressed in S. cerevisiae, the S. cerevisiae cells adhere to and invade endothelial cells or CHO cells overexpressing GRP78. Therefore, one function of Mucorales CotH is a pro-adherence and/or pro-invasion function. In another aspect, a functional Mucorales CotH polypeptide or fragment thereof can also include in vivo or in vitro binding to a GRP78 protein, variant or fragment thereof.
[0079] The nucleic acid molecules described herein are useful for producing invention proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art. In addition, such nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of an invention Mucorales CotH gene or mRNA transcript in a given sample. The nucleic acid molecules described herein, and fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding invention proteins described herein.
[0080] The term "nucleic acid", also referred to as polynucleotides, encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers and can be single stranded or double stranded. DNA can be either complementary DNA (cDNA) or genomic DNA, and can represent the sense strand, the anti-sense strand or both. Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding an Mucorales CotH polypeptide. Such nucleic acids include, but are not limited to, nucleic acids comprising substantially the same nucleotide sequence as set forth in 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31. In general, a genomic sequence of the invention includes regulatory regions such as promoters, enhancers, and introns that are outside of the exons encoding a Mucorales CotH but does not include proximal genes that do not encode Mucorales CotH.
[0081] Use of the terms "isolated" and/or "purified" in the present specification and claims as a modifier of DNA, RNA, polypeptides or proteins means that the DNA, RNA, polypeptides or proteins so designated have been produced in such form by the hand of man, and thus are separated from their native in vivo cellular environment.
[0082] The term substantially the same nucleotide sequence refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions. In one embodiment, DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in any of SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31. In another embodiment, DNA having substantially the same nucleotide sequence as the reference nucleotide sequence has at least 65% identity with respect to the reference nucleotide sequence. DNA having substantially the same nucleotide sequence can have at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity to the reference nucleotide sequence.
[0083] As used herein, a "modification" of a nucleic acid can also include one or several nucleotide additions, deletions, or substitutions with respect to a reference sequence. A modification of a nucleic acid can include substitutions that do not change the encoded amino acid sequence due to the degeneracy of the genetic code. Such modifications can correspond to variations that are made deliberately, or which occur as mutations during nucleic acid replication.
[0084] Exemplary modifications of the recited Mucorales CotH sequences include sequences that correspond to homologs of other species, including species of the Mucorales order such as A. corymbifera, A. elegans, A. rouxii, B. circina, B. multispora, C. brefeldii, C. angarensis, C. recurvatus, D. fulva, E. anomalus, H. elegans, H. assamensis, K. cordensis, M. amphibiorum, P. parasitica, P. agaricina, P. anomala, P. circinans, R. endophyticus, R. javensis, S. umbellata, S. megalocarpus, T. elegans, T. indicae-seudaticae, Z. californiensis, R. azygosporus, R. caespitosus, R. homothallicus, R. oryzae, R. microspores, R. microsporus var. rhizopodiformis, R. schipperae, or any other species of the Mucorales order disclosed herein. The corresponding Mucorales CotH sequences of Mucorales species can be determined by methods known in the art, such as by PCR or by screening genomic, cDNA or expression libraries.
[0085] Another exemplary modification of the invention Mucorales CotH can correspond to splice variant forms of the Mucorales CotH nucleotide sequence. Additionally, a modification of a nucleotide sequence can include one or more non-native nucleotides, having, for example, modifications to the base, the sugar, or the phosphate portion, or having a modified phosphodiester linkage. Such modifications can be advantageous in increasing the stability of the nucleic acid molecule.
[0086] The invention also encompasses nucleic acids which differ from the nucleic acids shown in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31, but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as functionally equivalent nucleic acids. As used herein, the phrase functionally equivalent nucleic acids encompasses nucleic acids characterized by slight and non-consequential sequence variations that will function in substantially the same manner to produce the same protein product(s) as the nucleic acids disclosed herein. In particular, functionally equivalent nucleic acids encode polypeptides that are the same as those encoded by the nucleic acids disclosed herein or that have conservative amino acid variations. For example, conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein.
[0087] Further provided are nucleic acids encoding Mucorales CotH polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions. As used herein, the term degenerate refers to codons that differ in at least one nucleotide from a reference nucleic acid, but encode the same amino acids as the reference nucleic acid. Nucleic acids encoding the invention Mucorales CotH polypeptides can be comprised of nucleotides that encode substantially the same amino acid sequence as set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
[0088] In one embodiment, the invention provides an isolated nucleic acid encoding a polypeptide as disclosed herein including a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof. The invention also provides an isolated nucleic acid encoding a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof, comprising a nucleic acid selected from: (a) nucleic acid encoding an amino acid sequence set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or (b) nucleic acid that hybridizes to the nucleic acid of (a) under low, moderately or highly stringent conditions, wherein said nucleic acid contiguously encodes biologically active Mucorales CotH polypeptide, or (c) nucleic acid degenerate with respect to either (a) or (b) above, wherein said nucleic acid encodes biologically active Mucorales CotH polypeptide. In one aspect, the nucleic acid of the invention hybridizes under highly stringent conditions.
[0089] Hybridization refers to the binding of complementary strands of nucleic acid, for example, sense:antisense strands or probe:target-nucleic acid to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA. Stringency levels used to hybridize a given probe with target-DNA can be readily varied by those of skill in the art.
[0090] The phrase "stringent hybridization" is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T.sub.m) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.
[0091] As used herein, the phrase "moderately stringent hybridization" refers to conditions that permit target-nucleic acid to bind a complementary nucleic acid. The hybridized nucleic acids will generally have at least about 60% identity, at least about 75% identity, or at least about 85% identity; or at least about 90% identity. Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5.times. Denhart's solution, 5.times.SSPE, 0.2% SDS at 42EC, followed by washing in 0.2.times.SSPE, 0.2% SDS, at 42EC.
[0092] The phrase "highly stringent hybridization" refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65EC, for example, if a hybrid is not stable in 0.018M NaCl at 65EC, it will not be stable under high stringency conditions, as contemplated herein. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5.times. Denhart's solution, 5.times.SSPE, 0.2% SDS at 42EC, followed by washing in 0.1.times.SSPE, and 0.1% SDS at 65EC.
[0093] The phrase "low stringency hybridization" refers to conditions equivalent to hybridization in 10% formamide, 5.times. Denhart's solution, 6.times.SSPE, 0.2% SDS at 22EC, followed by washing in 1.times.SSPE, 0.2% SDS, at 37EC. Denhart's solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA). 20.times.SSPE (sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA)) contains 3M sodium chloride, 0.2M sodium phosphate, and 0.025 M (EDTA). Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y., 1989; and Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999)). Nucleic acids encoding polypeptides hybridize under moderately stringent or high stringency conditions to substantially the entire sequence, or substantial portions, for example, typically at least 15-30 nucleotides of the nucleic acid sequence set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
[0094] The invention also provides a modification of a Mucorales CotH nucleotide sequence that hybridizes to a Mucorales CotH nucleic acid molecule, for example, a nucleic acid molecule set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31, under moderately stringent conditions. Modifications of Mucorales CotH nucleotide sequences, where the modification has at least 65% identity to a Mucorales CotH nucleotide sequence, are also provided. The invention also provides modification of a Mucorales CotH nucleotide sequence having at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity. The invention also provides modification of Mucorales CotH nucleotide sequences, wherein the amino acid sequence encoded by the modified nucleic acid has 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity to the amino acid sequence set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
[0095] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.
[0096] A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Ausubel et al., supra. Preferably, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity.
[0097] One means of isolating a nucleic acid encoding a Mucorales CotH polypeptide is to probe a cDNA library or genomic library with a natural or artificially designed nucleic acid probe using methods well known in the art. Nucleic acid probes derived from the Mucorales CotH gene are particularly useful for this purpose. DNA and cDNA molecules that encode Mucorales CotH polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from any number of Mucorales species sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods well known in the art (see, for example, Sambrook et al., supra, 1989; Ausubel et al., supra, 1999).
[0098] The invention additionally provides a Mucorales CotH oligonucleotide comprising between 15 and 300 contiguous nucleotides of SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31, or the anti-sense strand thereof. As used herein, the term "oligonucleotide" refers to a nucleic acid molecule that includes at least 15 contiguous nucleotides from a reference nucleotide sequence, and can include at least 16, 17, 18, 19, 20 or at least 25 contiguous nucleotides, and often includes at least 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, up to 350 contiguous nucleotides from the reference nucleotide sequence. The reference nucleotide sequence can be the sense strand or the anti-sense strand. Accordingly, in one aspect of the inventions, CotH oligonucleotides can comprise the nucleic acid sequence of ATGAAATTATCTATTATATCCGCTGCC (SEQ ID NO: 33), GCTGGGAATATAATTGTCATCGA (SEQ ID NO: 34), GATGACAATTATATTCCCAGC (SEQ ID NO: 35), GAGTAGACGTAATTAGATCCAA (SEQ ID NO: 36) AAACGTACCTGCTGACCGAATC (SEQ ID NO: 37) or oligonucleotide disclosed herein.
[0099] The Mucorales CotH oligonucleotides of the invention that contain at least 15 contiguous nucleotides of a reference Mucorales CotH nucleotide sequence are able to hybridize to Mucorales CotH under moderately stringent hybridization conditions and thus can be advantageously used, for example, as probes to detect Mucorales CotH DNA or RNA in a sample, and to detect splice variants thereof; as sequencing or PCR primers; as antisense reagents to block transcription of Mucorales CotH RNA in cells; or in other applications known to those skilled in the art in which hybridization to a Mucorales CotH nucleic acid molecule is desirable.
[0100] The isolated Mucorales CotH nucleic acid molecules of the invention can be used in a variety of diagnostic and therapeutic applications. For example, the isolated Mucorales CotH nucleic acid molecules of the invention can be used as probes, as described above; as templates for the recombinant expression of Mucorales CotH polypeptides; or in screening assays to identify cellular molecules that bind Mucorales CotH.
[0101] Another useful method for producing a Mucorales CotH nucleic acid molecule of the invention involves amplification of the nucleic acid molecule using PCR and Mucorales CotH oligonucleotides and, optionally, purification of the resulting product by gel electrophoresis. Either PCR or RT-PCR can be used to produce a Mucorales CotH nucleic acid molecule having any desired nucleotide boundaries. Desired modifications to the nucleic acid sequence can also be introduced by choosing an appropriate oligonucleotide primer with one or more additions, deletions or substitutions. Such nucleic acid molecules can be amplified exponentially starting from as little as a single gene or mRNA copy, from any cell, tissue or species of interest.
[0102] The invention thus provides methods for detecting Mucorales CotH nucleic acid in a sample. The methods of detecting Mucorales CotH nucleic acid in a sample can be either qualitative or quantitative, as desired. For example, the presence, abundance, integrity or structure of a Mucorales CotH can be determined, as desired, depending on the assay format and the probe used for hybridization or primer pair chosen for application.
[0103] Useful assays for detecting Mucorales CotH nucleic acid based on specific hybridization with an isolated Mucorales CotH nucleic acid molecule are well known in the art and include, for example, in situ hybridization, which can be used to detect altered chromosomal location of the nucleic acid molecule, altered gene copy number, and RNA abundance, depending on the assay format used. Other hybridization assays include, for example, Northern blots and RNase protection assays, which can be used to determine the abundance and integrity of different RNA splice variants, and Southern blots, which can be used to determine the copy number and integrity of DNA. A Mucorales CotH hybridization probe can be labeled with any suitable detectable moiety, such as a radioisotope, fluorochrome, chemiluminescent marker, biotin, or other detectable moiety known in the art that is detectable by analytical methods.
[0104] Useful assays for detecting a Mucorales CotH nucleic acid in a sample based on amplifying a Mucorales CotH nucleic acid with two or more Mucorales CotH oligonucleotides are also well known in the art, and include, for example, qualitative or quantitative polymerase chain reaction (PCR); reverse-transcription PCR (RT-PCR); single strand conformational polymorphism (SSCP) analysis, which can readily identify a single point mutation in DNA based on differences in the secondary structure of single-strand DNA that produce an altered electrophoretic mobility upon non-denaturing gel electrophoresis; and coupled PCR, transcription and translation assays, such as a protein truncation test, in which a mutation in DNA is determined by an altered protein product on an electrophoresis gel. Additionally, the amplified Mucorales CotH nucleic acid can be sequenced to detect mutations and mutational hot-spots, and specific assays for large-scale screening of samples to identify such mutations can be developed.
[0105] The invention further provides an isolated Mucorales CotH polypeptides, immunogenic fragment thereof, or a functional fragment thereof, encoded by a Mucorales CotH nucleic acid of the invention. For example, the invention provides a polypeptide comprising the same or substantially the same amino acid sequence as set forth in SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32. Also provided is a Mucorales CotH polypeptide encoded by a nucleotide sequence comprising the same or substantially the same nucleotide sequence as set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
[0106] As employed herein, the term substantially the same amino acid sequence refers to amino acid sequences having at least about 65% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence. In one aspect, proteins having substantially the same amino acid sequence will have at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, or at least 99% identity. It is recognized, however, that polypeptides, or encoding nucleic acids, containing less than the described levels of sequence identity arising as splice variants or that are modified by conservative amino acid substitutions, or by substitution of degenerate codons are also encompassed within the scope of the present invention.
[0107] Also encompassed by the term Mucorales CotH are functional fragments or polypeptide analogs thereof. The term "functional fragment" refers to a peptide fragment that is a portion of a full length Mucorales CotH protein, provided that the portion has a biological activity, as defined herein, that is characteristic of the corresponding full length protein. For example, in aspect of the invention, the functional fragments of the invention can bind to the GRP78 protein or more specifically the functional fragments of the invention can bind to the GRP78 protein expressed by epithelial cells. Thus, the invention also provides functional fragments of invention Mucorales CotH proteins, which can be identified using the binding and routine methods, such as bioassays described herein.
[0108] As used herein, the term "polypeptide" when used in reference to Mucorales CotH is intended to refer to a peptide or polypeptide of two or more amino acids. The term polypeptide analog includes any polypeptide having an amino acid residue sequence substantially the same as a sequence specifically described herein in which one or more residues have been conservatively substituted with a functionally similar residue and which displays the ability to functionally mimic a Mucorales CotH as described herein. A "modification" of a Mucorales CotH polypeptide also encompasses conservative substitutions of a Mucorales CotH polypeptide amino acid sequence. Conservative substitutions of encoded amino acids include, for example, amino acids that belong within the following groups: (1) non-polar amino acids (Gly, Ala, Val, Leu, and Ile); (2) polar neutral amino acids (Cys, Met, Ser, Thr, Asn, and Gln); (3) polar acidic amino acids (Asp and Glu); (4) polar basic amino acids (Lys, Arg and His); and (5) aromatic amino acids (Phe, Trp, Tyr, and His). Other minor modifications are included within Mucorales CotH polypeptides so long as the polypeptide retains some or all of its function as described herein.
[0109] The amino acid length of functional fragments or polypeptide analogs of the present invention can range from about 5 amino acids up to the full-length protein sequence of an invention Mucorales CotH. In certain embodiments, the amino acid lengths include, for example, at least about 10 amino acids, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250 or more amino acids in length up to the full-length Mucorales CotH protein sequence. The functional fragments can be contiguous amino acid sequences of a Mucorales CotH polypeptide, including contiguous amino acid sequences of SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32.
[0110] In another embodiment, the invention provides an immunogenic fragment of the Mucorales CotH polypeptides disclosed herein. The immunogenic fragments of the invention can include immunogenic epitopes, which can be identified using experimental methods well known in the art. Additionally, computational modeling can also be used to identify immunogenic epitopes. See, for example, Tong et al. (Brief Bioinform. 8(2):96-108 (2006)) and Ponomarenko et al. (2008) "B-cell epitope prediction," in Structural Bioinformatics, Bourne P E and Gu J (eds) Wiley-Liss; 2 edition, pgs. 849-879. Once an epitope bearing reactivity with an antibody raised against the intact protein is identified, the polypeptide can be tested for specificity by amino acid substitution at every position and/or extension at both C and/or N terminal ends. Such epitope bearing polypeptides typically contain at least six to fourteen amino acid residues, and can be produced, for example, by polypeptide synthesis using methods well known in the art or by fragmenting an existing protein. Accordingly, in some aspects of the invention, an immunogenic fragment of the Mucorales CotH polypeptides disclosed herein can include the amino acid sequence GAGKKHNNAKQSWNW (SEQ ID NO: 39) or MGQTNDGAYRDPTDNNK (SEQ ID NO: 40).
[0111] With respect to the molecule used as immunogens pursuant to the present invention, those skilled in the art will recognize that the protein can be truncated or fragmented without losing the essential qualities as an immunogenic vaccine. For example, a protein can be truncated to yield an N-terminal fragment by truncation from the C-terminal end with preservation of the functional properties of the molecule as an immunogenic. Similarly, C-terminal fragments can be generated by truncation from the N-terminal end with preservation of the functional properties of the molecule as an immunogenic. Other modifications in accordance with the teachings and guidance provided herein can be made pursuant to this invention to create other polypeptide functional fragments, immunogenic fragments, variants, analogs or derivatives thereof, to achieve the therapeutically useful properties described herein with the native proteins.
[0112] Accordingly, the term "immunogenic fragment" as it is used herein refers to a portion of a protein that is recognized by a T-cell and/or B-cell antigen receptor. The immunogenic portion generally includes at least 5 amino acid residues, or alternatively at least 6, or alternatively at least 7, or alternatively at least 8, or alternatively at least 9, or alternatively at least 10, or alternatively at least 11, or alternatively at least 12, or alternatively at least 13, or alternatively at least 14, or alternatively at least 15, or alternatively at least 16, or alternatively at least 17, or alternatively at least 18, or alternatively at least 18, or alternatively at least 19, or alternatively at least 20, or alternatively at least 25, or alternatively at least 30, or alternatively at least 50, or alternatively at least 100 amino acid residues of a CotH polypeptide disclosed herein. Alternatively, the immunogenic portion can include at most 5 amino acid residues, or alternatively at most 6, or alternatively at most 7, or alternatively at most 8, or alternatively at most 9, or alternatively at most 10, or alternatively at most 11, or alternatively at most 12, or alternatively at most 13, or alternatively at most 14, or alternatively at most 15, or alternatively at most 16, or alternatively at most 17, or alternatively at most 18, or alternatively at most 18, or alternatively at most 19, or alternatively at most 20, or alternatively at most 25, or alternatively at most 30, or alternatively at most 50, or alternatively at most 100 amino acid residues of a CotH polypeptide disclosed herein. In some aspects, immunogenic portions can contain a small N- and/or C-terminal fragment (e.g., 5-30 amino acids, preferably 10-25 amino acids).
[0113] A modification of a polypeptide can also include derivatives, analogues and functional mimetics thereof, provided that such polypeptide displays the Mucorales CotH biological activity. For example, derivatives can include chemical modifications of the polypeptide such as alkylation, acylation, carbamylation, iodination, or any modification that derivatizes the polypeptide. Such derivatized molecules include, for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups can be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups can be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine can be derivatized to form N-im-benzylhistidine. Also included as derivatives or analogues are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids, for example, 4-hydroxyproline, 5-hydroxylysine, 3-methylhistidine, homoserine, ornithine or carboxyglutamate, and can include amino acids that are not linked by peptide bonds. Polypeptides of the present invention also include any polypeptide having one or more additions and/or deletions of residues, relative to the sequence of a polypeptide whose sequence is shown herein, so long as Mucorales CotH activity is maintained.
[0114] The invention provides an isolated Mucorales CotH polypeptides, immunogenic fragment thereof, or functional fragment thereof. The invention Mucorales CotH polypeptides can be isolated by a variety of methods well-known in the art, for example, recombinant expression systems, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology, Vol. 182, (Academic Press, (1990)). Alternatively, the isolated polypeptides of the present invention can be obtained using well-known recombinant methods (see, for example, Sambrook et al., supra, 1989; Ausubel et al., supra, 1999). The methods and conditions for biochemical purification of a polypeptide of the invention can be chosen by those skilled in the art, and purification monitored, for example, by an immunological assay or a functional assay.
[0115] An example of the means for preparing the invention polypeptide(s) is to express nucleic acids encoding Mucorales CotH in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell such as an oocyte, or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known purification methods, so described herein. Invention polypeptides can be isolated directly from cells that have been transformed with expression vectors as described herein. Recombinantly expressed polypeptides of the invention can also be expressed as fusion proteins with appropriate affinity tags, such as glutathione S transferase (GST) or poly His, and affinity purified. The invention polypeptide, biologically functional fragments, and functional equivalents thereof can also be produced by chemical synthesis. For example, synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, Calif.) employing the chemistry provided by the manufacturer.
[0116] The present invention also provides compositions containing an acceptable carrier and any of an isolated, purified Mucorales CotH mature protein or functional polypeptide fragments thereof, alone or in combination with each other. These polypeptides or proteins can be recombinantly derived, chemically synthesized or purified from native sources. As used herein, the term "acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil and water emulsion, and various types of wetting agents.
[0117] The invention thus provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a compound selected from the group consisting of a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof as described herein, an antisense nucleic acid as described herein or an anti-Mucorales CotH antibody as described herein. The invention additionally provides a method of treating or preventing mucormycosis in a subject in need thereof by administering a therapeutically effective amount of a pharmaceutical composition containing a pharmaceutically acceptable carrier and a compound selected from the group consisting of a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof as described herein, an antisense nucleic acid as described herein or an anti-Mucorales CotH antibody as described herein. The invention additionally provides a method of treating or preventing mucormycosis in a subject in need thereof by administering an therapeutically effective amount of a vaccine composition as disclosed herein.
[0118] Also provided are antisense-nucleic acids having a sequence capable of binding specifically with full-length or any portion of an mRNA that encodes Mucorales CotH polypeptides so as to prevent translation of the mRNA. The antisense-nucleic acid can have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding Mucorales CotH polypeptides. As used herein, the phrase binding specifically encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs. An example of an antisense-nucleic acid is an antisense-nucleic acid comprising chemical analogs of nucleotides.
[0119] The present invention provides means to modulate levels of expression of Mucorales CotH polypeptides by recombinantly expressing Mucorales CotH anti-sense nucleic acids or employing synthetic anti-sense nucleic acid compositions (hereinafter SANC) that inhibit translation of mRNA encoding these polypeptides. Synthetic oligonucleotides, or other antisense-nucleic acid chemical structures designed to recognize and selectively bind to mRNA are constructed to be complementary to full-length or portions of an Mucorales CotH coding strand, including nucleotide sequences set forth in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31.
[0120] The SANC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions. The SANC is designed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SANC, which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SANC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SANC into the cell. In addition, the SANC can be designed for administration only to certain selected cell populations by targeting the SANC to be recognized by specific cellular uptake mechanisms which bind and take up the SANC only within select cell populations. In a particular embodiment the SANC is an antisense oligonucleotide.
[0121] For example, the SANC may be designed to bind to a receptor found only in a certain cell type, as discussed above. The SANC is also designed to recognize and selectively bind to target mRNA sequence, which can correspond to a sequence contained within the sequences shown in SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31. The SANC is designed to inactivate target mRNA sequence by either binding thereto and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of mRNA target sequence by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA. SANCs have been shown to be capable of such properties when directed against mRNA targets (see Cohen et al., TIPS, 10:435 (1989) and Weintraub, Sci. American, January (1990), pp. 40).
[0122] Compositions comprising an amount of the antisense-nucleic acid of the invention, effective to reduce expression of Mucorales CotH polypeptides by entering a cell and binding specifically to mRNA encoding Mucorales CotH polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein. Suitable hydrophobic carriers are described, for example, in U.S. Pat. Nos. 5,334,761; 4,889,953; 4,897,355, and the like. The acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type.
[0123] Antisense-nucleic acid compositions are useful to inhibit translation of mRNA encoding invention polypeptides. Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding Mucorales CotH polypeptides and inhibit translation of mRNA and are useful as compositions to inhibit expression of Mucorales CotH associated genes in a tissue sample or in a subject.
[0124] The invention also provides a method for expression of a Mucorales CotH polypeptide by culturing cells containing a Mucorales CotH nucleic acid under conditions suitable for expression of Mucorales CotH. Thus, there is provided a method for the recombinant production of a Mucorales CotH of the invention by expressing the nucleic acid sequences encoding Mucorales CotH in suitable host cells. Recombinant DNA expression systems that are suitable to produce Mucorales CotH described herein are well-known in the art (see, for example, Ausubel et al., supra, 1999). For example, the above-described nucleotide sequences can be incorporated into vectors for further manipulation. As used herein, vector refers to a recombinant DNA or RNA plasmid or virus containing discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.
[0125] The invention also provides vectors containing the Mucorales CotH nucleic acids of the invention. Suitable expression vectors are well-known in the art and include vectors capable of expressing nucleic acid operatively linked to a regulatory sequence or element such as a promoter region or enhancer region that is capable of regulating expression of such nucleic acid. Appropriate expression vectors include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
[0126] The terms "vector", "cloning vector" and "expression vector" mean the vehicle by which a nucleic acid can be introduced into a host cell. The vector can be used for propagation or harboring a nucleic acid or for polypeptide expression of an encoded sequence. A wide variety of vectors are known in the art and include, for example, plasmids, phages and viruses. Exemplary vectors can be found described in, for example, Sambrook et al., supra; Ausubel et al., supra.
[0127] Promoters or enhancers, depending upon the nature of the regulation, can be constitutive or regulated. The regulatory sequences or regulatory elements are operatively linked to a nucleic acid of the invention such that the physical and functional relationship between the nucleic acid and the regulatory sequence allows transcription of the nucleic acid.
[0128] Suitable vectors for expression in prokaryotic or eukaryotic cells are well known to those skilled in the art (see, for example, Ausubel et al., supra, 1999). Vectors useful for expression in eukaryotic cells can include, for example, regulatory elements including the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like. The vectors of the invention are useful for subcloning and amplifying a Mucorales CotH nucleic acid molecule and for recombinantly expressing a Mucorales CotH polypeptide. A vector of the invention can include, for example, viral vectors such as a bacteriophage, a baculovirus or a retrovirus; cosmids or plasmids; and, particularly for cloning large nucleic acid molecules, bacterial artificial chromosome vectors (BACs) and yeast artificial chromosome vectors (YACs). Such vectors are commercially available, and their uses are well known in the art. One skilled in the art will know or can readily determine an appropriate promoter for expression in a particular host cell.
[0129] The invention additionally provides recombinant cells containing Mucorales CotH nucleic acids of the invention. The recombinant cells are generated by introducing into a host cell a vector containing a Mucorales CotH nucleic acid molecule. The recombinant cells are transducted, transfected or otherwise genetically modified. Exemplary host cells that can be used to express recombinant Mucorales CotH molecules include mammalian primary cells; established mammalian cell lines, such as COS, CHO, HeLa, NIH3T3, HEK 293 and PC12 cells; amphibian cells, such as Xenopus embryos and oocytes; and other vertebrate cells. Exemplary host cells also include insect cells such as Drosophila, yeast cells such as Saccharomyces cerevisiae, Saccharomyces pombe, or Pichia pastoris, and prokaryotic cells such as Escherichia coli.
[0130] In one embodiment, the invention provides a vaccine composition having an immunogenic amount of a Mucorales CotH polypeptide, an immunogenic fragment thereof or a variant of the polypeptide. The vaccine composition also can include an adjuvant. The formulation of the vaccine composition of the invention is effective in inducing protective immunity in a subject by stimulating both specific humoral (neutralizing antibodies) and effector cell mediated immune responses against Mucorales CotH polypeptide. The vaccine composition of the invention is also used in the treatment or prophylaxis of fungal infections such as, for example, mucormycosis.
[0131] The vaccine of the present invention will contain an immunoprotective quantity of Mucorales CotH polypeptide antigens and is prepared by methods well known in the art. The preparation of vaccines is generally described in, for example, M. F. Powell and M. J. Newman, eds., "Vaccine Design (the subunit and adjuvant approach)," Plenum Press (1995); A. Robinson, M. Cranage, and M. Hudson, eds., "Vaccine Protocols (Methods in Molecular Medicine)," Humana Press (2003); and D. Ohagan, ed., "Vaccine Ajuvants: Preparation Methods and Research Protocols (Methods in Molecular Medicine)," Humana Press (2000).
[0132] Mucorales CotH polypeptide, and peptide fragments or variants thereof can include immunogenic epitopes, which can be identified using methods known in the art and described in, for example, Geysen et al. Proc. Natl. Acad. Sci. USA 81: 3998 (1984)). Briefly, hundreds of overlapping short peptides, e.g., hexapeptides, can be synthesized covering the entire amino acid sequence of the target polypeptide (i.e., Mucorales CotH). The peptides while still attached to the solid support used for their synthesis are then tested for antigenicity by an ELISA method using a variety of antisera. Antiserum against Mucorales CotH protein can be obtained by known techniques, Kohler and Milstein, Nature 256: 495-499 (1975), and can be humanized to reduce antigenicity, see, for example, U.S. Pat. No. 5,693,762, or produced in transgenic mice leaving an unrearranged human immunoglobulin gene, see, for example, U.S. Pat. No. 5,877,397. Once an epitope bearing hexapeptide reactive with antibody raised against the intact protein is identified, the peptide can be further tested for specificity by amino acid substitution at every position and/or extension at both C and/or N terminal ends. Such epitope bearing polypeptides typically contain at least six to fourteen amino acid residues, and can be produced, for example, by polypeptide synthesis using methods well known in the art or by fragmenting an Mucorales CotH polypeptide. With respect to the molecule used as immunogens pursuant to the present invention, those skilled in the art will recognize that the Mucorales CotH polypeptide can be truncated or fragmented without losing the essential qualities as an immunogenic vaccine. For example, Mucorales CotH polypeptide can be truncated to yield an N-terminal fragment by truncation from the C-terminal end with preservation of the functional properties of the molecule as an immunogen. Similarly, C-terminal fragments can be generated by truncation from the N-terminal end with preservation of the functional properties of the molecule as an immunogen. Other modifications in accord with the teachings and guidance provided herein can be made pursuant to this invention to create other Mucorales CotH polypeptide functional fragments, immunogenic fragments, variants, analogs or derivatives thereof, to achieve the therapeutically useful properties described herein with the native protein.
[0133] The vaccine compositions of the invention further contain conventional pharmaceutical carriers. Suitable carriers are well known to those of skill in the art. These vaccine compositions can be prepared in liquid unit dose forms. Other optional components, e.g., pharmaceutical grade stabilizers, buffers, preservatives, excipients and the like can be readily selected by one of skill in the art. However, the compositions can be lyophilized and reconstituted prior to use. Alternatively, the vaccine compositions can be prepared in any manner appropriate for the chosen mode of administration, e.g., intranasal administration, oral administration, etc. The preparation of a pharmaceutically acceptable vaccine, having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
[0134] The immunogenicity of the vaccine compositions of the invention can further be enhanced if the vaccine further comprises an adjuvant substance. Various methods of achieving adjuvant effect for the vaccine are known. General principles and methods are detailed in "The Theory and Practical Application of Adjuvants", 1995, Duncan E. S. Stewart-Tull (ed.), John Wiley & Sons Ltd, ISBN 0-471-95170-6, and also in "Vaccines: New Generationn Immunological Adjuvants", 1995, Gregoriadis G et al. (eds.), Plenum Press, New York, ISBN 0-306-45283-9, both of which are hereby incorporated by reference herein.
[0135] Preferred adjuvants facilitate uptake of the vaccine molecules by antigen presenting cells (APCs), such as dendritic cells, and activate these cells. Non-limiting examples are selected from the group consisting of an immune targeting adjuvant; an immune modulating adjuvant such as a toxin, a cytokine, and a mycobacterial derivative; an oil formulation; a polymer; a micelle forming adjuvant; a saponin; an immunostimulating complex matrix (ISCOM.RTM. matrix); a particle; DDA (dimethyldioctadecylammonium bromide); aluminium adjuvants; DNA adjuvants; and an encapsulating adjuvant. Liposome formulations are also known to confer adjuvant effects, and therefore liposome adjuvants are included according to the invention.
[0136] In addition to vaccination of subjects susceptible to fungal infections such as mucormycosis, the vaccine compositions of the present invention can be used to treat, immunotherapeutically, subjects suffering from a variety of fungal infections. Accordingly, vaccines that contain one or more of Mucorales CotH polynucleotides, polypeptides and/or antibody compositions described herein in combination with adjuvants, and that act for the purposes of prophylactic or therapeutic use, are also within the scope of the invention. In an embodiment, vaccines of the present invention will induce the body's own immune system to seek out and inhibit Mucorales CotH molecules.
[0137] The term "vaccine", as used herein, refers to a composition that can be administered to an individual to protect the individual against an infectious disease. Vaccines protect against diseases by inducing or increasing an immune response in an animal against the infectious disease. An exemplary infectious disease amenable to treatment with the vaccines of the invention is mucormycosis. The vaccine-mediated protection can be humoral and/or cell mediated immunity induced in host when a subject is challenged with, for example, Mucorales CotH or an immunogenic portion or fragment thereof.
[0138] The term "adjuvant" is intended to mean a composition with the ability to enhance an immune response to an antigen generally by being delivered with the antigen at or near the site of the antigen. Ability to increase an immune response is manifested by an increase in immune mediated protection. Enhancement of humoral immunity can be determined by, for example, an increase in the titer of antibody raised to the antigen. Enhancement of cellular immunity can be measured by, for example, a positive skin test, cytotoxic T-cell assay, ELISPOT assay for IFN-gamma or IL-2. Adjuvants are well known in the art. Exemplary adjuvants include, for example, Freud's complete adjuvant, Freud's incomplete adjuvant, aluminum adjuvants, MF59 and QS21.
[0139] The term "treating" or "treatment," as it is used herein is intended to mean an amelioration of a clinical symptom indicative of a fungal condition. Amelioration of a clinical symptom includes, for example, a decrease or reduction in at least one symptom of a fungal condition in a treated individual compared to pretreatment levels or compared to an individual with a fungal condition. The term "treating" also is intended to include the reduction in severity of a pathological condition, a chronic complication or an opportunistic fungal infection which is associated with a fungal condition. Such pathological conditions, chronic complications or opportunistic infections are exemplified below with reference to mucormycosis. Mucormycosis and other such pathological conditions, chronic complications and opportunistic infections also can be found described in, for example, Merck Manual, Sixteenth Edition, 1992, and Spellberg et al., Clin. Microbio. Rev. 18:556-69 (2005).
[0140] The term "preventing" or "prevention," as it is used herein is intended to mean a forestalling of a clinical symptom indicative of a fungal condition. Such forestalling includes, for example, the maintenance of normal physiological indicators in an individual at risk of infection by a fungus or fungi prior to the development of overt symptoms of the condition or prior to diagnosis of the condition. Therefore, the term "preventing" includes the prophylactic treatment of individuals to guard them from the occurrence of a fungal condition. Preventing a fungal condition in an individual also is intended to include inhibiting or arresting the development of the fungal condition. Inhibiting or arresting the development of the condition includes, for example, inhibiting or arresting the occurrence of abnormal physiological indicators or clinical symptoms such as those described above and/or well known in the art. Therefore, effective prevention of a fungal condition would include maintenance of normal body temperature, weight, psychological state as well as lack of lesions or other pathological manifestations in an individual predisposed to a fungal condition. Individuals predisposed to a fungal condition include an individual who is immunocompromised, for example, but not limited to, an individual with AIDS, azotemia, diabetes mellitus, diabetic ketoacidosis, neutropenia, bronchiectasis, emphysema, TB, lymphoma, leukemia, or burns, or an individual undergoing chemotherapy, bone marrow-, stem cell- and/or solid organ transplantation or an individual with a history of susceptibility to a fungal condition. Inhibiting or arresting the development of the condition also includes, for example, inhibiting or arresting the progression of one or more pathological conditions, chronic complications or susceptibility to an opportunistic infection associated with a fungal condition.
