Patent application title: CHOLERA TOXIN CHIMERA AND ITS USE AS A STAPH VACCINE
Inventors:
IPC8 Class: AA61K39085FI
USPC Class:
1 1
Class name:
Publication date: 2019-10-31
Patent application number: 20190328860
Abstract:
The present invention relates to chimeric protein vaccines and methods of
use thereof in the treatment of Staphylococcus aureus. One embodiment of
the present invention provides a method of generating an immune response
in a mammal, that includes administering to the mammal, a composition
having a chimeric protein having at least one of: a portion of a cholera
toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin;
and an antigen having at least one of: an antigenic material from S.
aureus and an antigenic material from a S. aureus-specific polypeptide.Claims:
1-20. (canceled)
21: A chimeric protein capable of generating an immune response in a mammal comprising: a truncated iron-regulated surface determinant B (IsdB) protein of Staphylococcus aureus consisting of amino acids 42-338 of SEQ ID NO: 23; and an adjuvant protein, wherein said adjuvant protein is cholera toxin subunit A.sub.2 (CTA.sub.2), cholera toxin subunit B (CTB), heat labile toxin subunit A.sub.2, heat labile toxin subunit B, Shiga toxin subunit A.sub.2, Shiga toxin subunit B, or combination thereof.
22: The chimeric protein of claim 21, wherein said adjuvant protein is CTA.sub.2 and CTB.
23: The chimeric protein of claim 21, wherein said CTA.sub.2 has the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90% identical thereto.
24: The chimeric protein of claim 21, wherein said CTB has the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 90% identical thereto.
25: The chimeric protein of claim 21, wherein the chimeric protein is a fusion protein.
26: The chimeric protein of claim 21, wherein the chimeric protein comprises amino acids 24-367 of SEQ ID NO: 22.
27: An immunogenic composition comprising the chimeric protein of claim 21.
28: The immunogenic composition of claim 27, wherein said adjuvant protein is CTA.sub.2 and CTB.
29: The immunogenic composition of claim 27, wherein said CTA.sub.2 has the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90% identical thereto.
30: The immunogenic composition of claim 27, wherein said CTB has the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 90% identical thereto.
31: The immunogenic composition of claim 27, wherein the chimeric protein is a fusion protein.
32: The immunogenic composition of claim 27, wherein the chimeric protein comprises amino acids 24-367 of SEQ ID NO: 22.
33: A method of generating an immune response to Staphylococcus aureus in a mammal comprising: administering to the mammal a composition comprising a chimeric protein, wherein the chimeric protein comprises a truncated iron-regulated surface determinant B (IsdB) protein of Staphylococcus aureus consisting of amino acids 42-338 of SEQ ID NO: 23; and an adjuvant protein, wherein said adjuvant protein is cholera toxin subunit A2 (CTA.sub.2), cholera toxin subunit B (CTB), heat labile toxin subunit A2, heat labile toxin subunit B, Shiga toxin subunit A2, Shiga toxin subunit B, or combination thereof.
34: The method of claim 33, wherein said adjuvant protein is CTA.sub.2 and CTB.
35: The method of claim 33, wherein said CTA.sub.2 has the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90% identical thereto.
36: The method of claim 33, wherein said CTB has the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 90% identical thereto.
37: The method of claim 33, wherein the chimeric protein is a fusion protein.
38: The method of claim 33, wherein the chimeric protein comprises amino acids 24-367 of SEQ ID NO: 22.
39: The method of claim 33, wherein the administration is by intranasal administration, oral administration, intramuscular administration, peritoneal administration, sublingual administration, transcutaneous administration, subcutaneous administration, intravaginal administration, intrarectal administration, intramammary administration, or combination thereof.
40: The method of claim 33, wherein the mammal is a cow.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This present application is a continuation of U.S. patent application Ser. No. 15/910,783, filed Mar. 2, 2018, which is a continuation of U.S. patent application Ser. No. 14/456,090, filed Aug. 11, 2014, now U.S. Pat. No. 9,943,582 issued Apr. 17, 2018; which is a continuation of U.S. patent application Ser. No. 13/328,686, filed Dec. 16, 2011, now U.S. Pat. No. 8,834,898 issued Sep. 16, 2014; and which is also a continuation of U.S. patent application Ser. No. 13/896,854, filed May 17, 2013, now U.S. Pat. No. 8,911,748 issued Dec. 16, 2014.
[0002] This present application is also a continuation of U.S. patent application Ser. No. 13/896,854, filed May 17, 2013, now U.S. Pat. No. 8,911,748 issued Dec. 16, 2014, which is a continuation-in-part of U.S. patent application Ser. No. 13/328,686, filed Dec. 16, 2011, now U.S. Pat. No. 8,834,898 issued Sep. 16, 2014.
[0003] Each of these applications is hereby incorporated by reference.
SEQUENCE LISTING
[0005] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 17, 2013, is named 083956-0028_SL.txt and is 53,242 bytes in size.
BACKGROUND
[0006] The present invention relates to infectious diseases and, more particularly, to chimeric protein vaccines and methods of use thereof in the treatment of Staphylococcus aureus.
[0007] Staphylococcus aureus (S. aureus) is a common cause of hospital-acquired infections and represents an important public health threat. S. aureus can cause nosocomial (hospital) and community-acquired infections including impetigo, cellulitis, food poisoning, toxic shock syndrome, invasive necrotizing pneumonia, and endocarditis. S. aureus is also the most common species of staphylococci to cause Staph infections. Currently, it is one of the top causes of infectious disease deaths in the United States.
[0008] S. aureus also causes mastitis, which is a major problem in dairy cows with considerable economic implications. For example, contagious mastitis in dairy cows is most commonly caused by S. aureus and is one of the most common diseases infecting dairy cattle in the United States. S. aureus causes a persistent, inflammatory reaction of the udder tissue that can lead to chronic infections that result in the cow being culled from the herd. Milk from cows with mastitis also typically has higher somatic cell count, which generally lowers the milk quality. It is estimated that mastitis may cost the dairy industry billions of dollars per year in economic losses.
[0009] A growing concern in the treatment of S. aureus is that the bacterium is often resistant to multiple antibiotics. Roughly half of the nosocomial isolates in the United States are methicillin-resistant S. aureus (MRSA). Methicillin-resistant S. aureus is also sometimes referred to as "multidrug-resistant" S. aureus or "oxacillin-resistant S. aureus." MRSA bacterium is generally resistant to beta-lactam antibiotics, which include the penicillins (e.g., methicillin, dicloxacillin, nafcillin, oxacillin, etc.) and cephalosporins. Currently, a vaccine that prevents staphylococcal disease is unavailable.
[0010] A possible approach for staphylococcal vaccine development is to target virulence factors such as toxins, enzymes, polysaccharide capsules, adhesive factors, and the like. A key to the possible vaccine approach may be that the anterior nares of humans are known to be an important niche for S. aureus. It is believed that nasal carriage is a major risk factor for invasive infection.
[0011] One potential S. aureus virulence factor is the iron-regulated surface determinant A (IsdA). IsdA is an S. aureus surface adhesin protein that may be immunogenic in certain organisms. IsdA can bind to human desquamated nasal epithelial cells and is believed to play a critical role in nasal colonization.
[0012] However, a major obstacle in vaccine development of S. aureus is the lack of immunostimulatory adjuvants that can function from mucosal surfaces. While certain toxins (e.g., cholera toxin and heat-labile toxin) have the ability to induce mucosal and systemic immune responses to co-administered antigens, these bacterial proteins are generally too toxic for human use.
SUMMARY OF THE INVENTION
[0013] The present invention relates to infectious diseases and, more particularly, to chimeric protein vaccines and methods of use thereof in the treatment of Staphylococcus aureus.
[0014] In some embodiments, the present invention provides methods of generating an immune response in a mammal comprising: administering to the mammal a composition comprising: a chimeric protein comprising at least one of: a portion of a cholera toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin; and an antigen comprising at least one of: an antigenic material from S. aureus and an antigenic material from an S. aureus-specific polypeptide.
[0015] In other embodiments, the present invention provides a method of inducing an immune response in a cow comprising: administering to the cow a chimeric protein comprising: an adjuvant selected from the group consisting of: a portion of a cholera toxin, a portion of a heat-labile toxin, a portion of a shiga toxin, and any combination thereof; and an antigen selected from the group consisting of: an antigenic material from S. aureus, an antigenic material from a S. aureus-specific polypeptide, and any combination thereof.
[0016] The features and advantages of the present invention will be readily apparent to those skilled in the art upon a reading of the description of the preferred embodiments that follows.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The following figures are included to illustrate certain aspects of the present invention, and should not be viewed as exclusive embodiments. The subject matter disclosed is capable of considerable modification, alteration, and equivalents in form and function, as will occur to those skilled in the art and having the benefit of this disclosure.
[0018] FIGS. 1A-1C show ribbon diagrams illustrating structures of cholera toxin, IsdA, and chimeric protein according to some embodiments.
[0019] FIG. 2 shows a diagram illustrating a plasmid that encodes a chimeric protein according to some embodiments.
[0020] FIGS. 3A-3B illustrate expression and purification of a chimeric protein according to some embodiments.
[0021] FIG. 4 shows a plot showing the results of a receptor binding affinity assay according to some embodiments.
[0022] FIGS. 5A-5D show confocal images of chimeric protein binding to Vero and DC2.4 cells stained with fluorescent dyes according to some embodiments.
[0023] FIG. 6 shows a plot showing in vivo systemic antibody response to chimeric protein according to some embodiments.
[0024] FIG. 7 shows a plot illustrating in vivo mucosal antibody response to chimeric protein according to some embodiments.