[0141] A "subject," "individual" or "patient" is used interchangeably herein, and refers to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, rats, rabbits, simians, bovines, ovines, porcines, canines, felines, farm animals, sport animals, pets, equines, and primates, particularly humans.
[0142] The term "fungal condition" as used herein refers to fungal diseases, infection, or colonization including superficial mycoses (i.e., fungal diseases of skin, hair, nail and mucous membranes; for example, ringworm or yeast infection), subcutaneous mycoses (i.e., fungal diseases of subcutaneous tissues, fascia and bone; for example, mycetoma, chromomycosis, or sporotichosis), and systemic mycoses (i.e., deep-seated fungal infections generally resulting from the inhalation of air-borne spores produced by causal moulds; for example, zygomycosis, aspergillosis, cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis, paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis, penicilliosis or sporotrichosis.
[0143] As used herein, the term "zygomycosis" is intended to mean a fungal condition caused by fungi of the class Zygomycetes, comprised of the orders Mucorales and Entomophthorales. The Entomophthorales are causes of subcutaneous and mucocutaneous infections known as entomophthoromycosis, which largely afflict immunocompetent hosts in developing countries. Zygomycosis is also referred to as mucormycosis and the two terms are used interchangeably to refer to similar types of fungal infections.
[0144] As used herein, the term "mucormycosis" is intended to mean a fungal condition caused by fungi of the order Mucorales. Mucormycosis is a life-threatening fungal infection almost uniformly affecting immunocompromised hosts in either developing or industrialized countries. Fungi belonging to the order Mucorales are distributed into at least six families, all of which can cause cutaneous and deep infections. Species belonging to the family Mucoraceae are isolated more frequently from patients with mucormycosis than any other family. Among the Mucoraceae, Rhizopus oryzae (Rhizopus arrhizus) is a common cause of infection. Other exemplary species of the Mucoraceae family that cause a similar spectrum of infections include, for example, Rhizopus microsporus var. rhizopodiformis, Absidia corymbifera, Apophysomyces elegans, Mucor species, Rhizomucor pusillus and Cunninghamella spp (Cunninghamellaceae family). Mucormycosis is well known in the art and includes, for example, rinocerebral mucormycosis, pulmonary mucormycosis, gastrointestinal mucormycosis, disseminated mucormycosis, bone mucormycosis, mediastinum mucormycosis, trachea mucormycosis, kidney mucormycosis, peritoneum mucormycosis, superior vena cava mucormycosis or external otitis mucormycosis.
[0145] Fungi belonging to the order Mucorales are currently distributed into the families of Choanephoraceae; Cunninghamellaceae; Mucoraceae; Mycotyphaceae; Phycomycetaceae; Pilobolaceae; Saksenaeaceae; Syncephalastraceae; and Umbelopsidaceae. Each of these fungi families consists of one or more genera. For example, fungi belonging to the order Mucorales, family Mucoraceae, are further classified into the genera of Absidia (e.g., A. corymbifera); Actinomucor (e.g., A. elegans); Amylomyces (e.g., A. rouxii); Apophysomyces; Backusella (e.g., B. circina); Benjaminiella (e.g., B. multispora); Chaetocladium (e.g., C. brefeldii); Circinella (e.g., C. angarensis); Cokeromyces (e.g., C. recurvatus); Dicranophora (e.g., D. fulva); Ellisomyces (e.g., E. anomalus; Helicostylum (e.g., H. elegans); Hyphomucor (e.g., H. assamensis); Kirkomyces (e.g., K. cordensis); Mucor (e.g., M. amphibiorum); Parasitella (e.g., P. parasitica); Philophora (e.g., P. agaricina); Pilaira (e.g., P. anomala); Pirella (e.g., P. circinans); Rhizomucor (e.g., R. endophyticus); Rhizopodopsis (e.g., R. javensis); Rhizopus; Sporodiniella (e.g., S. umbellata); Syzygites (e.g., S. megalocarpus); Thamnidium (e.g., T. elegans); Thermomucor (e.g., T. indicae-seudaticae); and Zygorhynchus (e.g., Z. californiensis). The genus Rhizopus, for example, consists of R. azygosporus; R. caespitosus; R. homothallicus; R. oryzae; R. microsporus, R. microsporus var. rhizopodiformis and R. schipperae species.
[0146] The term "immunogenic amount" as used herein refers an effective amount of a particular epitope of a polypeptide of the invention or a fragment or variant thereof that can induce the host immune response against the polypeptide or the infectious agent expressing the polypeptide. This amount is generally in the range of 20 .mu.g to 10 mg of antigen per dose of vaccine and depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. The precise amount of immunogen required can be calculated by various methods such as, for example, antibody titration. The term effective amount refers to an amount of a compound or compositions that is sufficient to provide a desired result. Thus, as used to describe a vaccine, an effective amount refers to an amount of a compound or composition (e.g., an antigen) that is sufficient to produce or elicit a protective immune response. An effective amount with respect to an immunological composition is an amount that is sufficient to elicit an immune response, whether or not the response is protective.
[0147] The "therapeutically effective amount" will vary depending on the polypeptide, polynucleotide, antibody, antibody fragment or compositions, the disease and its severity and the age, weight, etc., of the patient to be treated all of which is within the skill of the attending clinician. It is contemplated that a therapeutically effective amount of one or more of a polynucleotide, polypeptide, antibody, antibody fragment or composition described herein will alter a fungal pathogen penetration through and damage of endothelial cells in the patient as compared to the absence of treatment. As such, fungal pathogenesis is decreased. A therapeutically effective amount is distinguishable from an amount having a biological effect (a "biologically effective amount"). A polypeptide, polynucleotide, antibody, antibody fragment or compositions of the present invention may have one or more biological effects in vitro or even in vivo, such as reducing function of a Mucorales CotH polypetide. A biological effect, however, may not result in any clinically measurable therapeutically effect as described herein as determined by methods within the skill of the attending clinician.
[0148] In one embodiment, nucleic acids encoding the invention Mucorales CotH polypeptides can be delivered into mammalian cells, either in vivo or in vitro using suitable vectors well-known in the art. Suitable vectors for delivering a Mucorales CotH polypeptide, an immunogenic fragment thereof, or a functional fragment thereof to a mammalian cell, include viral vectors such as retroviral vectors, adenovirus, adeno-associated virus, lentivirus, herpesvirus, as well as non-viral vectors such as plasmid vectors. Such vectors are useful for providing therapeutic or immunogenic amounts of a Mucorales CotH polypeptide (see, for example, U.S. Pat. No. 5,399,346, issued Mar. 21, 1995). Delivery of Mucorales CotH polypeptides or nucleic acids therapeutically can be particularly useful when targeted to a muscel cell, bone marrow cell or B-cell, thereby presenting the encoded mucorales CotH polypeptide for development of an immune response. Such presentation is commonly known in the art as a DNA vaccination.
[0149] Viral based systems provide the advantage of being able to introduce relatively high levels of the heterologous nucleic acid into a variety of cells. Suitable viral vectors for introducing invention nucleic acid encoding an Mucorales CotH protein into mammalian cells are well known in the art. These viral vectors include, for example, Herpes simplex virus vectors (Geller et al., Science, 241:1667-1669 (1988)); vaccinia virus vectors (Piccini et al., Meth. Enzymology, 153:545-563 (1987)); cytomegalovirus vectors (Mocarski et al., in Viral Vectors, Y. Gluzman and S. H. Hughes, Eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1988, pp. 78-84)); Moloney murine leukemia virus vectors (Danos et al., Proc. Natl. Acad. Sci. USA, 85:6460-6464 (1988); Blaese et al., Science, 270:475-479 (1995); Onodera et al., J. Virol., 72:1769-1774 (1998)); adenovirus vectors (Berkner, Biotechniques, 6:616-626 (1988); Cotten et al., Proc. Natl. Acad. Sci. USA, 89:6094-6098 (1992); Graham et al., Meth. Mol. Biol., 7:109-127 (1991); Li et al., Human Gene Therapy, 4:403-409 (1993); Zabner et al., Nature Genetics, 6:75-83 (1994)); adeno-associated virus vectors (Goldman et al., Human Gene Therapy, 10:2261-2268 (1997); Greelish et al., Nature Med., 5:439-443 (1999); Wang et al., Proc. Natl. Acad. Sci. USA, 96:3906-3910 (1999); Snyder et al., Nature Med., 5:64-70 (1999); Herzog et al., Nature Med., 5:56-63 (1999)); retrovirus vectors (Donahue et al., Nature Med., 4:181-186 (1998); Shackleford et al., Proc. Natl. Acad. Sci. USA, 85:9655-9659 (1988); U.S. Pat. Nos. 4,405,712, 4,650,764 and 5,252,479, and WIPO publications WO 92/07573, WO 90/06997, WO 89/05345, WO 92/05266 and WO 92/14829; and lentivirus vectors (Kafri et al., Nature Genetics, 17:314-317 (1997)).
[0150] Vectors useful for therapeutic administration of a Mucorales CotH polypeptide of nucleic acid can contain a regulatory element that provides tissue specific or inducible expression of an operatively linked nucleic acid. One skilled in the art can readily determine an appropriate tissue-specific promotor or enhancer that allows expression of a Mucorales CotH polypeptide or nucleic acid in a desired tissue or cell. Any of a variety of inducible promoters or enhancers can also be included in the vector for regulatable expression of a Mucorales CotH polypeptide or nucleic acid. Such inducible systems, include, for example, tetracycline inducible system (Gossen & Bizard, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992); Gossen et al., Science, 268:1766-1769 (1995); Clontech, Palo Alto, Calif.); metalothionein promoter induced by heavy metals; insect steroid hormone responsive to ecdysone or related steroids such as muristerone (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996); Yao et al., Nature, 366:476-479 (1993); Invitrogen, Carlsbad, Calif.); mouse mammary tumor virus (MMTV) induced by steroids such as glucocorticoid and estrogen (Lee et al., Nature, 294:228-232 (1981); and heat shock promoters inducible by temperature changes.
[0151] An inducible system particularly useful for therapeutic administration utilizes an inducible promotor that can be regulated to deliver a level of therapeutic product in response to a given level of drug administered to an individual and to have little or no expression of the therapeutic product in the absence of the drug. One such system utilizes a Gal4 fusion that is inducible by an antiprogestin such as mifepristone in a modified adenovirus vector (Burien et al., Proc. Natl. Acad. Sci. USA, 96:355-360 (1999). Another such inducible system utilizes the drug rapamycin to induce reconstitution of a transcriptional activator containing rapamycin binding domains of FKBP12 and FRAP in an adeno-associated virus vector (Ye et al., Science, 283:88-91 (1999)). It is understood that any combination of an inducible system can be combined in any suitable vector, including those disclosed herein. Such a regulatable inducible system is advantageous because the level of expression of the therapeutic product can be controlled by the amount of drug administered to the individual or, if desired, expression of the therapeutic product can be terminated by stopping administration of the drug.
[0152] The invention additionally provides an isolated anti-Mucorales CotH antibody having specific reactivity with a Mucorales CotH polypeptide, an immunogenic fragment thereof, or functional fragment thereof. For example, an anti-Mucorales CotH antibody of the invention can have specific reactivity to a polypeptide having the amino acid sequence GAGKKHNNAKQSWNW (SEQ ID NO: 39) or MGQTNDGAYRDPTDNNK (SEQ ID NO: 40). The anti-Mucorales CotH antibody can be a monoclonal antibody or a polyclonal antibody. The invention further provides cell lines producing monoclonal antibodies having specific reactivity with a Mucorales CotH polypeptide, an immunogenic fragment thereof, or functional fragment thereof.
[0153] The invention thus provides antibodies that specifically bind a Mucorales CotH polypeptide. As used herein, the term "antibody" is used in its broadest sense to include polyclonal and monoclonal antibodies, as well as antigen binding fragments of such antibodies. With regard to an anti-Mucorales CotH antibody of the invention, the term "antigen" means a native or synthesized Mucorales CotH polypeptide or fragment thereof. An anti-Mucorales CotH antibody, or antigen binding fragment of such an antibody, is characterized by having specific binding activity for a Mucorales CotH polypeptide or a peptide portion thereof of at least about 1.times.10.sup.5 M.sup.-1. Thus, Fab, F(ab').sub.2, Fd and Fv fragments of an anti-Mucorales CotH antibody, which retain specific binding activity for a Mucorales CotH polypeptide, are included within the definition of an antibody. Specific binding activity of a Mucorales CotH polypeptide can be readily determined by one skilled in the art, for example, by comparing the binding activity of an anti-Mucorales CotH antibody to a Mucorales CotH polypeptide versus a control polypeptide that is not a Mucorales CotH polypeptide. Methods of preparing polyclonal or monoclonal antibodies are well known to those skilled in the art (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988)).
[0154] In addition, antibodies of the invention can be naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, as well as antigen-binding fragments thereof. Such non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantly or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as described by Huse et al. (Huse et al., Science 246:1275-1281 (1989)). These and other methods of making, for example, chimeric, humanized, CDR-grafted, single chain, and bifunctional antibodies are well known to those skilled in the art (Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature 341:544-546 (1989); Harlow and Lane, supra, 1988); Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); Borrabeck, Antibody Engineering, 2d ed. (Oxford University Press 1995)).
[0155] Anti-Mucorales CotH antibodies can be raised using a Mucorales CotH immunogen such as an isolated Mucorales CotH polypeptide having the amino acid sequence of SEQ ID NOS: 1, 3, 5, 11, 15, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or an immunogenic fragment thereof, which can be prepared from natural sources or produced recombinantly, or a peptide portion of the Mucorales CotH polypeptide. Such peptide portions of a Mucorales CotH polypeptide are functional antigenic fragments if the antigenic peptides can be used to generate a Mucorales CotH-specific antibody. A non-immunogenic or weakly immunogenic Mucorales CotH polypeptide or portion thereof can be made immunogenic by coupling the hapten to a carrier molecule such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Accordingly, in some aspects of the invention, an immunogenic fragment of the CotH polypeptides disclosed herein can be conjugated to a carrier molecule, such as, but not limited to KLH or BSA. Various other carrier molecules and methods for coupling a hapten to a carrier molecule are well known in the art (see, for example, Harlow and Lane, supra, 1988). An immunogenic Mucorales CotH polypeptide fragment can also be generated by expressing the peptide portion as a fusion protein, for example, to glutathione S transferase (GST), polyHis or the like. Methods for expressing peptide fusions are well known to those skilled in the art (Ausubel et al., supra).
[0156] The invention further provides a method for detecting the presence of a Mucorales organism in a sample by contacting a sample with a Mucorales CotH-specific antibody, and detecting the presence of specific binding of the antibody to the sample, thereby detecting the presence of a Mucorales CotH polypeptide in the sample. Mucorales CotH specific antibodies can be used in diagnostic methods and systems to detect the level of Mucorales CotH present in a sample. As used herein, the term "sample" is intended to mean any biological fluid, cell, tissue, organ or portion thereof, that includes or potentially includes Mucorales CotH nucleic acids or polypeptides. The term includes samples present in an individual as well as samples obtained or derived from the individual. For example, a sample can be a histologic section of a specimen obtained by biopsy, or cells that are placed in or adapted to tissue culture. A sample further can be a subcellular fraction or extract, or a crude or substantially pure nucleic acid or protein preparation.
[0157] Mucorales CotH-specific antibodies can also be used for the immunoaffinity or affinity chromatography purification of the invention Mucorales CotH. In addition, methods are contemplated herein for detecting the presence of an invention Mucorales CotH protein in a cell, comprising contacting the cell with an antibody that specifically binds to Mucorales CotH polypeptides under conditions permitting binding of the antibody to the Mucorales CotH polypeptides, detecting the presence of the antibody bound to the Mucorales CotH polypeptide, and thereby detecting the presence of invention polypeptides in a cell. With respect to the detection of such polypeptides, the antibodies can be used for in vitro diagnostic or in vivo imaging methods.
[0158] Immunological procedures useful for in vitro detection of target Mucorales CotH polypeptides in a sample include immunoassays that employ a detectable antibody. Such immunoassays include, for example, immunohistochemistry, immunofluorescence, ELISA assays, radioimmunoassay, FACS analysis, immunoprecipitation, immunoblot analysis, Pandex microfluorimetric assay, agglutination assays, flow cytometry and serum diagnostic assays, which are well known in the art (Harlow and Lane, supra, 1988; Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1999)).
[0159] An antibody can be made detectable by various means well known in the art. For example, a detectable marker can be directly attached to the antibody or indirectly attached using, for example, a secondary agent that recognizes the Mucorales CotH specific antibody. Useful markers include, for example, radionucleotides, enzymes, binding proteins such as biotin, fluorogens, chromogens and chemiluminescent labels.
[0160] As used herein, the terms label and indicating means in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
[0161] The labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer. A description of immunofluorescent analytic techniques is found in DeLuca, "Immunofluorescence Analysis", in Antibody As a Tool, Marchalonis et al., eds., John Wiley & Sons, Ltd., pp. 189-231 (1982), which is incorporated herein by reference.
[0162] In one embodiment, the indicating group is an enzyme, such as horseradish peroxidase (HRP), glucose oxidase, and the like. In another embodiment, radioactive elements are employed labeling agents. The linking of a label to a substrate, i.e., labeling of nucleic acid probes, antibodies, polypeptides, and proteins, is well known in the art. For instance, an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al., Meth. Enzymol., 73:3-46 (1981). Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable. See, for example, Aurameas et al., Scand. J. Immunol., Vol. 8, Suppl. 7:7-23 (1978), Rodwell et al., Biotech., 3:889-894 (1984), and U.S. Pat. No. 4,493,795.
[0163] Invention nucleic acids, oligonucleotides, including antisense, vectors containing invention nucleic acids, transformed host cells, polypeptides and combinations thereof, as well as antibodies of the present invention, can be used to screen compounds to determine whether a compound functions as a potential agonist or antagonist of invention polypeptides. These screening assays provide information regarding the function and activity of invention polypeptides, which can lead to the identification and design of compounds that are capable of specific interaction with one or more types of polypeptides, peptides or proteins.
[0164] Thus, the invention provides methods for identifying compounds which bind to Mucorales CotH polypeptides. The invention proteins can be employed in a competitive binding assay. Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to Mucorales CotH polypeptides. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention Mucorales CotH polypeptides. Compounds that bind to and/or modulate invention Mucorales CotH polypeptides can be used to treat a variety of pathologies mediated by invention Mucorales CotH polypeptides.
[0165] Various binding assays to identify cellular proteins that interact with protein binding domains are known in the art and include, for example, yeast two-hybrid screening assays (see, for example, U.S. Pat. Nos. 5,283,173, 5,468,614 and 5,667,973; Ausubel et al., supra, 1999; Luban et al., Curr. Opin. Biotechnol. 6:59-64 (1995)) and affinity column chromatography methods using cellular extracts. By synthesizing or expressing polypeptide fragments containing various Mucorales CotH sequences or deletions, the Mucorales CotH binding interface can be readily identified.
[0166] In another embodiment of the invention, there is provided a bioassay for identifying compounds which modulate the activity of invention Mucorales CotH polypeptides. According to this method, invention polypeptides are contacted with an "unknown" or test substance, for example, in the presence of a reporter gene construct responsive to a Mucorales CotH signaling pathway, the activity of the polypeptide is monitored subsequent to the contact with the "unknown" or test substance, and those substances which cause the reporter gene construct to be expressed are identified as functional ligands for Mucorales CotH polypeptides. Such reporter gene assays and systems are well known to those skilled in the art (Ausubel et al., supra, 1999). In addition, a reporter gene constrict can be generated using the promoter region of Mucorales CotH and screened for compounds that increase or decrease Mucorales CotH gene promoter activity. Such compounds can also be used to alter Mucorales CotH expression.
[0167] In accordance with another embodiment of the present invention, transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect(s) thereof can then be evaluated by comparing the Mucorales CotH-mediated response, for example, via reporter gene expression in the presence and absence of test compound, or by comparing the response of test cells or control cells, to the presence of the compound.
[0168] As used herein, a compound or a signal that modulates the activity of invention polypeptides refers to a compound or a signal that alters the activity of Mucorales CotH polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal. In particular, such compounds or signals include agonists and antagonists. An agonist encompasses a compound or a signal that activates Mucorales CotH protein expression or biological activity. Alternatively, an antagonist includes a compound or signal that interferes with Mucorales CotH expression or biological activity. Typically, the effect of an antagonist is observed as a blocking of agonist-induced protein activation. Antagonists include competitive and non-competitive antagonists.
[0169] Assays to identify compounds that modulate Mucorales CotH polypeptide expression can involve detecting a change in Mucorales CotH polypeptide abundance in response to contacting the cell with a compound that modulates Mucorales CotH activity. Assays for detecting changes in polypeptide expression include, for example, immunoassays with Mucorales CotH-specific Mucorales CotH antibodies, such as immunoblotting, immunofluorescence, immunohistochemistry and immunoprecipitation assays, as described above.
[0170] As understood by those of skill in the art, assay methods for identifying compounds that modulate Mucorales CotH activity generally require comparison to a control. One type of a "control" is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound. Another type of "control" cell or culture can be a cell or culture that is identical to the test cells, with the exception that the "control" cells or culture do not express a Mucorales CotH polypeptide. Accordingly, the response of the transfected cell to a compound is compared to the response, or lack thereof, of the "control" cell or culture to the same compound under the same reaction conditions.
[0171] The invention further provides a method for modulating an activity mediated by a Mucorales CotH polypeptide by contacting the Mucorales CotH polypeptide with an effective, modulating amount of an agent that modulates Mucorales CotH activity. The Mucorales CotH activity can be, for example, binding to GRP78. The invention additionally provides a method of modulating the level of adhesion to a cell.
[0172] In some embodiment, the invention provides a method of detecting a Mucorales CotH nucleic acid molecule in a sample. Such methods of the invention can include the steps of contacting a sample with two or more oligonucleotides disclosed herein, amplifying a nucleic acid molecule, and detecting the amplification. It is understood that methods for amplifying a nucleic acid are well known to one of skill in the art, which can be readily selected and applied to the methods of the invention. For example, in some aspects, the amplification is performed using polymerase chain reaction (PCR). In some aspects of the invention, at least one of the two or more oligonucleotides used in the method of the invention includes an oligonucleotide having the nucleic acid sequence of ATGAAATTATCTATTATATCCGCTGCC (SEQ ID NO: 33), GCTGGGAATATAATTGTCATCGA (SEQ ID NO: 34), GATGACAATTATATTCCCAGC (SEQ ID NO: 35), GAGTAGACGTAATTAGATCCAA (SEQ ID NO: 36), AAACGTACCTGCTGACCGAATC (SEQ ID NO: 37) or any oligonucleotide disclosed herein.
[0173] The invention further provides a method of diagnosing mucormycosis infection in a subject by detecting the presence of a Mucorales organism in a sample from the patient. The method can include the steps of (a) providing a test sample from the subject; (b) contacting the sample with an agent that can binds a nucleic acid or a polypeptide of the invention under suitable conditions, wherein the conditions allow specific binding of the agent to the nucleic acid or polypeptide; and (c) comparing the amount of the specific binding in the test sample with the amount of specific binding in a control sample, wherein an increased or decreased amount of the specific binding in the test sample as compared to the control sample is diagnostic of mucormycosis infection. In some aspects of the invention, the agent is selected from the group consisting of an anti-Mucorales CotH antibody or a CotH oligonucleotide as described herein.
[0174] In accordance with another embodiment of the present invention, there are provided diagnostic systems, preferably in kit form, comprising at least one invention nucleic acid or antibody in a suitable packaging material. The diagnostic kits containing nucleic acids are derived from the Mucorales CotH-encoding nucleic acids described herein. In one embodiment, for example, the diagnostic nucleic acids are derived from any of SEQ ID NOS: 2, 4, 6, 9, 10, 12-14, 17, 19, 21, 23, 25, 27, 29 or 31 and can be oligonucleotides of the invention. In some aspects of the invention, at least one oligonucleotide comprises a nucleic acid sequence selected from ATGAAATTATCTATTATATCCGCTGCC (SEQ ID NO: 33), GCTGGGAATATAATTGTCATCGA (SEQ ID NO: 34), GATGACAATTATATTCCCAGC (SEQ ID NO: 35), GAGTAGACGTAATTAGATCCAA (SEQ ID NO: 36), AAACGTACCTGCTGACCGAATC (SEQ ID NO: 37) or any oligonucleotide disclosed herein. Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding Mucorales CotH in either genomic DNA or mRNA.
[0175] A suitable diagnostic system includes at least one invention nucleic acid or antibody, as a separately packaged chemical reagent(s) in an amount sufficient for at least one assay. For a diagnostic kit containing nucleic acid of the invention, the kit will generally contain two or more nucleic acids. When the diagnostic kit is to be used in PCR, the kit will contain at least two oligonucleotides that can serve as primers for PCR. Those of skill in the art can readily incorporate invention nucleic probes and/or primers or invention antibodies into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein. A kit containing a Mucorales CotH antibody can contain a reaction cocktail that provides the proper conditions for performing an assay, for example, an ELISA or other immunoassay, for determining the level of expression of a Mucorales CotH polypeptide in a sample, and can contain control samples that contain known amounts of a Mucorales CotH polypeptide and, if desired, a second antibody specific for the anti-Mucorales CotH antibody.
[0176] The contents of the kit of the invention, for example, Mucorales CotH nucleic acids or antibodies, are contained in packaging material, preferably to provide a sterile, contaminant-free environment. In addition, the packaging material contains instructions indicating how the materials within the kit can be employed both to detect the presence or absence of a particular Mucorales CotH sequence or Mucorales CotH polypeptide or to diagnose the presence of, or a predisposition for a condition associated with mucormycosis. The instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
[0177] It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also provided within the definition of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.
EXAMPLES
Example I
Cell Surface CotH3 Protein Facilitates Binding to Host GRP78 During Fungal Invasion of Endothelial Cells
[0178] Cell wall material was collected from supernatants of protoplasts of R. oryzae germlings. R. oryzae ligands bound to rGrp78 were isolated by FAR Western blot analysis using anti-Grp78 Ab and identified by MALDI-TOF-MS/MS analysis (FIG. 1). Briefly, protein spots of interest were excised and sent to the UCLA W. M. Keck Proteomic Center for identification on a Thermo LTQ-Orbitrap XL mass spectrometer (San Jose, Calif.) equipped with an Eksigent (Dublin, Calif.) NanoLiquid chromatography-1D plus system and an Eksigent autosampler. Proteins within the spots were in-gel tryptic digested as described by Shevchenko et al. (Shevchenko et al. (1996). Proc Natl Acad Sci USA 93: 14440-14445; Shevchenko et al., Anal. Chem., 68(5):850-8 (1996)). The eluted peptides were loaded onto a CVC Microtech (Fontana, Calif.) 35 mm length, 100 .mu.m ID C18 pre-Trap column and washed for 10 min with 100% Buffer A (2% acetonitrile containing 0.1% formic acid) at a flow rate of 5 .mu.l/min. The peptides were separated on a 15 cm New Objective ProteoPep IntegraFrit column (Woburn, Mass.) using a flow rate of 300 nl/min. The following elution gradient was used: 0-15 min 0-30% Buffer B (98% acetonitrile containing 0.1% formic acid), 15-20 min 30-80% Buffer B and 20-22 min 80% Buffer B. The column was then re-equilibrated for 13 min with Buffer A. The eluting analytes were sprayed in positive mode into the LTQ-Orbitrap MS using electrospray ionization voltage of 2300 V, capillary voltage of 45 V, tube lens of 130 V, and capillary temperature of 200.degree. C. Information dependent acquisition was performed where the 6 most intense ions were selected in the m/z range of 300-1600 using a 60 K resolution FTMS scan and subjecting them to MS-MS using broadband collision induced disassociation of normalized collision energy of 35 and LTQ detection. Peaks were excluded from further MS-MS for a period of 60 sec.
[0179] The resulting MS/MS spectra was searched against the Rhizopus oryzae 99-880 database (http://www.broadinstitute.org/annotation/genome/rhizopus_oryzae/MultiHom- e.html) using the Matrix Science MASCOT Daemon search engine (Boston, Mass.). The following search parameters were used: peptide tolerance: .+-.10 ppm, MS/MS tolerance .+-.0.3 Da, maximum missed cleavages: 2, fixed modifications: carboxymethyl (C) and variable modifications: deamidization (ND) and oxidation (M). Proteins identified within a particular included those with a minimum of two unique peptides that are ranked as number 1 and with an ion scores with a p<0.05.
[0180] Expression of the putative ligands in R. oryzae incubated with endothelial cells was detected by RT-PCR (FIG. 4). Interaction of the ligand with GRP78 was confirmed by heterologously expressing the ligand in Saccharomyces cerevisiae (FIG. 6) and comparing its adherence to and invasion of endothelial cells and CHO cells overexpressing GRP78 to S. cerevisiae transformed with empty plasmid (control) (FIG. 8).
[0181] Three of the ORF had homology to CotH family of proteins implicated in spore coat formation from several bacteria:
[0182] RO3G_05018, CotH1
[0183] RO3G_08029, CotH2
[0184] RO3G_11882, CotH3
[0185] A fourth ORF (RO3G_16295) is widely present in other pathogenic fungi, but none of these ORFs appear to encode a protein that has an identified function. As sequence comparison between the identified CotH polypeptides and other bacterial CotH proteins shows very little sequence identity (FIG. 17 and Table 1).
TABLE-US-00001 TABLE 1 Sequence similarity of Rhizopus CotH and bacterial CotH (different sizes) Flammeovirga Desulfotomaculum Bacillus Bacillus yaeyamensis reducens amyloliquefaciens cereus (ACY02060) (YP_001112853) (YP_001422883) (ZP_04217292) RO3G_05018 18.5 13.6 12.9 14.5 RO3G_08029 18.6 15.8 13.8 13.6 RO3G_11882 18 14.1 13 13.6
[0186] RO3G_16295 appears to be a common protein, it's homologues (usually .about.25% identity at amino acid) can be seen from many different fungi as well as a few bacteria (FIGS. 18-26). All these proteins are not characterized. To name a few:
[0187] Talaromyces stipitatus ATCC 10500 (EED23986);
[0188] Penicillium marneffei ATCC 18224 (XP_002144175);
[0189] Aspergillus niger (XP_001392236);
[0190] Aspergillus nidulans (XP_658934);
[0191] Ustilago maydis (XP_760027);
[0192] Coccidioides immitis (XP_001243211);
[0193] Neurospora crassa (XP_956792);
[0194] Cryptococcus neoformans (XP_775558); and
[0195] Streptomyces lividans (EFD65170).
[0196] CotH3 and to a lesser extent CotH2 were expressed in R. oryzae germlings interacting with human umbilical vein endothelial cells (FIG. 4). CotH1 was expressed by R. oryzae spores but not germlings interacting with endothelial cells (FIG. 3). Although FAR-Western analysis identified the 4th ORF (RO3G_16295), this gene was not expressed by R. oryzae germlings interacting with endothelial cells. S. cerevisiae expressing CotH3, and to a lesser extent CotH2, specifically bound endothelial cell GRP78 (FIG. 6). Heterologous expression of CotH3 in the non-adherent S. cerevisiae promoted adherence and subsequent invasion of endothelial cells and CHO cells overexpressing GRP78 (FIG. 58). A sequence alignment between CotH3 polypeptides from various Mucorales species show an >90% sequence identity between the various species (FIG. 7 and Table 2)
[0197] These results show that R. oryzae invasion of endothelial cells is facilitated by CotH3, or CotH2 binding to GRP78.
TABLE-US-00002 TABLE 2 Alignamaent of Nucleotide (CotH3 and other genera exons only) R. R. oryzae oryzae Mucor Absidia Cunninghamela R. CotH 3 99-880 99-892 99-932 Corymbifera bertholetiae microsporus R. oryzae .sup. 100% 95.82 96.42% 99.34% 97.80% 99.94 99-880 R. oryzae 95.82 .sup. 100% 100.00% 96.53% 94.51% 96.47% 99-892 Mucor 96.42% 100.00% .sup. 100% 96.53% 94.51% 96.47% 99-932 Absidia 99.34% 96.53% 96.53% .sup. 100% 97.36% 99.39% Corymbifera Cunninghamela 97.80% 94.51% 94.51% 97.36% .sup. 100% 97.85% bertholetiae R. microsporus 99.94 96.47% 96.47% 99.39% 97.85% .sup. 100%
Example II
CotH3 and CotH2 are Unique Mucorales Invasins that Bind to Endothelial Cell GRP78
[0198] R. oryzae and Culture Conditions
[0199] Several clinical Mucorales isolates were used in the experiments disclosed herein. For example, R. oryzae 99-880 and Mucor sp. 99-932 were isolated from brain samples, whereas R. oryzae 99-892 and Rhizopus sp 99-1150 were isolated from lungs samples of infected patients (samples were obtained from the Fungus Testing Laboratory, University of Texas Health Science Center at San Antonio). Cunninghamella bertholletiae 182 is also a clinical isolate, which was a kind gift from Dr. Tomas Walsh (NIH). Lichtheimia corymbifera is also a clinical isolate obtained from the DEFEAT Mucor clinical study (Spellberg et al. (2102), J Antimicorbiol Chemother 67(3):715-22).
[0200] Mucorales were grown on potato dextrose agar (PDA, BD Diagnostic) plates for 3-5 days at 37.degree. C., while A. fumigatus and C. albicans were grown on Sabouraud dextrose agar (SDA) plates for 2 weeks and 48 h at 37.degree. C., respectively. The sporangiospores were collected in endotoxin free Dulbecco's phosphate buffered saline (PBS) containing 0.01% Tween 80, washed with PBS, and counted with a hemocytometer to prepare the final inocula. For C. albicans, blastospores were collected in PBS after growing the organisms in YPD medium [1% yeast extract (Difco Laboratories), 2% bacto-peptone (Difco) and 2% glucose (Sigma)] at 30.degree. C. for overnight. To form germlings, spores were incubated in liquid YPD medium at 37.degree. C. with shaking for 1-3 h based on the assay under study. Germlings were washed twice with RPMI 1640 without glutamine (Irvine Scientific) for all assays used except for isolating the endothelial cell receptor experiments in which the germlings were washed twice with PBS (plus Ca.sup.2+ and Mg.sup.2+).
Heterologous Expression of CotH Genes in S. cerevisiae
[0201] The entire ORF of CotH1, CotH2, and CotH3 were PCR amplified from cDNA extracted from R. oryzae spores grown on PDA plates by using Phusion high fidelity PCR Kit (New England Biolabs) and the primers listed in Table 3. The pESC-LEU yeast dual expression vector (Stratagene) was used to clone and express these genes under the Gall promoter. The vector was digested with BamHI and SalI. PCR amplified inserts from each of the CotH genes were cloned into pESC-LEU by using In-Fusion 2.0 Dry-Down PCR Cloning Kit, per the manufacturer's instructions (Clontech Laboratories). The generated yeast expression vectors were independently transformed into yeast strain LL-20 by the polyethylene glycol-LiOAc method, and transformants were screened on the solid synthetic dextrose minimal medium lacking leucine. S. cerevisiae transformed with the empty plasmid served as control.
TABLE-US-00003 TABLE 3 Primers used in this study Primer Sequences (SEQ ID NOS 41-64, respectively, in Primer Name order of appearance) Reaction/Use CotH1-F AAAAAACCCCGGATCCTATGAAATCCC RT-PCR and to clone CotH1 in TACTTTTTGTTGTATTC to expression vector pESC-Leu CotH1-R TCTGTTCCATGTCGACCTAGAAGAAAG RT-PCR and to clone CotH2 in AGGCAAATAAAGTGC to expression vector CotH2-F AAAAACCCCGGATCCTATGAAATTATC RT-PCR to clone CotH3 in to ACTCACTATAGTATCCTCT expression vector CotH2-R TCTGTTCCATGTCGACTTAAAAGATAG RT-PCR to clone CotH3 in to CAGTGGCAACTAAAG expression vector CotH3-F AAAAAACCCCGGATCCTATGAAATTAT RT-PCR to clone CotH3 in to CTATTATATCCGCTGCC expression vector CotH3-R TCTGTTCCATGTCGACTTAGAATACAA Detection in mucorales GGAGAGCTAAAGCG Ligand#4-F AAAAAACCCCGGATCCTATGATTGCTA RT-PCR RO3G_16295 CCCCTTTTGAAA Ligand#4-R TCTGTTCCATGTCGACTTAAAAGAAAA RT-PCR RO3G_16295 TAAAGAATGTTGCAGC CotH3-F-ORF ATGAAATTATCTATTATATCCGCTGCC Detection IN OTHER MUCORALS1.9Kb CotH3-R-ORF TTAGAATACAAGGAGAGCTAAAGCG Detection IN OTHER MUCORALS1.9Kb RNAi-cotHF-F GCATGCTAGAACAGAAGAAAGTTTTGA RNAi-forward TCGTTC RNAi-ccoHF-R GTACGACGTTCACGAATCTGTGTAGG RNAi-forward RNAi-I-F CCGCGGGACGTTCACGAATCTGTGTAG RNAi-Reverse G RNAi-I-R GCTAGCAGAACAGAAGAAAGTTTTGAT RNAi-Reverse CGTTC CotH1-F CAAACAAATGATGGGGCCTA qRT-PCR for Expression CotH1-R CGTTTTTGTTCAAGATTTACACCA qRTPCR for Expression CotH2-F CCTAATAAGGACAACGCAAACG qRT-PCR for Expression CotH2-R TTGGCAATGGCTGTGTTATC qRT-PCR for Expression CotH3-F GCCAATCCTAATGGTGAAGC qRT-PCR for Expression CotH3-R CATGAAACGGTCGAGATCAA qRT-PCR for Expression RO Actin-F AGCTCCTTTGAACCCCAAGT qRT-PCR for Expression RO Actin-R ACGACCAGAGGCATACAAGG qRT-PCR for Expression RO 18sRNA-F GCGGATCGCATGGCC qRTPCR for CFU RO 18sRNA-R CCATGATAGGGCAGAAAATCG qRTPCR for CFU
Anti-CotH Antibody Production and Cell Surface Localization
[0202] Rabbit polyclonal antibodies were raised against two peptides predicted to be antigenic. The peptides GAGKKHNNAKQSWNW (SEQ ID NO: 39), and MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) were coupled with KLH and used to commercially vaccinate rabbits (ProMab Biotechnologies Inc., Richmond, Calif.). Purified IgG from the vaccinated rabbits were used to detect cell surface localization of CotH proteins on S. cerevisiae and on R. oryzae interacting with endothelial cells (Liu et al., J. Clin. Invest., 120:1914-1924 (2010)).
[0203] For localizing the CotH proteins to the cell surface of S. cerevisiae, blastospores expressing individual CotH genes were incubated first with the anti-CotH IgG at 1:50, followed by fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG at 1:100. The stained cells were imaged with Leica confocal microscope and the entire yeast cells were visualized with differential interference contract (DIC).
[0204] For detecting the expression of the CotH proteins on R. oryzae, spores were germinated in YPD for 3 hours at 37.degree. C. Germlings were stained with the anti-CotH IgG at 1:50, followed by FITC-labeled goat anti-rabbit IgG at 1:100. A FACSCalibur (Becton Dickinson) instrument equipped with an argon laser emitting at 488 nm was used for flow cytometric analysis. Fluorescence emission was read with a 515/40 bandpass filter. Fluorescence data were collected with logarithmic amplifiers. The mean fluorescence intensities of 10.sup.4 events were calculated using the CELLQUEST software.
Endothelial Cells and Chinese Hamster Ovary (CHO) Cells
[0205] Endothelial cells were collected from umbilical vein endothelial cells by the method of Jaffe et al. (Jaffe et al., J. Clin. Invest. 52:2745-2756 (1973)). The cells were harvested by using collagenase and were grown in M-199 (Gibco BRL) enriched with 10% fetal bovine serum, 10% defined bovine calf serum, L-glutamine, penicillin, and streptomycin (all from Gemini Bio-Products, CA). Second-passage cells were grown to confluency in 96-well tissue culture plates (Costar, Van Nuys, Calif.) on fibronectin (BD Biosciences). All incubations were in 5% CO.sub.2 at 37.degree. C. The reagents were tested for endotoxin using a chromogenic limulus amebocyte lysate assay (BioWhittaker, Inc., Walkersville, Md.), and the endotoxin concentrations were less than 0.01 IU/ml. Endothelial cell collection was approved by Institutional Review Board at Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center. CHO cell line C.1 which was derived from parental DHFR-deficient CHO cells engineered to overexpress GRP78s were kind gifts of Dr. Randall Kaufman (Morris et al., J. Biol. Chem., 272:4327-4334 (1997); Reddy et al., J. Biol. Chem., 278:20915-20924 (2003)).
Extraction of Endothelial Cell Membrane Proteins
[0206] Endothelial cell membrane proteins were extracted according to the method of Isberg and Leong (Isberg and Leong, Cell 60:861-871 (1990)). Briefly, confluent endothelial cells in 100-mm diameter tissue culture dishes were rinsed twice with warm DPBS containing Ca.sup.2+ and Mg.sup.2+ (PBS-CM) and then incubated with Ez-Link Sulfo-NHS-LS Biotin (0.5 mg/ml, Pierce) in PBS-CM for 12 min at 37.degree. C. in 5% CO.sub.2. The cells were then rinsed extensively with cold PBS-CM and scraped from the tissue culture dishes. The endothelial cells were collected by centrifugation at 500.times.g for 5 min at 4.degree. C. and then lysed by incubation for 20 min on ice in PBS-CM containing 5.8% n-octyl- -D-glucopyranoside (w/v) (Cal BioChem) and protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 .mu.g/ml pepstatin A, 1 .mu.g/ml leupeptin, and 1 .mu.g/ml aprotinin) (Sigma). The cell debris was removed by centrifugation at 5000.times.g for 5 min at 4.degree. C. The supernatant was collected and centrifuged at 100,000.times.g for 1 h at 4.degree. C. The concentration of the endothelial cell proteins in the resulting supernatant was determined using Bradford method (Bio-Rad).
RNA Interference of CotH2/CotH3
[0207] Previously described RNA interference (RNAi) technology (Ibrahim et al., Mol. Microbiol., 77:587-604 (2010)) was utilized to inhibit the expression of CotH2 and CotH3 in R. oryzae. A 450 bp fragment commonly shared between CotH2 and CotH3 ORF was PCR amplified and cloned as an inverted repeat under control of the Rhizopus expression vector pPdcA-Ex (Mertens et al., Archives of microbiology 186:41-50 (2006)). Additionally, an intron from the Rhizopus pdcA gene (Skory, Curr. Microbiol., 47: 59-64 (2003)) was included between repeat to serve as a linker for stabilization of the intended dsRNA structure (Nakayashiki et al., Fungal Genet. Biol., 42:275-283 (2005); Wesley et al., Plant J., 27:581-590 (2001)). The generated plasmid was transformed into R. oryzae pyrF mutant using the biolistic delivery system (Skory, Mol. Genet. Genomics 268: 397-406 (2002)) (BioRad) and transformants were selected on minimal medium lacking uracil.
Binding of GRP78 by S. cerevisiae Expressing CotH.
[0208] S. cerevisiae cells (8.times.10.sup.8) expressing CotH1, CotH2, CotH3, or empty plasmid were incubated for 1 h on ice with 250 .mu.g of biotin-labeled endothelial cell surface proteins in PBS-CM plus 1.5% n-octyl- -D-glucopyranoside and protease inhibitors. The unbound endothelial cell proteins were washed away by three rinses with this buffer. The endothelial cell proteins that remained bound to the fungal cells were eluted twice with 6M urea (Fluka) and the supernatant was combined and concentrated to appropriate volume with a Microcon centrifugal filter (10,000 MWCO, Millipore). The proteins were then separated on 10% SDS-PAGE, and transferred to PVDF-plus membranes (GE Water& Process Technologies). The membrane was then treated with Western Blocking Reagent (Roche) and probed with a rabbit anti-GRP78 antibody (Abcam) followed with secondary antibodies of HRP-conjugated goat anti-rabbit IgG (Pierce), respectively. After incubation with SuperSignal West Dura Extended Duration Substrate (Pierce), the signals were detected using a CCD camera.
Interactions of Fungi with Endothelial or CHO Cells
[0209] The number of organisms endocytosed by endothelial cells or CHO cells was determined using a modification of a previously described differential fluorescence assay (Ibrahim et al., Infect. Immun., 63:4368-4374 (1995)). Briefly, 12-mm glass coverslips in a 24-well cell culture plate were coated with fibronectin for at least 4 hrs, and seeded with endothelial or CHO cells until confluency. After washing twice with prewarmed HBSS, the cells were then infected with 10.sup.5 cells of S. cerevisiae expressing CotH or R. oryzae in RPMI 1640 medium that has been germinated for 1 h. Following incubation for 3 h, the cells were fixed in 3% paraformaldehyde and the cells were stained with 1% Uvitex (a kind gift from Jay Isharani, Ciba-Geigy, Greensboro, N.C.) for 1 hr, which specifically binds to the chitin of fungal cell wall. After washing 3 times with PBS, the coverslips were mounted on a glass slide with a drop of ProLong Gold antifade reagent (Molecular Probes) and sealed with nail polish. The total number of cell associated organisms (i.e. germlings adhering to monolayer) was determined by phase-contrast microscopy. The same field was examined by epifluorescence microscopy, and the number of uninternalized germlings (which were brightly fluorescent) was determined. The number of endocytosed organisms was calculated by subtracting the number of fluorescent organisms from the total number of visible organisms. At least 400 organisms were counted in 20-40 different fields on each slide. Two slides per arm were used for each experiment and the experiment was performed in triplicate on different days.
[0210] R. oryzae-induced endothelial or CHO cell damage was quantified by using a chromium (.sup.51Cr) release assay (Ibrahim et al., J. Infect. Dis., 198:1083-1090 (2008)). Briefly, endothelial cells or CHO cells grown in 96-well tissue culture plates containing detachable wells were incubated with 1 .mu.Ci per well of Na.sub.2.sup.51CrO.sub.4 (ICN, Irvine, Calif.) in M-199 medium (for endothelial cells) or Alpha minimum Eagle's medium (for CHO cells) for 16 h. On the day of the experiment, the unincorporated .sup.51Cr was aspirated, and the wells were washed twice with warmed Hanks' balanced salt solution (Irvine Scientific, Irvine, Calif.). Cells were infected with fungal germlings (1.5.times.10.sup.5 germinated for 1 h) suspended in 150 .mu.l of RPMI 1640 medium (Irvine Scientific) supplemented with glutamine. Spontaneous .sup.51Cr release was determined by incubating endothelial or CHO cells in RPMI 1640 medium supplemented with glutamine without R. oryzae. After 3 h of incubation at 37.degree. C. in a 5% CO.sub.2 incubator, 50% of the medium was aspirated from each well and transferred to glass tubes, and the cells were manually detached and placed into another set of tubes. The amount of .sup.51Cr in the aspirate and the detached well was determined by gamma counting. The total amount of .sup.51Cr incorporated by endothelial cells in each well equaled the sum of radioactive counts per minute of the aspirated medium plus the radioactive counts of the corresponding detached wells. After the data were corrected for variations in the amount of tracer incorporated in each well, the percentage of specific endothelial cell release of .sup.51Cr was calculated by the following formula: [(experimental release.times.2)-(spontaneous release.times.2)]/[total incorporation-(spontaneous release.times.2)]. Each experimental condition was tested at least in triplicate and the experiment repeated at least once.
[0211] For antibody blocking of adherence, endocytosis, or damage caused by R. oryzae, the assays were carried out as described above except for incubating endothelial cells with 50 .mu.g of anti-CotH antibodies (purified IgG) or with serum obtained from the same rabbit prior to vaccination with CotH3 peptide predicted to be antigenic for 1 h prior to adding R. oryzae germlings.
In Vivo Virulence Studies
[0212] For in vivo studies, ICR male mice (.gtoreq.20 g) (Taconic Farms) were rendered DKA with a single i.p. injection of 190 mg/kg streptozotocin in 0.2 ml citrate buffer 10 days prior to fungal challenge (Ibrahim et al., Antimicrob. Agents Chemother., 47:3343-3344 (2003)). Glycosuria and ketonuria were confirmed in all mice 7 days after streptozotocin treatment. Diabetic ketoacidotic mice were infected with fungal spores by intratracheal route after sedating the mice with ketamine (66 mg/kg) and xylazine (4.8 mg/kg) with a target inoculum of 2.5.times.10.sup.5 spores. To confirm the inoculum, the lungs from three mice that were sacrificed immediately following inoculation, were homogenized in PBS and quantitatively cultured on PDA plates containing 0.1% triton and colonies were counted following a 24 h incubation period at 37.degree. C. The primary efficacy endpoint was time to moribundity. In some experiments, as a secondary endpoint, fungal burden in the lungs and brains (primary target organs) was determined on day +2 post infection by qPCR assay as previously described (Ibrahim et al., Antimicrob. Agents Chemother., 49:721-727 (2005)). Values were expressed as login spore equivalent/g of tissue. Histopathological examination was carried out on sections of the harvested organs after fixing in 10% zinc formalin. The fixed organs were embedded in paraffin, and 5 mm sections were stained with hematoxylin and eosin (H&E) or Periodic acid-Schiff stains to detect R. oryzae hyphae (Ibrahim et al., J. Clin. Invest., 117:2649-2657 (2007)).
[0213] For in vivo expression of the CotH genes, lungs and brains collected from mice 48 h post infection intratracheally with wild-type R. oryzae, or transformants with empty plasmid or with RNA-i construct were flash frozen in liquid nitrogen and process for RNA extraction using a Tri Reagent solution (Ambion). Reverse transcription was performed with RETROscript (Ambion) using primers listed in Table 3. For quantitative RT-PCR, SYBR green assays were performed. Constitutively expressed ACT1 was used as a control for all reactions. Calculations and statistical analyses were performed using ABI PRISM 7000 Sequence Detection System User Bulletin 2 (Applied Biosystems).
Passive Immunization
[0214] To detect if antibodies against CotH proteins protect mice from mucormycosis, diabetic ketoacidotic mice were immunized with 1 mg of rabbit purified anti-CotH IgG raised against GAGKKHNNAKQSWNW (SEQ ID NO: 39) or MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) by intraperitoneal injection 2 hours prior to infecting the mice intratracheally as outlined above. Control mice were infected similarly but received a similar dose from the same rabbit prior to vaccinating with the CotH3 peptide. Three days post infection a repeated dose of the antibody or the control serum (prior to vaccination) was introduced. The primary efficacy endpoint was time to moribundity.
Statistical Analysis
[0215] Differences in CotH expression and fungi-endothelial cell interactions were compared by the non-parametric Wilcoxon Rank Sum test. The non-parametric log-rank test was used to determine differences in survival times. Comparisons with P values of <0.05 were considered significant.
Results
[0216] Isolation of Putative R. oryzae Ligand(s) that Bind to Endothelial Cell GRP78.
[0217] To identify the R. oryzae ligand that binds to endothelial cell GRP78, cell wall material from supernatants of protoplasts of R. oryzae germlings were collected (Michielse et al., Mol. Genet. Genomics, 271:499-510 (2004)). Incubating protoplasts in the presence of an osmotic stabilizer (e.g. sorbitol) enables regeneration of the cell wall, and during regeneration cell wall constituents are released into the supernatant (Pitarch et al., Mol. Cell. Proteomics, 5:79-96 (2006); Pitarch et al., Electrophoresis, 20:1001-1010 (1999)). After a 2 h incubation period, (Michielse et al., Mol. Genet. Genomics, 271:499-510 (2004)) protoplasts were pelleted and the supernatant was sterilized in the presence of protease inhibitors. The supernatant was concentrated and protein concentration was measured. Negative control samples were processed similarly with the exception of absence of protoplasts. FAR Western blot analysis (Wu et al., Nat. Protoc., 2:3278-3284 (2007)) using recombinant human Grp78 and anti-Grp78 Ab revealed the presence of 4 bands collected from the supernatant of R. oryzae protoplasts that bound to Grp78p (FIG. 51A). These bands were excised for protein identification by MALDI-TOF-MS/MS analysis. Only 4 ORFs predicted to be cell surface proteins were identified with GPI anchor sequence at the c-terminus, signal peptides at the N-terminus and multiple predicted N- and O-glycosylation sites. Three of the ORF (i.e. RO3G_05018, RO3G_08029, and RO3G_11882) had limited homology of 17% at the amino acid level to CotH family of proteins implicated in spore coat formation from several bacteria (Giorno et al., J. Bacteriol., 189:691-705 (2007); Naclerio et al., J. Bacteriol., 178:6407 (1996)). These were named CotH1 (RO3G_05018), CotH2 (RO3G_08029) and CotH3 (RO3G_11882). The fourth ORF RO3G_16295 is widely present in many fungi and some bacteria without an identified function.
CotH2 and CotH3 are closely related to each other with 77% identity at the amino acid level, while CotH1 is more distantly related (FIG. 51b). The fourth ORF had an overall identity of 10% to the three CotH proteins at the amino acid level. Upon searching the R. oryzae (delemar) 99-880 genome data base, two more related ORFs were found (66% homology at the amino acid level) and were predicted to encode GPI-anchored proteins. These two ORFS (RO3G_09276; and RO3G_01139) had distant homology to CotH1, CotH2, CotH3 proteins (20-24% at the amino acid level). These ORFs were named CotH4 and CotH5, respectively.
[0218] The possibility of the presence of this family of genes in other Mucorales known to cause human mucormycosis was also examined. Using primers that span the entire CotH3 ORF (1.9 kb), bands were amplified from clinical isolates including R. oryzae 99-892, Mucor sp. 99-932, Lichtheimia corymbifera, Cunninghamella bertholletiae, and Rhizomucor. Sequence analysis of these PCR-amplified bands revealed more than 90% identity at the nucleotide and predicted amino acid level with R. oryzae 99-880 CotH3. Collectively, these studies show the uniqueness of CotH family of genes to agents of mucormycosis.
CotH2 and CotH3 are Expressed During Interaction of R. oryzae with Endothelial Cells.
[0219] Based on the results disclosed herein, it was hypothesizes that, if any of the isolated proteins represented a fungal ligand to GRP78, then the proteins must be expressed during R. oryzae interaction with endothelial cells. Since R. oryzae binds endothelial cell GRP78 while in germlings, the expression of these four ORFs in spores or germlings were studied. All CotH genes were expressed in the spore form while only CotH3 was expressed in germlings of R. oryzae. Importantly, when R. oryzae germlings were incubated with endothelial cells, both CotH2 and CotH3 were expressed (FIG. 52B) with CotH3 having 16 fold and 4 fold increase compared to CotH1 and CotH2, respectively (FIG. 52C). Finally, the fourth ORF RO3G_16295 was not expressed R. oryzae spores or germlings (FIG. 52A) or in R. oryzae germlings interacting with endothelial cells (FIG. 52B). These results showed that CotH3 and to a lesser extent CotH2 are putative candidates for interacting with GRP78 during invasion of human cells.
S. cerevisiae Cells Expressing CotH2 or CotH3 Bound GRP78 and Adhered to and Invaded Endothelial Cells and CHO Cells Overexpressing GRP78.
[0220] To study the role of CotH1, CotH2 and CotH3 in interacting with the GRP78 receptor, CotH2 or CotH3 were heterologously expressed in the none-adherent none invading S. cerevisiae. The transformed yeast cells were tested for their ability to specifically bind endothelial cell GRP78. Antibodies raised against two CotH3 peptides predicted to be antigenic and surface expressed (GAGKKHNNAKQSWNW (SEQ ID NO: 39), and MGQTNDGAYRDPTDNNK (SEQ ID NO: 40)) recognized S. cerevisiae expressing CotH3, and to a lesser extent CotH2, but not cells expressing CotH1 (FIG. 53). S. cerevisiae cells expressing CotH3 primarily bound GRP78 from endothelial cell membrane protein extracts. CotH2 expressing yeast cells also bound GRP78 from the same extract but S. cerevisiae expressing CotH1 (FIG. 54A). These results indicated that CotH3, and to lesser extent CotH2, interact with endothelial cell GRP78 during invasion of R. oryzae of the endothelium. To confirm this hypothesis, the ability of the transformed yeast cells to adhere to and invade endothelial cells in vitro was examined.
[0221] Compared to empty plasmid, S. cerevisiae expressing CotH1 had no enhancement in adherence to or endocytosis (invasion) of endothelial cells. In contrast, yeast cells expressing CotH2 or CotH3 had multiple fold increase in adherence to and invasion of endothelial cells compared to S. cerevisiae expressing CotH1 or those transformed with empty plasmid (FIG. 54B). Importantly, cells expressing CotH3 had significantly higher ability to adhere to and invade endothelial cells compared to yeast cells expressing CotH2. To examine if this enhanced adherence to and invasion of endothelial cells was due to interactions with GRP78, the ability of S. cerevisiae expressing CotH1, CotH2, CotH3 or empty plasmid to adhere to and invade parent CHO cells were compared to CHO cells overexpressing GRP78 (Morris et al., J. Biol. Chem., 272:4327-4334 (1997); Reddy et al., J. Biol. Chem., 278:20915-20924 (2003)).
[0222] Only yeast cells expressing CotH2 or CotH3 had significant enhancement in their adhering to and invading CHO cells overexpressing GRP78 (FIG. 54C). Yeast cells expressing CotH1, CotH2 or CotH3 demonstrated no increased ability to bind to and invade parent CHO cells. Collectively, these data show that CotH3, and to a lesser extent CotH2, represents an adhesin/invasin of R. oryzae during interacting with endothelial cell GRP78.
CotH3 Protein is a R. oryzae Invasin.
[0223] Because endocytosis of the fungus was previously shown to be a prerequisite for R. oryzae to cause endothelial cell damage, (Ibrahim et al., Infect. Immun. 73:778-783 (2005); Liu et al., J. Clin. Invest., 120:1914-1924 (2010)) blocking the function or expression of CotH3 to protect endothelial cells from R. oryzae-induced endocytosis and subsequent damage was investigated. Endocytosis, but not adherence, of R. oryzae germlings was abrogated by addition of rabbit anti-CotH3 polyclonal antibodies, but not pre-immune serum collected from the same animal (FIG. 55A). The damage to endothelial cells caused by R. oryzae germlings was reduce by >40% using anti-CotH3 antibodies (FIG. 55B)
[0224] To complement the antibody blocking studies, suppression of CotH3 and CotH2 expression was investigated to determine their impact on adherence, endocytosis, and endothelial cell damage. Using a previously described RNA-i method (Ibrahim et al., Mol. Microbiol., 77:587-604 (2010)), a .about.400 bp fragment was used to suppress both genes in one construct. CotH2 and CotH3 expression in two clones of R. oryzae pyrf mutant (Skory and Ibrahim, Curr. Genet. 52:23-33 (2007)) transformed with the RNA-i construct harboring PyrF as a selection marker (i.e. Trans 2 and Trans 6) were almost entirely abrogated compared to R. oryzae pyrf mutant transformed with empty plasmid (FIG. 56A).
[0225] Next, the cell surface expression of CotH2 and CotH3 on the constructed mutants was assayed by flow cytometry using anti-CotH3 polyclonal antibodies as described herein. R. oryzae transformed with the RNA-i construct expressed less cell surface CotH2 and CotH3 proteins compared to wild-type or R. oryzae transformed with the empty plasmid (FIG. 56B). These RNA-i transformants had no difference in growth rate, cell size or germination when compared to the wild-type or empty plasmid transformed cells (FIG. 56C). However, the reduction of R. oryzae cell surface expression of CotH2 and CotH3 resulted in significant reduction of endothelial cell endocytosis of R. oryzae germlings and subsequent endothelial cell damage (FIGS. 57A and 57B). These results show that CotH3 and CotH2 are required for maximal invasion of endothelial cells by R. oryzae.
[0226] To further demonstrate that CotH3 and CotH2 function as invasins via binding to GRP78, the ability of R. oryzae germlings with CotH3 and CotH2 RNA-i construct to cause damage to CHO cells overexpressing GRP78 or parent CHO cells (which do not overexpress GRP78) were compared to R. oryzae transformed with the empty plasmid or wild type R. oryzae cells (Morris et al., J. Biol. Chem., 272:4327-4334 (1997); Reddy et al., J. Biol. Chem., 278:20915-20924 (2003)). As previously shown (Liu et al., J. Clin. Invest., 120:1914-1924 (2010)), wild type R. oryzae caused considerably more damage to CHO cells overexpressing GRP78 when compared to CHO parent cells. These results were further confirmed by a similar pattern of cell damage caused by R. oryzae germlings transformed with the empty plasmid. In contrast, CHO cells overexpressing GRP78 and CHO parent cells were equally susceptible to damage caused by R. oryzae germlings with reduced cell surface expression of CotH3 and CotH2 (FIG. 57C). Collectively, these results indicate that CotH3 and CotH2 are cell surface proteins that mediate invasion (endocytosis) of endothelial cells via binding to GRP78.
CotH2 and CotH3 are Required for Full Virulence of R. oryzae In Vivo.
[0227] Because CotH3 and CotH2 function as invasins of endothelial cells, it was hypothesized that these two genes are critical determinants of virulence. To test this hypothesis, the virulence of R. oryzae with reduced cell surface expression of CotH2 and CotH3 was compared to wild-type or to R. oryzae transformed with empty plasmid using an intratracheally infected diabetic ketoacidotic mouse model. Despite the initial infection being initiated by inoculating the lungs in this model, the infection hematogenously disseminates to other target organs such as the brain. Empty plasmid harboring cells were as virulent as wild type R. oryzae cells (median survival time of 3 vs. 4 days of the wild type and the empty plasmid infected mice, respectively, P=0.33). In contrast, mice infected with the RNAi-transformant had attenuated virulence, which was shown by a 10 day median survival time and 1/3 of the mice surviving the lethal infection (P=0.003) (FIG. 58A). Additionally, mice infected with the RNA-i transformant had significantly less fungal burden in the lungs and brains (primary and secondary target organs) when compared to the same organs recovered from mice infected with wild type cells or those infected with the empty plasmid transformant (FIG. 58B).
[0228] To further demonstrate that the attenuated virulence observed with mice infected with R. oryzae transformed with the RNA-i construct was due to actual inhibition of CotH2 and CotH3, the pattern of in vivo expression of these genes was assessed in fungal hyphae recovered from the mouse target organs. CotH1 was not expressed in mice infected with wild type R. oryzae, or R. oryzae transformed with the empty plasmid or RNA-i constructs. In contrast, CotH2 showed a four fold and two fold increase in expression in the lungs and brains of mice infected with either the wild type R. oryzae or R. oryzae transformed with the empty plamid, receptively (FIG. 58C) compared to CotH1. Additionally, CotH3 had significantly higher expression than CotH2 in the lungs, but not brains, of mice infected with wild type the empty plasmid transformant. Finally, fungal cells recovered from mice infected with R. oryzae transformed with the RNA-i construct had no expression of any of the CotH genes (FIG. 58C). These results indicate that CotH2 and CotH3 are expressed in vivo and the reduced virulence in mice infected with R. oryzae transformed with the RNA-i is due to a lack of expression of any of the CotH genes.
[0229] To compare the severity of infection, histopathological examination of mice organs infected with the three different strains was conducted. Lungs harvested from mice infected with R. oryzae transformed with RNA-i construct had normal histology compared with lungs taken from mice infected with the wild type or R. oryzae transformed with the empty plasmid, which had an abundance of fungal abscesses characterized by phagocyte infiltration and substantial edema (FIG. 59).
Anti-CotH3p Antibodies Protect Diabetic Ketoacidotic Mice from R. oryzae Infection.
[0230] Because the above data showed that CotH2 and CotH3 proteins act as invasins to mammalian cells in vitro and because CotH2 and Cot3 were required for full virulence of R. oryzae in the hematogenously disseminated murine model infection initiated by intratracheal inoculation, the use of anti-CotH3 and CotH2 antibodies raised against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) or peptide MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) were investigated for their protective affect against the disease (antibodies raised against these 2 peptides recognized S. cerevisiae expressing either CotH2 or CotH3 proteins). 1 mg of the polyclonal antibodies was administered to diabetic ketoacidotic mice two hours prior to and three days post infecting intratracheally with R. oryzae spores. Mice receiving the anti-CotH2 and anti-CotH3 rabbit IgG had a significantly enhanced survival time compared to mice receiving pre-vaccination serum from the same rabbit. Survival at day 21 post infection was 44% for the mice receiving antibodies raised against peptide GAGKKHNNAKQSWNW (SEQ ID NO: 39) vs. 0% survival for the mice receiving the control pre-vaccination IgG (FIG. 60A). Further, Survival at day 14 post infection was 75% for mice receiving antibodies raised against peptide MGQTNDGAYRDPTDNNK (SEQ ID NO: 40) vs. 0% survival for mice receiving the control pre-vaccination IgG (FIG. 60B). These results demonstrate that antibodies targeting CotH proteins can be used to treat mucormycosis.
Example III
Diagnostic Methods for Detecting Mucormycosis
[0231] A series of experiments were performed to determine the detection capability of Nucleic Acid Sequence-Based Amplification (NASBA). A NASBA primer pair was designed to amplify a 127 bp CotH3 using Rhizopus oryzae total RNA as a template.
TABLE-US-00004 CotH3 forward primer (SEQ ID NO: 35) 5'-GATGACAATTATATTCCCAGC-3', CotH3 reverse primer (SEQ ID NO: 36) 5'-GAGTAGACGTAATTAGATCCAA-3', Molecular beacon probe: (SEQ ID NO: 38) 5'-CGCGATCAAACGTACCTGCTGACCGAATCGATCGCG-3'
[0232] RNAs from Aspergillus fumigatus, Candida albicans, and Rhizopus oryzae were isolated using an RNeasy.RTM. Plant Mini Kit (Qiagen) according to manufacturer's instructions. Total RNA isolated from four different R. oryzae spores (10, 100, 1000, 10000 spores, respectively) were added to the NASBA reactions.
[0233] To test the specificity of the molecular beacon for Rhizopus spp., RNAs isolated from C. albicans and A. fumigatus were used as controls. 300 ng total RNA was added to each reaction. NASBA reactions were performed with NucliSENS EasyQ Basic kit v2 (bioMerieux by, Boxtel, NL) according to manufacturer's instructions. In brief, The NASBA reaction volume was 20 .mu.l (per reaction) in MicroAmp.RTM. 96-Well Reaction Plate (Applied Biosystems) and contained 5.4 .mu.l of sterile water, 0.4 .mu.l of each primer, 0.2 .mu.l probe, 4 .mu.l of 5.times. NASBA buffer. Then 5 .mu.l of purified RNA (300 ng) or water (when preparing no template controls) was added to the premix. Reaction mixtures were subsequently incubated at 65.degree. C. for 5 min, cooled down to 41.degree. C. for 5 min, after which 5 .mu.l of enzyme mix from the NucliSENS EasyQ Basic kit v2 was added. This mix consisted of containing T7 RNA polymerase, AMV-RT (avian myeloblastosis virus reverse transcriptase), RNase H, and BSA (bovine serum albumin). Reactions were incubated at 41.degree. C. for 90 min. The fluorescence signal was measured with StepOnePlus Real-Time PCR machine (Applied Biosystems).
[0234] Using the NASBA amplification assay described above, the CotH3 molecular beacon primers/probe showed differential detection of fungal species, i.e. specificity for R. oryzae. Application products from samples spiked with R. oryzae readily show amplification, whereas amplification products from samples spiked with A. fumigants or C. albicans were not detected (FIG. 61).
[0235] The CotH3 molecular beacon primers/probe showed highly sensitive detection of R. oryzae. Fungal spores were germinated in YPD broth for 3 hours at 37.degree. C. shaker. 100 of samples containing 10 to 10.sup.5 of germlings were aliquoted into 250 .mu.l of sheep blood. Total RNA was isolated from the spiked blood samples with RNeasy Plant Mini Kit (Qiagen) and eluted in 30 .mu.l elution buffer. Five microliter of the total RNA was added to each NASBA reaction. Applification products were detected in all samples, include samples inoculated with only 10 germlings (FIG. 62).
[0236] The CotH3 molecular beacon primers showed not only highly sensitive detection of R. oryzae, but also a robust specificity. Fresh R. oryzae, A. fumigatus and C. albicans spores were collected, counted and aliquoted into 10 .mu.l of YPD broth each. 350 .mu.l of sheep blood was added into each tube and incubated for 24 hours at 37.degree. C. shaker. Total RNA was isolated with RNeasy Plant Mini Kit (Qiagen) and eluted in 30 .mu.l in elution buffer. Five microliter of the RNA was added to each NASBA reaction. No amplification products were detected in samples inoculated with 10.sup.6 spores of A. fumigatus or C. albicans, whereas each sample inoculated with 10 to 10.sup.4 spores of R. oryzae were detectable (FIG. 63).
[0237] The CotH3 molecular beacon primers/probe showed detection of multiple Rhizopus species. Fresh R. oryzae (99-880 and 99-892 isolates) and R. microsporus spores (1000 spores each) were aliquoted into 10 .mu.l of YPD broth. 350 .mu.l of sheep blood was added into each tube and incubated for 24 hours at 37.degree. C. shaker. Total RNA was isolated with RNeasy Plant Mini Kit (Qiagen) and eluted in 30 .mu.l in elution buffer. Five microliter of the RNA was added to each NASBA reaction. Not only were samples containing R. oryzae 99-892 spores detectable, but samples containing R. oryzae 99-880 (R1000) and R. microspores (ATCC62417) showed amplification (FIG. 64). These results show that primers designed from CotH genes of R. oryzae can detect other strains of R. oryzae as well as other species of Rhizopus confirming the conserved nature of CotH genes among Mucorales.
[0238] Throughout this application various publications have been referenced. The disclosures of these publications in their entireties are hereby incorporated by reference in this application in order to more fully describe the state of the art to which this invention pertains. Although the invention has been described with reference to the examples provided above, it should be understood that various modifications can be made without departing from the spirit of the invention.