[0025] FIGS. 8A-8D show plots showing the results of flow cytometry experiments on the proliferation of T lymphocytes from mice immunized with chimeric protein according to some embodiments.
[0026] FIG. 9 shows a plot summarizing the flow cytometry results shown in FIGS. 8A-8D according to some embodiments.
[0027] FIG. 10 shows a plot showing the results of Resazurin assay of splenocytes from mice immunized with chimeric protein according to some embodiments.
[0028] FIG. 11 shows a plot showing IL-4 and IN-.gamma. levels of antigen-stimulated splenocytes from mice immunized with chimeric protein according to some embodiments.
[0029] FIG. 12 shows a plot showing the results of IsdA-specific ELISA titrations of systemic antibody subtypes according to some embodiments.
[0030] FIGS. 13A-13B show a plot showing the effects of immune serum on S. aureus adhesion to human epithelial cells according to some embodiments.
[0031] FIG. 14A is a graph showing IsdA specific IgG serum titers in cows treated with IsdA-CTA.sub.2/B (V) or control IsdA (C). FIG. 14B is a graph showing IsdA specific IgG milk titers in cows. FIG. 14C is a graph showing IsdA-specific IgA milk titers in cows. FIG. 14D is a graph showing IsdA-specific IgA nasal secretion titers in cows. FIG. 14E is a graph showing somatic cell counts in cows treated with IsdA-CTA.sub.2/B or control IsdA.
[0032] FIG. 15A is an illustration of a plasmid pSKJ001 for expression of ClfA-CTA.sub.2/B. FIG. 15B is an image of SDS-PAGE of the S. aureus ClfACTA.sub.2/B chimera (ClfA-CTA.sub.2 approximately 37 kD, CTB equals 11.5 kD). FT=flow through, W1=wash 1, E=elution of D-galactose column.
[0033] FIG. 16A is an illustration of a plasmid pMPEZ001 for expression of IsdB-CTA.sub.2/B. FIG. 16B is an image of SDS-PAGE of the S. aureus IsdBCTA.sub.2/B chimera (IsdB-CTA.sub.2 approximately 42 kD, CTB=11.5 kD). W1=wash 1, E=elution of D-galactose column.
DETAILED DESCRIPTION
[0034] The present invention relates to infectious diseases and, more particularly, to immunogenic compositions comprising chimeric proteins and methods of use thereof in the prevention of Staphylococcus aureus.
[0035] There are a number of advantages related to the present invention. The present invention provides compositions (in some embodiments, chimeric proteins) that may be useful as vaccines against various strains of S. aureus and related bacteria in various organisms (e.g., mammals such as humans, cows, etc.).
[0036] As used herein, the term "chimeric protein" generally refers to any protein comprised of a first amino acid sequence derived from a first source, bonded, covalently or non-covalently (e.g., hydrogen bonding, van der Waals force, hydrophobic interaction, etc.), to a second amino acid sequence derived from a second source, wherein the first and second source are not the same. A first source and a second source that are not the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity. A chimeric protein can include, for example, a protein derived from at least 2 different biological sources. A biological source can include any non-synthetically produced nucleic acid or amino acid sequence (e.g., a genomic or cDNA sequence, a plasmid or viral vector, a native virion or a mutant or analog, as further described herein, of any of the above). A synthetic source can include a protein or nucleic acid sequence produced chemically and not by a biological system (e.g., solid phase synthesis of amino acid sequences). A chimeric protein can also include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source. For the purposes of this disclosure, a chimeric protein may or may not be a single polypeptide (i.e., a fusion protein).
[0037] In some embodiments, the immunogenic compositions may be prophylactic and may be administered before the onset of S. aureus related infections. It is believed that the immunogenic compositions of the present invention can activate humoral responses, stimulate protection, and block the promotion of oral tolerance against S. aureus. Currently, there are no known vaccines that can prevent Staphylococcal infection.
[0038] The present invention provides compositions that comprise a first amino acid sequence derived from a suitable adjuvant source and a second amino acid sequence derived from a suitable antigen source. In some embodiments, the composition may have multiple functions. For example, the first amino acid sequence may act as an adjuvant while the second amino acid sequence may act as an antigen. As used herein, the term "amino acid sequence" does not necessarily imply a single polypeptide. In other words, the amino acid sequence derived from a suitable adjuvant source may not necessarily be confined to a single polypeptide. For example, a portion of the amino acid sequence may be in one polypeptide while the remaining portion of the amino acid sequence may reside in another polypeptide.
[0039] In some embodiments, the composition may be a single polypeptide (e.g., a fusion protein). In other embodiments, the composition may be assembled from two or more polypeptides. In certain embodiments having two or more polypeptides, one or more polypeptide may be chimeric. In certain embodiments, the two or more polypeptides may fold or assemble together within a suitable expression system (e.g., E. coli) or by any other suitable method (e.g., by the use of chaperone molecules).
[0040] The adjuvants typically used to construct the chimeric proteins of the present invention may be non-toxigenic or less toxigenic than full-length or non-chimeric toxins and yet retain their potent adjuvant characteristics. In some embodiments, the adjuvant may have been modified from a toxigenic adjuvant source with a modification that renders the adjuvant non-toxigenic or less toxigenic and likely suitable for mucosal surfaces. Such modifications may include, but are not limited to, mutation of amino acid, removal of toxigenic subunits, and the like.
[0041] As used herein, an "adjuvant" generally refers to a pharmacological or an immunological agent that modifies the effect of other agents (e.g., drug or vaccine), while having few if any direct effects when given by itself. An immunological adjuvant is often included in vaccines to enhance the recipient's immune response to the antigen, while keeping the injection of foreign material to a minimum. For the purposes of this disclosure, an adjuvant may be linked covalently or non-covalently to the antigen.
[0042] While cholera toxin is an example of a potent adjuvant, it remains mostly unsuitable for use in humans. Specifically, there are safety concerns with the mucosal administration of cholera toxin and other similar toxins such as heat-labile toxin and shiga toxin. It is believed that such administration can redirect antigens to the central nervous system through GM1-dependent binding to olfactory epithelium. It has been previously difficult to separate the toxigenicity and adjuvanticity of cholera toxin, heat-labile toxin, and/or shiga toxin.
[0043] In some embodiments, the adjuvant source may be a toxin. The adjuvant may be coupled, assembled, folded, fused, or otherwise associated with an antigen to form a composition that further enhances the immunogenic effects of the antigen. Examples of suitable toxins include, but are not limited to, cholera toxin (CT), shiga toxin (ST1, ST2, etc.), heat-labile toxin (LT, LT-IIa, LT-IIb, etc.) from E. coli. In some preferred embodiments, the toxins are modified to be non-toxigenic while remaining potent immunostimulatory molecules that can bind to and target immune effector cells at mucosal site. It is believed that both shiga toxin and heat-labile toxin are structurally similar or analogous to cholera toxin.
[0044] In particular, cholera toxin is a protein secreted by the bacterium Vibrio cholerae and is generally responsible for the massive, watery diarrhea characteristic of cholera infection. Structurally, cholera toxin is an oligomeric complex made up of six protein subunits: a single copy of the A subunit (part A, enzymatic), and five copies of the B subunit (part B, receptor binding). The A subunit has two important segments: the A1 domain (CTA.sub.1), which is toxigenic and the A2 domain (CTA.sub.2), which forms an extended alpha helix that sits snugly in the central pore of the B subunit ring.
[0045] FIG. 1A shows a ribbon diagram of the cholera toxin crystal structure showing the CTA.sub.1 domain (SEQ ID NO: 1) and connecting CTA.sub.2 domain (SEQ ID NO:2), and the B subunit (SEQ ID NO: 3).
[0046] It is believed that cholera toxin immunomodulation may be involved in the activation of antigen-presenting cells, promotion of B-cell isotype switching, and upregulation of costimulatory and major histocompability complex (MHC) class II expression. Many of these responses result from the interaction of the cholera toxin B (CTB) subunit with the ganglioside GM1 receptor on effector cells, such as dendritic cells, that promote antigen uptake, presentation, and cellular activation. Thus, suitably modified non-toxigenic forms of cholera toxin by themselves may act as an antigen carrier and be highly immunostimulatory. Without being limited by theory, it is believed that heat-labile toxin and shiga toxin are structurally and functionally similar (e.g., adjuvanticity) to the cholera toxin.
[0047] For example, heat-labile toxin has an A.sub.1 domain (SEQ ID NO: 7), A.sub.2 domain (SEQ ID NO: 8), B domain (SEQ ID NO: 9) analogous to the A.sub.1, A.sub.2, and B domains of cholera toxin. An IsdA-LTA.sub.2/B chimeric protein may have a sequence shown in SEQ ID NO: 10.
[0048] An antigen is generally any substance that causes the production of antibodies against it. An antigen may be a foreign substance from the environment or it may also be formed within the environment, such as bacterial toxins or tissue cells. Examples of a suitable antigen source include, but are not limited to, iron-regulated surface determinant A (IsdA), iron-regulated surface determinant B (IsdB), clumping factor A (ClfA), clumping factor B (ClfB), fibronectin-binding protein (FnBP), penicillin binding protein 2a (PBP2A), serine-aspartate rich fibrinogen sialoprotein binding protein (SdrE), and the like.
[0049] In particular, the N-terminal near iron transporter (NEAT) domain of IsdA is capable of binding to a broad spectrum of human ligands, including transferring heme, fibrinogen, fibronectin, and corneocyte envelope proteins to mediate adherence and dissemination of S. aureus. The C-terminal domain of IsdA defends S. aureus against human skin bactericidal fatty acids and antimicrobial peptides by making the cell surface hydrophilic.