Sequence CWU
1
1
751610PRTRhizopus oryzaeMOD_RES(610)..(610)Any amino acid 1Met Lys Ser Leu
Leu Phe Val Val Phe Ile Phe Leu Thr Thr Thr Tyr1 5
10 15Ala Ala Lys Val Ser Phe Lys Val Ile Ala
Pro Asp Ala Lys Asn Arg 20 25
30Val His Val Asn Ile Asn Gly Val Leu Val Glu Leu Lys Ala Ser Asp
35 40 45Pro Asp Val Pro Tyr Tyr Thr Gly
Phe Ala Glu Leu Lys His Gly Gln 50 55
60Ser Tyr Asn Tyr Val Val Asp Gly Asn Ala Glu Pro Phe Lys Arg Leu65
70 75 80Leu Asn Gly Ser Ser
Thr Lys Asn Glu Phe Phe Asn Arg Pro Val Thr 85
90 95Tyr Ala Thr Asn Ile Pro Glu Leu Pro Ser Ile
Leu Thr Glu Gly Ser 100 105
110Trp Thr Arg Gly Asp Thr Ser Asn Pro Ile Trp Asp Ser Asn Tyr Val
115 120 125Pro Ser Ile Phe Val Thr Gly
Asn Pro Arg Glu Met Asn Glu Leu Ile 130 135
140Glu Asn Val Lys Lys Asn Thr Tyr Lys Thr Lys Ile Thr Phe Ile
Gly145 150 155 160Pro Glu
Thr Ile Asn Thr Phe Glu Gly Cys Thr Leu Gly Leu His Lys
165 170 175Pro Gly Arg Lys His Asn Asp
Ala Lys Gln Ser Trp Ile Trp Ala Leu 180 185
190Pro Glu Gly Gln Phe Met Ala Asn Arg Asn Trp Phe Lys Ile
Arg His 195 200 205Met Glu Glu Asp
Pro Thr Gln Leu Arg Glu Lys Leu Tyr Ala Asp Ile 210
215 220Leu Arg Lys Met Gly Thr Tyr Ala Asn Glu Ala Asn
Met Val Arg Phe225 230 235
240Phe Ile Asn Lys Glu Gly Met Gly Ile Phe Asn Met Leu Asp Asp Val
245 250 255Ile Met Tyr Ser Tyr
Ile Asn Ala Met Phe Tyr His Gly Asp Thr Pro 260
265 270Glu Gln Leu Gly Gly Leu Tyr Asp Gly Ala Ser Gly
Ala Ser Phe Asn 275 280 285Phe Pro
Gly Asp Phe Asp Ser Phe Ile Pro Asn Val Glu Ser Pro Leu 290
295 300Asp Gln Asp Ala Ile Glu Pro Phe Ser Lys Ala
Phe Thr Ser Ile Asp305 310 315
320Phe Leu Glu Asp Glu Gln Val Lys Thr Ile Gly Lys Tyr Phe Asp Tyr
325 330 335Asp Gln Phe Leu
Arg Phe Met Val Met Glu Phe Leu Thr Gly Asp Trp 340
345 350Asp Gly Tyr Trp Gln Glu Gln Thr Asn Asp Gly
Ala Tyr Ile Asp Ile 355 360 365Asn
Asp His Asn Lys Ile Tyr Tyr Leu Gly Gln Asp Phe Asp Ala Thr 370
375 380Phe Gly Val Asn Leu Glu Gln Lys Arg Glu
Phe Val Asn Val Ser Tyr385 390 395
400Thr Glu Tyr Pro Lys Leu Phe Pro Gly Gly Val Leu Ile Asn Arg
Leu 405 410 415Leu Gln Asn
Pro Gly Val Lys Lys Thr Phe Glu Asn Tyr Leu Lys Ile 420
425 430Thr Val Gln Glu Ile Phe Asn Asn Ala Thr
Leu Gly Pro Tyr Val Thr 435 440
445Ala Arg His Glu Phe Leu Ala Pro Asp Leu Gln Trp Asp Arg Ser Ile 450
455 460Lys Gln Arg Ser Pro Gly Asn Ile
Phe Gly Trp Thr Phe Glu Gln Thr465 470
475 480Tyr Glu Asn Leu Phe Glu Gly Val Thr Ala Pro Gly
Lys Asn Ser Gly 485 490
495Gly Ala Asp Trp Gly Leu Leu Glu Trp Val Ala Ala Lys Glu Lys Ala
500 505 510Val Lys Ser Tyr Leu Ser
Ser Ser Glu Ala Ala Asp Ala Ala Thr Val 515 520
525Thr Gln Val Pro Glu Ala Pro Gly Thr Asp Gly Thr Pro Ser
Glu Ser 530 535 540Thr Ala Trp Pro His
Ala Asn Thr Arg Phe Arg Gln Ala Glu Ala Ser545 550
555 560Asn Thr His Lys Ile Gly Thr Ser Ser Pro
Ser Asn Phe Ile Val Lys 565 570
575Ile Lys Gln Gly Thr Val Ser Ser Ser Ser Ser Ile Lys Arg Thr Pro
580 585 590Cys Ile Leu Pro Leu
Val Ile Leu Ala Ser Thr Leu Phe Ala Ser Phe 595
600 605Phe Xaa 61021830DNARhizopus oryzae 2atgaaatccc
tactttttgt tgtattcatc tttttaacaa caacatatgc cgctaaagta 60tcatttaaag
ttatcgctcc tgatgctaaa aacagagttc atgtcaatat caatggagta 120cttgtcgaat
taaaggccag tgatccagat gttccttact acaccggttt tgctgaacta 180aagcatggac
aaagttataa ttacgttgtc gatggaaatg cagagccatt caaacgtcta 240ttgaatggct
cttctactaa aaacgagttc ttcaatcgac ctgtaaccta cgctaccaac 300attcccgagc
tacccagcat tcttactgaa ggtagctgga ctcgtggaga tacgagtaat 360cctatttggg
atagtaacta tgtcccttct atctttgtca ctggaaatcc aagggaaatg 420aatgaattaa
ttgagaatgt gaaaaagaac acatataaaa caaaaatcac ttttattgga 480cctgagacta
tcaacacatt tgagggttgt acccttggac ttcataaacc tgggcgtaaa 540cataatgatg
ctaaacaatc ttggatatgg gctctccctg aaggtcaatt tatggcgaat 600cgaaattggt
ttaagattcg acatatggaa gaagatccta cacaacttcg tgaaaagctt 660tatgcagata
tccttcgaaa gatgggaacc tatgcgaatg aggccaatat ggttcgattc 720tttataaaca
aggaaggcat gggtatcttt aatatgttgg acgatgttat tatgtattct 780tatattaatg
ccatgtttta ccacggtgat actcctgaac agctcggtgg tctttacgac 840ggtgcctctg
gtgcctcatt caattttcct ggtgactttg atagcttcat cccgaatgtc 900gaatccccgc
ttgaccaaga tgctatcgag cctttttcta aagcctttac tagtattgac 960tttttggaag
acgaacaggt caagacgatc ggaaagtatt ttgattatga ccaattcctt 1020cgtttcatgg
tcatggagtt ccttaccggt gactgggatg gctactggca agagcaaaca 1080aatgatgggg
cctatattga tatcaacgac cacaacaaaa tttattactt ggggcaggat 1140tttgacgcca
cctttggtgt aaatcttgaa caaaaacgag agtttgtcaa tgtgtcttat 1200actgaatacc
ccaaactgtt tcctggaggt gtcttgatca acagacttct tcaaaaccca 1260ggtgtcaaga
aaacgtttga aaactatctg aaaatcacag tacaagagat cttcaacaac 1320gccacgctcg
gcccctatgt cactgctcgc cacgaattcc ttgctccaga tcttcagtgg 1380gatcgttcga
taaaacaacg gtctcctgga aatatctttg gttggacgtt cgagcagaca 1440tatgaaaatc
tatttgaagg tgtcactgct cctggaaaaa actcgggtgg tgctgattgg 1500ggtcttcttg
aatgggtggc tgcaaaggaa aaagcagtca aaagttacct cagttcgtct 1560gaagccgctg
atgctgccac tgttacgcaa gtaccagaag ctcctggtac agatggcact 1620ccttccgaat
caactgcctg gcctcatgcc aatacaaggt tcagacaagc cgaagcttct 1680aatactcata
aaataggcac ctcatcgcct tctaatttta ttgttaaaat caagcaaggt 1740actgtgtcat
cgtcttcatc tatcaaaaga accccatgta ttctacctct tgttatcttg 1800gctagcactt
tatttgcctc tttcttctag
18303595PRTRhizopus oryzaeMOD_RES(595)..(595)Any amino acid 3Met Lys Leu
Ser Leu Thr Ile Val Ser Ser Ser Phe Leu Val Ala Ile1 5
10 15Ala His Ala Ala Ser Val Gln Phe Asn
Leu Ile Ala Pro Ser Ala Thr 20 25
30Asp Val Lys Val Ser Val Asn Gly Gln Gln Val Ala Leu Thr Ala Ser
35 40 45Asp Pro Asn Val Pro Tyr Phe
Thr Gly Ser Ala Glu Val Gly Gly Thr 50 55
60Glu Glu Ser Phe Glu Arg Ser Leu Ala Gly Ile Thr Asn Ser Thr Phe65
70 75 80Asn Asp Phe Tyr
Asn Arg Pro Val Thr Tyr Ala Asn Leu Pro Gln Leu 85
90 95Pro Trp Pro Ile Glu Asn Asp Pro Gln Trp
Thr Arg Lys Gly Lys Lys 100 105
110Ala Glu Ile Phe Asp Asp Asn Tyr Ile Pro Ser Val Phe Phe His Gly
115 120 125Asp Asp Ser Gln Val Gln Asp
Leu Val Lys Asn Val Pro Lys Asp Lys 130 135
140Val Thr Gly Thr Leu Thr Phe Ile Gly Ser Asn Tyr Val His Ser
Phe145 150 155 160Ala Asn
Val Ser Phe Gly Ile His Gly Ala Gly Lys Lys His Asn Asn
165 170 175Ala Lys Gln Ser Trp Lys Trp
Thr Leu Ser Gly Thr Asp Thr Met Gly 180 185
190Asn Arg Asn His Phe Lys Leu Arg His Met Glu Glu Asp Pro
Thr Gln 195 200 205Ile Arg Glu Arg
Leu Tyr Ala Asp Ile Leu His Ala Met Gly Thr Tyr 210
215 220Ala Asn Glu Thr Thr Met Val Arg Leu Phe Ile Asn
Gly Gln Gly Phe225 230 235
240Gly Thr Phe Asn Met Leu Asp Asp Ile Thr Glu Phe Ser Tyr Ile Asn
245 250 255Ala Met Phe Tyr Gly
Gly Asn Pro Pro Ala Thr Leu Gly Pro Leu Phe 260
265 270Asp Gly Ala Ser Gly Ala Asp Phe Ile Tyr His Pro
Gly Asn Leu Asp 275 280 285Gly Tyr
Ser Ser Trp Lys Pro Asn Lys Asp Asn Ala Asn Gly Glu Gly 290
295 300Tyr Glu Ala Phe Asp Pro Leu Cys Lys Ala Trp
Asn Glu Thr Asp Tyr305 310 315
320Thr Asp Asn Thr Ala Ile Ala Asn Phe Glu Lys Met Phe Asp Thr Glu
325 330 335His Phe Leu Arg
Phe Met Val Ile Glu Tyr Leu Thr Ala His Trp Asp 340
345 350Gly Tyr Trp Met Gly Gln Thr Asn Asp Gly Ala
Tyr Arg Asp Pro Ser 355 360 365Asp
Asn Asn Lys Trp Tyr Phe Leu Asp Gln Asp Phe Asp Ala Thr Phe 370
375 380Gly Val Asn Leu Asp Val Pro Glu Asn Lys
Asp Phe Ile Ser Val Ser385 390 395
400Tyr Lys Asp Phe Pro Ser Arg Tyr Pro Ala Gly Val Met Ala Asn
Gly 405 410 415Leu Leu Gln
Asn Ala Asp Lys Lys Ala Lys Phe Glu Gln Tyr Leu Thr 420
425 430Glu Thr Val Arg Val Leu Phe Asn Asn Val
Thr Leu Thr Asn Arg Val 435 440
445Leu Ala Ile His Asn Phe Leu Ser Pro Asp Leu Glu Trp Asp Arg Ser 450
455 460Ile Val Gln Gln Ser Pro Gly Thr
Asn Phe Gly Trp Thr Phe Glu Gln465 470
475 480Thr Ser Gln Asn Leu Trp Gln Gly Val Ser Ala Pro
Asn Asn Asn Gly 485 490
495Gly Gly Ala Glu Trp Gly Leu Val Glu Tyr Ile Ala Ala Lys Ser Gln
500 505 510Ala Met Ala Lys Glu Phe
Asn Ile Thr Ile Val Ser Glu Pro Val Gly 515 520
525Pro Pro Ala Ala Asn Gly Thr Ala Thr Ser Thr Asn Asp Gly
Gly Asn 530 535 540Thr His Thr Ala Ala
Gly Glu Ser Lys Pro Ala Ser Ser Ser Glu Ser545 550
555 560Ser Gly Ser Lys Ile Ala Ser Gln Ser Val
Ser Gly Ala Ser Arg Ser 565 570
575Ala Val Ser Thr Val Leu Leu Gly Val Thr Ala Leu Val Ala Thr Ala
580 585 590Ile Phe Xaa
59541785DNARhizopus oryzae 4atgaaattat cactcactat agtatcctct tcatttttag
tagccattgc acatgctgct 60tcagtacaat tcaatttaat tgctccaagt gcaactgatg
tcaaagtatc tgtaaatgga 120cagcaggttg cccttacagc ttcagaccct aatgtgcctt
atttcaccgg atctgctgaa 180gttggtggaa ctgaagaaag ctttgagcgt tctctcgctg
gtattacaaa ctccacattc 240aatgattttt ataaccgtcc tgttacttac gctaaccttc
ctcaattacc atggccaatt 300gaaaatgatc cacaatggac tcgcaaagga aagaaagctg
aaatatttga cgacaactac 360atcccctccg tattctttca cggtgatgat agccaagtcc
aagatttggt taaaaatgtg 420cccaaagaca aagttactgg caccttgact ttcattgggt
ccaattacgt tcattctttc 480gcaaatgtct cctttggaat tcatggtgca ggaaagaagc
acaacaatgc aaagcaatcc 540tggaagtgga ccttgtctgg tactgatact atgggcaacc
gtaaccattt taagcttcgt 600catatggaag aagatcctac acagatccgt gaacgtcttt
atgctgatat attgcatgct 660atgggaacct atgccaatga gaccactatg gtccgattgt
ttattaacgg tcaaggtttt 720ggtaccttca acatgctaga cgatattact gaattttctt
acatcaatgc catgttctat 780ggtggtaatc ctcctgctac tttaggacct ctatttgatg
gtgcaagcgg tgcagacttt 840atttaccatc ctggtaatct cgatggttat tcctcttgga
aacctaataa ggacaacgca 900aacggtgaag gctatgaggc ctttgatcct ctatgtaagg
cttggaacga aaccgactat 960accgataaca cagccattgc caactttgaa aaaatgtttg
ataccgagca ctttttacga 1020ttcatggtga ttgaatatct aactgctcac tgggatggtt
attggatggg acagaccaac 1080gatggtgctt atcgtgaccc aagtgacaat aacaagtggt
actttttgga tcaagatttt 1140gatgccacat ttggtgtcaa tttggacgtt cctgagaata
aagactttat cagtgtctcc 1200tacaaggatt tcccatctcg ttaccctgct ggtgtcatgg
ccaatggtct cttacagaat 1260gctgataaaa aagccaagtt tgaacagtac ttgactgaaa
ctgttcgcgt cttgttcaat 1320aatgtcactt tgactaatcg tgtcttggct atccacaact
tcctctctcc tgatcttgaa 1380tgggatcgat ccatcgttca acagtcgcct ggtactaatt
ttggatggac ctttgagcaa 1440acttctcaaa acttatggca aggtgtctca gccccaaata
acaacggagg tggtgctgag 1500tggggcttgg ttgaatatat cgcagcaaaa tcccaagcca
tggctaagga atttaatatc 1560actattgtct ctgaacctgt aggtcctcct gctgctaatg
gaactgcaac ttctactaat 1620gatggtggta acactcatac cgctgccgga gaaagtaagc
ctgcctcaag ttctgaatct 1680tccggttcga aaattgcttc tcaaagcgta tcaggtgctt
cccgttctgc tgtatctacc 1740gtcttattag gtgttacagc tttagttgcc actgctatct
tttaa 17855602PRTRhizopus oryzaeMOD_RES(602)..(602)Any
amino acid 5Met Lys Leu Ser Ile Ile Ser Ala Ala Phe Leu Val Ala Ile Thr
His1 5 10 15Ala Ala Ser
Ile Lys Phe Asn Val Ile Ala Pro Asn Ala Thr Asp Val 20
25 30Lys Val Ser Val Asn Gly Gln Gln Val Thr
Leu Thr Ala Ser Asp Ala 35 40
45Asn Val Pro Tyr Phe Thr Gly Ser Ala Glu Val Gly Ala Ser Lys Thr 50
55 60Tyr Lys Tyr Val Ala Gly Gly Thr Glu
Glu Ser Phe Asp Arg Ser Leu65 70 75
80Asp Gly Ile Thr Asn Ser Thr Leu Asn Asp Phe Tyr Asn Arg
Pro Val 85 90 95Thr Tyr
Ala Asn Leu Pro Gln Leu Pro Trp Pro Ile Glu Lys Asp Pro 100
105 110Gln Trp Thr Arg Ser Gly Ser Lys Ala
Asp Ile Phe Asp Asp Asn Tyr 115 120
125Ile Pro Ser Val Phe Phe His Gly Asp Asp Ser Gln Val Gln Asn Val
130 135 140Val Lys Asn Val Pro Ala Asp
Arg Ile Ser Gly Thr Leu Thr Phe Ile145 150
155 160Gly Ser Asn Tyr Val Tyr Ser Phe Gln Asn Val Ser
Phe Gly Ile His 165 170
175Gly Ala Gly Lys Lys His Asn Asn Ala Lys Gln Ser Trp Asn Trp Ile
180 185 190Leu Ser Gly Ser Asp Thr
Met Gly Asn Arg Asn Phe Phe Lys Leu Arg 195 200
205His Met Glu Glu Asp Pro Thr Gln Ile Arg Glu Arg Leu Tyr
Ser Asp 210 215 220Ile Leu His Ala Met
Gly Thr Tyr Ala Asn Asp Ala Thr Met Val Arg225 230
235 240Leu Phe Ile Asn Asn Gln Gly Phe Gly Thr
Phe Asn Met Leu Asp Asp 245 250
255Ile Thr Gln Phe Ser Tyr Ile Asn Ala Lys Phe Tyr Asn Gly Lys Pro
260 265 270Pro Ala Thr Leu Gly
Pro Leu Tyr Asp Gly Ala Ser Gly Ala Asp Phe 275
280 285Leu Tyr His Pro Gly Asn Leu Asp Gly Tyr Ser Ser
Trp Val Ala Asn 290 295 300Thr Ala Asn
Pro Asn Gly Glu Ala Tyr Glu Ala Leu Asp Pro Leu Cys305
310 315 320Lys Ala Trp Asn Glu Thr Thr
Tyr Thr Asp Asn Thr Ala Ile Ala Asn 325
330 335Phe Glu Lys Met Phe Asp Leu Asp Arg Phe Met Arg
Phe Met Val Ile 340 345 350Glu
Tyr Leu Thr Ala Asp Trp Asp Gly Tyr Trp Met Gly Gln Thr Asn 355
360 365Asp Gly Ala Tyr Arg Asp Pro Thr Asp
Asn Asn Lys Trp Tyr Phe Leu 370 375
380Asp Gln Asp Phe Asp Gly Thr Phe Gly Val Asn Leu Ala Ala Pro Glu385
390 395 400Gly Asn Ala Phe
Leu Asp Val Ser Tyr Lys Asp Phe Pro Ser Arg Tyr 405
410 415Pro Gly Ala Val Met Ile Asn Asn Leu Leu
Gln Asn Ala Asp Lys Lys 420 425
430Ala Thr Phe Glu Lys Tyr Leu Thr Glu Thr Val Arg Val Leu Phe Asn
435 440 445Asn Val Thr Leu Thr Asn Arg
Val Leu Ala Leu His Asn Phe Leu Leu 450 455
460Pro Asp Leu Glu Trp Asp Arg Ser Ile Val Gln Gln Ser Pro Gly
Ile465 470 475 480Asn Phe
Gly Trp Thr Phe Asp Gln Val Thr Gln Asn Leu Trp Gln Gly
485 490 495Val Thr Ala Pro Asn Asn Asn
Gly Gly Gly Ala Ala Phe Gly Leu Val 500 505
510Glu Tyr Ile Ala Ala Lys Ala Gln Ala Val Ala Lys Glu Phe
Asn Ile 515 520 525Ser Ile Val Ser
Gln Pro Val Gly Pro Pro Ser Ala Asn Gly Thr Thr 530
535 540Ala Ala Ala Pro Ala Pro Ala Ala Gly Asn Ser Thr
Gly Lys Gly Gly545 550 555
560Asn Gln Ser Ile Ser Ser Ser Ala Ser Ser Asn Lys Thr Ser Ala Gln
565 570 575Ser Thr Ser Gly Ala
Ser Arg Ser Lys Thr Ala Pro Ile Val Leu Ala 580
585 590Ile Ser Ala Leu Ala Leu Leu Val Phe Xaa
595 60061806DNARhizopus oryzae 6atgaaattat ctattatatc
cgctgccttt ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg taattgctcc
taatgcaact gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga
tgcaaatgtc ccttatttca ctggttcagc tgaagttggt 180gcctcaaaga catacaaata
tgttgcaggt ggaacagaag aaagttttga tcgttctctt 240gatggaatca caaactcaac
acttaatgat ttttataacc gccccgtcac ttatgctaac 300cttcctcaat taccttggcc
aattgaaaaa gaccctcagt ggactcgttc tggaagcaaa 360gccgacattt tcgatgacaa
ttatattccc agcgtttttt tccacggaga tgacagtcaa 420gtccaaaatg tggttaaaaa
cgtacctgct gaccgaatca gtggtacact gacctttatt 480ggatctaatt acgtctactc
tttccagaat gtctcatttg gtattcacgg tgctggcaag 540aaacacaaca atgcaaaaca
atcttggaac tggatattgt ctggaagtga tacgatgggt 600aaccgcaatt tctttaagct
tcgacatatg gaagaagatc ctacacagat tcgtgaacgt 660ctttattctg acattttaca
tgccatgggt acttatgcca atgatgctac catggttcga 720ttgtttatta acaaccaagg
cttcggtacc ttcaacatgt tggatgatat cactcaattc 780tcctatatca atgctaaatt
ttataatggc aaaccacctg ctaccttggg tcctctctat 840gatggtgcct ctggtgcaga
cttcttatat catcctggta acctcgatgg atactcttct 900tgggttgcca acacagccaa
tcctaatggt gaagcttatg aagctcttga tcctctctgt 960aaggcctgga acgagacgac
ctataccgat aatacagcca ttgcaaactt tgaaaaaatg 1020tttgatctcg accgtttcat
gcgtttcatg gttattgaat acttgactgc cgattgggat 1080ggttactgga tgggacagac
caatgatggt gcctatcgtg atccaactga taataacaag 1140tggtactttt tagatcaaga
ctttgatggt acttttggtg tcaacttggc tgcacccgaa 1200ggcaatgctt ttcttgatgt
ttcttacaag gatttccctt ctcgttaccc tggcgctgtc 1260atgatcaaca acctcttaca
gaatgctgat aaaaaggcca cctttgaaaa atatttgact 1320gagactgtgc gtgtgctgtt
caataatgtc accttgacta accgtgtctt ggcccttcac 1380aacttcctct tgcctgatct
tgaatgggat cgttcgatcg ttcaacaatc tcctggtatt 1440aactttggtt ggacatttga
tcaagtcact caaaacttgt ggcaaggtgt cactgcaccc 1500aataacaatg gaggtggtgc
tgcttttggt ttagttgaat atattgctgc aaaggcacaa 1560gctgtagcta aggaatttaa
tatttctatc gtttcccaac ctgttggccc tccttctgct 1620aatggtacta ctgctgctgc
tcctgctcct gctgctggca attctactgg aaaaggagga 1680aatcaatcta tttctagcag
tgcttcatcc aacaaaacct cggctcaaag cacatcaggt 1740gcttctcgtt ccaagactgc
gcccatcgtt ttagccattt ccgctttagc tctccttgta 1800ttctaa
18067366PRTRhizopus
oryzaeMOD_RES(366)..(366)Any amino acid 7Met Ile Ala Thr Pro Phe Glu Met
Phe Gln Cys Gln Met Tyr Ile Leu1 5 10
15Cys Leu Val Leu Ile Ala Phe Ser Phe Thr Cys Val Asn Thr
Gln Gln 20 25 30Leu Cys Asn
Gly Tyr Ala Glu Tyr Cys Asn Lys Pro Tyr Asn Ser Leu 35
40 45Thr Tyr Leu Leu Thr His Asn Ser Tyr Gly Tyr
Val Ser Asn Pro Ala 50 55 60Ala Asn
Gln Leu Cys Pro Ile Thr Thr Gln Leu Ala Asp Gly Val Arg65
70 75 80Gly Ile Lys Leu Ser Ala Val
Lys Ala Thr Asn Ala Thr Thr Asp Gly 85 90
95Thr Ile Thr Ala Asp Ser Ile Tyr Leu Cys His Thr Ser
Cys Ile Ile 100 105 110Leu Asn
Ala Gly Pro Ala Val Asn Thr Leu Arg Thr Ile Lys Glu Trp 115
120 125Val Glu Gln Asn Pro Asn Glu Val Val Thr
Ile Met Trp Asn Asn Val 130 135 140Asp
Ala Phe Asp Gly Asn Ala Phe Glu Ala Ala Tyr Asn Ala Ser Gly145
150 155 160Ile Ile Glu Tyr Ser Tyr
Gln Gln Pro Lys Lys Asn Tyr Thr Trp Pro 165
170 175Thr Leu Gly Glu Leu Ile Ala Ser Gly Lys Arg Val
Ile Asn Phe Gly 180 185 190Asp
Thr Tyr Tyr Gln Gln Asp Leu Pro Trp Leu Leu Thr Glu Tyr Asp 195
200 205Tyr Val Phe Glu Thr Pro Tyr Glu Asn
His Asn Glu Ser Ser Phe Ser 210 215
220Cys Thr Ile Asp Arg Pro Gln Asp Pro Ala Ser Pro Thr Glu Phe Leu225
230 235 240Tyr Val Met Asn
His Phe Leu Tyr Gly Ser Leu Gln Leu Gly Ser Leu 245
250 255Pro Ile Glu Ile Pro Gln Lys Gly Ile Ala
Asn Thr Thr Asn Ser Asp 260 265
270Asn Ser Leu Met Lys Gln Ala Lys Thr Cys Thr Glu Lys Phe Gly Arg
275 280 285Gln Pro Asn Phe Leu Glu Ile
Asp Phe Tyr Asn Leu Gly Asp Ala Leu 290 295
300Lys Ile Thr Ala Glu Leu Asn Asn Val Thr Tyr Lys Gly Ser Gly
Ser305 310 315 320Leu Gln
Cys Asp Thr Tyr Ala Ala Gln Gln Ala Ser Ser Ser Ser Thr
325 330 335Asp Ser Ser Glu Ala Ile Gln
Thr Ile Ser Ile Ser Ser Val Ser Leu 340 345
350Leu Leu Thr Leu Ile Ala Ala Thr Phe Phe Ile Phe Phe Xaa
355 360 36581098DNARhizopus oryzae
8atgattgcta ccccttttga aatgtttcaa tgtcaaatgt atattttatg tttagtactc
60attgcatttt catttacttg tgtcaatact caacagctct gtaatgggta tgcagagtat
120tgtaataagc cttacaactc gctcacctac ctcttgacac ataattcata tggttatgta
180tctaaccctg ctgctaatca actctgtcct atcactactc aacttgcaga tggtgttcga
240ggcatcaagc tgtcagccgt taaagcaaca aatgcaacta cagatggtac cattacagcg
300gacagcattt atctttgtca cacatcgtgt attatattaa atgctggtcc agcagtcaat
360acccttcgta cgattaaaga atgggtcgag caaaacccta atgaagtagt gacaatcatg
420tggaataatg tggatgcctt tgatgggaat gcatttgagg ctgcttataa tgcaagtggt
480atcattgaat atagttatca gcaacctaaa aaaaactata cttggccaac gttaggtgaa
540ttaattgcta gtggaaaaag agtaattaat tttggtgata cttattatca acaggatctt
600ccctggttat taacagaata tgattatgtg ttcgagacac cttatgaaaa tcataacgaa
660agttcattta gttgcactat tgatcgacct caagatcctg ccagcccaac cgaattctta
720tacgtcatga accatttttt gtatggttca cttcaattgg gttcactacc tatcgagata
780cctcaaaaag gcatagccaa cacaaccaac tctgataatt cgctcatgaa acaagctaaa
840acatgtaccg agaaatttgg tcgtcaaccc aactttttag aaatagattt ttataacctg
900ggtgatgcac tcaagattac tgcagaatta aacaatgtca cctacaaagg ttcaggaagt
960ttgcagtgtg atacatatgc tgctcaacaa gcaagtagtt caagtacaga ctcatccgaa
1020gcaattcaaa caattagtat tagttcagtt agtttactat taactttaat tgctgcaaca
1080ttctttattt tcttttaa
109891913DNARhizopus oryzae 9atgaaattat ctattatatc cgctgccttt ttagtggcta
ttacacacgc tgcttcaata 60aagtttaatg taattgctcc taatgcaact gatgtcaaag
tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc ccttatttca
ctggttcagc tgaagttggt 180gcctcaaaga catacaaagt aatcataaat ttagtttgaa
ttcaatgaga ttaatcatct 240tattctatag tatgttgcag gtggaacaga agaaagtttt
gatcgttctc ttgatggaat 300cacaaactca acacttaatg atttttataa ccgccccgtc
acttatgcta accttcctca 360attaccttgg ccaattgaaa aagacgtaag ttattttatt
tttatctttt ctcagctaaa 420ataaacattg tctttctcag cctcagtgga ctcgttctgg
aagcaaagcc gacattttcg 480atgacaatta tattcccagc gtttttttcc acggagatga
cagtcaagtc caaaatgtgg 540ttaaaaacgt acctgctgac cgaatcagtg gtacactgac
ctttattgga tctaattacg 600tctactcttt ccagaatgtc tcatttggta ttcacggtgc
tggcaagaaa cacaacaatg 660caaaacaatc ttggaactgg atattgtctg gaagtgatac
gatgggtaac cgcaatttct 720ttaagcttcg acatatggaa gaagatccta cacagattcg
tgaacgtctt tattctgaca 780ttttacatgc catgggtact tatgccaatg atgctaccat
ggttcgattg tttattaaca 840accaaggctt cggtaccttc aacatgttgg atgatatcac
tcaattctcc tatatcaatg 900ctaaatttta taatggcaaa ccacctgcta ccttgggtcc
tctctatgat ggtgcctctg 960gtgcagactt cttatatcat cctggtaacc tcgatggata
ctcttcttgg gttgccaaca 1020cagccaatcc taatggtgaa gcttatgaag ctcttgatcc
tctctgtaag gcctggaacg 1080agacgaccta taccgataat acagccattg caaactttga
aaaaatgttt gatctcgacc 1140gtttcatgcg tttcatggtt attgaatact tgactgccga
ttgggatggt tactggatgg 1200gacagaccaa tgatggtgcc tatcgtgatc caactgataa
taacaagtgg tactttttag 1260atcaagactt tgatggtact tttggtgtca acttggctgc
acccgaaggc aatgcttttc 1320ttgatgtttc ttacaaggat ttcccttctc gttaccctgg
cgctgtcatg atcaacaacc 1380tcttacagaa tgctgataaa aaggccacct ttgaaaaata
tttgactgag actgtgcgtg 1440tgctgttcaa taatgtcacc ttgactaacc gtgtcttggc
ccttcacaac ttcctcttgc 1500ctgatcttga atgggatcgt tcgatcgttc aacaatctcc
tggtattaac tttggttgga 1560catttgatca agtcactcaa aacttgtggc aaggtgtcac
tgcacccaat aacaatggag 1620gtggtgctgc ttttggttta gttgaatata ttgctgcaaa
ggcacaagct gtagctaagg 1680aatttaatat ttctatcgtt tcccaacctg ttggccctcc
ttctgctaat ggtactactg 1740ctgctgctcc tgctcctgct gctggcaatt ctactggaaa
aggaggaaat caatctattt 1800ctagcagtgc ttcatccaac aaaacctcgg ctcaaagcac
atcaggtgct tctcgttcca 1860agactgcgcc catcgtttta gccatttccg ctttagctct
ccttgtattc taa 1913101806DNARhizopus oryzae 10atgaaattat
ctattatatc cgctgccttt ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg
taattgctcc taatgcaact gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta
ctgcttcaga tgcaaatgtc ccttatttca ctggttcagc tgaagttggt 180gcctcaaaga
catacaaata tgttgcaggt ggaacagaag aaagttttga tcgttctctt 240gatggaatca
caaactcaac acttaatgat ttttataacc gccccgtcac ttatgctaac 300cttcctcaat
taccttggcc aattgaaaaa gaccctcagt ggactcgttc tggaagcaaa 360gccgacattt
tcgatgacaa ttatattccc agcgtttttt tccacggaga tgacagtcaa 420gtccaaaatg
tggttaaaaa cgtacctgct gaccgaatca gtggtacact gacctttatt 480ggatctaatt
acgtctactc tttccagaat gtctcatttg gtattcacgg tgctggcaag 540aaacacaaca
atgcaaaaca atcttggaac tggatattgt ctggaagtga tacgatgggt 600aaccgcaatt
tctttaagct tcgacatatg gaagaagatc ctacacagat tcgtgaacgt 660ctttattctg
acattttaca tgccatgggt acttatgcca atgatgctac catggttcga 720ttgtttatta
acaaccaagg cttcggtacc ttcaacatgt tggatgatat cactcaattc 780tcctatatca
atgctaaatt ttataatggc aaaccacctg ctaccttggg tcctctctat 840gatggtgcct
ctggtgcaga cttcttatat catcctggta acctcgatgg atactcttct 900tgggttgcca
acacagccaa tcctaatggt gaagcttatg aagctcttga tcctctctgt 960aaggcctgga
acgagacgac ctataccgat aatacagcca ttgcaaactt tgaaaaaatg 1020tttgatctcg
accgtttcat gcgtttcatg gttattgaat acttgactgc cgattgggat 1080ggttactgga
tgggacagac caatgatggt gcctatcgtg atccaactga taataacaag 1140tggtactttt
tagatcaaga ctttgatggt acttttggtg tcaacttggc tgcacccgaa 1200ggcaatgctt
ttcttgatgt ttcttacaag gatttccctt ctcgttaccc tggcgctgtc 1260atgatcaaca
acctcttaca gaatgctgat aaaaaggcca cctttgaaaa atatttgact 1320gagactgtgc
gtgtgctgtt caataatgtc accttgacta accgtgtctt ggcccttcac 1380aacttcctct
tgcctgatct tgaatgggat cgttcgatcg ttcaacaatc tcctggtatt 1440aactttggtt
ggacatttga tcaagtcact caaaacttgt ggcaaggtgt cactgcaccc 1500aataacaatg
gaggtggtgc tgcttttggt ttagttgaat atattgctgc aaaggcacaa 1560gctgtagcta
aggaatttaa tatttctatc gtttcccaac ctgttggccc tccttctgct 1620aatggtacta
ctgctgctgc tcctgctcct gctgctggca attctactgg aaaaggagga 1680aatcaatcta
tttctagcag tgcttcatcc aacaaaacct cggctcaaag cacatcaggt 1740gcttctcgtt
ccaagactgc gcccatcgtt ttagccattt ccgctttagc tctccttgta 1800ttctaa
180611602PRTRhizopus oryzaeMOD_RES(602)..(602)Any amino acid 11Met Lys
Leu Ser Ile Ile Ser Ala Ala Phe Leu Val Ala Ile Thr His1 5
10 15Ala Ala Ser Ile Lys Phe Asn Val
Ile Ala Pro Asn Ala Thr Asp Val 20 25
30Lys Val Ser Val Asn Gly Gln Gln Val Thr Leu Thr Ala Ser Asp
Ala 35 40 45Asn Val Pro Tyr Phe
Thr Gly Ser Ala Glu Val Gly Ala Ser Lys Thr 50 55
60Tyr Lys Tyr Val Ala Gly Gly Thr Glu Glu Ser Phe Asp Arg
Ser Leu65 70 75 80Asp
Gly Ile Thr Asn Ser Thr Leu Asn Asp Phe Tyr Asn Arg Pro Val
85 90 95Thr Tyr Ala Asn Leu Pro Gln
Leu Pro Trp Pro Ile Glu Lys Asp Pro 100 105
110Gln Trp Thr Arg Ser Gly Ser Lys Ala Asp Ile Phe Asp Asp
Asn Tyr 115 120 125Ile Pro Ser Val
Phe Phe His Gly Asp Asp Ser Gln Val Gln Asn Val 130
135 140Val Lys Asn Val Pro Ala Asp Arg Ile Ser Gly Thr
Leu Thr Phe Ile145 150 155
160Gly Ser Asn Tyr Val Tyr Ser Phe Gln Asn Val Ser Phe Gly Ile His
165 170 175Gly Ala Gly Lys Lys
His Asn Asn Ala Lys Gln Ser Trp Asn Trp Ile 180
185 190Leu Ser Gly Ser Asp Thr Met Gly Asn Arg Asn Phe
Phe Lys Leu Arg 195 200 205His Met
Glu Glu Asp Pro Thr Gln Ile Arg Glu Arg Leu Tyr Ser Asp 210
215 220Ile Leu His Ala Met Gly Thr Tyr Ala Asn Asp
Ala Thr Met Val Arg225 230 235
240Leu Phe Ile Asn Asn Gln Gly Phe Gly Thr Phe Asn Met Leu Asp Asp
245 250 255Ile Thr Gln Phe
Ser Tyr Ile Asn Ala Lys Phe Tyr Asn Gly Lys Pro 260
265 270Pro Ala Thr Leu Gly Pro Leu Tyr Asp Gly Ala
Ser Gly Ala Asp Phe 275 280 285Leu
Tyr His Pro Gly Asn Leu Asp Gly Tyr Ser Ser Trp Val Ala Asn 290
295 300Thr Ala Asn Pro Asn Gly Glu Ala Tyr Glu
Ala Leu Asp Pro Leu Cys305 310 315
320Lys Ala Trp Asn Glu Thr Thr Tyr Thr Asp Asn Thr Ala Ile Ala
Asn 325 330 335Phe Glu Lys
Met Phe Asp Leu Asp Arg Phe Met Arg Phe Met Val Ile 340
345 350Glu Tyr Leu Thr Ala Asp Trp Asp Gly Tyr
Trp Met Gly Gln Thr Asn 355 360
365Asp Gly Ala Tyr Arg Asp Pro Thr Asp Asn Asn Lys Trp Tyr Phe Leu 370
375 380Asp Gln Asp Phe Asp Gly Thr Phe
Gly Val Asn Leu Ala Ala Pro Glu385 390
395 400Gly Asn Ala Phe Leu Asp Val Ser Tyr Lys Asp Phe
Pro Ser Arg Tyr 405 410
415Pro Gly Ala Val Met Ile Asn Asn Leu Leu Gln Asn Ala Asp Lys Lys
420 425 430Ala Thr Phe Glu Lys Tyr
Leu Thr Glu Thr Val Arg Val Leu Phe Asn 435 440
445Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His Asn Phe
Leu Leu 450 455 460Pro Asp Leu Glu Trp
Asp Arg Ser Ile Val Gln Gln Ser Pro Gly Ile465 470
475 480Asn Phe Gly Trp Thr Phe Asp Gln Val Thr
Gln Asn Leu Trp Gln Gly 485 490
495Val Thr Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala Phe Gly Leu Val
500 505 510Glu Tyr Ile Ala Ala
Lys Ala Gln Ala Val Ala Lys Glu Phe Asn Ile 515
520 525Ser Ile Val Ser Gln Pro Val Gly Pro Pro Ser Ala
Asn Gly Thr Thr 530 535 540Ala Ala Ala
Pro Ala Pro Ala Ala Gly Asn Ser Thr Gly Lys Gly Gly545
550 555 560Asn Gln Ser Ile Ser Ser Ser
Ala Ser Ser Asn Lys Thr Ser Ala Gln 565
570 575Ser Thr Ser Gly Ala Ser Arg Ser Lys Thr Ala Pro
Ile Val Leu Ala 580 585 590Ile
Ser Ala Leu Ala Leu Leu Val Phe Xaa 595
600121914DNARhizopus oryzae 12atgaaattat ctattatatc cgctgccttt ttagtggcta
ttacacacgc tgcttcaata 60aagtttaatg taattgctcc taatgcaact gatgtcaaag
tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc ccttatttca
ctggttcagc tgaagttggt 180gcctcaaaga catacaaagt aatcataaat ttagtttgaa
ttcaatgaga ttaatcatct 240tattctatag tatgttgcag gtggaacaga agaaagtttt
gatcgttctc ttgatggaat 300cacaaactca acacttaatg atttttataa ccgccccgtc
acttatgcta accttcctca 360attaccttgg ccaattgaaa aagacgtaag ttattttatt
tttatctttt ctcagctaaa 420ataaacattg tctttctcag cctcagtgga ctcgttctgg
aagcaaagcc gacattttcg 480atgacaatta tattcccagc gtttttttcc acggagatga
cagtcaagtc caaaatgtgg 540ttaaaaacgt acctgctgac cgaatcagtg gtacactgac
ctttattgga tctaattacg 600tctactcttt ccagaatgtc tcatttggta ttcacggtgc
tggcaagaaa cacaacaatg 660caaaacaatc ttggaactgg atattgtctg gaagtgatac
gatgggtaac cgcaatttct 720ttaagcttcg acatatggaa gaagatccta cacagattcg
tgaacgtctt tattctgaca 780ttttacatgc catgggtact tatgccaatg atgctaccat
ggttcgattg tttattaaca 840accaaggctt cggtaccttc aacatgttgg atgatatcac
tcaattctcc tatatcaatg 900ctaaatttta taatggcaaa ccacctgcta ccttgggtcc
tctctatgat ggtgcctctg 960gtgcagactt cttatatcat cctggtaacc tcgatggata
ctcttcttgg gttgccaaca 1020cagccaatcc taatggtgaa gcttatgaag ctcttgatcc
tctctgtaag gcctggaacg 1080agacgaccta taccgataat acagccattg caaactttga
aaaaatgttt gatctcgacc 1140gtttcatgcg tttcatggtt attgaatact tgactgccga
ttgggatggt tactggatgg 1200gacagaccaa tgatggtgcc tatcgtgatc caactgataa
taacaagtgg tactttttag 1260atcaagactt tgatggtact tttggtgtca acttggctgc
acccgaaggc aatgcttttc 1320ttgatgtttc ttacaaggat ttcccttctc gttaccctgg
cgctgtcatg atcaacaacc 1380tcttacagaa tgctgataaa aaggccacct ttgaaaaata
tttgactgag actgtgcgtg 1440tgctgttcaa taatgtcacc ttgactaacc gtgtcttggc
ccttcacaac ttcctcttgc 1500ctgatcttga atgggatcgt tcgatcgttc aacaatctcc
tggtattaac tttggttgga 1560catttgatca agtcactcaa aacttgtggc aaggtgtcac
tgcacccaat aacaatggag 1620gtggtgctgc ttttggttta gttgaatata ttgctgcaaa
ggcacaagct gtagctaagg 1680aatttaatat ttctatcgtt tcccaacctg ttggccctcc
ttctgctaat ggtactactg 1740ctgctgctcc tgctcctgct gctggcaatt ctactggaaa
aggaggaaat caatctattt 1800ctagcagtgc ttcatccaac aaaacctcgg ctcaaagcac
atcaggtgct tctcgttcca 1860agactgcgcc catcgtttta gccatttccg ctttagctct
ccttgtattc taaa 1914131805DNARhizopus oryzae 13atgaaattat
ctattatatc cgctgccttt ttagtggcta taacacacgc tgcttcaata 60aagtttaatg
taattgctcc taatgcaact gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta
ctgcttcaga tgcaaatgtc ccttacttca ctggttcagc tgaagttggt 180tcctcaaaga
catacaaata tgttgcaggt ggaacagaag aaggttttga tcgttctctt 240gatggaatca
caaactcaac atttaatgat ttttataatc gccccatcac ttatgctaac 300cttcctcaat
taccttggcc aattgaaaaa gaccctcagt ggactcgttc tggaaacaaa 360gccgacattt
tcgatgacaa ttatattccc agcatttttt tccacggaga tgacagtcaa 420gtccaaaatg
tggttaaaaa cgtacctgct gaccgaatca gtggtacact gacctttatc 480ggatctaatt
acgtctactc tttccagaat gtctcatttg gtattcacgg tgctggcaag 540aaacacaaca
atgcaaagca atcttggaac tggatcttgt ctggaagtga tacgatgggt 600aaccgtaatt
tctttaagct tcgacatatg gaagaagatc ctacacagat ccgtgaacgt 660ctttattctg
acattttaca tgccatgggt acttatgcca atgatgctac catggttcga 720ttgtttatta
acaatcaagg cttcggtacc ttcaacatgt tggatgacat cactcaattc 780tcttatatca
atgctaaatt ctataatggc aaaccacctg ctaccttggg tcctctctat 840gatggtgcct
ctggtgcaga tttcttatat catcctggta acctcgatgg atactctttc 900ttgggttgcc
aacacagcta atcctaatgg tgaagcttat gaagctcttg atcctctctg 960taaggcctgg
aacgagacga cctataccga taatacagcc attgcgaact ttgaaaaaat 1020gtttgatctt
gaccgtttca tgcgtttcat ggttgttgaa tacttggctg ccgattggga 1080tggttactgg
atgggacaga ccaatgatgg tgcctatcgt gatccaactg ataataacaa 1140gtggtacttt
ttagatcaag actttgatgg tacctttggt gtcaacttgg ctgcacccga 1200aggcaatgct
tttcttgata tttcttacaa agatttccct tctcgttacc ctggcgctgt 1260catgatcaac
aacctcttac agaatgctga taaaaaggcc acctttgaaa aatacttgac 1320tgagactgtg
cgtgtgctgt tcaataatgt caccttgact aaccgtgtct tggcccttca 1380caacttcctc
ttgcctgacc ttgaatggga tcgttcgatc gttcaacaat ctcctggtat 1440taactttggt
tggacatttg atcaagtcac tcaaaacttg tggcaaggtg tcaatgcacc 1500caataacaac
ggaggtggtg ctgctattgg tttagttgaa tatattgcta caaaggcaca 1560agttgtagct
aagaattaat attactatcg ttcccaacct gttggccctc cttctgctaa 1620tggtactact
actgctgcta actgctccta ctgctggtat ctactggaaa aggaagaaat 1680catcccattt
ctagcagtgc ttcatcaaca aactcgctca agtaacatca agtgcttctc 1740gtcaagactg
cgccaatcat tttaggcaat ttccgcttag ccctcccccg ttgtgattct 1800caaaa
1805141908DNARhizopus oryzae 14atgaaattat ctattatatc cgctgccttt
ttagtggcta taacacacgc tgcttcaata 60aagtttaatg taattgctcc taatgcaact
gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc
ccttacttca ctggttcagc tgaagttggt 180tcctcaaaga catacaaagt aatcataaat
ttattttgaa ttcaatcata ttaatcatct 240tattctatag tatgttgcag gtggaacaga
agaaggtttt gatcgttctc ttgatggaat 300cacaaactca acatttaatg atttttataa
tcgccccatc acttatgcta accttcctca 360attaccttgg ccaattgaaa aagacgtaag
ttattttatt tttatctttt ctcagctaaa 420ataaacattg tctttctcag cctcagtgga
ctcgttctgg aaacaaagcc gacattttcg 480atgacaatta tattcccagc atttttttcc
acggagatga cagtcaagtc caaaatgtgg 540ttaaaaacgt acctgctgac cgaatcagtg
gtacactgac ctttatcgga tctaattacg 600tctactcttt ccagaatgtc tcatttggta
ttcacggtgc tggcaagaaa cacaacaatg 660caaagcaatc ttggaactgg atcttgtctg
gaagtgatac gatgggtaac cgtaatttct 720ttaagcttcg acatatggaa gaagatccta
cacagatccg tgaacgtctt tattctgaca 780ttttacatgc catgggtact tatgccaatg
atgctaccat ggttcgattg tttattaaca 840atcaaggctt cggtaccttc aacatgttgg
atgacatcac tcaattctct tatatcaatg 900ctaaattcta taatggcaaa ccacctgcta
ccttgggtcc tctctatgat ggtgcctctg 960gtgcagattt cttatatcat cctggtaacc
tcgatggata ctctttcttg ggttgccaac 1020acagctaatc ctaatggtga agcttatgaa
gctcttgatc ctctctgtaa ggcctggaac 1080gagacgacct ataccgataa tacagccatt
gcgaactttg aaaaaatgtt tgatcttgac 1140cgtttcatgc gtttcatggt tgttgaatac
ttggctgccg attgggatgg ttactggatg 1200ggacagacca atgatggtgc ctatcgtgat
ccaactgata ataacaagtg gtacttttta 1260gatcaagact ttgatggtac ctttggtgtc
aacttggctg cacccgaagg caatgctttt 1320cttgatattt cttacaaaga tttcccttct
cgttaccctg gcgctgtcat gatcaacaac 1380ctcttacaga atgctgataa aaaggccacc
tttgaaaaat acttgactga gactgtgcgt 1440gtgctgttca ataatgtcac cttgactaac
cgtgtcttgg cccttcacaa cttcctcttg 1500cctgaccttg aatgggatcg ttcgatcgtt
caacaatctc ctggtattaa ctttggttgg 1560acatttgatc aagtcactca aaacttgtgg
caaggtgtca atgcacccaa taacaacgga 1620ggtggtgctg ctattggttt agttgaatat
attgctacaa aggcacaagt tgtagctaag 1680aattaatatt actatcgttc ccaacctgtt
ggccctcctt ctgctaatgg tactactact 1740gctgctaact gctcctactg ctggtatcta
ctggaaaagg aagaaatcat cccatttcta 1800gcagtgcttc atcaacaaac tcgctcaagt
aacatcaagt gcttctcgtc aagactgcgc 1860caatcatttt aggcaatttc cgcttagccc
tccttgtgat tctcaaaa 190815636PRTRhizopus
oryzaeMOD_RES(73)..(73)Any amino acidMOD_RES(78)..(78)Any amino
acidMOD_RES(94)..(94)Any amino acidMOD_RES(98)..(98)Any amino
acidMOD_RES(106)..(107)Any amino acidMOD_RES(110)..(110)Any amino
acidMOD_RES(117)..(117)Any amino acidMOD_RES(126)..(126)Any amino
acidMOD_RES(193)..(193)Any amino acidMOD_RES(562)..(562)Any amino
acidMOD_RES(624)..(624)Any amino acidMOD_RES(629)..(629)Any amino
acidMOD_RES(633)..(633)Any amino acid 15Met Lys Leu Ser Ile Ile Ser Ala
Ala Phe Leu Val Ala Ile Thr His1 5 10
15Ala Ala Ser Ile Lys Phe Asn Val Ile Ala Pro Asn Ala Thr
Asp Val 20 25 30Lys Val Ser
Val Asn Gly Gln Gln Val Thr Leu Thr Ala Ser Asp Ala 35
40 45Asn Val Pro Tyr Phe Thr Gly Ser Ala Glu Val
Gly Ser Ser Lys Thr 50 55 60Tyr Lys
Val Ile Ile Asn Leu Phe Xaa Ile Gln Ser Tyr Xaa Ser Ser65
70 75 80Tyr Ser Ile Val Cys Cys Arg
Trp Asn Arg Arg Arg Phe Xaa Ser Phe 85 90
95Ser Xaa Trp Asn His Lys Leu Asn Ile Xaa Xaa Phe Leu
Xaa Ser Pro 100 105 110His His
Leu Cys Xaa Pro Ser Ser Ile Thr Leu Ala Asn Xaa Lys Arg 115
120 125Arg Lys Leu Phe Tyr Phe Tyr Leu Phe Ser
Ala Lys Ile Asn Ile Val 130 135 140Phe
Leu Ser Leu Ser Gly Leu Val Leu Glu Thr Lys Pro Thr Phe Ser145
150 155 160Met Thr Ile Ile Phe Pro
Ala Phe Phe Ser Thr Glu Met Thr Val Lys 165
170 175Ser Lys Met Trp Leu Lys Thr Tyr Leu Leu Thr Glu
Ser Val Val His 180 185 190Xaa
Pro Leu Ser Asp Leu Ile Thr Ser Thr Leu Ser Arg Met Ser His 195
200 205Leu Val Phe Thr Val Leu Ala Arg Asn
Thr Thr Met Gln Ser Asn Leu 210 215
220Gly Thr Gly Ser Cys Leu Glu Val Ile Arg Trp Val Thr Val Ile Ser225
230 235 240Leu Ser Phe Asp
Ile Trp Lys Lys Ile Leu His Arg Ser Val Asn Val 245
250 255Phe Ile Leu Thr Phe Tyr Met Pro Trp Val
Leu Met Pro Met Met Leu 260 265
270Pro Trp Phe Asp Cys Leu Leu Thr Ile Lys Ala Ser Val Pro Ser Thr
275 280 285Cys Trp Met Thr Ser Leu Asn
Ser Leu Ile Ser Met Leu Asn Ser Ile 290 295
300Met Ala Asn His Leu Leu Pro Trp Val Leu Ser Met Met Val Pro
Leu305 310 315 320Val Gln
Ile Ser Tyr Ile Ile Leu Val Thr Ser Met Asp Thr Leu Ser
325 330 335Trp Val Ala Asn Thr Ala Asn
Pro Asn Gly Glu Ala Tyr Glu Ala Leu 340 345
350Asp Pro Leu Cys Lys Ala Trp Asn Glu Thr Thr Tyr Thr Asp
Asn Thr 355 360 365Ala Ile Ala Asn
Phe Glu Lys Met Phe Asp Leu Asp Arg Phe Met Arg 370
375 380Phe Met Val Val Glu Tyr Leu Ala Ala Asp Trp Asp
Gly Tyr Trp Met385 390 395
400Gly Gln Thr Asn Asp Gly Ala Tyr Arg Asp Pro Thr Asp Asn Asn Lys
405 410 415Trp Tyr Phe Leu Asp
Gln Asp Phe Asp Gly Thr Phe Gly Val Asn Leu 420
425 430Ala Ala Pro Glu Gly Asn Ala Phe Leu Asp Ile Ser
Tyr Lys Asp Phe 435 440 445Pro Ser
Arg Tyr Pro Gly Ala Val Met Ile Asn Asn Leu Leu Gln Asn 450
455 460Ala Asp Lys Lys Ala Thr Phe Glu Lys Tyr Leu
Thr Glu Thr Val Arg465 470 475
480Val Leu Phe Asn Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His
485 490 495Asn Phe Leu Leu
Pro Asp Leu Glu Trp Asp Arg Ser Ile Val Gln Gln 500
505 510Ser Pro Gly Ile Asn Phe Gly Trp Thr Phe Asp
Gln Val Thr Gln Asn 515 520 525Leu
Trp Gln Gly Val Asn Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala 530
535 540Ile Gly Leu Val Glu Tyr Ile Ala Thr Lys
Ala Gln Val Val Ala Lys545 550 555
560Asn Xaa Tyr Tyr Tyr Arg Ser Gln Pro Val Gly Pro Pro Ser Ala
Asn 565 570 575Gly Thr Thr
Thr Ala Ala Asn Cys Ser Tyr Cys Trp Tyr Leu Leu Glu 580
585 590Lys Glu Glu Ile Ile Pro Phe Leu Ala Val
Leu His Gln Gln Thr Arg 595 600
605Ser Ser Asn Ile Lys Cys Phe Ser Ser Arg Leu Arg Gln Ser Phe Xaa 610
615 620Ala Ile Ser Ala Xaa Pro Ser Leu
Xaa Phe Ser Lys625 630
63516637PRTRhizopus oryzaeMOD_RES(73)..(73)Any amino
acidMOD_RES(78)..(78)Any amino acidMOD_RES(94)..(94)Any amino
acidMOD_RES(98)..(98)Any amino acidMOD_RES(106)..(107)Any amino
acidMOD_RES(110)..(110)Any amino acidMOD_RES(117)..(117)Any amino
acidMOD_RES(126)..(126)Any amino acidMOD_RES(193)..(193)Any amino
acidMOD_RES(562)..(562)Any amino acidMOD_RES(624)..(624)Any amino
acidMOD_RES(629)..(629)Any amino acid 16Met Lys Leu Ser Ile Ile Ser Ala
Ala Phe Leu Val Ala Ile Thr His1 5 10
15Ala Ala Ser Ile Lys Phe Asn Val Ile Ala Pro Asn Ala Thr
Asp Val 20 25 30Lys Val Ser
Val Asn Gly Gln Gln Val Thr Leu Thr Ala Ser Asp Ala 35
40 45Asn Val Pro Tyr Phe Thr Gly Ser Ala Glu Val
Gly Ser Ser Lys Thr 50 55 60Tyr Lys
Val Ile Ile Asn Leu Phe Xaa Ile Gln Ser Tyr Xaa Ser Ser65
70 75 80Tyr Ser Ile Val Cys Cys Arg
Trp Asn Arg Arg Arg Phe Xaa Ser Phe 85 90
95Ser Xaa Trp Asn His Lys Leu Asn Ile Xaa Xaa Phe Leu
Xaa Ser Pro 100 105 110His His
Leu Cys Xaa Pro Ser Ser Ile Thr Leu Ala Asn Xaa Lys Arg 115
120 125Arg Lys Leu Phe Tyr Phe Tyr Leu Phe Ser
Ala Lys Ile Asn Ile Val 130 135 140Phe
Leu Ser Leu Ser Gly Leu Val Leu Glu Thr Lys Pro Thr Phe Ser145
150 155 160Met Thr Ile Ile Phe Pro
Ala Phe Phe Ser Thr Glu Met Thr Val Lys 165
170 175Ser Lys Met Trp Leu Lys Thr Tyr Leu Leu Thr Glu
Ser Val Val His 180 185 190Xaa
Pro Leu Ser Asp Leu Ile Thr Ser Thr Leu Ser Arg Met Ser His 195
200 205Leu Val Phe Thr Val Leu Ala Arg Asn
Thr Thr Met Gln Ser Asn Leu 210 215
220Gly Thr Gly Ser Cys Leu Glu Val Ile Arg Trp Val Thr Val Ile Ser225
230 235 240Leu Ser Phe Asp
Ile Trp Lys Lys Ile Leu His Arg Ser Val Asn Val 245
250 255Phe Ile Leu Thr Phe Tyr Met Pro Trp Val
Leu Met Pro Met Met Leu 260 265
270Pro Trp Phe Asp Cys Leu Leu Thr Ile Lys Ala Ser Val Pro Ser Thr
275 280 285Cys Trp Met Thr Ser Leu Asn
Ser Leu Ile Ser Met Leu Asn Ser Ile 290 295
300Met Ala Asn His Leu Leu Pro Trp Val Leu Ser Met Met Val Pro
Leu305 310 315 320Val Gln
Ile Ser Tyr Ile Ile Leu Val Thr Ser Met Asp Thr Leu Ser
325 330 335Trp Val Ala Asn Thr Ala Asn
Pro Asn Gly Glu Ala Tyr Glu Ala Leu 340 345
350Asp Pro Leu Cys Lys Ala Trp Asn Glu Thr Thr Tyr Thr Asp
Asn Thr 355 360 365Ala Ile Ala Asn
Phe Glu Lys Met Phe Asp Leu Asp Arg Phe Met Arg 370
375 380Phe Met Val Val Glu Tyr Leu Ala Ala Asp Trp Asp
Gly Tyr Trp Met385 390 395
400Gly Gln Thr Asn Asp Gly Ala Tyr Arg Asp Pro Thr Asp Asn Asn Lys
405 410 415Trp Tyr Phe Leu Asp
Gln Asp Phe Asp Gly Thr Phe Gly Val Asn Leu 420
425 430Ala Ala Pro Glu Gly Asn Ala Phe Leu Asp Ile Ser
Tyr Lys Asp Phe 435 440 445Pro Ser
Arg Tyr Pro Gly Ala Val Met Ile Asn Asn Leu Leu Gln Asn 450
455 460Ala Asp Lys Lys Ala Thr Phe Glu Lys Tyr Leu
Thr Glu Thr Val Arg465 470 475
480Val Leu Phe Asn Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His
485 490 495Asn Phe Leu Leu
Pro Asp Leu Glu Trp Asp Arg Ser Ile Val Gln Gln 500
505 510Ser Pro Gly Ile Asn Phe Gly Trp Thr Phe Asp
Gln Val Thr Gln Asn 515 520 525Leu
Trp Gln Gly Val Asn Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala 530
535 540Ile Gly Leu Val Glu Tyr Ile Ala Thr Lys
Ala Gln Val Val Ala Lys545 550 555
560Asn Xaa Tyr Tyr Tyr Arg Ser Gln Pro Val Gly Pro Pro Ser Ala
Asn 565 570 575Gly Thr Thr
Thr Ala Ala Asn Cys Ser Tyr Cys Trp Tyr Leu Leu Glu 580
585 590Lys Glu Glu Ile Ile Pro Phe Leu Ala Val
Leu His Gln Gln Thr Arg 595 600
605Ser Ser Asn Ile Lys Cys Phe Ser Ser Arg Leu Arg Gln Ser Phe Xaa 610
615 620Ala Ile Ser Ala Xaa Pro Ser Pro
Val Val Ile Leu Lys625 630
635171806DNAMucor sp. 17atgaaattat ctattatatc cgctgccttt ttagtggcta
taacacacgc tgcttcataa 60agtttaatgt aattgctcct aatgcaactg atgtcaaagt
atctgtaaat ggacagcaag 120tgacacttac tgcttcagat gcaaatgtcc cttacttcac
tggttcagct gaagttggtt 180cctcaaagac atacaaatat gttgcaggtg gaacagaaga
aggttttgat cgttctcttg 240atggaatcac aaactcaaca tttaatgatt tttataatcg
ccccatcact tatgctaacc 300ttcctcaatt accttggcca attgaaaaag accctcagtg
gactcgttct ggaaacaaag 360ccgacatttt cgatgacaat tatattccca gcattttttt
ccacggagat gacagtcaag 420tccaaaatgt ggttaaaaac gtacctgctg accgaatcag
tggtacactg acctttatcg 480gatctaatta cgtctactct ttccagaatg tctcatttgg
tattcacggt gctggcaaga 540aacacaacaa tgcaaagcaa tcttggaact ggatcttgtc
tggaagtgat acgatgggta 600accgtaattt ctttaagctt cgacatatgg aagaagatcc
tacacagatc cgtgaacgtc 660tttattctga cattttacat gccatgggta cttatgccaa
tgatgctacc atggttcgat 720tgtttattaa caatcaaggc ttcggtacct tcaacatgtt
ggatgacatc actcaattct 780cttatatcaa tgctaaattc tataatggca aaccacctgc
taccttgggt cctctctatg 840atggtgcctc tggtgcagat ttcttatatc atcctggtaa
cctcgatgga tactcttctt 900gggttgccaa cacagctaat cctaatggtg aagcttatga
agctcttgat ccttctctgt 960aaggcctgga aacgagacga cctattaccg ataatacagc
caattgcgaa ctttgaaaaa 1020atgtttgatc tgacgtttca tgcgttccat gctggtgata
ctgggctgcc gaatgaatgc 1080tactgcaatg gaagacatga atcgtgtcta ttcgtgatcc
aactgaataa taccagtcgg 1140gtacttttta gatcaagact ttgatggtac ttttggtgtc
aacttggctg cacccgaagg 1200caatgctttt cttgatgttt cttacaagga tttcccttct
cgttaccctg gcgctgtcat 1260gatcaacaac ctcttacaga atgctgataa aaaggccacc
tttgaaaaat atttgactga 1320gactgtgcgt gtgctgttca ataatgtcac cttgactaac
cgtgtcttgg cccttcacaa 1380cttcctcttg cctgatcttg aatgggatcg ttcgatcgtt
caacaatctc ctggtattaa 1440ctttggttgg acatttgatc aagtcactca aaacttgtgg
caaggtgtca ctgcacccaa 1500taacaatgga ggtggtgctg cttttggttt agttgaatat
attgctgcaa aggcacaagc 1560tgtagctaag gaatttaata tttctatcgt ttcccaacct
gttggccctc cttctgctaa 1620tggtactact gctgctgctc ctgctcctgc tgctggcaat
tctactggaa aaggaggaaa 1680tcaatctatt tctagcagtg cttcatccaa caaaacctcg
gctcaaagca catcaggtgc 1740ttctcgttcc aagactgcgc ccatcgtttt agccatttcc
gctttagctc tccttggtat 1800tctaaa
180618602PRTMucor sp.MOD_RES(20)..(20)Any amino
acidMOD_RES(24)..(24)Any amino acidMOD_RES(36)..(36)Any amino
acidMOD_RES(41)..(41)Any amino acidMOD_RES(157)..(157)Any amino
acidMOD_RES(388)..(388)Any amino acidMOD_RES(405)..(405)Any amino
acidMOD_RES(429)..(430)Any amino acidMOD_RES(435)..(435)Any amino
acidMOD_RES(440)..(440)Any amino acidMOD_RES(448)..(448)Any amino
acidMOD_RES(453)..(453)Any amino acidMOD_RES(465)..(465)Any amino
acidMOD_RES(467)..(467)Any amino acidMOD_RES(480)..(480)Any amino
acidMOD_RES(486)..(486)Any amino acidMOD_RES(501)..(501)Any amino
acidMOD_RES(512)..(512)Any amino acidMOD_RES(523)..(523)Any amino
acidMOD_RES(526)..(526)Any amino acidMOD_RES(540)..(540)Any amino
acidMOD_RES(565)..(565)Any amino acid 18Met Lys Leu Ser Ile Ile Ser Ala
Ala Phe Leu Val Ala Ile Thr His1 5 10
15Ala Ala Ser Xaa Ser Leu Met Xaa Leu Leu Leu Met Gln Leu
Met Ser 20 25 30Lys Tyr Leu
Xaa Met Asp Ser Lys Xaa His Leu Leu Leu Gln Met Gln 35
40 45Met Ser Leu Thr Ser Leu Val Gln Leu Lys Leu
Val Pro Gln Arg His 50 55 60Thr Asn
Met Leu Gln Val Glu Gln Lys Lys Val Leu Ile Val Leu Leu65
70 75 80Met Glu Ser Gln Thr Gln His
Leu Met Ile Phe Ile Ile Ala Pro Ser 85 90
95Leu Met Leu Thr Phe Leu Asn Tyr Leu Gly Gln Leu Lys
Lys Thr Leu 100 105 110Ser Gly
Leu Val Leu Glu Thr Lys Pro Thr Phe Ser Met Thr Ile Ile 115
120 125Phe Pro Ala Phe Phe Ser Thr Glu Met Thr
Val Lys Ser Lys Met Trp 130 135 140Leu
Lys Thr Tyr Leu Leu Thr Glu Ser Val Val His Xaa Pro Leu Ser145
150 155 160Asp Leu Ile Thr Ser Thr
Leu Ser Arg Met Ser His Leu Val Phe Thr 165
170 175Val Leu Ala Arg Asn Thr Thr Met Gln Ser Asn Leu
Gly Thr Gly Ser 180 185 190Cys
Leu Glu Val Ile Arg Trp Val Thr Val Ile Ser Leu Ser Phe Asp 195
200 205Ile Trp Lys Lys Ile Leu His Arg Ser
Val Asn Val Phe Ile Leu Thr 210 215
220Phe Tyr Met Pro Trp Val Leu Met Pro Met Met Leu Pro Trp Phe Asp225
230 235 240Cys Leu Leu Thr
Ile Lys Ala Ser Val Pro Ser Thr Cys Trp Met Thr 245
250 255Ser Leu Asn Ser Leu Ile Ser Met Leu Asn
Ser Ile Met Ala Asn His 260 265
270Leu Leu Pro Trp Val Leu Ser Met Met Val Pro Leu Val Gln Ile Ser
275 280 285Tyr Ile Ile Leu Val Thr Ser
Met Asp Thr Leu Leu Gly Leu Pro Thr 290 295
300Gln Leu Ile Leu Met Val Lys Leu Met Lys Leu Leu Ile Leu Leu
Cys305 310 315 320Lys Ala
Trp Lys Arg Asp Asp Leu Leu Pro Ile Ile Gln Pro Ile Ala
325 330 335Asn Phe Glu Lys Met Phe Asp
Leu Thr Phe His Ala Phe His Ala Gly 340 345
350Asp Thr Gly Leu Pro Asn Glu Cys Tyr Cys Asn Gly Arg His
Glu Ser 355 360 365Cys Leu Phe Val
Ile Gln Leu Asn Asn Thr Ser Arg Val Leu Phe Arg 370
375 380Ser Arg Leu Xaa Trp Tyr Phe Trp Cys Gln Leu Gly
Cys Thr Arg Arg385 390 395
400Gln Cys Phe Ser Xaa Cys Phe Leu Gln Gly Phe Pro Phe Ser Leu Pro
405 410 415Trp Arg Cys His Asp
Gln Gln Pro Leu Thr Glu Cys Xaa Xaa Lys Gly 420
425 430His Leu Xaa Lys Ile Phe Asp Xaa Asp Cys Ala Cys
Ala Val Gln Xaa 435 440 445Cys His
Leu Asp Xaa Pro Cys Leu Gly Pro Ser Gln Leu Pro Leu Ala 450
455 460Xaa Ser Xaa Met Gly Ser Phe Asp Arg Ser Thr
Ile Ser Trp Tyr Xaa465 470 475
480Leu Trp Leu Asp Ile Xaa Ser Ser His Ser Lys Leu Val Ala Arg Cys
485 490 495His Cys Thr Gln
Xaa Gln Trp Arg Trp Cys Cys Phe Trp Phe Ser Xaa 500
505 510Ile Tyr Cys Cys Lys Gly Thr Ser Cys Ser Xaa
Gly Ile Xaa Tyr Phe 515 520 525Tyr
Arg Phe Pro Thr Cys Trp Pro Ser Phe Cys Xaa Trp Tyr Tyr Cys 530
535 540Cys Cys Ser Cys Ser Cys Cys Trp Gln Phe
Tyr Trp Lys Arg Arg Lys545 550 555
560Ser Ile Tyr Phe Xaa Gln Cys Phe Ile Gln Gln Asn Leu Gly Ser
Lys 565 570 575His Ile Arg
Cys Phe Ser Phe Gln Asp Cys Ala His Arg Phe Ser His 580
585 590Phe Arg Phe Ser Ser Pro Trp Tyr Ser Lys
595 600191913DNAMucor sp. 19atgaaattat ctattatatc
cgctgccttt ttagtggcta taacacacgc tgcttcataa 60agtttaatgt aattgctcct
aatgcaactg atgtcaaagt atctgtaaat ggacagcaag 120tgacacttac tgcttcagat
gcaaatgtcc cttacttcac tggttcagct gaagttggtt 180cctcaaagac atacaaagta
atcataaatt tattttgaat tcaatcatat taatcatctt 240attctatagt atgttgcagg
tggaacagaa gaaggttttg atcgttctct tgatggaatc 300acaaactcaa catttaatga
tttttataat cgccccatca cttatgctaa ccttcctcaa 360ttaccttggc caattgaaaa
agacgtaagt tattttattt ttatcttttc tcagctaaaa 420taaacattgt ctttctcagc