[0050] FIG. 1B shows a ribbon diagram of IsdA antigen (SEQ ID NO: 4) that is replacing the toxigenic CTA.sub.1 domain (SEQ ID NO: 1) to construct a chimeric protein that comprises an antigen and a non-toxigenic adjuvant. FIG. 1C shows a ribbon diagram of one preferred chimeric protein, IsdA-CTA.sub.2/B (SEQ ID NO: 5).
[0051] Some embodiments provide compositions comprising: a chimeric protein comprising at least one of: a portion of a cholera toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin; and an antigen comprising at least one of: an antigenic material from S. aureus and an antigenic material from a S. aureus-specific polypeptide.
[0052] In some embodiments, the composition is a fusion protein. In certain embodiments, the composition is a single polypeptide.
[0053] Some embodiments provide a chimeric protein comprising: an adjuvant and an antigen. The adjuvant may be selected from the group consisting of: a portion of a cholera toxin, a portion of a heat-labile toxin, a portion of a shiga toxin, and combinations thereof. The antigen may be selected from the group consisting of: an antigenic material from S. aureus (e.g., carbohydrates, peptides, etc.), an antigenic material from an S. aureus-specific polypeptide, and combinations thereof.
[0054] In some embodiments, the adjuvant is one of: CTA.sub.2/B, LTA.sub.2/B, or STA.sub.2/B. In one or more embodiments, the adjuvant further includes at least one additional cholera toxin B subunit, heat-labile toxin B subunit (e.g., I or II), or shiga toxin B subunit (e.g., I or II). In one or more embodiments, the adjuvant further comprises at least one additional cholera toxin A.sub.2 subunit, heat-labile toxin A.sub.2 subunit (e.g., I or II), or shiga toxin A.sub.2 subunit (e.g., I or II).
[0055] While some preferred embodiments of the domain and chimeric protein sequences have been provided, the present invention may be practiced using any number of alternative embodiments. For example, it is well known in the relevant arts that protein or polypeptide variants typically retain their function as long as they have sufficient sequence identity with their native sequences.
[0056] In some embodiments, the composition has at least about 80% sequence identity to SEQ ID NO: 5, 10, or 15. In some preferred embodiments, the composition has at least about 90% sequence identity to SEQ ID NO: 5, 10, or 15. In some preferred embodiments, the composition has at least about 95% sequence identity to SEQ ID NO: 5, 10, or 15. In certain embodiments, the antigen portion of the composition has at least about 80% sequence identity to SEQ ID NO: 4. In some preferred embodiments, the antigen portion of the composition has at least about 90% sequence identity to SEQ ID NO: 4. In some preferred embodiments, the antigen portion of the composition has at least about 95% sequence identity to SEQ ID NO: 4. In some embodiments, the composition is assembled from a first polypeptide and a second polypeptide that are non-covalently linked. In one or more of these embodiments, the first polypeptide has at least about 80% sequence identity to SEQ ID NO: 6, 11, or 16. In some preferred embodiments, the first polypeptide has at least about 90% sequence identity to SEQ ID NO: 6, 11, or 16. In some preferred embodiments, the first polypeptide has at least about 95% sequence identity to SEQ ID NO: 6, 11, or 16. In some embodiments, the second polypeptide has at least about 80% sequence identity to SEQ ID NO: 3, 9, or 14. In some preferred embodiments, the second polypeptide has at least about 90% sequence identity to SEQ ID NO: 3, 9, or 14. In some preferred embodiments, the second polypeptide has at least about 95% sequence identity to SEQ ID NO: 3, 9, or 14.
[0057] Generally, a chimeric protein will be comprised of a single A.sub.2 subunit and a B subunit (from cholera toxin, heat-labile toxin, or shiga toxin). In some optional embodiments, the chimeric protein may further comprise at least one additional B subunit. In some optional embodiments, the B subunit may comprise five identical peptides. In some optional embodiments, the chimeric protein may further comprise at least one additional A.sub.2 subunit. In some embodiments, the subunits may be linked by a disulfide bond. In some embodiments, the disulfide bond may be engineered. In some embodiments, the antigen has a disulfide bond with the adjuvant. In some embodiments, the antigen is associated non-covalently with the adjuvant.
[0058] In some embodiments, the antigen comprises a sequence that has at least about 80% sequence identity to iron-regulated surface determinant A (IsdA), iron-regulated surface determinant B (IsdB), clumping factor A (ClfA), clumping factor B (ClfB), fibronectin-binding protein (FnBP), fibronectin-binding protein (FnBP), penicillin binding protein 2a (PBP2A), or serine-aspartate rich fibrinogen sialoprotein binding protein (SdrE). In some preferred embodiments, the sequence identity is at least about 90%, or at least about 95%.
[0059] In some exemplary embodiments, the chimeric protein is IsdA-CTA.sub.2/B (SEQ ID NO: 5). As used herein, "IsdA-CTA.sub.2/B" generally refers to a chimeric protein that comprises an IsdA antigen domain, a CTA.sub.2 subunit, and a CTB subunit. In some embodiments, each of the IsdA antigen domain (SEQ ID NO: 4), the CTA.sub.2 domain (SEQ ID NO: 2) and the CTB domain (SEQ ID NO: 3) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0060] In some embodiments, the chimeric protein is IsdA-LTA.sub.2/B (SEQ ID NO: 10). As used herein, "IsdA-LTA.sub.2/B" generally refers to a chimeric protein that comprises an IsdA antigen domain, a LTA.sub.2 subunit, and a LTB subunit. In some embodiments, each of the IsdA antigen domain (SEQ ID NO: 4), the LTA.sub.2 subunit (SEQ ID NO: 8) and the CTB subunit (SEQ ID NO: 9) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0061] In some embodiments, the chimeric protein is IsdA-STA.sub.2/B (SEQ ID NO: 15). As used herein, "IsdA-STA.sub.2/B" generally refers to a chimeric protein that comprises an IsdA antigen domain, a STA.sub.2 subunit, and a STB subunit. In some embodiments, each of the IsdA antigen domain (SEQ ID NO: 4), the STA.sub.2 subunit (SEQ ID NO: 13) and the STB subunit (SEQ ID NO: 14) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0062] In some embodiments, the chimeric protein is IsdB-CTA.sub.2/B (amino acids 24-367 of SEQ ID NO: 22). As used herein, "IsdB-CTA.sub.2/B" generally refers to a chimeric protein that comprises an IsdB antigen domain, a CTA.sub.2 subunit, and a CTB subunit. In some embodiments, each of the IsdB antigen domain (amino acids 42-338 of SEQ ID NO: 23), the CTA.sub.2 subunit (SEQ ID NO: 2) and the CTB subunit (SEQ ID NO: 3) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0063] In some embodiments, the chimeric protein is ClfA-CTA.sub.2/B (amino acids 24-347 of SEQ ID NO: 24). As used herein, "ClfA-CTA.sub.2/B" generally refers to a chimeric protein that comprises a ClfA antigen domain, a CTA.sub.2 subunit, and a CTB subunit. In some embodiments, each of the ClfA antigen domain (amino acids 287-559 of SEQ ID NO: 25), the CTA.sub.2 subunit (SEQ ID NO: 2) and the CTB subunit (SEQ ID NO: 3) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0064] In some embodiments, the chimeric protein may further comprise modifications that enhance at least one of: solubility of the chimeric protein, specificity for S. aureus, specificity for GM1, expression of the chimeric protein, and immunogenicity of the chimeric protein.
[0065] Some embodiments provide methods for generating an immune response in a mammal comprising: administering to the mammal a composition (e.g., chimeric protein) according to one or more embodiments described herein.
[0066] In some embodiments, the mammal is selected from the group consisting of: a human, a cow, a dog, a cat, and a horse.
[0067] In some embodiments, the administration of the composition is by intranasal administration, oral administration, intramuscular administration, peritoneal administration, sublingual administration, transcutaneous administration, subcutaneous administration, intravaginal administration, intramammary administration or intrarectal administration. The administered dosage of the composition may generally be an amount suitable to elicit the desired immune response. In some embodiments, the administering to the mammal comprises: administering the composition to at least one cell from the mammal in vitro or in vivo.
[0068] Some embodiments provide methods for inducing an immune response in a cow comprising: administering to the cow, a chimeric protein according to one or more embodiments described herein.
[0069] To facilitate a better understanding of the present invention, the following examples of preferred embodiments are given. In no way should the following examples be read to limit, or to define, the scope of the invention.
Example 1
[0070] To direct the IsdA-CTA.sub.2 and CTB peptides of the chimera to the E. coli periplasm for proper assembly, pBA001 (FIG. 2) was constructed from pARLDR19, which utilizes the E. coli LTIIb N-terminal leader sequence. Induction of pBA001 and purification from the periplasm of E. coli resulted in efficient IsdA-CTA.sub.2/B production (3 to 4 mg from 1 liter of starting culture). SDS-PAGE analysis of the purification of IsdA-CTA.sub.2/B and immunoblotting using antibodies against CTA and CTB (FIG. 3A) confirm that IsdA-CTA.sub.2 (.about.38 kDa) was copurified with CTB (.about.11 kDa) on D-galactose agarose, which is indicative of proper chimera folding. Referring to FIG. 3A, the SDS-PAGE analysis shows flowthrough (FT), washes (W1 and W2) and elution (E) of IsdA-CTA.sub.2/B from D-galactose affinity purification and anti-CTA/B Western blot of purified IsdA-CTA.sub.2/B (.about.38 and 11 kDA).
[0071] IsdA alone was also purified using a six-histidine tag (SEQ ID NO: 26). FIG. 3B shows an SDS-polyacrylamide gel of all resulting proteins used in animal studies, as well as immunoblotting of purified IsdA with anti-His6 ("His6" disclosed as SEQ ID NO: 26) (.about.37 kDa): ISdA-CTA.sub.2/B (G1), IsdA plus CTA.sub.2/B mixed (G2), and IsdA (G3).