ctcagtggac tcgttctgga aacaaagccg acattttcga 480tgacaattat attcccagca
tttttttcca cggagatgac agtcaagtcc aaaatgtggt 540taaaaacgta cctgctgacc
gaatcagtgg tacactgacc tttatcggat ctaattacgt 600ctactctttc cagaatgtct
catttggtat tcacggtgct ggcaagaaac acaacaatgc 660aaagcaatct tggaactgga
tcttgtctgg aagtgatacg atgggtaacc gtaatttctt 720taagcttcga catatggaag
aagatcctac acagatccgt gaacgtcttt attctgacat 780tttacatgcc atgggtactt
atgccaatga tgctaccatg gttcgattgt ttattaacaa 840tcaaggcttc ggtaccttca
acatgttgga tgacatcact caattctctt atatcaatgc 900taaattctat aatggcaaac
cacctgctac cttgggtcct ctctatgatg gtgcctctgg 960tgcagatttc ttatatcatc
ctggtaacct cgatggatac tcttcttggg ttgccaacac 1020agctaatcct aatggtgaag
cttatgaagc tcttgatcct tctctgtaag gcctggaaac 1080gagacgacct attaccgata
atacagccaa ttgcgaactt tgaaaaaatg tttgatctga 1140cgtttcatgc gttccatgct
ggtgatactg ggctgccgaa tgaatgctac tgcaatggaa 1200gacatgaatc gtgtctattc
gtgatccaac tgaataatac cagtcgggta ctttttagat 1260caagactttg atggtacttt
tggtgtcaac ttggctgcac ccgaaggcaa tgcttttctt 1320gatgtttctt acaaggattt
cccttctcgt taccctggcg ctgtcatgat caacaacctc 1380ttacagaatg ctgataaaaa
ggccaccttt gaaaaatatt tgactgagac tgtgcgtgtg 1440ctgttcaata atgtcacctt
gactaaccgt gtcttggccc ttcacaactt cctcttgcct 1500gatcttgaat gggatcgttc
gatcgttcaa caatctcctg gtattaactt tggttggaca 1560tttgatcaag tcactcaaaa
cttgtggcaa ggtgtcactg cacccaataa caatggaggt 1620ggtgctgctt ttggtttagt
tgaatatatt gctgcaaagg cacaagctgt agctaaggaa 1680tttaatattt ctatcgtttc
ccaacctgtt ggccctcctt ctgctaatgg tactactgct 1740gctgctcctg ctcctgctgc
tggcaattct actggaaaag gaggaaatca atctatttct 1800agcagtgctt catccaacaa
aacctcggct caaagcacat caggtgcttc tcgttccaag 1860actgcgccca tcgttttagc
catttccgct ttagctctcc ttggtattct aaa 191320637PRTMucor
sp.MOD_RES(20)..(20)Any amino acidMOD_RES(24)..(24)Any amino
acidMOD_RES(36)..(36)Any amino acidMOD_RES(41)..(41)Any amino
acidMOD_RES(67)..(67)Any amino acidMOD_RES(69)..(69)Any amino
acidMOD_RES(83)..(83)Any amino acidMOD_RES(141)..(141)Any amino
acidMOD_RES(161)..(161)Any amino acidMOD_RES(173)..(173)Any amino
acidMOD_RES(181)..(181)Any amino acidMOD_RES(186)..(186)Any amino
acidMOD_RES(198)..(198)Any amino acidMOD_RES(232)..(232)Any amino
acidMOD_RES(236)..(236)Any amino acidMOD_RES(238)..(238)Any amino
acidMOD_RES(241)..(241)Any amino acidMOD_RES(254)..(254)Any amino
acidMOD_RES(259)..(259)Any amino acidMOD_RES(270)..(270)Any amino
acidMOD_RES(279)..(279)Any amino acidMOD_RES(291)..(291)Any amino
acidMOD_RES(301)..(301)Any amino acidMOD_RES(304)..(304)Any amino
acidMOD_RES(316)..(316)Any amino acidMOD_RES(329)..(329)Any amino
acidMOD_RES(342)..(342)Any amino acidMOD_RES(344)..(344)Any amino
acidMOD_RES(346)..(346)Any amino acidMOD_RES(349)..(349)Any amino
acidMOD_RES(352)..(352)Any amino acidMOD_RES(367)..(367)Any amino
acidMOD_RES(380)..(380)Any amino acidMOD_RES(408)..(408)Any amino
acidMOD_RES(411)..(411)Any amino acid 20Met Lys Leu Ser Ile Ile Ser Ala
Ala Phe Leu Val Ala Ile Thr His1 5 10
15Ala Ala Ser Xaa Ser Leu Met Xaa Leu Leu Leu Met Gln Leu
Met Ser 20 25 30Lys Tyr Leu
Xaa Met Asp Ser Lys Xaa His Leu Leu Leu Gln Met Gln 35
40 45Met Ser Leu Thr Ser Leu Val Gln Leu Lys Leu
Val Pro Gln Arg His 50 55 60Thr Lys
Xaa Ser Xaa Ile Tyr Phe Glu Phe Asn His Ile Asn His Leu65
70 75 80Ile Leu Xaa Tyr Val Ala Gly
Gly Thr Glu Glu Gly Phe Asp Arg Ser 85 90
95Leu Asp Gly Ile Thr Asn Ser Thr Phe Asn Asp Phe Tyr
Asn Arg Pro 100 105 110Ile Thr
Tyr Ala Asn Leu Pro Gln Leu Pro Trp Pro Ile Glu Lys Asp 115
120 125Val Ser Tyr Phe Ile Phe Ile Phe Ser Gln
Leu Lys Xaa Thr Leu Ser 130 135 140Phe
Ser Ala Ser Val Asp Ser Phe Trp Lys Gln Ser Arg His Phe Arg145
150 155 160Xaa Gln Leu Tyr Ser Gln
His Phe Phe Pro Arg Arg Xaa Gln Ser Ser 165
170 175Pro Lys Cys Gly Xaa Lys Arg Thr Cys Xaa Pro Asn
Gln Trp Tyr Thr 180 185 190Asp
Leu Tyr Arg Ile Xaa Leu Arg Leu Leu Phe Pro Glu Cys Leu Ile 195
200 205Trp Tyr Ser Arg Cys Trp Gln Glu Thr
Gln Gln Cys Lys Ala Ile Leu 210 215
220Glu Leu Asp Leu Val Trp Lys Xaa Tyr Asp Gly Xaa Pro Xaa Phe Leu225
230 235 240Xaa Ala Ser Thr
Tyr Gly Arg Arg Ser Tyr Thr Asp Pro Xaa Thr Ser 245
250 255Leu Phe Xaa His Phe Thr Cys His Gly Tyr
Leu Cys Gln Xaa Cys Tyr 260 265
270His Gly Ser Ile Val Tyr Xaa Gln Ser Arg Leu Arg Tyr Leu Gln His
275 280 285Val Gly Xaa His His Ser Ile
Leu Leu Tyr Gln Cys Xaa Ile Leu Xaa 290 295
300Trp Gln Thr Thr Cys Tyr Leu Gly Ser Ser Leu Xaa Trp Cys Leu
Trp305 310 315 320Cys Arg
Phe Leu Ile Ser Ser Trp Xaa Pro Arg Trp Ile Leu Phe Leu
325 330 335Gly Cys Gln His Ser Xaa Ser
Xaa Trp Xaa Ser Leu Xaa Ser Ser Xaa 340 345
350Ser Phe Ser Val Arg Pro Gly Asn Glu Thr Thr Tyr Tyr Arg
Xaa Tyr 355 360 365Ser Gln Leu Arg
Thr Leu Lys Lys Cys Leu Ile Xaa Arg Phe Met Arg 370
375 380Ser Met Leu Val Ile Leu Gly Cys Arg Met Asn Ala
Thr Ala Met Glu385 390 395
400Asp Met Asn Arg Val Tyr Ser Xaa Ser Asn Xaa Ile Ile Pro Val Gly
405 410 415Tyr Phe Leu Asp Gln
Asp Phe Asp Gly Thr Phe Gly Val Asn Leu Ala 420
425 430Ala Pro Glu Gly Asn Ala Phe Leu Asp Val Ser Tyr
Lys Asp Phe Pro 435 440 445Ser Arg
Tyr Pro Gly Ala Val Met Ile Asn Asn Leu Leu Gln Asn Ala 450
455 460Asp Lys Lys Ala Thr Phe Glu Lys Tyr Leu Thr
Glu Thr Val Arg Val465 470 475
480Leu Phe Asn Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His Asn
485 490 495Phe Leu Leu Pro
Asp Leu Glu Trp Asp Arg Ser Ile Val Gln Gln Ser 500
505 510Pro Gly Ile Asn Phe Gly Trp Thr Phe Asp Gln
Val Thr Gln Asn Leu 515 520 525Trp
Gln Gly Val Thr Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala Phe 530
535 540Gly Leu Val Glu Tyr Ile Ala Ala Lys Ala
Gln Ala Val Ala Lys Glu545 550 555
560Phe Asn Ile Ser Ile Val Ser Gln Pro Val Gly Pro Pro Ser Ala
Asn 565 570 575Gly Thr Thr
Ala Ala Ala Pro Ala Pro Ala Ala Gly Asn Ser Thr Gly 580
585 590Lys Gly Gly Asn Gln Ser Ile Ser Ser Ser
Ala Ser Ser Asn Lys Thr 595 600
605Ser Ala Gln Ser Thr Ser Gly Ala Ser Arg Ser Lys Thr Ala Pro Ile 610
615 620Val Leu Ala Ile Ser Ala Leu Ala
Leu Leu Gly Ile Leu625 630
635211809DNALichtheimia corymbifera 21atgaaattat ctattatatc cgctgccttt
ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg taattgctcc taatgcaact
gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc
ccttatttca ctggttcagc tgaagttggt 180tcctcaaaga catacaaata tgttgcaggt
ggaacagaag aaagttttga tcgttctctt 240gatggaatca caaactcaac acttaatgat
ttttataatc gccccgtcac ttatgctaac 300cttcctcaat taccttggcc aattgaaaaa
gaccctcagt ggactcgttc tggaaacaaa 360gccgacattt tcgatgacaa ttatattccc
agcgtttttt tccacggaga tgacagtcaa 420gtccaaaatg tggttaaaaa cgtacctgct
gaccgaatca gtggtacact gacctttatt 480ggatctaatt acgtctactc tttccagaat
gtctcatttg gtattcacgg tgctggcaag 540aaacacaaca atgcaaaaca atcttggaac
tggatattgt ctggaagtga tacgatgggt 600aaccgcaatt tctttaagct tcgacatatg
gaagaagatc ctacacagat ccgtgaacgt 660ctttattctg acattttaca tgccatgggt
acttatgcca atgatgctac catggttcga 720ttgtttatta acaaccaagg cttcggtacc
ttcaacatgt tggatgatat cactcaattc 780tcttatatca atgctaaatt ttataatggc
aaaccacctg ctaccttggg tcctctctat 840gatggtgcct ctggtgcaga tttcttatat
catcctggta acctcgatgg atactcttct 900tgggttgcca acacagccaa tcctaatggt
gaagcttatg aagctcttga tcctctctgt 960aaggcctgga acgagacgac ctataccgat
aatacagcca ttgcaaactt tgaaaaaatg 1020tttgatctcg accgtttcat gcgtttcatg
gttattgaat acttgactgc cgattgggat 1080ggttactgga tgggacagac caatgatggt
gcctatcgtg atccaactga taataacaag 1140tggtactttt tagatcaaga ctttgatggt
acttttggtg tcaacttggc tgcacccgaa 1200ggcaatgctt ttcttgatgt ttcttacaag
gatttccctt ctcgttaccc tggcgctgtc 1260atgatcaaca acctcttaca gaatgctgat
aaaaaggcca cctatgaaaa atatttgact 1320gagactgtgc gtgtgctgtt caataatgtc
accttgacta accgtgtctt ggcccttcac 1380aacttcctct tgcctgatct tgaatgggat
cgttcgatcg ttcaacaatc tcctggtatt 1440aactttggtt ggacatttga tcaagtcact
caaaacttgt ggcaaggtgt cactgcaccc 1500aataacaatg gaggtggtgc tgcttttggt
ttagttgaat atattgctac aaaggcacaa 1560gctgtagcta aggaatttaa tatttctatc
gtttcccaac ctgttggccc tccttctgct 1620aatggtacta ctgctgctgc tcctgctcct
gctgctggca attctactgg aaaaggagga 1680aatcaatcta tttctagcag tgcttcatcc
aacaaaacct cggctcaaag cacatcaggt 1740gcttctcgtt ccaagactgc gcccatcatt
tttagccatt tccgctttag ctctcccttg 1800tattctaaa
180922603PRTLichtheimia corymbifera
22Met Lys Leu Ser Ile Ile Ser Ala Ala Phe Leu Val Ala Ile Thr His1
5 10 15Ala Ala Ser Ile Lys Phe
Asn Val Ile Ala Pro Asn Ala Thr Asp Val 20 25
30Lys Val Ser Val Asn Gly Gln Gln Val Thr Leu Thr Ala
Ser Asp Ala 35 40 45Asn Val Pro
Tyr Phe Thr Gly Ser Ala Glu Val Gly Ser Ser Lys Thr 50
55 60Tyr Lys Tyr Val Ala Gly Gly Thr Glu Glu Ser Phe
Asp Arg Ser Leu65 70 75
80Asp Gly Ile Thr Asn Ser Thr Leu Asn Asp Phe Tyr Asn Arg Pro Val
85 90 95Thr Tyr Ala Asn Leu Pro
Gln Leu Pro Trp Pro Ile Glu Lys Asp Pro 100
105 110Gln Trp Thr Arg Ser Gly Asn Lys Ala Asp Ile Phe
Asp Asp Asn Tyr 115 120 125Ile Pro
Ser Val Phe Phe His Gly Asp Asp Ser Gln Val Gln Asn Val 130
135 140Val Lys Asn Val Pro Ala Asp Arg Ile Ser Gly
Thr Leu Thr Phe Ile145 150 155
160Gly Ser Asn Tyr Val Tyr Ser Phe Gln Asn Val Ser Phe Gly Ile His
165 170 175Gly Ala Gly Lys
Lys His Asn Asn Ala Lys Gln Ser Trp Asn Trp Ile 180
185 190Leu Ser Gly Ser Asp Thr Met Gly Asn Arg Asn
Phe Phe Lys Leu Arg 195 200 205His
Met Glu Glu Asp Pro Thr Gln Ile Arg Glu Arg Leu Tyr Ser Asp 210
215 220Ile Leu His Ala Met Gly Thr Tyr Ala Asn
Asp Ala Thr Met Val Arg225 230 235
240Leu Phe Ile Asn Asn Gln Gly Phe Gly Thr Phe Asn Met Leu Asp
Asp 245 250 255Ile Thr Gln
Phe Ser Tyr Ile Asn Ala Lys Phe Tyr Asn Gly Lys Pro 260
265 270Pro Ala Thr Leu Gly Pro Leu Tyr Asp Gly
Ala Ser Gly Ala Asp Phe 275 280
285Leu Tyr His Pro Gly Asn Leu Asp Gly Tyr Ser Ser Trp Val Ala Asn 290
295 300Thr Ala Asn Pro Asn Gly Glu Ala
Tyr Glu Ala Leu Asp Pro Leu Cys305 310
315 320Lys Ala Trp Asn Glu Thr Thr Tyr Thr Asp Asn Thr
Ala Ile Ala Asn 325 330
335Phe Glu Lys Met Phe Asp Leu Asp Arg Phe Met Arg Phe Met Val Ile
340 345 350Glu Tyr Leu Thr Ala Asp
Trp Asp Gly Tyr Trp Met Gly Gln Thr Asn 355 360
365Asp Gly Ala Tyr Arg Asp Pro Thr Asp Asn Asn Lys Trp Tyr
Phe Leu 370 375 380Asp Gln Asp Phe Asp
Gly Thr Phe Gly Val Asn Leu Ala Ala Pro Glu385 390
395 400Gly Asn Ala Phe Leu Asp Val Ser Tyr Lys
Asp Phe Pro Ser Arg Tyr 405 410
415Pro Gly Ala Val Met Ile Asn Asn Leu Leu Gln Asn Ala Asp Lys Lys
420 425 430Ala Thr Tyr Glu Lys
Tyr Leu Thr Glu Thr Val Arg Val Leu Phe Asn 435
440 445Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His
Asn Phe Leu Leu 450 455 460Pro Asp Leu
Glu Trp Asp Arg Ser Ile Val Gln Gln Ser Pro Gly Ile465
470 475 480Asn Phe Gly Trp Thr Phe Asp
Gln Val Thr Gln Asn Leu Trp Gln Gly 485
490 495Val Thr Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala
Phe Gly Leu Val 500 505 510Glu
Tyr Ile Ala Thr Lys Ala Gln Ala Val Ala Lys Glu Phe Asn Ile 515
520 525Ser Ile Val Ser Gln Pro Val Gly Pro
Pro Ser Ala Asn Gly Thr Thr 530 535
540Ala Ala Ala Pro Ala Pro Ala Ala Gly Asn Ser Thr Gly Lys Gly Gly545
550 555 560Asn Gln Ser Ile
Ser Ser Ser Ala Ser Ser Asn Lys Thr Ser Ala Gln 565
570 575Ser Thr Ser Gly Ala Ser Arg Ser Lys Thr
Ala Pro Ile Ile Phe Ser 580 585
590His Phe Arg Phe Ser Ser Pro Leu Tyr Ser Lys 595
600231916DNALichtheimia corymbifera 23atgaaattat ctattatatc cgctgccttt
ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg taattgctcc taatgcaact
gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc
ccttatttca ctggttcagc tgaagttggt 180tcctcaaaga catacaaagt aatcataaat
ttagtttgaa ttcaatgaga ttaatcatct 240tattctatag tatgttgcag gtggaacaga
agaaagtttt gatcgttctc ttgatggaat 300cacaaactca acacttaatg atttttataa
tcgccccgtc acttatgcta accttcctca 360attaccttgg ccaattgaaa aagacgtaag
ttattttatt tttatctttt ctcagctaaa 420ataaacattg tctttctcag cctcagtgga
ctcgttctgg aaacaaagcc gacattttcg 480atgacaatta tattcccagc gtttttttcc
acggagatga cagtcaagtc caaaatgtgg 540ttaaaaacgt acctgctgac cgaatcagtg
gtacactgac ctttattgga tctaattacg 600tctactcttt ccagaatgtc tcatttggta
ttcacggtgc tggcaagaaa cacaacaatg 660caaaacaatc ttggaactgg atattgtctg
gaagtgatac gatgggtaac cgcaatttct 720ttaagcttcg acatatggaa gaagatccta
cacagatccg tgaacgtctt tattctgaca 780ttttacatgc catgggtact tatgccaatg
atgctaccat ggttcgattg tttattaaca 840accaaggctt cggtaccttc aacatgttgg
atgatatcac tcaattctct tatatcaatg 900ctaaatttta taatggcaaa ccacctgcta
ccttgggtcc tctctatgat ggtgcctctg 960gtgcagattt cttatatcat cctggtaacc
tcgatggata ctcttcttgg gttgccaaca 1020cagccaatcc taatggtgaa gcttatgaag
ctcttgatcc tctctgtaag gcctggaacg 1080agacgaccta taccgataat acagccattg
caaactttga aaaaatgttt gatctcgacc 1140gtttcatgcg tttcatggtt attgaatact
tgactgccga ttgggatggt tactggatgg 1200gacagaccaa tgatggtgcc tatcgtgatc
caactgataa taacaagtgg tactttttag 1260atcaagactt tgatggtact tttggtgtca
acttggctgc acccgaaggc aatgcttttc 1320ttgatgtttc ttacaaggat ttcccttctc
gttaccctgg cgctgtcatg atcaacaacc 1380tcttacagaa tgctgataaa aaggccacct
atgaaaaata tttgactgag actgtgcgtg 1440tgctgttcaa taatgtcacc ttgactaacc
gtgtcttggc ccttcacaac ttcctcttgc 1500ctgatcttga atgggatcgt tcgatcgttc
aacaatctcc tggtattaac tttggttgga 1560catttgatca agtcactcaa aacttgtggc
aaggtgtcac tgcacccaat aacaatggag 1620gtggtgctgc ttttggttta gttgaatata
ttgctacaaa ggcacaagct gtagctaagg 1680aatttaatat ttctatcgtt tcccaacctg
ttggccctcc ttctgctaat ggtactactg 1740ctgctgctcc tgctcctgct gctggcaatt
ctactggaaa aggaggaaat caatctattt 1800ctagcagtgc ttcatccaac aaaacctcgg
ctcaaagcac atcaggtgct tctcgttcca 1860agactgcgcc catcattttt agccatttcc
gctttagctc tcccttgtat tctaaa 191624638PRTLichtheimia
corymbiferaMOD_RES(73)..(73)Any amino acidMOD_RES(76)..(76)Any amino
acidMOD_RES(78)..(78)Any amino acidMOD_RES(94)..(94)Any amino
acidMOD_RES(98)..(98)Any amino acidMOD_RES(106)..(107)Any amino
acidMOD_RES(110)..(110)Any amino acidMOD_RES(117)..(117)Any amino
acidMOD_RES(126)..(126)Any amino acidMOD_RES(193)..(193)Any amino
acidMOD_RES(391)..(391)Any amino acidMOD_RES(420)..(420)Any amino
acidMOD_RES(457)..(457)Any amino acidMOD_RES(475)..(475)Any amino
acidMOD_RES(488)..(488)Any amino acidMOD_RES(547)..(547)Any amino
acidMOD_RES(558)..(558)Any amino acid 24Met Lys Leu Ser Ile Ile Ser Ala
Ala Phe Leu Val Ala Ile Thr His1 5 10
15Ala Ala Ser Ile Lys Phe Asn Val Ile Ala Pro Asn Ala Thr
Asp Val 20 25 30Lys Val Ser
Val Asn Gly Gln Gln Val Thr Leu Thr Ala Ser Asp Ala 35
40 45Asn Val Pro Tyr Phe Thr Gly Ser Ala Glu Val
Gly Ser Ser Lys Thr 50 55 60Tyr Lys
Val Ile Ile Asn Leu Val Xaa Ile Gln Xaa Asp Xaa Ser Ser65
70 75 80Tyr Ser Ile Val Cys Cys Arg
Trp Asn Arg Arg Lys Phe Xaa Ser Phe 85 90
95Ser Xaa Trp Asn His Lys Leu Asn Thr Xaa Xaa Phe Leu
Xaa Ser Pro 100 105 110Arg His
Leu Cys Xaa Pro Ser Ser Ile Thr Leu Ala Asn Xaa Lys Arg 115
120 125Arg Lys Leu Phe Tyr Phe Tyr Leu Phe Ser
Ala Lys Ile Asn Ile Val 130 135 140Phe
Leu Ser Leu Ser Gly Leu Val Leu Glu Thr Lys Pro Thr Phe Ser145
150 155 160Met Thr Ile Ile Phe Pro
Ala Phe Phe Ser Thr Glu Met Thr Val Lys 165
170 175Ser Lys Met Trp Leu Lys Thr Tyr Leu Leu Thr Glu
Ser Val Val His 180 185 190Xaa
Pro Leu Leu Asp Leu Ile Thr Ser Thr Leu Ser Arg Met Ser His 195
200 205Leu Val Phe Thr Val Leu Ala Arg Asn
Thr Thr Met Gln Asn Asn Leu 210 215
220Gly Thr Gly Tyr Cys Leu Glu Val Ile Arg Trp Val Thr Ala Ile Ser225
230 235 240Leu Ser Phe Asp
Ile Trp Lys Lys Ile Leu His Arg Ser Val Asn Val 245
250 255Phe Ile Leu Thr Phe Tyr Met Pro Trp Val
Leu Met Pro Met Met Leu 260 265
270Pro Trp Phe Asp Cys Leu Leu Thr Thr Lys Ala Ser Val Pro Ser Thr
275 280 285Cys Trp Met Ile Ser Leu Asn
Ser Leu Ile Ser Met Leu Asn Phe Ile 290 295
300Met Ala Asn His Leu Leu Pro Trp Val Leu Ser Met Met Val Pro
Leu305 310 315 320Val Gln
Ile Ser Tyr Ile Ile Leu Val Thr Ser Met Asp Thr Leu Leu
325 330 335Gly Leu Pro Thr Gln Pro Ile
Leu Met Val Lys Leu Met Lys Leu Leu 340 345
350Ile Leu Ser Val Arg Pro Gly Thr Arg Arg Pro Ile Pro Ile
Ile Gln 355 360 365Pro Leu Gln Thr
Leu Lys Lys Cys Leu Ile Ser Thr Val Ser Cys Val 370
375 380Ser Trp Leu Leu Asn Thr Xaa Leu Pro Ile Gly Met
Val Thr Gly Trp385 390 395
400Asp Arg Pro Met Met Val Pro Ile Val Ile Gln Leu Ile Ile Thr Ser
405 410 415Gly Thr Phe Xaa Ile
Lys Thr Leu Met Val Leu Leu Val Ser Thr Trp 420
425 430Leu His Pro Lys Ala Met Leu Phe Leu Met Phe Leu
Thr Arg Ile Ser 435 440 445Leu Leu
Val Thr Leu Ala Leu Ser Xaa Ser Thr Thr Ser Tyr Arg Met 450
455 460Leu Ile Lys Arg Pro Pro Met Lys Asn Ile Xaa
Leu Arg Leu Cys Val465 470 475
480Cys Cys Ser Ile Met Ser Pro Xaa Leu Thr Val Ser Trp Pro Phe Thr
485 490 495Thr Ser Ser Cys
Leu Ile Leu Asn Gly Ile Val Arg Ser Phe Asn Asn 500
505 510Leu Leu Val Leu Thr Leu Val Gly His Leu Ile
Lys Ser Leu Lys Thr 515 520 525Cys
Gly Lys Val Ser Leu His Pro Ile Thr Met Glu Val Val Leu Leu 530
535 540Leu Val Xaa Leu Asn Ile Leu Leu Gln Arg
His Lys Leu Xaa Leu Arg545 550 555
560Asn Leu Ile Phe Leu Ser Phe Pro Asn Leu Leu Ala Leu Leu Leu
Leu 565 570 575Met Val Leu
Leu Leu Leu Leu Leu Leu Leu Leu Leu Ala Ile Leu Leu 580
585 590Glu Lys Glu Glu Ile Asn Leu Phe Leu Ala
Val Leu His Pro Thr Lys 595 600
605Pro Arg Leu Lys Ala His Gln Val Leu Leu Val Pro Arg Leu Arg Pro 610
615 620Ser Phe Leu Ala Ile Ser Ala Leu
Ala Leu Pro Cys Ile Leu625 630
635251803DNACunninghamella bertholetiae 25atgaaattat ctattatatc
cgctgccttt ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg taattgctcc
taatgcaact gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga
tgcaaatgtc ccttatttca ctggttcagc tgaagttggt 180gcctcaaaga catacaaata
tgttgcaggt ggaacagaag aaagttttga tcgttctctt 240gatggaatca caaactcaac
acttaatgat ttttataacc gccccgtcac ttatgctaac 300cttcctcaat taccttggcc
aattgaaaaa gaccctcagt ggactcgttc tggaagcaaa 360gccgacattt tcgatgacaa
ttatattccc agcgtttttt tccacggaga tgacagtcaa 420gtccaaaatg tggttaaaaa
cgtacctgct gaccgaatca gtggtacact gacctttatt 480ggatctaatt acgtctactc
tttccagaat gtctcatttg gtattcacgg tgctggcaag 540aaacacaaca atgcaaaaca
atcttggaac tggatattgt ctggaagtga tacgatgggt 600aaccgcaatt tctttaagct
tcgacatatg gaagaagatc ctacacagat tcgtgaacgt 660ctttattctg acattttaca
tgccatgggt acttatgcca atgatgctac catggttcga 720ttgtttatta acaaccaagg
cttcggtacc ttcaacatgt tggatgatat cactcaattc 780tcctatatca atgctaaatt
ttataatggc aaaccacctg ctaccttggg tcctctctat 840gatggtgcct ctggtgcaga
cttcttatat catcctggta acctcgatgg atactcttct 900tgggttgcca acacagccaa
tcctaatgtg aagcttatga agcctcttga tcctctctgt 960agcctggaac gagacgacct
aataccgata atacagccat tgcaaacttt gaaaaaatgt 1020ttgatctcga ccgtttcatg
cgtttcatgg ttattgaata cttgactgcc gattgggatg 1080gttactggat gggacagacc
aatgatggtg cctatcgtga tccaactgat aataacaagt 1140ggtacttttt agatcaagac
tttgatggta cttttggtgt caacttggct gcacccgaag 1200gcaatgcttt tcttgatgtt
tcttacaagg atttcccttc tcgttaccct ggcgctgtca 1260tgatcaacaa cctcttacag
aatgctgata aaaaggccac ctttgaaaaa tatttgactg 1320agactgtgcg tgtgctgttc
aataatgtca ccttgactaa ccgtgtcttg gcccttcaca 1380acttcctctt gcctgatctt
gaatgggatc gttcgatcgt tcaacaatct cctggtatta 1440actttggttg gacatttgat
caagtcactc aaaacttgtg gcaaggtgtc actgcaccca 1500ataacaatgg aggtggtgct
gcttttggtt tagttgaata tattgctgca aaggcacaag 1560ctgtagctaa ggaatttaat
atttctatcg tttcccaacc tgttggccct ccttctgcta 1620atggtactac tgctgctgct
ctgctctgct gctgcaattc tactggaaaa gagaaatcaa 1680tctattttct agcagtgctt
catcaacaaa gctcggctca aggcacatca gtgccttctc 1740gatcaagact gcgcccatcg
attaagcagt tcgctttagc ttccctgggg taatctccaa 1800aaa
180326636PRTCunninghamella
bertholetiaeMOD_RES(73)..(73)Any amino acidMOD_RES(76)..(76)Any amino
acidMOD_RES(78)..(78)Any amino acidMOD_RES(94)..(94)Any amino
acidMOD_RES(98)..(98)Any amino acidMOD_RES(106)..(107)Any amino
acidMOD_RES(110)..(110)Any amino acidMOD_RES(117)..(117)Any amino
acidMOD_RES(126)..(126)Any amino acidMOD_RES(161)..(161)Any amino
acidMOD_RES(173)..(173)Any amino acidMOD_RES(181)..(181)Any amino
acidMOD_RES(186)..(186)Any amino acidMOD_RES(198)..(198)Any amino
acidMOD_RES(232)..(232)Any amino acidMOD_RES(236)..(236)Any amino
acidMOD_RES(241)..(241)Any amino acidMOD_RES(254)..(254)Any amino
acidMOD_RES(259)..(259)Any amino acidMOD_RES(270)..(270)Any amino
acidMOD_RES(279)..(279)Any amino acidMOD_RES(291)..(291)Any amino
acidMOD_RES(301)..(301)Any amino acidMOD_RES(304)..(304)Any amino
acidMOD_RES(316)..(316)Any amino acidMOD_RES(329)..(329)Any amino
acidMOD_RES(344)..(344)Any amino acidMOD_RES(352)..(352)Any amino
acidMOD_RES(356)..(356)Any amino acidMOD_RES(633)..(633)Any amino acid
26Met Lys Leu Ser Ile Ile Ser Ala Ala Phe Leu Val Ala Ile Thr His1
5 10 15Ala Ala Ser Ile Lys Phe
Asn Val Ile Ala Pro Asn Ala Thr Asp Val 20 25
30Lys Val Ser Val Asn Gly Gln Gln Val Thr Leu Thr Ala
Ser Asp Ala 35 40 45Asn Val Pro
Tyr Phe Thr Gly Ser Ala Glu Val Gly Ala Ser Lys Thr 50
55 60Tyr Lys Val Ile Ile Asn Leu Val Xaa Ile Gln Xaa
Asp Xaa Ser Ser65 70 75
80Tyr Ser Ile Val Cys Cys Arg Trp Asn Arg Arg Lys Phe Xaa Ser Phe
85 90 95Ser Xaa Trp Asn His Lys
Leu Asn Thr Xaa Xaa Phe Leu Xaa Pro Pro 100
105 110Arg His Leu Cys Xaa Pro Ser Ser Ile Thr Leu Ala
Asn Xaa Lys Arg 115 120 125Arg Lys
Leu Phe Tyr Phe Tyr Leu Phe Ser Ala Lys Ile Asn Ile Val 130
135 140Phe Ser Ala Ser Val Asp Ser Phe Trp Lys Gln
Ser Arg His Phe Arg145 150 155
160Xaa Gln Leu Tyr Ser Gln Arg Phe Phe Pro Arg Arg Xaa Gln Ser Ser
165 170 175Pro Lys Cys Gly
Xaa Lys Arg Thr Cys Xaa Pro Asn Gln Trp Tyr Thr 180
185 190Asp Leu Tyr Trp Ile Xaa Leu Arg Leu Leu Phe
Pro Glu Cys Leu Ile 195 200 205Trp
Tyr Ser Arg Cys Trp Gln Glu Thr Gln Gln Cys Lys Thr Ile Leu 210
215 220Glu Leu Asp Ile Val Trp Lys Xaa Tyr Asp
Gly Xaa Pro Gln Phe Leu225 230 235
240Xaa Ala Ser Thr Tyr Gly Arg Arg Ser Tyr Thr Asp Ser Xaa Thr
Ser 245 250 255Leu Phe Xaa
His Phe Thr Cys His Gly Tyr Leu Cys Gln Xaa Cys Tyr 260
265 270His Gly Ser Ile Val Tyr Xaa Gln Pro Arg
Leu Arg Tyr Leu Gln His 275 280
285Val Gly Xaa Tyr His Ser Ile Leu Leu Tyr Gln Cys Xaa Ile Leu Xaa 290
295 300Trp Gln Thr Thr Cys Tyr Leu Gly
Ser Ser Leu Xaa Trp Cys Leu Trp305 310
315 320Cys Arg Leu Leu Ile Ser Ser Trp Xaa Pro Arg Trp
Ile Leu Phe Leu 325 330
335Gly Cys Gln His Ser Gln Ser Xaa Cys Glu Ala Tyr Glu Ala Ser Xaa
340 345 350Ser Ser Leu Xaa Pro Gly
Thr Arg Arg Pro Asn Thr Asp Asn Thr Ala 355 360
365Ile Ala Asn Phe Glu Lys Met Phe Asp Leu Asp Arg Phe Met
Arg Phe 370 375 380Met Val Ile Glu Tyr
Leu Thr Ala Asp Trp Asp Gly Tyr Trp Met Gly385 390
395 400Gln Thr Asn Asp Gly Ala Tyr Arg Asp Pro
Thr Asp Asn Asn Lys Trp 405 410
415Tyr Phe Leu Asp Gln Asp Phe Asp Gly Thr Phe Gly Val Asn Leu Ala
420 425 430Ala Pro Glu Gly Asn
Ala Phe Leu Asp Val Ser Tyr Lys Asp Phe Pro 435
440 445Ser Arg Tyr Pro Gly Ala Val Met Ile Asn Asn Leu
Leu Gln Asn Ala 450 455 460Asp Lys Lys
Ala Thr Phe Glu Lys Tyr Leu Thr Glu Thr Val Arg Val465
470 475 480Leu Phe Asn Asn Val Thr Leu
Thr Asn Arg Val Leu Ala Leu His Asn 485
490 495Phe Leu Leu Pro Asp Leu Glu Trp Asp Arg Ser Ile
Val Gln Gln Ser 500 505 510Pro
Gly Ile Asn Phe Gly Trp Thr Phe Asp Gln Val Thr Gln Asn Leu 515
520 525Trp Gln Gly Val Thr Ala Pro Asn Asn
Asn Gly Gly Gly Ala Ala Phe 530 535
540Gly Leu Val Glu Tyr Ile Ala Ala Lys Ala Gln Ala Val Ala Lys Glu545
550 555 560Phe Asn Ile Ser
Ile Val Ser Gln Pro Val Gly Pro Pro Ser Ala Asn 565
570 575Gly Thr Thr Ala Ala Ala Leu Leu Cys Cys
Cys Asn Ser Thr Gly Lys 580 585
590Glu Lys Ser Ile Tyr Phe Leu Ala Val Leu His Gln Gln Ser Ser Ala
595 600 605Gln Gly Thr Ser Val Pro Ser
Arg Ser Arg Leu Arg Pro Ser Ile Lys 610 615
620Gln Phe Ala Leu Ala Ser Leu Gly Xaa Ser Pro Lys625
630 635271909DNACunninghamella bertholetiae 27atgaaattat
ctattatatc cgctgccttt ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg
taattgctcc taatgcaact gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta
ctgcttcaga tgcaaatgtc ccttatttca ctggttcagc tgaagttggt 180gcctcaaaga
catacaaagt aatcataaat ttagtttgaa ttcaatgaga ttaatcatct 240tattctatag
tatgttgcag gtggaacaga agaaagtttt gatcgttctc ttgatggaat 300cacaaactca
acacttaatg atttttataa ccgccccgtc acttatgcta accttcctca 360attaccttgg
ccaattgaaa aagacgtaag ttattttatt tttatctttt ctcagctaaa 420ataaacattg
tcttctcagc ctcagtggac tcgttctgga agcaaagccg acattttcga 480tgacaattat
attcccagcg tttttttcca cggagatgac agtcaagtcc aaaatgtggt 540taaaaacgta
cctgctgacc gaatcagtgg tacactgacc tttattggat ctaattacgt 600ctactctttc
cagaatgtct catttggtat tcacggtgct ggcaagaaac acaacaatgc 660aaaacaatct
tggaactgga tattgtctgg aagtgatacg atgggtaacc gcaatttctt 720taagcttcga
catatggaag aagatcctac acagattcgt gaacgtcttt attctgacat 780tttacatgcc
atgggtactt atgccaatga tgctaccatg gttcgattgt ttattaacaa 840ccaaggcttc
ggtaccttca acatgttgga tgatatcact caattctcct atatcaatgc 900taaattttat
aatggcaaac cacctgctac cttgggtcct ctctatgatg gtgcctctgg 960tgcagacttc
ttatatcatc ctggtaacct cgatggatac tcttcttggg ttgccaacac 1020agccaatcct
aatgtgaagc ttatgaagcc tcttgatcct ctctgtagcc tggaacgaga 1080cgacctaata
ccgataatac agccattgca aactttgaaa aaatgtttga tctcgaccgt 1140ttcatgcgtt
tcatggttat tgaatacttg actgccgatt gggatggtta ctggatggga 1200cagaccaatg
atggtgccta tcgtgatcca actgataata acaagtggta ctttttagat 1260caagactttg
atggtacttt tggtgtcaac ttggctgcac ccgaaggcaa tgcttttctt 1320gatgtttctt
acaaggattt cccttctcgt taccctggcg ctgtcatgat caacaacctc 1380ttacagaatg
ctgataaaaa ggccaccttt gaaaaatatt tgactgagac tgtgcgtgtg 1440ctgttcaata
atgtcacctt gactaaccgt gtcttggccc ttcacaactt cctcttgcct 1500gatcttgaat
gggatcgttc gatcgttcaa caatctcctg gtattaactt tggttggaca 1560tttgatcaag
tcactcaaaa cttgtggcaa ggtgtcactg cacccaataa caatggaggt 1620ggtgctgctt
ttggtttagt tgaatatatt gctgcaaagg cacaagctgt agctaaggaa 1680tttaatattt
ctatcgtttc ccaacctgtt ggccctcctt ctgctaatgg tactactgct 1740gctgctctgc
tctgctgctg caattctact ggaaaagaga aatcaatcta ttttctagca 1800gtgcttcatc
aacaaagctc ggctcaaggc acatcagtgc cttctcgatc aagactgcgc 1860ccatcgatta
agcagttcgc tttagcttcc ctggggtaat ctccaaaaa
190928636PRTCunninghamella bertholetiaeMOD_RES(73)..(73)Any amino
acidMOD_RES(76)..(76)Any amino acidMOD_RES(78)..(78)Any amino
acidMOD_RES(94)..(94)Any amino acidMOD_RES(98)..(98)Any amino
acidMOD_RES(106)..(107)Any amino acidMOD_RES(110)..(110)Any amino
acidMOD_RES(117)..(117)Any amino acidMOD_RES(126)..(126)Any amino
acidMOD_RES(161)..(161)Any amino acidMOD_RES(173)..(173)Any amino
acidMOD_RES(181)..(181)Any amino acidMOD_RES(186)..(186)Any amino
acidMOD_RES(198)..(198)Any amino acidMOD_RES(232)..(232)Any amino
acidMOD_RES(236)..(236)Any amino acidMOD_RES(241)..(241)Any amino
acidMOD_RES(254)..(254)Any amino acidMOD_RES(259)..(259)Any amino
acidMOD_RES(270)..(270)Any amino acidMOD_RES(279)..(279)Any amino
acidMOD_RES(291)..(291)Any amino acidMOD_RES(301)..(301)Any amino
acidMOD_RES(304)..(304)Any amino acidMOD_RES(316)..(316)Any amino
acidMOD_RES(329)..(329)Any amino acidMOD_RES(344)..(344)Any amino
acidMOD_RES(352)..(352)Any amino acidMOD_RES(356)..(356)Any amino
acidMOD_RES(633)..(633)Any amino acid 28Met Lys Leu Ser Ile Ile Ser Ala
Ala Phe Leu Val Ala Ile Thr His1 5 10
15Ala Ala Ser Ile Lys Phe Asn Val Ile Ala Pro Asn Ala Thr
Asp Val 20 25 30Lys Val Ser
Val Asn Gly Gln Gln Val Thr Leu Thr Ala Ser Asp Ala 35
40 45Asn Val Pro Tyr Phe Thr Gly Ser Ala Glu Val
Gly Ala Ser Lys Thr 50 55 60Tyr Lys
Val Ile Ile Asn Leu Val Xaa Ile Gln Xaa Asp Xaa Ser Ser65
70 75 80Tyr Ser Ile Val Cys Cys Arg
Trp Asn Arg Arg Lys Phe Xaa Ser Phe 85 90
95Ser Xaa Trp Asn His Lys Leu Asn Thr Xaa Xaa Phe Leu
Xaa Pro Pro 100 105 110Arg His
Leu Cys Xaa Pro Ser Ser Ile Thr Leu Ala Asn Xaa Lys Arg 115
120 125Arg Lys Leu Phe Tyr Phe Tyr Leu Phe Ser
Ala Lys Ile Asn Ile Val 130 135 140Phe
Ser Ala Ser Val Asp Ser Phe Trp Lys Gln Ser Arg His Phe Arg145
150 155 160Xaa Gln Leu Tyr Ser Gln
Arg Phe Phe Pro Arg Arg Xaa Gln Ser Ser 165
170 175Pro Lys Cys Gly Xaa Lys Arg Thr Cys Xaa Pro Asn
Gln Trp Tyr Thr 180 185 190Asp
Leu Tyr Trp Ile Xaa Leu Arg Leu Leu Phe Pro Glu Cys Leu Ile 195
200 205Trp Tyr Ser Arg Cys Trp Gln Glu Thr
Gln Gln Cys Lys Thr Ile Leu 210 215
220Glu Leu Asp Ile Val Trp Lys Xaa Tyr Asp Gly Xaa Pro Gln Phe Leu225
230 235 240Xaa Ala Ser Thr
Tyr Gly Arg Arg Ser Tyr Thr Asp Ser Xaa Thr Ser 245
250 255Leu Phe Xaa His Phe Thr Cys His Gly Tyr
Leu Cys Gln Xaa Cys Tyr 260 265
270His Gly Ser Ile Val Tyr Xaa Gln Pro Arg Leu Arg Tyr Leu Gln His
275 280 285Val Gly Xaa Tyr His Ser Ile
Leu Leu Tyr Gln Cys Xaa Ile Leu Xaa 290 295
300Trp Gln Thr Thr Cys Tyr Leu Gly Ser Ser Leu Xaa Trp Cys Leu
Trp305 310 315 320Cys Arg
Leu Leu Ile Ser Ser Trp Xaa Pro Arg Trp Ile Leu Phe Leu
325 330 335Gly Cys Gln His Ser Gln Ser
Xaa Cys Glu Ala Tyr Glu Ala Ser Xaa 340 345
350Ser Ser Leu Xaa Pro Gly Thr Arg Arg Pro Asn Thr Asp Asn
Thr Ala 355 360 365Ile Ala Asn Phe
Glu Lys Met Phe Asp Leu Asp Arg Phe Met Arg Phe 370
375 380Met Val Ile Glu Tyr Leu Thr Ala Asp Trp Asp Gly
Tyr Trp Met Gly385 390 395
400Gln Thr Asn Asp Gly Ala Tyr Arg Asp Pro Thr Asp Asn Asn Lys Trp
405 410 415Tyr Phe Leu Asp Gln
Asp Phe Asp Gly Thr Phe Gly Val Asn Leu Ala 420
425 430Ala Pro Glu Gly Asn Ala Phe Leu Asp Val Ser Tyr
Lys Asp Phe Pro 435 440 445Ser Arg
Tyr Pro Gly Ala Val Met Ile Asn Asn Leu Leu Gln Asn Ala 450
455 460Asp Lys Lys Ala Thr Phe Glu Lys Tyr Leu Thr
Glu Thr Val Arg Val465 470 475
480Leu Phe Asn Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His Asn
485 490 495Phe Leu Leu Pro
Asp Leu Glu Trp Asp Arg Ser Ile Val Gln Gln Ser 500
505 510Pro Gly Ile Asn Phe Gly Trp Thr Phe Asp Gln
Val Thr Gln Asn Leu 515 520 525Trp
Gln Gly Val Thr Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala Phe 530
535 540Gly Leu Val Glu Tyr Ile Ala Ala Lys Ala
Gln Ala Val Ala Lys Glu545 550 555
560Phe Asn Ile Ser Ile Val Ser Gln Pro Val Gly Pro Pro Ser Ala
Asn 565 570 575Gly Thr Thr
Ala Ala Ala Leu Leu Cys Cys Cys Asn Ser Thr Gly Lys 580
585 590Glu Lys Ser Ile Tyr Phe Leu Ala Val Leu
His Gln Gln Ser Ser Ala 595 600
605Gln Gly Thr Ser Val Pro Ser Arg Ser Arg Leu Arg Pro Ser Ile Lys 610
615 620Gln Phe Ala Leu Ala Ser Leu Gly
Xaa Ser Pro Lys625 630
635291807DNARhizopus microsporus 29atgaaattat ctattatatc cgctgccttt
ttagtggcta ttacacacgc tgcttcaata 60aagtttaatg taattgctcc taatgcaact
gatgtcaaag tatctgtaaa tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc
ccttatttca ctggttcagc tgaagttggt 180gcctcaaaga catacaaata tgttgcaggt
ggaacagaag aaagttttga tcgttctctt 240gatggaatca caaactcaac acttaatgat
ttttataacc gccccgtcac ttatgctaac 300cttcctcaat taccttggcc aattgaaaaa
gaccctcagt ggactcgttc tggaagcaaa 360gccgacattt tcgatgacaa ttatattccc
agcgtttttt tccacggaga tgacagtcaa 420gtccaaaatg tggttaaaaa cgtacctgct
gaccgaatca gtggtacact gacctttatt 480ggatctaatt acgtctactc tttccagaat
gtctcatttg gtattcacgg tgctggcaag 540aaacacaaca atgcaaaaca atcttggaac
tggatattgt ctggaagtga tacgatgggt 600aaccgcaatt tctttaagct tcgacatatg
gaagaagatc ctacacagat tcgtgaacgt 660ctttattctg acattttaca tgccatgggt
acttatgcca atgatgctac catggttcga 720ttgtttatta acaaccaagg cttcggtacc
ttcaacatgt tggatgatat cactcaattc 780tcctatatca atgctaaatt ttataatggc
aaaccacctg ctaccttggg tcctctctat 840gatggtgcct ctggtgcaga cttcttatat
catcctggta acctcgatgg atactcttct 900tgggttgcca acacagccaa tcctaatggt
gaagcttatg aagctcttga tcctctctgt 960aaggcctgga acgagacgac ctataccgat
aatacagcca ttgcaaactt tgaaaaaatg 1020tttgatctcg accgtttcat gcgtttcatg
gttattgaat acttgactgc cgattgggat 1080ggttactgga tgggacagac caatgatggt
gcctatcgtg atccaactga taataacaag 1140tggtactttt tagatcaaga ctttgatggt
acttttggtg tcaacttggc tgcacccgaa 1200ggcaatgctt ttcttgatgt ttcttacaag
gatttccctt ctcgttaccc tggcgctgtc 1260atgatcaaca acctcttaca gaatgctgat
aaaaaggcca cctttgaaaa atatttgact 1320gagactgtgc gtgtgctgtt caataatgtc
accttgacta accgtgtctt ggcccttcac 1380aacttcctct tgcctgatct tgaatgggat
cgttcgatcg ttcaacaatc tcctggtatt 1440aactttggtt ggacatttga tcaagtcact
caaaacttgt ggcaaggtgt cactgcaccc 1500aataacaatg gaggtggtgc tgcttttggt
ttagttgaat atattgctgc aaaggcacaa 1560gctgtagcta aggaatttaa tatttctatc
gtttcccaac ctgttggccc tccttctgct 1620aatggtacta ctgctgctgc tcctgctcct
gctgctggca attctactgg aaaaggagga 1680aatcaatcta tttctagcag tgcttcatcc
aacaaaacct cggctcaaag cacatcaggt 1740gcttctcgtt ccaagactgc gcccatcgtt
ttagccattt ccgctttagc tctccttgta 1800ttctaaa
180730602PRTRhizopus
microsporusMOD_RES(602)..(602)Any amino acid 30Met Lys Leu Ser Ile Ile
Ser Ala Ala Phe Leu Val Ala Ile Thr His1 5
10 15Ala Ala Ser Ile Lys Phe Asn Val Ile Ala Pro Asn
Ala Thr Asp Val 20 25 30Lys
Val Ser Val Asn Gly Gln Gln Val Thr Leu Thr Ala Ser Asp Ala 35
40 45Asn Val Pro Tyr Phe Thr Gly Ser Ala
Glu Val Gly Ala Ser Lys Thr 50 55
60Tyr Lys Tyr Val Ala Gly Gly Thr Glu Glu Ser Phe Asp Arg Ser Leu65
70 75 80Asp Gly Ile Thr Asn
Ser Thr Leu Asn Asp Phe Tyr Asn Arg Pro Val 85
90 95Thr Tyr Ala Asn Leu Pro Gln Leu Pro Trp Pro
Ile Glu Lys Asp Pro 100 105
110Gln Trp Thr Arg Ser Gly Ser Lys Ala Asp Ile Phe Asp Asp Asn Tyr
115 120 125Ile Pro Ser Val Phe Phe His
Gly Asp Asp Ser Gln Val Gln Asn Val 130 135
140Val Lys Asn Val Pro Ala Asp Arg Ile Ser Gly Thr Leu Thr Phe
Ile145 150 155 160Gly Ser
Asn Tyr Val Tyr Ser Phe Gln Asn Val Ser Phe Gly Ile His
165 170 175Gly Ala Gly Lys Lys His Asn
Asn Ala Lys Gln Ser Trp Asn Trp Ile 180 185
190Leu Ser Gly Ser Asp Thr Met Gly Asn Arg Asn Phe Phe Lys
Leu Arg 195 200 205His Met Glu Glu
Asp Pro Thr Gln Ile Arg Glu Arg Leu Tyr Ser Asp 210
215 220Ile Leu His Ala Met Gly Thr Tyr Ala Asn Asp Ala
Thr Met Val Arg225 230 235
240Leu Phe Ile Asn Asn Gln Gly Phe Gly Thr Phe Asn Met Leu Asp Asp
245 250 255Ile Thr Gln Phe Ser
Tyr Ile Asn Ala Lys Phe Tyr Asn Gly Lys Pro 260
265 270Pro Ala Thr Leu Gly Pro Leu Tyr Asp Gly Ala Ser
Gly Ala Asp Phe 275 280 285Leu Tyr
His Pro Gly Asn Leu Asp Gly Tyr Ser Ser Trp Val Ala Asn 290
295 300Thr Ala Asn Pro Asn Gly Glu Ala Tyr Glu Ala
Leu Asp Pro Leu Cys305 310 315
320Lys Ala Trp Asn Glu Thr Thr Tyr Thr Asp Asn Thr Ala Ile Ala Asn
325 330 335Phe Glu Lys Met
Phe Asp Leu Asp Arg Phe Met Arg Phe Met Val Ile 340
345 350Glu Tyr Leu Thr Ala Asp Trp Asp Gly Tyr Trp
Met Gly Gln Thr Asn 355 360 365Asp
Gly Ala Tyr Arg Asp Pro Thr Asp Asn Asn Lys Trp Tyr Phe Leu 370
375 380Asp Gln Asp Phe Asp Gly Thr Phe Gly Val
Asn Leu Ala Ala Pro Glu385 390 395
400Gly Asn Ala Phe Leu Asp Val Ser Tyr Lys Asp Phe Pro Ser Arg
Tyr 405 410 415Pro Gly Ala
Val Met Ile Asn Asn Leu Leu Gln Asn Ala Asp Lys Lys 420
425 430Ala Thr Phe Glu Lys Tyr Leu Thr Glu Thr
Val Arg Val Leu Phe Asn 435 440
445Asn Val Thr Leu Thr Asn Arg Val Leu Ala Leu His Asn Phe Leu Leu 450
455 460Pro Asp Leu Glu Trp Asp Arg Ser
Ile Val Gln Gln Ser Pro Gly Ile465 470
475 480Asn Phe Gly Trp Thr Phe Asp Gln Val Thr Gln Asn
Leu Trp Gln Gly 485 490
495Val Thr Ala Pro Asn Asn Asn Gly Gly Gly Ala Ala Phe Gly Leu Val
500 505 510Glu Tyr Ile Ala Ala Lys
Ala Gln Ala Val Ala Lys Glu Phe Asn Ile 515 520
525Ser Ile Val Ser Gln Pro Val Gly Pro Pro Ser Ala Asn Gly
Thr Thr 530 535 540Ala Ala Ala Pro Ala
Pro Ala Ala Gly Asn Ser Thr Gly Lys Gly Gly545 550
555 560Asn Gln Ser Ile Ser Ser Ser Ala Ser Ser
Asn Lys Thr Ser Ala Gln 565 570
575Ser Thr Ser Gly Ala Ser Arg Ser Lys Thr Ala Pro Ile Val Leu Ala
580 585 590Ile Ser Ala Leu Ala
Leu Leu Val Phe Xaa 595 600311862DNARhizopus
microsporus 31atgaaattat ctattatatc cgctgccttt ttagtggcta ttacacacgc
tgcttcaata 60aagtttaatg taattgctcc taatgcaact gatgtcaaag tatctgtaaa
tggacagcaa 120gtgacactta ctgcttcaga tgcaaatgtc ccttatttca ctggttcagc
tgaagttggt 180gcctcaaaga catacaaata tgttgcaggt ggaacagaag aaagttttga
tcgttctctt 240gatggaatca caaactcaac acttaatgat ttttataacc gccccgtcac
ttatgctaac 300cttcctcaat taccttggcc aattgaaaaa gacgtaagtt attttatttt
tatcttttct 360cagctaaaat aaacattgtc tttctcagcc tcagtggact cgttctggaa
gcaaagccga 420cattttcgat gacaattata ttcccagcgt ttttttccac ggagatgaca
gtcaagtcca 480aaatgtggtt aaaaacgtac ctgctgaccg aatcagtggt acactgacct
ttattggatc 540taattacgtc tactctttcc agaatgtctc atttggtatt cacggtgctg
gcaagaaaca 600caacaatgca aaacaatctt ggaactggat attgtctgga agtgatacga
tgggtaaccg 660caatttcttt aagcttcgac atatggaaga agatcctaca cagattcgtg
aacgtcttta 720ttctgacatt ttacatgcca tgggtactta tgccaatgat gctaccatgg
ttcgattgtt 780tattaacaac caaggcttcg gtaccttcaa catgttggat gatatcactc
aattctccta 840tatcaatgct aaattttata atggcaaacc acctgctacc ttgggtcctc
tctatgatgg 900tgcctctggt gcagacttct tatatcatcc tggtaacctc gatggatact
cttcttgggt 960tgccaacaca gccaatccta atggtgaagc ttatgaagct cttgatcctc
tctgtaaggc 1020ctggaacgag acgacctata ccgataatac agccattgca aactttgaaa
aaatgtttga 1080tctcgaccgt ttcatgcgtt tcatggttat tgaatacttg actgccgatt
gggatggtta 1140ctggatggga cagaccaatg atggtgccta tcgtgatcca actgataata
acaagtggta 1200ctttttagat caagactttg atggtacttt tggtgtcaac ttggctgcac
ccgaaggcaa 1260tgcttttctt gatgtttctt acaaggattt cccttctcgt taccctggcg
ctgtcatgat 1320caacaacctc ttacagaatg ctgataaaaa ggccaccttt gaaaaatatt
tgactgagac 1380tgtgcgtgtg ctgttcaata atgtcacctt gactaaccgt gtcttggccc
ttcacaactt 1440cctcttgcct gatcttgaat gggatcgttc gatcgttcaa caatctcctg
gtattaactt 1500tggttggaca tttgatcaag tcactcaaaa cttgtggcaa ggtgtcactg
cacccaataa 1560caatggaggt ggtgctgctt ttggtttagt tgaatatatt gctgcaaagg
cacaagctgt 1620agctaaggaa tttaatattt ctatcgtttc ccaacctgtt ggccctcctt
ctgctaatgg 1680tactactgct gctgctcctg ctcctgctgc tggcaattct actggaaaag
gaggaaatca 1740atctatttct agcagtgctt catccaacaa aacctcggct caaagcacat
caggtgcttc 1800tcgttccaag actgcgccca tcgttttagc catttccgct ttagctctcc
ttgtattcta 1860aa
186232638PRTRhizopus microsporusMOD_RES(73)..(73)Any amino
acidMOD_RES(76)..(76)Any amino acidMOD_RES(78)..(78)Any amino
acidMOD_RES(94)..(94)Any amino acidMOD_RES(98)..(98)Any amino
acidMOD_RES(106)..(107)Any amino acidMOD_RES(110)..(110)Any amino
acidMOD_RES(117)..(117)Any amino acidMOD_RES(126)..(126)Any amino
acidMOD_RES(193)..(193)Any amino acidMOD_RES(391)..(391)Any amino
acidMOD_RES(420)..(420)Any amino acidMOD_RES(457)..(457)Any amino
acidMOD_RES(475)..(475)Any amino acidMOD_RES(488)..(488)Any amino
acidMOD_RES(547)..(547)Any amino acidMOD_RES(558)..(558)Any amino
acidMOD_RES(627)..(627)Any amino acidMOD_RES(632)..(632)Any amino acid
32Met Lys Leu Ser Ile Ile Ser Ala Ala Phe Leu Val Ala Ile Thr His1
5 10 15Ala Ala Ser Ile Lys Phe
Asn Val Ile Ala Pro Asn Ala Thr Asp Val 20 25
30Lys Val Ser Val Asn Gly Gln Gln Val Thr Leu Thr Ala
Ser Asp Ala 35 40 45Asn Val Pro
Tyr Phe Thr Gly Ser Ala Glu Val Gly Ala Ser Lys Thr 50
55 60Tyr Lys Val Ile Ile Asn Leu Val Xaa Ile Gln Xaa
Asp Xaa Ser Ser65 70 75
80Tyr Ser Ile Val Cys Cys Arg Trp Asn Arg Arg Lys Phe Xaa Ser Phe
85 90 95Ser Xaa Trp Asn His Lys
Leu Asn Thr Xaa Xaa Phe Leu Xaa Pro Pro 100
105 110Arg His Leu Cys Xaa Pro Ser Ser Ile Thr Leu Ala
Asn Xaa Lys Arg 115 120 125Arg Lys
Leu Phe Tyr Phe Tyr Leu Phe Ser Ala Lys Ile Asn Ile Val 130
135 140Phe Leu Ser Leu Ser Gly Leu Val Leu Glu Ala
Lys Pro Thr Phe Ser145 150 155
160Met Thr Ile Ile Phe Pro Ala Phe Phe Ser Thr Glu Met Thr Val Lys
165 170 175Ser Lys Met Trp
Leu Lys Thr Tyr Leu Leu Thr Glu Ser Val Val His 180
185 190Xaa Pro Leu Leu Asp Leu Ile Thr Ser Thr Leu
Ser Arg Met Ser His 195 200 205Leu
Val Phe Thr Val Leu Ala Arg Asn Thr Thr Met Gln Asn Asn Leu 210
215 220Gly Thr Gly Tyr Cys Leu Glu Val Ile Arg
Trp Val Thr Ala Ile Ser225 230 235
240Leu Ser Phe Asp Ile Trp Lys Lys Ile Leu His Arg Phe Val Asn
Val 245 250 255Phe Ile Leu
Thr Phe Tyr Met Pro Trp Val Leu Met Pro Met Met Leu 260
265 270Pro Trp Phe Asp Cys Leu Leu Thr Thr Lys
Ala Ser Val Pro Ser Thr 275 280
285Cys Trp Met Ile Ser Leu Asn Ser Pro Ile Ser Met Leu Asn Phe Ile 290
295 300Met Ala Asn His Leu Leu Pro Trp
Val Leu Ser Met Met Val Pro Leu305 310
315 320Val Gln Thr Ser Tyr Ile Ile Leu Val Thr Ser Met
Asp Thr Leu Leu 325 330
335Gly Leu Pro Thr Gln Pro Ile Leu Met Val Lys Leu Met Lys Leu Leu
340 345 350Ile Leu Ser Val Arg Pro
Gly Thr Arg Arg Pro Ile Pro Ile Ile Gln 355 360
365Pro Leu Gln Thr Leu Lys Lys Cys Leu Ile Ser Thr Val Ser
Cys Val 370 375 380Ser Trp Leu Leu Asn
Thr Xaa Leu Pro Ile Gly Met Val Thr Gly Trp385 390
395 400Asp Arg Pro Met Met Val Pro Ile Val Ile
Gln Leu Ile Ile Thr Ser 405 410
415Gly Thr Phe Xaa Ile Lys Thr Leu Met Val Leu Leu Val Ser Thr Trp
420 425 430Leu His Pro Lys Ala
Met Leu Phe Leu Met Phe Leu Thr Arg Ile Ser 435
440 445Leu Leu Val Thr Leu Ala Leu Ser Xaa Ser Thr Thr
Ser Tyr Arg Met 450 455 460Leu Ile Lys
Arg Pro Pro Leu Lys Asn Ile Xaa Leu Arg Leu Cys Val465
470 475 480Cys Cys Ser Ile Met Ser Pro
Xaa Leu Thr Val Ser Trp Pro Phe Thr 485
490 495Thr Ser Ser Cys Leu Ile Leu Asn Gly Ile Val Arg
Ser Phe Asn Asn 500 505 510Leu
Leu Val Leu Thr Leu Val Gly His Leu Ile Lys Ser Leu Lys Thr 515
520 525Cys Gly Lys Val Ser Leu His Pro Ile
Thr Met Glu Val Val Leu Leu 530 535
540Leu Val Xaa Leu Asn Ile Leu Leu Gln Arg His Lys Leu Xaa Leu Arg545
550 555 560Asn Leu Ile Phe
Leu Ser Phe Pro Asn Leu Leu Ala Leu Leu Leu Leu 565
570 575Met Val Leu Leu Leu Leu Leu Leu Leu Leu
Leu Leu Ala Ile Leu Leu 580 585
590Glu Lys Glu Glu Ile Asn Leu Phe Leu Ala Val Leu His Pro Thr Lys
595 600 605Pro Arg Leu Lys Ala His Gln
Val Leu Leu Val Pro Arg Leu Arg Pro 610 615
620Ser Phe Xaa Pro Phe Pro Leu Xaa Leu Ser Leu Tyr Ser Lys625
630 6353327DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 33atgaaattat ctattatatc cgctgcc
273423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34gctgggaata taattgtcat cga
233521DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 35gatgacaatt atattcccag c
213622DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36gagtagacgt aattagatcc aa
223722DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 37aaacgtacct gctgaccgaa tc
223836DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
38cgcgatcaaa cgtacctgct gaccgaatcg atcgcg
363915PRTUnknownDescription of Unknown Mucorales CotH peptide 39Gly
Ala Gly Lys Lys His Asn Asn Ala Lys Gln Ser Trp Asn Trp1 5
10 154017PRTUnknownDescription of
Unknown Mucorales CotH peptide 40Met Gly Gln Thr Asn Asp Gly Ala Tyr
Arg Asp Pro Thr Asp Asn Asn1 5 10
15Lys4144DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 41aaaaaacccc ggatcctatg aaatccctac
tttttgttgt attc 444242DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
42tctgttccat gtcgacctag aagaaagagg caaataaagt gc
424346DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 43aaaaaccccg gatcctatga aattatcact cactatagta tcctct
464442DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 44tctgttccat gtcgacttaa aagatagcag tggcaactaa ag
424544DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 45aaaaaacccc ggatcctatg aaattatcta
ttatatccgc tgcc 444641DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46tctgttccat gtcgacttag aatacaagga gagctaaagc g
414739DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 47aaaaaacccc ggatcctatg attgctaccc cttttgaaa
394843DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 48tctgttccat gtcgacttaa aagaaaataa agaatgttgc agc
434927DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 49atgaaattat ctattatatc cgctgcc
275025DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 50ttagaataca aggagagcta aagcg
255133DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51gcatgctaga acagaagaaa gttttgatcg ttc
335226DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 52gtacgacgtt cacgaatctg tgtagg
265328DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 53ccgcgggacg ttcacgaatc tgtgtagg
285432DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 54gctagcagaa cagaagaaag ttttgatcgt tc
325520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 55caaacaaatg atggggccta
205624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
56cgtttttgtt caagatttac acca
245722DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 57cctaataagg acaacgcaaa cg
225820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 58ttggcaatgg ctgtgttatc
205920DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 59gccaatccta atggtgaagc
206020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 60catgaaacgg tcgagatcaa
206120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
61agctcctttg aaccccaagt
206220DNAArtificial SequenceDescription of Artificial Sequence Synthetic
primer 62acgaccagag gcatacaagg
206315DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 63gcggatcgca tggcc
156421DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 64ccatgatagg gcagaaaatc g
2165604PRTStigmatella aurantiaca 65Met Pro
Ser Leu Phe Leu Glu Thr Pro Glu Asp Phe Glu Phe Lys Ala1 5
10 15Ser Val Cys Leu Arg Thr Leu Arg
Gly Trp Met Asn Thr Tyr Arg Pro 20 25
30Leu Val Ile Ala Ser Leu Leu Leu Ser Phe Cys Leu Leu Pro Thr
Ala 35 40 45Cys Gly Asp Asp Lys
Pro Gly Gly Pro Pro Pro Pro Asp Ala Gly Asn 50 55
60Pro Asn Asp Ala Gly Val Pro Asp Ala Gly Gly Pro Ser Glu
Gly Asp65 70 75 80Ala
Gly Asp Gly Gly Glu Ser Pro Asp Ala Gly Asp Ala Gly Glu Pro
85 90 95Gly Asp Ala Gly Asp Gly Gly
Gly Thr Asp Gly Gly Pro Thr Ala Asp 100 105
110Pro Ala Glu Pro Leu Phe Ser Gly His His Ile Ser Arg Phe
Glu Leu 115 120 125Asn Leu Ser Gln
Glu Ala Leu Ala Ser Leu Gln Ala Glu Pro Asp Glu 130
135 140Tyr Val Glu Gly Ala Leu His Leu Gln Val Gly Ala
Gln Ser Ile Asp145 150 155
160Leu Pro Lys Val Gly Val Arg Leu Lys Gly Gln Leu Gly Ser Phe Arg
165 170 175Pro Leu Asn Gln Lys
Ala Ala Phe Val Leu Lys Phe Asp Lys Phe Val 180
185 190Asp Gln Asn Leu Phe Gly Leu Lys Lys Leu Thr Leu
Asn Asn Met Val 195 200 205Gln Asp
Pro Ser Met Ile His Glu Arg Leu Gly Tyr Ala Leu Phe Arg 210
215 220Ala Met Glu Val Pro Ala Pro Arg Ala Ala His
Ala Thr Ile Arg Ile225 230 235
240Asn Gly Ala Leu Tyr Gly Leu Tyr Thr Ala Leu Glu Ser Thr Asp Asn
245 250 255Ser Val Phe Leu
Lys His Trp Phe Gly Ser Asn Asn Gly Asn Leu Tyr 260
265 270Glu Gly Gln Tyr Gly Ser Asp Leu Tyr Leu Gly
Leu Glu Ala Thr Phe 275 280 285Glu
Gln Asp Lys Gly Glu Asp Val Gly Phe Ala Asp Leu Thr Glu Leu 290
295 300Ala Lys Ala Leu Asp Gln Met Thr His Pro
Ala Thr Phe Leu Glu Asp305 310 315
320Val Ala Gln Val Ile Asp Leu Asp Ser Tyr Leu Arg Phe Ala Ala
Thr 325 330 335Glu Leu Phe
Ile Gly His Trp Asp Gly Tyr Val Ser Tyr Arg Asn Asn 340
345 350Phe Tyr Leu Tyr Arg Arg Pro Ser Asp Gly
Arg Trp Val Phe Ile Pro 355 360
365Trp Gly Ile Asp Gln Thr Phe Gly Arg Tyr Val Asp Thr Trp Ser Ala 370
375 380His Gly Arg Leu Gln Arg Met Cys
Ile Glu Ser Leu Pro Cys Arg Tyr385 390