[0072] The following protocol was followed in order to obtain the chimeric proteins.
[0073] MRSA252 strain was used for IsdA isolation. MRSA USA300 (pvl mutant) strain was used in adhesion assays. E. coli TE1, a .DELTA.endA derivative of TX1, and BL21(DE3)/pLysS strains were used for protein expression. All bacterial strains were cultured using Luria-Bertani (LB) agar or broth at 37.degree. C. with chloramphenicol (35 .mu.g/ml), ampicillin (100 .mu.g/ml), and/or kanamycin (50 .mu.g/ml).
[0074] To construct pBA001 plasmid (FIG. 2) for the expression of IsdA-CTA.sub.2/B, IsdA was PCR amplified from MRSA252 with primers that add 5' SphI GCTACTGGCATGCGGCAACAGAAGCTACGAAC (SEQ ID NO: 17) and 3' ClaI GTGCATGATCGATTTTGGTAATTCTTTAGC (SEQ ID NO: 18) sites (in boldface) and cloned into pARLDR19 between the LTIIb leader sequence and CTXA.sub.2. CTB was also expressed from this vector. To make His6-IsdA IsdA ("His6" disclosed as SEQ ID NO: 26), IsdA was amplified from MRSA252 with primers that add 5' BamHI GCTACTGGATCCGCGGCAACAGAAGCTACGAAC (SEQ ID NO: 19) or GTGCATAAGCTTTCAAGTTTTTGGTAATTCTTTAGC (SEQ ID NO: 20) and 3' HindIII GTGCATGATCGATTTTGGTAATTCTTTAGC (SEQ ID NO: 21) sites (in boldface) and cloned into pTrcHisA (Invitrogen, Carlsbad, Calif.) or pET-40b+, yielding pBA009A and pBA015. pARLDR19 was used to express CTA.sub.2/B for the mixed preparation. Plasmids were transformed into E. coli TE1 (pBA001, pBA009A, and pARLDR19) or BL21(DE3)/pLysS (pBA015) and sequenced.
[0075] To express IsdA-CTA.sub.2/B and CTA.sub.2/B, cultures with pBA001 or pARLDR19 were grown to an optical density at 600 nm (OD600) of 0.9 and induced for 15 h with 0.2% L-arabinose. Proteins were purified from the periplasmic extract using immobilized D-galactose. For mock cultures, E. coli TE1 without plasmid was induced, and the periplasmic extract was purified. IsdA was isolated from the cytosol of cultures containing pBA009A and purified by cobalt affinity chromatography under denaturing conditions. IsdA was also purified from periplasmic extracts of cultures containing pBA015 over Talon resin under native conditions. All proteins were dialyzed against phosphate-buffered saline (PBS), reduced to <0.125 endotoxin units (EU)/ml lipopolysaccharide by passage through an endotoxin removal column, and quantified by bicinchoninic acid assay prior to the addition of 5% glycerol.
[0076] Proteins resolved by SDS-12% PAGE were stained with Coomassie or transferred to nitrocellulose membranes. Membranes were blocked overnight with 5% skim milk in PBS plus 0.05% Tween 20 (PBS-T), incubated with polyclonal anti-CTA (1:2,500) and anti-CTB (1:5,000) or anti-His6 ("His6" disclosed as SEQ ID NO: 26) (1:2,500), followed by horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (1:5,000) and developed with IMMOBILON WESTERN HRP SUBSTRATE commercially available from Millipore, Billerica, Mass.
Example 2
[0077] To compare the receptor binding affinity of purified IsdA-CTA.sub.2/B chimera with native CT, ganglioside GM1 ELISA assays using anti-CTA and anti-CTB antibodies were performed.
[0078] GM1 enzyme-linked immunosorbent assays (ELISA) were performed by coating microtiter plates with 0.15 .mu.M GM1 for 15 h at 20.degree. C., blocking with 10% bovine serum albumin, and incubating with IsdA-CTA.sub.2/B or CT for 1 h at 37.degree. C. Ganglioside GM1 is found ubiquitously on mammalian cells and acts as the site of binding for both cholera toxin and heat-labile toxin. Plates were washed with PBS-T and incubated with anti-CTA (1:2,000) or anti-CTB (1:5,000) followed by HRP-conjugated anti-rabbit IgG, both for 1 h at 37.degree. C. The reaction was developed with o-phenylenediamine dihydrochloride (A.sub.450).
[0079] The ELISA results indicate that the B subunit of IsdA-CTA.sub.2/B has GM1 binding affinity similar to that of CT (FIG. 4). Low anti-CTA response from IsdA-CTA.sub.2/B was an expected result from this fusion that contains only 46 bp of full-length CTA.
[0080] Confocal microscopy was used to further confirm receptor binding and internalization of IsdA-CTA.sub.2/B into epithelial and dendritic cells (DC) in vitro. Immune effector cells, such as dendritic cells, have a uniquely high affinity for CT and non-toxigenic CTB. FIGS. 5A-5D show anti-CT FITC-labeled IsdA-CTA.sub.2/B bound to the surface of cells (Vero epithelial cells in FIG. 5A-5B; DC cells in FIG. 5C-5D) at 4.degree. C. and internalization after 45 min at 37.degree. C., indicating that, at a minimum, the CTB subunit of the chimera were efficiently imported into the cell. These images obtained using polyclonal anti-CT and anti-rabbit-FITC with DAPI suggest that IsdA-CTA.sub.2/B was binding and transporting into Vero and DC2.4 cells. Cells were incubated with IsdA-CTA.sub.2/B for 45 minutes at 4.degree. C. to inhibit, or at 37.degree. C. to promote cellular uptake.
Example 3
[0081] The chimeric proteins were tested for their specific humoral response.
[0082] BALB/c mice were mock immunized or immunized intranasally with IsdA-CTA.sub.2/B, IsdA plus CTA.sub.2/B mixed, or IsdA on day 0 and boosted on day 10 (Table 1 below). FIG. 6 shows systemic antibody response to IsdA-CTA.sub.2/B in vivo. Referring to FIG. 6, sera collected on days 0, 10, 14, and 45 were pooled by treatment group at each time point and tested for recognition of IsdA by IgG ELISA. IsdA-specific serum IgG endpoint titers from mice immunized with IsdA-CTA.sub.2/B were significantly higher than those of mock-immunized mice on day 10, than those of all control groups on day 14, and than those of mice immunized with IsdA alone and mock-immunized mice on day 45. As used herein, "*" denotes statistical significance (P<0.05) between mice immunized with IsdA-CTA.sub.2/B versus controls. Nasal, intestinal, and vaginal washes were collected on day 45, pooled by treatment group, and tested for recognition of IsdA by IgA ELISA.
[0083] FIG. 7 shows mucosal antibody response to IsdA-CTA.sub.2/B in vivo. Referring to FIG. 7, the percentage of IsdA-IgA out of total IgA was significantly higher in nasal and vaginal washes from mice immunized with IsdA-CTA.sub.2/B than from mock-immunized mice, mice immunized with IsdA plus CTA.sub.2/B, or mice immunized with IsdA alone. In addition, intestinal IsdA-IgA was significantly higher in IsdA-CTA.sub.2/B-immunized mice than in IsdA- and mock-immunized mice (FIG. 7). Together, these results suggest that IsdA specific systemic and mucosal humoral immunity can be stimulated after intranasal vaccination with the IsdA-CTA.sub.2/B chimera.
TABLE-US-00001 TABLE 1 Immunization Strategy. Days of sampling Dose per Mucosal vacci- Days of secretions Antigen/ nation intranasal and spleen adjuvant (.mu.g) n.sup.b vaccination Sera (n) IsdA- 50 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) CTA.sub.2/B chimera IsdA + 17 + 33.sup.a 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) CTA.sub.2/B IsdA 17 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) Mock NA.sup.c 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) .sup.aConcentrations are according to equimolar to equimolar amounts of IsdA .sup.bn, number of mice .sup.cNA, not applicable
Example 4
[0084] Cellular proliferation of IsdA-stimulated splenocytes was assessed using flow cytometry and a resazurin-based fluorescent dye assay. CFSE-based flow cytometric results suggest that day 45 splenocytes derived from mice immunized with IsdA-CTA.sub.2/B showed significant proliferation of IsdA-specific CD3+T lymphocytes compared with mixed and IsdA control groups (FIGS. 8A-8D and 9). Referring to FIGS. 8A-8D, CFSE-labeled splenocytes were cultured in vitro for 84 h with IsdA and stained with anti-CD3-PE-Cy5. Referring to FIG. 9, percent proliferation of IsdA-specific CD3+ T lymphocytes from individual mice on day 45 was determined by flow cytometry. Mock samples contained low numbers of CD3+ T lymphocytes.
[0085] FIG. 10 shows the result of a resazurin assay of splenocytes from days 14 and 45 cultured in vitro for 84 h with IsdA. The resazurin assays revealed that in vitro stimulation of splenocytes from IsdA-CTA.sub.2/B-immunized mice induced significant proliferation compared with IsdA plus CTA.sub.2/B, IsdA, and mock groups on day 45 (FIG. 10). With the low sample size (n=2 per group) on day 14, no significance was observed between groups. Error bars are based on n=2 (day 14) or n=6 (day 45). Stimulation was observed for the positive control, ConA. These results suggest that intranasal administration of IsdA-CTA.sub.2/B can induce a cellular activation response.
Example 5
[0086] The levels of IL-4 and IFN-.gamma. in supernatants of splenocytes stimulated with IsdA in vitro were determined by ELISA. Referring to FIG. 11, IL-4 and IFN-.gamma. levels in culture supernatants from splenocytes, pooled by immunization group (n=6), were stimulated in vitro for 84 h with IsdA and measured by ELISA. The splenocytes obtained from mice immunized with IsdA-CTA.sub.2/B secreted high levels of IL-4, and these levels were significantly higher than levels of all controls (FIG. 11). Although the level of IFN-.gamma. was slightly higher in IsdA-CTA.sub.2/B-immune splenocytes, low levels of IFN-.gamma., near the detection limit for the assay, were found in all groups (FIG. 11).
[0087] FIG. 12 shows IsdA-specific IgG1 and IgG2a ELISA titrations from day 45 sera pooled by immunization group (n=6). Titrations of IgG1 and IgG2a revealed that immunization with IsdA-CTA.sub.2/B drove isotype switching primarily to the IgG1 subclass although minute IgG2a levels were also detected. These results suggest that immunization with IsdA-CTA.sub.2/B promotes a Th2-type immune response.
Example 6
[0088] Pooled sera from commonly immunized mice were used to investigate the ability of immune serum to functionally block adherence of S. aureus to human epithelial cells (HeLa). FIGS. 13A-13B show the effect of immune serum on S. aureus adhesion to human epithelial cells in vitro. Referring to FIG. 13A, sera (1:100; day 45) was pooled by immunization group and incubated with MRSA252 (5.times.10.sup.7 CFU) for 1 h at 37.degree. C. and then added to confluent HeLa cells. After washing and lysis, the number of internalized and cell-bound bacteria was enumerated. Preincubation of the S. aureus strain used for vaccination (MRSA252) with day 45 sera from IsdA-CTA.sub.2/B-immunized mice significantly reduced bacterial adhesion to epithelial cells compared to all control groups (FIG. 13A).
[0089] FIG. 13B shows the result of similar tests performed with MRSA USA300 (5.times.10.sup.9 CFU). Referring to FIG. 13B, there was a significant reduction in bacterial adhesion to human epithelial cells after a different strain of S. aureus (MRSA USA300) was preincubated with day 45 sera from mice immunized with IsdA-CTA.sub.2/B (FIG. 13B).
[0090] These examples suggest that the chimeric proteins of the present invention can bind and transport into epithelial and dendritic cells as consistent with the uptake of CT involving retrograde movement to the perinuclear domain of the Golgi apparatus and endoplastmic reticulum. It is believed that the ability of the chimeric proteins to bind to GM1 and trigger internalization leads to the activation of immune effector cells by the CTB subunit and promotes antigen presentation on MHC molecules.
[0091] Moreover, the ELISAs of IsdA-specific responses from the sera and nasal, intestinal, and vaginal fluids of intranasally immunized mice verifies that the chimeric proteins can induce antigen-specific systemic and mucosal immunity in mice. As expected, IgG titers were highest on day 14 after the boost and began to diminish by day 45.
[0092] These results also suggest the characteristic ability of CT to induce systemic IgG to antigens co-administered with CT at mucosal sites. The presence of IsdA-specific IgA in nasal, intestinal, and vaginal fluids after intranasal immunization with IsdA-CTA.sub.2/B suggests that IgA blasts migrated from the nasal-associated lymphoid tissue into distal mucosal effector sites in the nasal passage and gastrointestinal and genital tracts. Thus, it is believed that CT and CT derivatives promote more of a Th2-type response, which is typically characterized by secretion of IL-4 leading to induction of antibody class switching to non-complement-activating IgG1. In vitro functional assays of antibodies revealed a significant reduction in internalized and cell-bound bacteria on human epithelial cells after preincubation of IsdA-CTA.sub.2/B immune serum with the S. aureus isolate used for vaccination, MRSA252. Additionally, antibodies were able to prevent adhesion of MRSA USA300.
[0093] IsdA from MRSA252 and MRSA USA300 has 92% amino acid identity with the majority of differences present within the C terminus, which suggests that antibodies against IsdA are functional in vitro and may protect against multiple serotypes in vivo.
[0094] The results also suggest that the humoral and cellular responses induced by IsdA-CTA.sub.2/B are superior to those stimulated by a mixed preparation of antigen and adjuvant (IsdA plus CTA.sub.2/B). Thus, the structure of the IsdA-CTA.sub.2/B chimera is optimal for the induction of antigen-specific humoral responses and potentially for presentation on MHC molecules.
Example 7
[0095] To direct the ClfA-CTA.sub.2 and CTB peptides of the chimera to the E. coli periplasm for proper assembly, pSKJ001 (FIG. 15A) was constructed from pARLDR19, which utilizes the E. coli LTIIb N-terminal leader sequence. SDS-PAGE analysis of the purification of ClfA-CTA.sub.2/B confirms that ClfA-CTA.sub.2 (.about.37 kDa) was copurified with CTB (11.5 kDa) on D-galactose agarose, which is indicative of proper chimera folding. Referring to FIG. 15B, the SDS-PAGE analysis shows flowthrough (FT), wash 1 (W1) and elution (E) of ClfA-CTA.sub.2/B from D-galactose affinity purification.
[0096] To direct the IsdB-CTA.sub.2 and CTB peptides of the chimera to the E. coli periplasm for proper assembly, pSKJ001 (FIG. 16A) was constructed from pARLDR19, which utilizes the E. coli LTIIb N-terminal leader sequence. SDS-PAGE analysis of the purification of IsdB-CTA.sub.2/B confirms that IsdB-CTA.sub.2 (.about.42 kDa) was copurified with CTB (11.5 kDa) on D-galactose agarose, which is indicative of proper chimera folding. Referring to FIG. 16B, the SDS-PAGE analysis shows flowthrough (FT), wash 1 (W1) and elution (E) of IsdB-CTA.sub.2/B from D-galactose affinity purification.
Example 8
[0097] Milk anti-IsdA IgA titer levels were measured in cows treated with a chimeric protein according to one or more embodiments of the present invention. Six (2472, 2340, 2319, 2403, 2299, 2296) clinically healthy Holstein dairy cows were vaccinated intranasally on day 0 with 300 .mu.g of IsdA-CTA.sub.2/B chimera (cows 2472, 2340, 2319) or an equivalent concentration of IsdA alone (cows 2403, 2299, 2296). Cows were boosted on day 14 with the same concentration. Milk was collected on days 0, 14 and 28 and analyzed by IsdA-specific IgA ELISA. Immunogenicity of the IsdA-CTA.sub.2/B chimera was measured after intranasal delivery in dairy cows (FIGS. 14A-14E).
[0098] A. IsdA specific IgG serum titers of IsdA-CTA.sub.2/B vaccinated cows (2472, 2340, 2319) and IsdA control vaccinated cows (2403, 2299, 2296).
[0099] Titers were calculated as the highest dilution 0.2 O.D. above background and were reported as a ratio with Day 0. Combined titers of IsdA-CTA.sub.2/B vaccinated cows were significant over IsdA control vaccinated cows on day 49 (**Student's t-test, p-0.003)
[0100] B. IsdA specific IgG milk titers of IsdA-CTA.sub.2/B vaccinated cows (2472, 2340, 2319) and IsdA control vaccinated cows (2403, 2299, 2296).
[0101] Titers were calculated as the highest dilution 0.2 O.D. above background and are reported as a ratio with Day 0. Combined titers of IsdA-CTA.sub.2/B vaccinated cows were significant over IsdA control vaccinated cows on days 14, 28, and 49 (*Student's t-test, p<0.05).
[0102] C. IsdA-specific IgA in milk from IsdA-CTA.sub.2/B vaccinated cows and IsdA vaccinated cows.
[0103] Levels were reported as the ratio of IsdA specific IgA over total IgA after the subtraction of Day 0 at a milk dilution of 1:8. No significant differences were detected between IsdA-CTA.sub.2/B vaccinated cows and IsdA control vaccinated cows.
[0104] D. IsdA-specific IgA in nasal secretions from IsdA-CTA.sub.2/B vaccinated cows and IsdA vaccinated cows.
[0105] Levels were reported as the ratio of IsdA specific IgA over total IgA after the subtraction of Day 0 at a nasal wash dilution of 1:8. No significant differences were detected between IsdA-CTA.sub.2/B vaccinated cows and IsdA control vaccinated cows.
[0106] E. Somatic cell counts throughout the study of IsdA-CTA.sub.2/B vaccinated cows and IsdA vaccinated cows. No significant differences were detected between IsdA-CTA.sub.2/B vaccinated cows and IsdA control vaccinated cows.
[0107] Therefore, the present invention is well adapted to attain the ends and advantages mentioned as well as those that are inherent therein. The particular embodiments disclosed above are illustrative only, as the present invention may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein. Furthermore, no limitations are intended to the details of construction or design herein shown, other than as described in the claims below. It is therefore evident that the particular illustrative embodiments disclosed above may be altered, combined, or modified and all such variations are considered within the scope and spirit of the present invention. The invention illustratively disclosed herein suitably may be practiced in the absence of any element that is not specifically disclosed herein and/or any optional element disclosed herein. While compositions and methods are described in terms of "comprising," "containing," or "including" various components or steps, the compositions and methods can also "consist essentially of" or "consist of" the various components and steps. All numbers and ranges disclosed above may vary by some amount. Whenever a numerical range with a lower limit and an upper limit is disclosed, any number and any included range falling within the range is specifically disclosed. In particular, every range of values (of the form, "from about a to about b," or, equivalently, "from approximately a to b," or, equivalently, "from approximately a-b") disclosed herein is to be understood to set forth every number and range encompassed within the broader range of values. Also, the terms in the claims have their plain, ordinary meaning unless otherwise explicitly and clearly defined by the patentee. Moreover, the indefinite articles "a" or "an," as used in the claims, are defined herein to mean one or more than one of the element that it introduces. If there is any conflict in the usages of a word or term in this specification and one or more patent or other documents that may be incorporated herein by reference, the definitions that are consistent with this specification should be adopted.
Sequence CWU
1
1
261193PRTVibrio cholerae 1Asn Asp Asp Lys Leu Tyr Arg Ala Asp Ser Arg Pro
Pro Asp Glu Ile1 5 10
15Lys Gln Ser Gly Gly Leu Met Pro Arg Gly Gln Ser Glu Tyr Phe Asp
20 25 30Arg Gly Thr Gln Met Asn Ile
Asn Leu Tyr Asp His Ala Arg Gly Thr 35 40
45Gln Thr Gly Phe Val Arg His Asp Asp Gly Tyr Val Ser Thr Ser
Ile 50 55 60Ser Leu Arg Ser Ala His
Leu Val Gly Gln Thr Ile Leu Ser Gly His65 70
75 80Ser Thr Tyr Tyr Ile Tyr Val Ile Ala Thr Ala
Pro Asn Met Phe Asn 85 90
95Val Asn Asp Val Leu Gly Ala Tyr Ser Pro His Pro Asp Glu Gln Glu
100 105 110Val Ser Ala Leu Gly Gly
Ile Pro Tyr Ser Gln Ile Tyr Gly Trp Tyr 115 120
125Arg Val His Phe Gly Val Leu Asp Glu Gln Leu His Arg Asn
Arg Gly 130 135 140Tyr Arg Asp Arg Tyr
Tyr Ser Asn Leu Asp Ile Ala Pro Ala Ala Asp145 150
155 160Gly Tyr Gly Leu Ala Gly Phe Pro Pro Glu
His Arg Ala Trp Arg Glu 165 170
175Glu Pro Trp Ile His His Ala Pro Pro Gly Cys Gly Asn Ala Pro Arg
180 185 190Ser247PRTVibrio
cholerae 2Ser Met Ser Asn Thr Ser Asp Glu Lys Thr Gln Ser Leu Gly Val
Lys1 5 10 15Phe Leu Asp
Glu Tyr Gln Ser Lys Val Lys Arg Gln Ile Phe Ser Gly 20
25 30Tyr Gln Ser Asp Ile Asp Thr His Asn Arg
Ile Lys Asp Glu Leu 35 40
453103PRTVibrio cholerae 3Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu Tyr
His Asn Thr Gln1 5 10
15Ile His Thr Leu Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu Ala
20 25 30Gly Lys Arg Glu Met Ala Ile
Ile Thr Phe Lys Asn Gly Ala Thr Phe 35 40
45Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys
Ala 50 55 60Ile Glu Arg Met Lys Asp
Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala65 70
75 80Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys
Thr Pro His Ala Ile 85 90
95Ala Ala Ile Ser Met Ala Asn 1004273PRTStaphylococcus aureus
4Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val Ser1
5 10 15Gln Ala Thr Ser Gln Pro
Ile Asn Phe Gln Val Gln Lys Asp Gly Ser 20 25
30Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro
Gly Lys Val 35 40 45Ile Lys Gln
Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60Ser Phe Trp Lys Glu Tyr Lys Phe Tyr Asn Ala Asn
Asn Gln Glu Leu65 70 75
80Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp Thr Arg Thr Ile
85 90 95Asn Val Ala Val Glu Pro
Gly Tyr Lys Ser Leu Thr Thr Lys Val His 100
105 110Ile Val Val Pro Gln Ile Asn Tyr Asn His Arg Tyr
Thr Thr His Leu 115 120 125Glu Phe
Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala Ala Lys Pro Asn 130
135 140Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln
Pro Lys Thr Pro Thr145 150 155
160Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175Val Thr Ala Pro
Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190Ser Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr
Gln Ser Ala Arg Thr 195 200 205Val
Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln Thr Pro 210
215 220Val Lys Asp Val Ala Thr Ala Lys Ser Glu
Ser Asn Asn Gln Ala Val225 230 235
240Ser Asp Asn Lys Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn
Glu 245 250 255Val His Lys
Gln Gly Pro Ser Lys Asp Ser Lys Ala Lys Glu Leu Pro 260
265 270Lys5423PRTArtificial SequenceDescription
of Artificial Sequence Synthetic chimeric protein IsdA-CTA2/B
polypeptide 5Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val
Ser1 5 10 15Gln Ala Thr
Ser Gln Pro Ile Asn Phe Gln Val Gln Lys Asp Gly Ser 20
25 30Ser Glu Lys Ser His Met Asp Asp Tyr Met
Gln His Pro Gly Lys Val 35 40
45Ile Lys Gln Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60Ser Phe Trp Lys Glu Tyr Lys Phe Tyr
Asn Ala Asn Asn Gln Glu Leu65 70 75
80Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp Thr Arg
Thr Ile 85 90 95Asn Val
Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His 100
105 110Ile Val Val Pro Gln Ile Asn Tyr Asn
His Arg Tyr Thr Thr His Leu 115 120
125Glu Phe Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala Ala Lys Pro Asn
130 135 140Asn Val Lys Pro Val Gln Pro
Lys Pro Ala Gln Pro Lys Thr Pro Thr145 150
155 160Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys
Val Lys Pro Ala 165 170
175Val Thr Ala Pro Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val
180 185 190Ser Ser Glu Ala Thr Lys
Asp Gln Ser Gln Thr Gln Ser Ala Arg Thr 195 200
205Val Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln
Thr Pro 210 215 220Val Lys Asp Val Ala
Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val225 230
235 240Ser Asp Asn Lys Ser Gln Gln Thr Asn Lys
Val Thr Lys Gln Asn Glu 245 250
255Val His Lys Gln Gly Pro Ser Lys Asp Ser Lys Ala Lys Glu Leu Pro
260 265 270Lys Ser Met Ser Asn
Thr Ser Asp Glu Lys Thr Gln Ser Leu Gly Val 275
280 285Lys Phe Leu Asp Glu Tyr Gln Ser Lys Val Lys Arg
Gln Ile Phe Ser 290 295 300Gly Tyr Gln
Ser Asp Ile Asp Thr His Asn Arg Ile Lys Asp Glu Leu305
310 315 320Thr Pro Gln Asn Ile Thr Asp
Leu Cys Ala Glu Tyr His Asn Thr Gln 325
330 335Ile His Thr Leu Asn Asp Lys Ile Phe Ser Tyr Thr
Glu Ser Leu Ala 340 345 350Gly
Lys Arg Glu Met Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr Phe 355
360 365Gln Val Glu Val Pro Gly Ser Gln His
Ile Asp Ser Gln Lys Lys Ala 370 375
380Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala385
390 395 400Lys Val Glu Lys
Leu Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile 405
410 415Ala Ala Ile Ser Met Ala Asn
4206320PRTArtificial SequenceDescription of Artificial Sequence Synthetic
chimeric protein Isda-CTA2 polypeptide 6Ala Thr Glu Ala Thr Asn Ala
Thr Asn Asn Gln Ser Thr Gln Val Ser1 5 10
15Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys
Asp Gly Ser 20 25 30Ser Glu
Lys Ser His Met Asp Asp Tyr Met Gln His Pro Gly Lys Val 35
40 45Ile Lys Gln Asn Asn Lys Tyr Tyr Phe Gln
Ala Val Leu Asn Asn Ala 50 55 60Ser
Phe Trp Lys Glu Tyr Lys Phe Tyr Asn Ala Asn Asn Gln Glu Leu65
70 75 80Ala Thr Thr Val Val Asn
Asp Asp Lys Lys Ala Asp Thr Arg Thr Ile 85
90 95Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr
Thr Lys Val His 100 105 110Ile
Val Val Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125Glu Phe Glu Lys Ala Ile Pro Thr Leu
Ala Asp Ala Ala Lys Pro Asn 130 135
140Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln Pro Lys Thr Pro Thr145
150 155 160Glu Gln Thr Lys
Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala 165
170 175Val Thr Ala Pro Ser Lys Asn Glu Asn Arg
Gln Thr Thr Lys Val Val 180 185
190Ser Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr Gln Ser Ala Arg Thr
195 200 205Val Lys Thr Thr Gln Thr Ala
Gln Asp Gln Asn Lys Val Gln Thr Pro 210 215
220Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala
Val225 230 235 240Ser Asp
Asn Lys Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu
245 250 255Val His Lys Gln Gly Pro Ser
Lys Asp Ser Lys Ala Lys Glu Leu Pro 260 265
270Lys Ser Met Ser Asn Thr Ser Asp Glu Lys Thr Gln Ser Leu
Gly Val 275 280 285Lys Phe Leu Asp
Glu Tyr Gln Ser Lys Val Lys Arg Gln Ile Phe Ser 290
295 300Gly Tyr Gln Ser Asp Ile Asp Thr His Asn Arg Ile
Lys Asp Glu Leu305 310 315
3207193PRTEscherichia coli 7Asn Gly Asp Lys Leu Tyr Arg Ala Asp Ser Arg
Pro Pro Asp Glu Ile1 5 10
15Lys Arg Ser Gly Gly Leu Met Pro Arg Gly His Asn Glu Tyr Phe Asp
20 25 30Arg Gly Thr Gln Met Asn Ile
Asn Leu Tyr Asp His Ala Arg Gly Thr 35 40
45Gln Thr Gly Phe Val Arg Tyr Asp Asp Gly Tyr Val Ser Thr Ser
Leu 50 55 60Ser Leu Arg Ser Ala His
Leu Ala Gly Gln Ser Ile Leu Ser Gly Tyr65 70
75 80Ser Thr Tyr Tyr Ile Tyr Val Ile Ala Thr Ala
Pro Asn Met Phe Asn 85 90
95Val Asn Asp Val Leu Gly Val Tyr Ser Pro His Pro Tyr Glu Gln Glu
100 105 110Val Ser Ala Leu Gly Gly
Ile Pro Tyr Ser Gln Ile Tyr Gly Trp Tyr 115 120
125Arg Val Asn Phe Gly Val Ile Asp Glu Arg Leu His Arg Asn
Arg Glu 130 135 140Tyr Arg Asp Arg Tyr
Tyr Arg Asn Leu Asn Ile Ala Pro Ala Glu Asp145 150
155 160Gly Tyr Arg Leu Ala Gly Phe Pro Pro Asp
His Gln Ala Trp Arg Glu 165 170
175Glu Pro Trp Ile His His Ala Pro Gln Gly Cys Gly Asn Ser Ser Arg
180 185 190Thr847PRTEscherichia
coli 8Ile Thr Gly Asp Thr Cys Asn Glu Glu Thr Gln Asn Leu Ser Thr Ile1
5 10 15Tyr Leu Arg Lys Tyr
Gln Ser Lys Val Lys Arg Gln Ile Phe Ser Asp 20
25 30Tyr Gln Ser Glu Val Asp Ile Tyr Asn Arg Ile Arg
Asn Glu Leu 35 40
459103PRTEscherichia coli 9Ala Pro Gln Ser Ile Thr Glu Leu Cys Ser Glu
Tyr His Asn Thr Gln1 5 10
15Ile Tyr Thr Ile Asn Asp Lys Ile Leu Ser Tyr Thr Glu Ser Met Ala
20 25 30Gly Lys Arg Glu Met Val Ile
Ile Thr Phe Lys Ser Gly Ala Thr Phe 35 40
45Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys
Ala 50 55 60Ile Glu Arg Met Lys Asp
Thr Leu Arg Ile Thr Tyr Leu Thr Glu Thr65 70
75 80Lys Ile Asp Lys Leu Cys Val Trp Asn Asn Lys
Thr Pro Asn Ser Ile 85 90
95Ala Ala Ile Ser Met Glu Asn 10010423PRTArtificial
SequenceDescription of Artificial Sequence Synthetic chimeric
protein IsdA-LTA2/B polypeptide 10Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn
Gln Ser Thr Gln Val Ser1 5 10
15Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys Asp Gly Ser
20 25 30Ser Glu Lys Ser His Met
Asp Asp Tyr Met Gln His Pro Gly Lys Val 35 40
45Ile Lys Gln Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn
Asn Ala 50 55 60Ser Phe Trp Lys Glu
Tyr Lys Phe Tyr Asn Ala Asn Asn Gln Glu Leu65 70
75 80Ala Thr Thr Val Val Asn Asp Asp Lys Lys
Ala Asp Thr Arg Thr Ile 85 90
95Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His
100 105 110Ile Val Val Pro Gln
Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125Glu Phe Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala
Ala Lys Pro Asn 130 135 140Asn Val Lys
Pro Val Gln Pro Lys Pro Ala Gln Pro Lys Thr Pro Thr145
150 155 160Glu Gln Thr Lys Pro Val Gln
Pro Lys Val Glu Lys Val Lys Pro Ala 165
170 175Val Thr Ala Pro Ser Lys Asn Glu Asn Arg Gln Thr
Thr Lys Val Val 180 185 190Ser
Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr Gln Ser Ala Arg Thr 195
200 205Val Lys Thr Thr Gln Thr Ala Gln Asp
Gln Asn Lys Val Gln Thr Pro 210 215
220Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val225
230 235 240Ser Asp Asn Lys
Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255Val His Lys Gln Gly Pro Ser Lys Asp Ser
Lys Ala Lys Glu Leu Pro 260 265
270Lys Ile Thr Gly Asp Thr Cys Asn Glu Glu Thr Gln Asn Leu Ser Thr
275 280 285Ile Tyr Leu Arg Lys Tyr Gln
Ser Lys Val Lys Arg Gln Ile Phe Ser 290 295
300Asp Tyr Gln Ser Glu Val Asp Ile Tyr Asn Arg Ile Arg Asn Glu
Leu305 310 315 320Ala Pro
Gln Ser Ile Thr Glu Leu Cys Ser Glu Tyr His Asn Thr Gln
325 330 335Ile Tyr Thr Ile Asn Asp Lys
Ile Leu Ser Tyr Thr Glu Ser Met Ala 340 345
350Gly Lys Arg Glu Met Val Ile Ile Thr Phe Lys Ser Gly Ala
Thr Phe 355 360 365Gln Val Glu Val
Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys Ala 370
375 380Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Thr Tyr
Leu Thr Glu Thr385 390 395
400Lys Ile Asp Lys Leu Cys Val Trp Asn Asn Lys Thr Pro Asn Ser Ile
405 410 415Ala Ala Ile Ser Met
Glu Asn 42011320PRTArtificial SequenceDescription of
Artificial Sequence Synthetic chimeric protein IsdA-LTA2 polypeptide
11Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val Ser1
5 10 15Gln Ala Thr Ser Gln Pro
Ile Asn Phe Gln Val Gln Lys Asp Gly Ser 20 25
30Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro
Gly Lys Val 35 40 45Ile Lys Gln
Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60Ser Phe Trp Lys Glu Tyr Lys Phe Tyr Asn Ala Asn
Asn Gln Glu Leu65 70 75
80Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp Thr Arg Thr Ile
85 90 95Asn Val Ala Val Glu Pro
Gly Tyr Lys Ser Leu Thr Thr Lys Val His 100
105 110Ile Val Val Pro Gln Ile Asn Tyr Asn His Arg Tyr
Thr Thr His Leu 115 120 125Glu Phe
Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala Ala Lys Pro Asn 130
135 140Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln
Pro Lys Thr Pro Thr145 150 155
160Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175Val Thr Ala Pro
Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190Ser Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr
Gln Ser Ala Arg Thr 195 200 205Val
Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln Thr Pro 210
215 220Val Lys Asp Val Ala Thr Ala Lys Ser Glu
Ser Asn Asn Gln Ala Val225 230 235
240Ser Asp Asn Lys Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn
Glu 245 250 255Val His Lys
Gln Gly Pro Ser Lys Asp Ser Lys Ala Lys Glu Leu Pro 260
265 270Lys Ile Thr Gly Asp Thr Cys Asn Glu Glu
Thr Gln Asn Leu Ser Thr 275 280
285Ile Tyr Leu Arg Lys Tyr Gln Ser Lys Val Lys Arg Gln Ile Phe Ser 290
295 300Asp Tyr Gln Ser Glu Val Asp Ile
Tyr Asn Arg Ile Arg Asn Glu Leu305 310
315 32012250PRTEscherichia coli 12Glu Phe Thr Leu Asp Phe
Ser Thr Ala Lys Thr Tyr Val Asp Ser Leu1 5
10 15Asn Val Ile Arg Ser Ala Ile Gly Thr Pro Leu Gln
Thr Ile Ser Ser 20 25 30Gly
Gly Thr Ser Leu Leu Met Ile Asp Ser Gly Thr Gly Asp Asn Leu 35
40 45Phe Ala Val Asp Val Arg Gly Ile Asp
Pro Glu Glu Gly Arg Phe Asn 50 55
60Asn Leu Arg Leu Ile Val Glu Arg Asn Asn Leu Tyr Val Thr Gly Phe65
70 75 80Val Asn Arg Thr Asn
Asn Val Phe Tyr Arg Phe Ala Asp Phe Ser His 85
90 95Val Thr Phe Pro Gly Thr Thr Ala Val Thr Leu
Ser Gly Asp Ser Ser 100 105
110Tyr Thr Thr Leu Gln Arg Val Ala Gly Ile Ser Arg Thr Gly Met Gln
115 120 125Ile Asn Arg His Ser Leu Thr
Thr Ser Tyr Leu Asp Leu Met Ser His 130 135
140Ser Gly Thr Ser Leu Thr Gln Ser Val Ala Arg Ala Met Leu Arg
Phe145 150 155 160Val Thr
Val Thr Ala Glu Ala Leu Arg Phe Arg Gln Ile Gln Arg Gly
165 170 175Phe Arg Thr Thr Leu Asp Asp
Leu Ser Gly Arg Ser Tyr Val Met Thr 180 185
190Ala Glu Asp Val Asp Leu Thr Leu Asn Trp Gly Arg Leu Ser
Ser Val 195 200 205Leu Pro Asp Tyr
His Gly Gln Asp Ser Val Arg Val Gly Arg Ile Ser 210
215 220Phe Gly Ser Ile Asn Ala Ile Leu Gly Ser Val Ala
Leu Ile Leu Asn225 230 235
240Cys His His His Ala Ser Arg Val Ala Arg 245
2501342PRTEscherichia coli 13Met Ala Ser Asp Glu Phe Pro Ser Met Cys
Pro Ala Asp Gly Arg Val1 5 10
15Arg Gly Ile Thr His Asn Lys Ile Leu Trp Asp Ser Ser Thr Leu Gly
20 25 30Ala Ile Leu Met Arg Arg
Thr Ile Ser Ser 35 401469PRTEscherichia coli
14Thr Pro Asp Cys Val Thr Gly Lys Val Glu Tyr Thr Lys Tyr Asn Asp1
5 10 15Asp Asp Thr Phe Thr Val
Lys Val Gly Asp Lys Glu Leu Phe Thr Asn 20 25
30Arg Trp Asn Leu Gln Ser Leu Leu Leu Ser Ala Gln Ile
Thr Gly Met 35 40 45Thr Val Thr
Ile Lys Thr Asn Ala Cys His Asn Gly Gly Gly Phe Ser 50
55 60Glu Val Ile Phe Arg6515384PRTArtificial
SequenceDescription of Artificial Sequence Synthetic chimeric
protein IsdA-STA2/B polypeptide 15Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn
Gln Ser Thr Gln Val Ser1 5 10
15Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys Asp Gly Ser
20 25 30Ser Glu Lys Ser His Met
Asp Asp Tyr Met Gln His Pro Gly Lys Val 35 40
45Ile Lys Gln Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn
Asn Ala 50 55 60Ser Phe Trp Lys Glu
Tyr Lys Phe Tyr Asn Ala Asn Asn Gln Glu Leu65 70
75 80Ala Thr Thr Val Val Asn Asp Asp Lys Lys
Ala Asp Thr Arg Thr Ile 85 90
95Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His
100 105 110Ile Val Val Pro Gln
Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125Glu Phe Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala
Ala Lys Pro Asn 130 135 140Asn Val Lys
Pro Val Gln Pro Lys Pro Ala Gln Pro Lys Thr Pro Thr145
150 155 160Glu Gln Thr Lys Pro Val Gln
Pro Lys Val Glu Lys Val Lys Pro Ala 165
170 175Val Thr Ala Pro Ser Lys Asn Glu Asn Arg Gln Thr
Thr Lys Val Val 180 185 190Ser
Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr Gln Ser Ala Arg Thr 195
200 205Val Lys Thr Thr Gln Thr Ala Gln Asp
Gln Asn Lys Val Gln Thr Pro 210 215
220Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val225
230 235 240Ser Asp Asn Lys
Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255Val His Lys Gln Gly Pro Ser Lys Asp Ser
Lys Ala Lys Glu Leu Pro 260 265
270Lys Met Ala Ser Asp Glu Phe Pro Ser Met Cys Pro Ala Asp Gly Arg
275 280 285Val Arg Gly Ile Thr His Asn
Lys Ile Leu Trp Asp Ser Ser Thr Leu 290 295
300Gly Ala Ile Leu Met Arg Arg Thr Ile Ser Ser Thr Pro Asp Cys
Val305 310 315 320Thr Gly
Lys Val Glu Tyr Thr Lys Tyr Asn Asp Asp Asp Thr Phe Thr
325 330 335Val Lys Val Gly Asp Lys Glu
Leu Phe Thr Asn Arg Trp Asn Leu Gln 340 345
350Ser Leu Leu Leu Ser Ala Gln Ile Thr Gly Met Thr Val Thr
Ile Lys 355 360 365Thr Asn Ala Cys
His Asn Gly Gly Gly Phe Ser Glu Val Ile Phe Arg 370
375 38016315PRTArtificial SequenceDescription of
Artificial Sequence Synthetic chimeric protein IsdA-STA2 polypeptide
16Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val Ser1
5 10 15Gln Ala Thr Ser Gln Pro
Ile Asn Phe Gln Val Gln Lys Asp Gly Ser 20 25
30Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro
Gly Lys Val 35 40 45Ile Lys Gln
Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60Ser Phe Trp Lys Glu Tyr Lys Phe Tyr Asn Ala Asn
Asn Gln Glu Leu65 70 75
80Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp Thr Arg Thr Ile
85 90 95Asn Val Ala Val Glu Pro
Gly Tyr Lys Ser Leu Thr Thr Lys Val His 100
105 110Ile Val Val Pro Gln Ile Asn Tyr Asn His Arg Tyr
Thr Thr His Leu 115 120 125Glu Phe
Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala Ala Lys Pro Asn 130
135 140Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln
Pro Lys Thr Pro Thr145 150 155
160Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175Val Thr Ala Pro
Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190Ser Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr
Gln Ser Ala Arg Thr 195 200 205Val
Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln Thr Pro 210
215 220Val Lys Asp Val Ala Thr Ala Lys Ser Glu
Ser Asn Asn Gln Ala Val225 230 235
240Ser Asp Asn Lys Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn
Glu 245 250 255Val His Lys
Gln Gly Pro Ser Lys Asp Ser Lys Ala Lys Glu Leu Pro 260
265 270Lys Met Ala Ser Asp Glu Phe Pro Ser Met
Cys Pro Ala Asp Gly Arg 275 280
285Val Arg Gly Ile Thr His Asn Lys Ile Leu Trp Asp Ser Ser Thr Leu 290
295 300Gly Ala Ile Leu Met Arg Arg Thr
Ile Ser Ser305 310 3151732DNAArtificial
SequenceDescription of Artificial Sequence Synthetic 5' SphI PCR
primer 17gctactggca tgcggcaaca gaagctacga ac
321830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic 3' ClaI primer 18gtgcatgatc gattttggta attctttagc
301933DNAArtificial SequenceDescription of
Artificial Sequence Synthetic 5' BamHI primer 19gctactggat
ccgcggcaac agaagctacg aac
332036DNAArtificial SequenceDescription of Artificial Sequence Synthetic
5' BamHI alternative primer 20gtgcataagc tttcaagttt ttggtaattc tttagc
362130DNAArtificial SequenceDescription of
Artificial Sequence Synthetic 3' HindIII primer 21gtgcatgatc
gattttggta attctttagc
3022367PRTArtificial SequenceDescription of Artificial Sequence Synthetic
chimeric protein IsdB-CTA2 polypeptide 22Met Ser Phe Lys Lys Ile Ile
Lys Ala Phe Val Ile Met Ala Ala Leu1 5 10
15Val Ser Val Gln Ala His Ala Ala Glu Glu Thr Gly Gly
Thr Asn Thr 20 25 30Glu Ala
Gln Pro Lys Thr Glu Ala Val Ala Ser Pro Thr Thr Thr Ser 35
40 45Glu Lys Ala Pro Glu Thr Lys Pro Val Ala
Asn Ala Val Ser Val Ser 50 55 60Asn
Lys Glu Val Glu Ala Pro Thr Ser Glu Thr Lys Glu Ala Lys Glu65
70 75 80Val Lys Glu Val Lys Ala
Pro Lys Glu Thr Lys Glu Val Lys Pro Ala 85
90 95Ala Lys Ala Thr Asn Asn Thr Tyr Pro Ile Leu Asn
Gln Glu Leu Arg 100 105 110Glu
Ala Ile Lys Asn Pro Ala Ile Lys Asp Lys Asp His Ser Ala Pro 115
120 125Asn Ser Arg Pro Ile Asp Phe Glu Met
Lys Lys Lys Asp Gly Thr Gln 130 135
140Gln Phe Tyr His Tyr Ala Ser Ser Val Lys Pro Ala Arg Val Ile Phe145
150 155 160Thr Asp Ser Lys
Pro Glu Ile Glu Leu Gly Leu Gln Ser Gly Gln Phe 165
170 175Trp Arg Lys Phe Glu Val Tyr Glu Gly Asp
Lys Lys Leu Pro Ile Lys 180 185
190Leu Val Ser Tyr Asp Thr Val Lys Asp Tyr Ala Tyr Ile Arg Phe Ser
195 200 205Val Ser Asn Gly Thr Lys Ala
Val Lys Ile Val Ser Ser Thr His Phe 210 215
220Asn Asn Lys Glu Glu Lys Tyr Asp Tyr Thr Leu Met Glu Phe Ala
Gln225 230 235 240Pro Ile
Tyr Asn Ser Ala Asp Lys Phe Lys Thr Glu Glu Asp Tyr Lys
245 250 255Ala Glu Lys Leu Leu Ala Pro
Tyr Lys Lys Ala Lys Thr Leu Glu Arg 260 265
270Gln Val Tyr Glu Leu Asn Lys Ile Gln Asp Lys Leu Pro Glu
Lys Leu 275 280 285Lys Ala Glu Tyr
Lys Lys Lys Leu Glu Asp Thr Lys Lys Ala Leu Asp 290
295 300Glu Gln Val Lys Ser Ala Ile Thr Glu Phe Gln Asn
Val Gln Pro Thr305 310 315
320Ser Met Ser Asn Thr Ser Asp Glu Lys Thr Gln Ser Leu Gly Val Lys
325 330 335Phe Leu Asp Glu Tyr
Gln Ser Lys Val Lys Arg Gln Ile Phe Ser Gly 340
345 350Tyr Gln Ser Asp Ile Asp Thr His Asn Arg Ile Lys
Asp Glu Leu 355 360
36523645PRTStaphylococcus aureus 23Met Asn Lys Gln Gln Lys Glu Phe Lys
Ser Phe Tyr Ser Ile Arg Lys1 5 10
15Ser Ser Leu Gly Val Ala Ser Val Ala Ile Ser Thr Leu Leu Leu
Leu 20 25 30Met Ser Asn Gly
Glu Ala Gln Ala Ala Ala Glu Glu Thr Gly Gly Thr 35
40 45Asn Thr Glu Ala Gln Pro Lys Thr Glu Ala Val Ala
Ser Pro Thr Thr 50 55 60Thr Ser Glu
Lys Ala Pro Glu Thr Lys Pro Val Ala Asn Ala Val Ser65 70
75 80Val Ser Asn Lys Glu Val Glu Ala
Pro Thr Ser Glu Thr Lys Glu Ala 85 90
95Lys Glu Val Lys Glu Val Lys Ala Pro Lys Glu Thr Lys Glu
Val Lys 100 105 110Pro Ala Ala
Lys Ala Thr Asn Asn Thr Tyr Pro Ile Leu Asn Gln Glu 115
120 125Leu Arg Glu Ala Ile Lys Asn Pro Ala Ile Lys
Asp Lys Asp His Ser 130 135 140Ala Pro
Asn Ser Arg Pro