395 400Lys Leu Ala Gln Ala Tyr Glu Gln Val Leu Leu Arg
Val Glu Glu Leu 405 410
415Ser Met Val Glu Gln Ala Met Ala Leu Gly Thr Phe Leu Trp Thr Asp
420 425 430Val Gln Glu Asp Pro Arg
Lys Glu Val Asp Val Gly Thr Val Phe Ser 435 440
445Lys Met Thr Glu Ala Ile Asp Phe Leu Lys Asn Arg Pro Thr
Asp Val 450 455 460Arg Leu Arg Leu Gly
Cys Val Asp Pro Met Gly Cys Glu Arg Cys Thr465 470
475 480Leu Ala Pro Ala Pro Gly Gly Gly Arg Leu
Ala Phe Cys Thr Gly Thr 485 490
495Val Thr Trp Ala Ala Ala Glu Ala Asp Cys Val Ala Gln Gly Gly His
500 505 510Leu Val Ser Ile His
Asp Gln Pro Thr Gln Thr Ala Val Arg Ala Gly 515
520 525Ala Arg Ala Leu Ser Thr Gly Pro Trp Trp Ile Gly
Leu Ser Asp Glu 530 535 540Ala Glu Glu
Gly Thr Phe Ala Trp Ser Asp Gln Thr Pro Ile Asn Phe545
550 555 560Thr Leu Trp Ala Thr Ser Glu
Pro Asn Asn Gln Asn Asn Glu Asp Cys 565
570 575Val Gln Leu Tyr Gly Glu Ala Gly Thr Trp Asn Asp
Val Thr Cys Ser 580 585 590Gly
Thr Ala Ser Tyr Val Cys Thr Leu Pro Pro Pro 595
60066365PRTRhizopus oryzae 66Met Ile Ala Thr Pro Phe Glu Met Phe Gln Cys
Gln Met Tyr Ile Leu1 5 10
15Cys Leu Val Leu Ile Ala Phe Ser Phe Thr Cys Val Asn Thr Gln Gln
20 25 30Leu Cys Asn Gly Tyr Ala Glu
Tyr Cys Asn Lys Pro Tyr Asn Ser Leu 35 40
45Thr Tyr Leu Leu Thr His Asn Ser Tyr Gly Tyr Val Ser Asn Pro
Ala 50 55 60Ala Asn Gln Leu Cys Pro
Ile Thr Thr Gln Leu Ala Asp Gly Val Arg65 70
75 80Gly Ile Lys Leu Ser Ala Val Lys Ala Thr Asn
Ala Thr Thr Asp Gly 85 90
95Thr Ile Thr Ala Asp Ser Ile Tyr Leu Cys His Thr Ser Cys Ile Ile
100 105 110Leu Asn Ala Gly Pro Ala
Val Asn Thr Leu Arg Thr Ile Lys Glu Trp 115 120
125Val Glu Gln Asn Pro Asn Glu Val Val Thr Ile Met Trp Asn
Asn Val 130 135 140Asp Ala Phe Asp Gly
Asn Ala Phe Glu Ala Ala Tyr Asn Ala Ser Gly145 150
155 160Ile Ile Glu Tyr Ser Tyr Gln Gln Pro Lys
Lys Asn Tyr Thr Trp Pro 165 170
175Thr Leu Gly Glu Leu Ile Ala Ser Gly Lys Arg Val Ile Asn Phe Gly
180 185 190Asp Thr Tyr Tyr Gln
Gln Asp Leu Pro Trp Leu Leu Thr Glu Tyr Asp 195
200 205Tyr Val Phe Glu Thr Pro Tyr Glu Asn His Asn Glu
Ser Ser Phe Ser 210 215 220Cys Thr Ile
Asp Arg Pro Gln Asp Pro Ala Ser Pro Thr Glu Phe Leu225
230 235 240Tyr Val Met Asn His Phe Leu
Tyr Gly Ser Leu Gln Leu Gly Ser Leu 245
250 255Pro Ile Glu Ile Pro Gln Lys Gly Ile Ala Asn Thr
Thr Asn Ser Asp 260 265 270Asn
Ser Leu Met Lys Gln Ala Lys Thr Cys Thr Glu Lys Phe Gly Arg 275
280 285Gln Pro Asn Phe Leu Glu Ile Asp Phe
Tyr Asn Leu Gly Asp Ala Leu 290 295
300Lys Ile Thr Ala Glu Leu Asn Asn Val Thr Tyr Lys Gly Ser Gly Ser305
310 315 320Leu Gln Cys Asp
Thr Tyr Ala Ala Gln Gln Ala Ser Ser Ser Ser Thr 325
330 335Asp Ser Ser Glu Ala Ile Gln Thr Ile Ser
Ile Ser Ser Val Ser Leu 340 345
350Leu Leu Thr Leu Ile Ala Ala Thr Phe Phe Ile Phe Phe 355
360 36567453PRTTalaromyces stipitatus 67Met Arg
Ser Leu Trp Ile Val Ala Thr Leu Leu Thr Gly Ala Leu Ala1 5
10 15Ser Thr Thr Thr Thr Ala Ser Thr
Thr Thr Ser Ser Ala Thr Asp Thr 20 25
30Ala Ala Ile Val Thr Leu Ser Gly Thr Val Asp Pro Leu Ser Leu
Glu 35 40 45Gly Ala Thr Gly Ser
Val Thr Tyr Pro Ser Val Thr Thr Thr Ile Thr 50 55
60Leu Ser Thr Pro Lys Asp Ser Lys Thr Ser Thr Gly Thr Gly
Thr Arg65 70 75 80Ser
Gly Asn Val Thr Asp Ala Tyr Thr Thr Thr Ser Gly Thr Val Thr
85 90 95Met Leu Val Gly Ser Gln Gly
Thr Ser Thr Leu Ala Pro Asn Ala Thr 100 105
110Ala Leu Arg Asn Ser Thr Ala Thr Thr Ser Thr Thr Pro Leu
Pro Thr 115 120 125Asn Thr Gln Pro
Cys Asn Gly Tyr Val Glu Phe Cys Ala Arg Asn Tyr 130
135 140Ser Asn Ile Thr Tyr Val Ala Ala His Asn Ser Pro
Phe Asp Arg Lys145 150 155
160Gly Asn Ile Ala Ser Asn Gln Gln Tyr Ser Val Thr Thr Gln Leu Asn
165 170 175Asp Gly Ile Arg Met
Leu Gln Phe Gln Ala His Leu Gln Asn Gly Thr 180
185 190Ile Arg Leu Cys His Thr Ser Cys Asp Leu Leu Asn
Val Gly Pro Leu 195 200 205Glu Glu
Tyr Leu Thr Thr Val Thr Arg Trp Leu Asn Asn Asn Pro Tyr 210
215 220Glu Val Ile Thr Ile Leu Met Gly Asn Tyr Asp
Leu Val Gly Val Gly225 230 235
240Asn Phe Thr Ala Pro Ile Ile Asn Ser Gly Leu Ser Arg Tyr Val Tyr
245 250 255Thr Pro Pro Lys
Ile Pro Met Ser Leu Asn Asp Trp Pro Val Leu Ser 260
265 270Glu Leu Ile Leu Thr Gln Lys Arg Val Ile Ile
Phe Met Asp Tyr Asn 275 280 285Ala
Asn Gln Thr Glu Val Pro Tyr Ile Leu Asp Glu Phe Thr Gln Met 290
295 300Trp Glu Thr Pro Phe Ser Pro Thr Asp Pro
Ala Phe Pro Cys Thr Val305 310 315
320Gln Arg Pro Pro Asn Leu Ser Pro Glu Ser Ala Lys Gln Ile Leu
Tyr 325 330 335Met Ala Asn
His Asn Leu Asn Val Glu Ile Ser Phe Ser Gly Leu Asp 340
345 350Leu Leu Ile Pro Asn Thr Ala Val Leu Asn
Glu Thr Asn Gly Val Ser 355 360
365Gly Tyr Arg Ser Leu Gly Leu Met Ala Asn Ser Cys Thr Thr Thr Trp 370
375 380Gly Arg Pro Pro Asn Phe Leu Leu
Val Asp Tyr Tyr Asn Glu Gly Ser385 390
395 400Ser Pro Gly Ser Val Phe Glu Val Ala Ala Asn Met
Asn Asn Val Thr 405 410
415Tyr Asn Gly His Cys Cys Gly Ser Asn Thr Ser Gly Ala Leu Arg Leu
420 425 430Gln Thr Pro Asp Ala Val
Trp Met Phe Val Val Ala Ala Leu Ser Val 435 440
445Leu Leu Cys Met Asn 45068449PRTPenicillium marneffei
68Met Pro Ser Leu Trp Met Ala Val Ala Leu Leu Thr Gly Ala Leu Val1
5 10 15Gln Ser Thr Thr Ala Ala
Ser Ser Ser Ser Ser Thr Leu Ser Ser Ala 20 25
30Ser Asp Thr Asp Ser Ala Gly Ile Val Thr Leu Ser Gly
Thr Val Asp 35 40 45Pro Leu Ser
Ile Asp Gly Ala Thr Gly Ser Val Thr Tyr Pro Ser Val 50
55 60Thr Thr Thr Ile Thr Leu Ser Thr Asp Ser Ser Thr
Ile Ser Gly Thr65 70 75
80Val Thr Arg Asn Thr Thr Asp Val Thr Thr Thr Thr Val Leu Val Gly
85 90 95Ser Gln Ala Ala Thr Ile
Leu Ala Pro Asn Ala Thr Ala Ser Ile Asn 100
105 110Ser Thr Thr Ala Thr Gly Thr Ala Thr Thr Ala Pro
Leu Pro Thr Asn 115 120 125Thr Gln
Pro Cys Asn Gly Tyr Val Glu Phe Cys Ala Arg Asn Tyr Ser 130
135 140Asn Ile Thr Tyr Val Ala Ala His Asn Ser Pro
Phe Asn Arg Gln Gly145 150 155
160Asn Ile Ala Ser Asn Gln Gln Tyr Pro Val Thr Thr Gln Leu Asn Asp
165 170 175Gly Ile Arg Met
Leu Gln Phe Gln Val His Leu Gln Asn Gly Ser Leu 180
185 190Tyr Leu Cys His Thr Ser Cys Asp Leu Leu Asn
Val Gly Thr Leu Gln 195 200 205Asp
Tyr Leu Thr Thr Val Thr Lys Trp Leu Asn Asn Asn Pro Tyr Glu 210
215 220Val Ile Thr Ile Leu Met Gly Asn Tyr Asp
Leu Ile Gly Val Gly Asn225 230 235
240Phe Thr Asp Pro Ile Val Asn Ser Gly Leu Ser Lys Tyr Ala Tyr
Gln 245 250 255Pro Pro Lys
Ile Pro Met Gly Leu Asp Asp Trp Pro Met Leu Ser Glu 260
265 270Leu Ile Leu Thr Gln Lys Arg Ala Ile Ile
Phe Met Asp Tyr Asn Ala 275 280
285Asn Gln Thr Glu Val Pro Tyr Ile Leu Asp Glu Phe Thr Gln Met Trp 290
295 300Glu Thr Pro Phe Ser Pro Thr Asp
Pro Asn Phe Pro Cys Thr Val Gln305 310
315 320Arg Pro Pro Asn Leu Ser Thr Glu Arg Ala Lys Ser
Ile Met Tyr Met 325 330
335Ala Asn His Asn Leu Asn Val Glu Ile Ser Phe Ser Gly Leu Asp Ile
340 345 350Leu Ile Pro Asn Thr Ala
Val Leu Asn Glu Thr Asn Gly Val Phe Gly 355 360
365Tyr Arg Ser Leu Gly Leu Met Ala Asn Asn Cys Thr Ala Thr
Trp Gly 370 375 380Arg Pro Pro Asn Phe
Leu Leu Val Asp Tyr Tyr Asn Asn Gly Asn Phe385 390
395 400Pro Gly Ser Val Phe Gln Val Ala Ala Glu
Met Asn Asn Val Thr Tyr 405 410
415Ser Gly His Cys Cys Arg Ser Met Ala Ser Gly Ala Leu Arg Leu Glu
420 425 430Ile Pro Gly His Trp
Met Phe Ala Met Ala Val Ser Ala Phe Leu Phe 435
440 445Ile69460PRTAspergillus niger 69Met Arg Leu Ile Ala
His Leu Leu Pro Leu Leu Ala Val Gly Val Trp1 5
10 15Pro Ser Leu Ala Lys Asp Asp Ser Thr Thr Thr
Thr Thr Thr Thr Gly 20 25
30Asn Asn Gly Gly Leu Thr Leu Glu Gly Thr Val Thr Ser Ser Ile Ser
35 40 45Glu Ala Thr Leu Pro Thr Gly His
Tyr Leu Ser Tyr Thr Thr Thr Met 50 55
60Thr Leu Asp Asp Gly His Thr Val Thr Ser Thr Gly Ala His Ser Ala65
70 75 80Thr Thr Thr Ser Asn
Ser Thr Thr Thr Ser Gly Asn Phe Thr Thr Thr 85
90 95Val Thr Ser Ser Ser Gln Ser Leu Thr Leu Leu
Val Gly Gly Gln Thr 100 105
110Gly Gly Val Asn Gly Thr Asn Ala Thr Thr Thr Ala Thr Ser Thr Ala
115 120 125Ser Ser Thr Pro Val Val Asn
Thr Gln Pro Cys Asn Gly His Ala Glu 130 135
140Phe Cys Ala Arg Lys Tyr Ser Asn Ile Thr Met Val Ala Ala His
Asn145 150 155 160Ser Pro
Phe Val Lys Pro Gly Asn Ala Ala Ala Asn Gln Ala Leu Lys
165 170 175Val Thr Ala Gln Leu Asp Asp
Gly Ile Arg Met Leu Gln Phe Gln Thr 180 185
190His Leu Val Asn Asn Thr Leu Tyr Leu Cys His Thr Ser Cys
Asp Leu 195 200 205Leu Asn Met Gly
Pro Leu Glu Asp Tyr Leu Thr Thr Val Thr Lys Trp 210
215 220Val Lys Thr His Pro Tyr Asp Val Val Thr Ile Leu
Ile Gly Asn Tyr225 230 235
240Asp Tyr Val Asp Pro Gly Asn Phe Thr Gly Pro Met Gln Asn Ser Gly
245 250 255Leu Met Asp Tyr Val
Phe Thr Pro Ser Lys Ile Pro Met Ala Leu Asp 260
265 270Asp Trp Pro Thr Met Ser Ser Met Ile Leu Ser Gly
Lys Arg Ala Val 275 280 285Val Phe
Met Asp Tyr Gln Ala Asn Gln Thr Ala Tyr Pro Trp Leu Met 290
295 300Asp Glu Phe Ser Gln Met Trp Glu Thr Pro Phe
Ser Pro Thr Asp Ala305 310 315
320Ala Phe Pro Cys Thr Glu Gln Arg Pro Pro Asp Leu Ser Ala Gln Asp
325 330 335Ala Lys Asp Arg
Met Tyr Met Ala Asn His Asn Leu Asn Leu Asp Ile 340
345 350Asn Ile Ala Ser Ile Ser Leu Leu Ile Pro Asn
Thr Ala Ser Leu Asn 355 360 365Gln
Thr Asn Ala Val Ser Gly Tyr Gly Ser Leu Gly Lys Met Ala Arg 370
375 380Asn Cys Thr Ala Met Trp Asp Arg Pro Pro
Asn Phe Leu Leu Val Asp385 390 395
400Tyr Tyr Asn Tyr Gly Asn Ile Asn Gly Ser Val Phe Glu Val Ala
Ala 405 410 415Glu Met Asn
Asn Val Thr Trp Asp Gly Lys Cys Cys Gly Ala Ala Ser 420
425 430Ala Ala Ser Ser Val Met Pro Gly Val Ser
Val Met Ser Thr Leu Leu 435 440
445Leu Ile Ala Gly Val Gln Tyr Met Ala Ser Ile Phe 450
455 46070470PRTAspergillus nidulans 70Met Arg Leu Thr Trp
Leu Leu Thr Leu Leu Ala Ala Ser Arg Val Leu1 5
10 15Ser Gln Asn Thr Asp Ser Asp Ser Asp Ser Asp
Ser Asp Ser Ser Thr 20 25
30Thr Thr Asp Ser Asn Glu Glu Ala Ile Ser Gln Ser Leu Ala Glu Ile
35 40 45Ala Ser Ala Ile Thr Thr Thr Val
Asp Asp Ala Thr Val Pro Ser Gly 50 55
60Asp Tyr Ile Thr Tyr Ser Thr Thr Val Tyr Leu Thr Gly Thr His Gly65
70 75 80Thr Val Ile Gly Ser
Thr Ala Val Gln Val Thr Gly Thr Pro Asn Ala 85
90 95Asn Ala Thr Thr Ser Ala Asn Ala Thr Ile Thr
Ser Thr Ser Asp Thr 100 105
110Val Thr Val Leu Ile Gly Gly Gln Thr Thr Ile Ser Gly Asn Ser Thr
115 120 125Gly Asn Ser Thr His Ser Ala
Thr Pro Ser Pro Ser Gln Thr Pro Val 130 135
140Val Asn Thr Gln Pro Cys Asn Gly Trp Pro Glu Phe Cys Asp Arg
Lys145 150 155 160Tyr Ser
Asn Ile Thr Gln Val Ala Ala His Asn Ser Pro Phe Val Ala
165 170 175Gln Gly Asn Val Ala Ala Asn
Gln Ala Leu Asp Val His Tyr Gln Leu 180 185
190Asp Asp Gly Val Arg Met Leu Gln Phe Gln Thr His Ile Met
Asn Gly 195 200 205Thr Met Tyr Leu
Cys His Thr Ser Cys Asp Leu Leu Asn Val Gly Pro 210
215 220Leu Glu Asp Tyr Leu Ser Asn Ile Thr Glu Trp Leu
Arg Gln His Pro225 230 235
240Tyr Asp Val Val Thr Ile Leu Ile Gly Asn Tyr Asp Tyr Val Asp Pro
245 250 255Gly Asn Phe Thr Thr
Pro Met Glu Asn Ser Gly Leu Met Asp Phe Val 260
265 270Phe Thr Pro Pro Met Ile Pro Met Gly Leu Asp Asp
Trp Pro Thr Leu 275 280 285Gly Ser
Ile Ile Leu Ser Gly Lys Arg Ala Ile Val Phe Met Asp Tyr 290
295 300Gln Ala Asn Gln Thr Ala Tyr Pro Trp Leu Met
Asp Glu Phe Ser Gln305 310 315
320Met Trp Glu Thr Pro Phe Ser Pro Thr Asp Arg Asp Phe Pro Cys Thr
325 330 335Val Gln Arg Pro
Pro Asp Leu Ala Ala Glu Asp Ala Arg Lys Arg Met 340
345 350Tyr Met Ala Asn His Asn Leu Asn Ile Asp Phe
Ser Ile Ala Ser Leu 355 360 365Asn
Leu Leu Ile Pro Asn Thr Ala Leu Leu Asn Glu Thr Asn Ala Asp 370
375 380His Gly Tyr Gly Ser Val Gly Arg Met Ala
Glu Asn Cys Thr Thr Leu385 390 395
400Trp Asn Arg Pro Pro Asn Phe Leu Leu Val Asp Tyr Tyr Asn Glu
Gly 405 410 415Asn Phe Asn
Gly Ser Val Phe Gln Val Ala Ala Asp Met Asn Gly Val 420
425 430Ser Tyr Asp Arg Asp Ser Cys Cys Gly Thr
Leu Ser Ala Ala Ser Ser 435 440
445Leu Gly Pro Gly Ala Met Met Ser Ala Val Leu Phe Phe Val Gly Leu 450
455 460Gln Val Leu Ala Trp Leu465
47071378PRTUstilago maydis 71Met Phe Gln Phe Ile Gln Leu Leu Ser
Leu Val Ser Ala Leu Val Ile1 5 10
15Val Ser Ser Leu Val Gly Ala Val Pro His Pro Val Leu Asp Ala
Ala 20 25 30Val Glu Thr Leu
Val Lys Arg Ala Ser Val Cys Asn Gly Asp Ala Ser 35
40 45Leu Cys Ser Arg Leu Tyr Ser Asn Val Thr Tyr Ile
Gly Ala His Asn 50 55 60Ser Tyr Ala
Val Gly Thr Leu Ala Gly Ala Ser Val Gly Lys Asn Gln65 70
75 80Glu Gln Ser Val Thr Gln Gln Leu
Thr Asp Gly Ile Arg Leu Leu Gln 85 90
95Val Gln Ala His Lys Ser Ser Asn Ser Thr Ser Gly Ser Gly
Ile Asn 100 105 110Leu Cys His
Ser Ser Cys Gln Ile Glu Asn Gly Gly Thr Leu Glu Asn 115
120 125Tyr Leu Ser Lys Val Lys Thr Trp Val Asp Ser
Asn Pro Asn Asp Val 130 135 140Ile Thr
Ile Leu Ile Val Asn Ser Asp Asn Gln Pro Val Ser Ser Phe145
150 155 160Gly Thr Ala Phe Gln Ser Thr
Gly Leu Ala Ser Lys Ala Tyr Ser Pro 165
170 175Gly Thr Ala Ala Leu Ala Lys Asp Ser Trp Pro Thr
Leu Gly Ser Leu 180 185 190Ile
Asp Ser Gly Lys Asn Leu Val Val Phe Ile Asp Asn Ser Ala Asp 195
200 205Val Ser Ser Val Pro Tyr Ile Leu Pro
His Phe Gln Asn Thr Trp Glu 210 215
220Asn Pro Tyr Asn Gln Ile Ser Val Pro Phe Asn Cys Ser Val Asp Arg225
230 235 240Ile Asn Ser Gly
Ser Glu Pro Ser Asn Leu Met Tyr Leu Ile Asn His 245
250 255Tyr Leu Asp Ser Ser Phe Asn Leu Phe Gly
Thr Thr Val Phe Val Pro 260 265
270Asn Thr Ala Gln Leu Asn Thr Thr Asn Ser Leu Ser Ser Ile Met Thr
275 280 285Asp Ala Gly Asn Cys Ala Ser
Leu His Gly Thr Gly Tyr Pro Thr Tyr 290 295
300Val Leu Thr Asp Phe Tyr Asp Val Gly Asp Gly Ser Val Phe Gln
Ala305 310 315 320Ala Ala
Gln Met Asn Gly Val Gln Tyr Thr Ala Lys Pro Ile Gly Asn
325 330 335Ala Thr Lys Ser Gly Ser Ser
Gly Ser Ser Gly Ser Ser Ser Ser Gly 340 345
350Ala Ala Ser Thr His Val Asn Ala Ile Ala Ala Val Ala Thr
Phe Met 355 360 365Thr Met Phe Ala
Leu Ala Ser Thr Leu Ala 370 37572449PRTCoccidioides
immitis 72Met Leu Leu Ser Phe Arg Leu Leu Ala Val Ala Ser Leu Leu Arg
Ser1 5 10 15Ile Tyr Ala
Asp Asp Ile Ile Thr Leu Thr Gly Thr Asn Ile Pro Pro 20
25 30Ser Leu Ser Val Gly Asp Pro Ile Pro Ser
Asp Thr Ser Gly Leu Tyr 35 40
45Lys Ser Tyr Ser Ser Val Val Thr Val Ser Ala Thr Asp Lys Gln Leu 50
55 60Glu Ser Ala Arg Thr Gly Thr Glu Thr
Ala Thr Gly Ser Glu Arg Thr65 70 75
80Ala Thr Ser Asp Gly Gly Thr Leu Leu Ile Gly Ser Lys Arg
Val Ser 85 90 95Thr Thr
Asn Gly Thr Thr Leu Ser Gly Asn Ala Thr Ala Thr Ser Thr 100
105 110Glu Ser Ala Ala Val Pro Thr Asn Thr
Arg Pro Cys Asn Gly Tyr Pro 115 120
125Glu Phe Cys Glu Arg Lys Tyr Ser Asn Ile Thr His Ile Ala Ala His
130 135 140Asn Ser Pro Phe Val Arg Arg
Gly Asn Ile Ala Gly Asn Gln Glu Leu145 150
155 160Asp Val Thr Ile Gln Leu Asn Asp Gly Ile Arg Met
Leu Gln Phe Gln 165 170
175Thr His Tyr Ile Asn Gly Thr Ile Arg Leu Cys His Ser Ser Cys Asp
180 185 190Leu Leu Asp Val Gly Pro
Leu Glu Asp Tyr Leu Arg Lys Val Ala Asp 195 200
205Trp Leu Arg Ala Asn Pro Tyr Asp Val Val Ser Ile Leu Met
Gly Asn 210 215 220Ser Asn Phe Ile Leu
Pro Thr Asn Tyr Thr Lys Pro Ile Glu Asn Ser225 230
235 240Gly Leu Ile Asp Tyr Val Tyr Thr Pro Pro
Lys Ile Pro Met Ala Leu 245 250
255Asp Asp Trp Pro Leu Leu Ser His Phe Ile Leu Thr Gly Gln Arg Ala
260 265 270Ile Val Tyr Leu Asp
Tyr Lys Ala Asn Gln Thr Glu Val Pro Tyr Leu 275
280 285Leu Asp Glu Phe Ser Gln Met Trp Glu Thr Pro Phe
Ser Pro Thr Asn 290 295 300Arg Asp Phe
Pro Cys Val Val His Arg Pro Pro Gly Leu Ser Ala Glu305
310 315 320Asp Ala Lys Lys Arg Leu Tyr
Met Ala Asn His Asn Leu Asn Thr Glu 325
330 335Val Ser Leu Ala Gly Ala Ser Leu Leu Val Pro Asn
Thr Val Leu Leu 340 345 350Asn
Glu Thr Asn Ala Val Ser Gly Tyr Gly Ser Ala Gly Ala Met Ala 355
360 365Gly Asn Cys Thr Glu Gln Trp Thr Arg
Pro Pro Asn Phe Ile Leu Val 370 375
380Asp Tyr Tyr Asn Ile Gly Asn Phe Asn Gly Ser Val Phe Glu Val Ala385
390 395 400Ala Asn Cys Asn
Asn Val Thr Tyr Asn Arg Lys Cys Cys Gly Arg Gln 405
410 415Thr Ser Ala Ala Ser Lys Gly Leu Ser Ser
Gly Ala Lys Gln Ser Phe 420 425
430Phe Val Gly Leu Leu Ala Thr Ile Thr Thr Ser Leu Leu Phe Thr Leu
435 440 445Pro73396PRTNeurospora crassa
73Met Pro Ser Leu Ile Ser Ser Leu Ala Thr Ala Leu Leu Leu Val Ser1
5 10 15Gly Ile Cys Ala Ile Pro
Gln Gly Pro Ser Gly Ala Glu Ser Gly Ile 20 25
30Val Ser Ala Val Ser Ala Ala Ser Val Ser Thr Ala Gly
Val Ala Val 35 40 45Ser Gln Ala
Thr Thr Ala Ser Pro Ser Thr Ser Asn Ala Ala Ser Gly 50
55 60Ile Ser Ala Cys Asn Asn Ser Pro Leu Leu Cys Asp
Arg Ala Tyr Asn65 70 75
80Asn Val Thr His Met Gly Ala His Asp Ser Ser Phe Leu Arg Asp Ala
85 90 95Ser Thr Ser Asp Ser Leu
Ala Gly Asn Gln Tyr Phe Asn Ala Thr Val 100
105 110Ala Leu Asp Ala Gly Ile Arg Leu Leu Gln Ala Gln
Val His Asp Val 115 120 125Asn Gly
Thr Leu Gln Leu Cys His Thr Ser Cys Ser Leu Leu Asp Ala 130
135 140Gly Pro Leu Gln Asp Trp Leu Ala Lys Ile Lys
Phe Trp Met Asp Asn145 150 155
160Asn Pro Asn Glu Val Val Thr Ile Leu Leu Val Asn Ser Asp Asn Lys
165 170 175Leu Val Ser Asp
Tyr Ala Ala Val Phe Glu Gly Ser Gly Ile Ser Thr 180
185 190Tyr Gly Tyr Gln Leu Ser Asn Gly Ser Ser Ala
Ser Asn Thr Trp Pro 195 200 205Thr
Leu Gly Asp Met Ile Thr Ser Asn Lys Arg Leu Val Thr Phe Ile 210
215 220Ala Ser Ile Asp Tyr Ser Pro Thr Tyr Pro
Tyr Leu Leu Ser Glu Phe225 230 235
240Asp His Val Phe Glu Thr Ala Tyr Asn Val Leu Ser Leu Ser Gly
Phe 245 250 255Asn Cys Thr
Leu Asp Arg Pro Lys Gly Gln Gly Ser Ala Gly Asp Ala 260
265 270Ile Ser Ala Gly Leu Met Pro Leu Met Asn
His Phe Ala Asp Ser Leu 275 280
285Leu Leu Gln Gly Val Gln Ile Pro Asp Glu Thr Asp Ile Asp Ile Thr 290
295 300Asn Ser Pro Asp Thr Ser Thr Thr
Gly Asn Leu Gly Leu His Ala Asp305 310
315 320Thr Cys Val Lys Gln Trp Gly Val Lys Pro Thr Phe
Ile Leu Val Asp 325 330
335Phe Phe Asp His Gly Pro Ala Ile Asp Thr Ala Asp Arg Leu Asn Gly
340 345 350Ile Thr Ala Thr Gly Arg
Lys Ser Val Ser Gly Glu Ser Lys Gly Asn 355 360
365Thr Ser Gly Ala Gly Glu Asn His Ser Pro Met Gly Met Asn
Val Ala 370 375 380Leu Ile Ala Phe Val
Val Phe Ala Leu Ala Met Val385 390
39574360PRTCryptococcus neoformans 74Met Leu Pro His Leu Ile Leu Ser Leu
Ala Ser Ile Phe Ala Leu Pro1 5 10
15Ala Val Phe Ala Ala Thr Thr Cys Asn Gly His Ser Glu Leu Cys
Ser 20 25 30Arg Leu Tyr Ser
Asn Val Thr Phe Ile Gly Ala His Asp Ser Tyr Ala 35
40 45Val Gly Ser Ser Val Ala Asp Asp Gln Asp Lys Asp
Val Thr Ser Gln 50 55 60Leu Asn Asp
Gly Ile Arg Thr Leu Gln Ile Gln Ala His Asn Ala Ser65 70
75 80Asp Gly Ile His Leu Cys His Ser
Ser Cys Ser Leu Leu Asp Gly Gly 85 90
95Leu Met Ser Asp Tyr Leu Ser Thr Val Ala Ser Trp Val Asn
Asp Asn 100 105 110Pro Asn Asp
Val Ile Thr Ile Val Ile Val Asn Ser Asp Asn Leu Pro 115
120 125Pro Thr Ser Phe Ser Pro Val Phe Glu Ser Ala
Gly Leu Ser Ser Lys 130 135 140Val Tyr
Thr Pro Ala Ser Gln Pro Thr Gln Leu Ser Asp Trp Pro Ser145
150 155 160Leu Ser Asp Met Ile Asp Ala
Gly Thr Thr Val Val Ala Phe Met Asp 165
170 175Tyr Glu Ala Asp Thr Ser Ser Val Pro Tyr Leu Leu
Asp Glu Phe Ala 180 185 190Ala
Met Trp Glu Asp Ala Tyr Gly Val Thr Thr Gln Glu Phe Gly Cys 195
200 205Ala Val Asn Arg Ser Ser Gly Asp Thr
Ser Ser Gln Pro Phe Leu Ile 210 215
220Asn His Phe Leu Asp Ser Thr Tyr Ser Phe Ser Ser Ile Gln Val Phe225
230 235 240Val Pro Asn Lys
Asp Lys Leu Asn Glu Thr Asn Ala Glu Thr Gly Thr 245
250 255Gly Ser Ile Gly Tyr His Val Asn Asn Cys
Arg Gln Leu Trp Gly Arg 260 265
270Asn Pro Asn His Ile Leu Leu Asp Phe Tyr Asp Ser Asn Gly Asn Ser
275 280 285Pro Phe Asn Val Ala Ala Ser
Leu Asn Gly Val Ser Ala Pro Thr Asn 290 295
300Thr Val Thr Ala Gly Thr Ala Ser Ala Thr Ser Ser Gly Thr Ala
Ala305 310 315 320Val Val
Ser Thr Gln Ser Leu Ser Gly Ser Val Thr Ser Ile Glu Gly
325 330 335Ile Ala Lys Gly Ile Thr Leu
Gly Phe Gly Val Met Leu Gly Val Gly 340 345
350Met Gly Val Gly Arg Val Phe Leu 355
36075740PRTStreptomyces lividans 75Met Ser Leu Thr Val Leu Ala Ala Ala
Ala Val Val Arg Ser Thr Val1 5 10
15Leu Asp Pro Gly Phe Tyr Gly Gln Val Leu Glu Asp Glu His Ala
Tyr 20 25 30Gln Arg Phe Tyr
Asp Glu Val Leu Val Asp Pro Arg Ser Thr Pro Phe 35
40 45Thr Ser Asp Leu Leu Glu Arg Leu Pro Val Pro Gln
Ser Thr Ile Thr 50 55 60Ser Asn Leu
Lys Val Val Val Pro Pro Glu Thr Leu Arg Thr Met Gly65 70
75 80Gln Gly Gln Ile Ala Glu Met Val
His Tyr Leu Glu Gly Asp Arg Glu 85 90
95Arg Leu Arg Ile Thr Val Asp Leu Glu Pro Val Val Ala Asn
Val Glu 100 105 110Arg Leu Ser
Gln Ala Tyr Phe Gly Asp Ala Val Ala Ala Leu Gln Lys 115
120 125Arg Ser Glu Pro Asp Phe Gln Ala Phe Val Gln
His Leu Ser Glu Leu 130 135 140Val Ala
Arg Val Val Ala Gly Glu Ala Pro Leu Asp Glu Leu Pro Thr145
150 155 160Leu Pro Leu Ser His Ser Gln
Ala Asp Ala Ala Thr Asp Ala Leu Met 165
170 175Arg Leu Val Pro Asp Gly Ala Ala Arg Asp Gly Val
Arg Ser Thr Val 180 185 190Leu
Thr Ala Leu Asp Arg Gly Asp Val Ala Ser Ala Leu Ala Ala Ile 195
200 205Ala Pro Val Ala Leu Thr Asp Gln Val
Arg Asp Ala Ala Glu Glu Met 210 215
220Leu Arg Glu Ala Lys Gln Gly Thr Trp Val Val Ser Val Asp Val Glu225
230 235 240Pro Gly Thr Glu
Ala Leu Ala Pro Leu Asp Arg Ala Arg Lys Val Thr 245
250 255Arg Leu Phe Gln Glu Val Val Glu Pro Ala
Ala Ala Val Leu Cys Ala 260 265
270Ala Ala Leu Thr Leu Leu Trp Phe Leu Arg Pro Ser Pro Ala Lys Arg
275 280 285Arg Leu Ile Pro Leu Gly Trp
Val Pro Ala Ala Ala Ala Ser Leu Met 290 295
300Ala Leu Thr Val Leu Val Leu Arg Leu Thr Leu Gly Asp Thr Leu
Phe305 310 315 320Gly Thr
Pro Pro Ser Trp Pro Pro Ala Ala Thr Gly Leu Leu Ala Asp
325 330 335Val Gln Ala Ala Ala Leu Asp
Arg Leu Leu Thr Thr Ala Val Val Val 340 345
350Ala Val Ile Leu Leu Ala Ala Gly Ala Leu Leu Ile Thr Val
Gly Trp 355 360 365Val Trp Gln Thr
Arg Pro Ser Val Pro Val Leu Thr Asp Pro Arg His 370
375 380Val Pro Ala Leu Thr Phe Thr Val Thr Ala Val Ala
Leu Val Gly Thr385 390 395
400Met Leu Ala Pro Val Ala Ile Ser Gly Ser Ser Pro Arg Ile Cys Gln
405 410 415Gly Ser Ala Glu Leu
Cys Asp Ala Arg Tyr Asp Glu Ile Ala Gln Leu 420
425 430Ala Ser His Asn Ala Met Ala Thr Thr Ala Asp Arg
Phe Ile Gly Pro 435 440 445Leu Gln
Asp Pro Asp Ile Val Gly Gln Leu Gly Ala Gly Ser Arg Val 450
455 460Leu Leu Leu Asp Thr His Arg Trp Glu Arg Pro
Glu Glu Val Ala Glu465 470 475
480Arg Leu Ser Thr Ser Asp Phe Ser Pro Ala Glu Arg Arg Arg Leu Thr
485 490 495Ala Ile Leu Gln
Arg Val Asn Pro Pro His Pro Gly Leu Trp Leu Cys 500
505 510His Ser Val Cys Gly Ala Gly Ala Ile Glu Leu
Glu Pro Thr Leu Arg 515 520 525Gln
Ile Gly Glu Trp Leu Arg Asp Asn Pro Thr Glu Ile Val Thr Leu 530
535 540Ile Leu Gln Asp Gly Val Asp Ala Val Thr
Thr Gln Asp Ala Phe Glu545 550 555
560Arg Ala Gly Leu Ser Asp Leu Leu Tyr Glu Pro Asp Arg Asp Pro
Asp 565 570 575Arg Pro Trp
Pro Lys Leu Gly Asp Met Ile Asp Ser Gly Arg Arg Leu 580
585 590Val Val Phe Ala Glu Lys Ala Asp Gly Pro
Ala Pro Trp Tyr Arg Asn 595 600
605Leu Tyr Arg Tyr Gly Met Glu Thr Pro Phe Ala Phe Arg Ser Pro Asp 610
615 620Glu Met Ser Cys Leu Pro Asn Arg
Gly Gly Ser Asp Lys Arg Leu Phe625 630
635 640Leu Leu Asn His Phe Val Thr Ala Gly Gly Gly Leu
Arg Leu Asp Ala 645 650
655Gly Val Val Asn Ser Arg Gln Arg Val Leu Glu Arg Ala His Asn Cys
660 665 670Glu Arg Gln Arg Gly Arg
Pro Val Asn Phe Ile Ala Val Asp Tyr Ala 675 680
685Thr Ile Gly Asp Ala Leu Gly Ala Val Asn Glu Leu Asn Ala
Glu Arg 690 695 700Val Glu Asp Gly Pro
Arg Val Pro Val Glu Arg Thr Pro Gly Arg Ile705 710
715 720Pro Gly Ala Ala Glu Ala Arg Arg Arg Gly
Gly Ala Pro Arg Arg Arg 725 730
735Ala Val Ser Arg 740
User Contributions:
Comment about this patent or add new information about this topic: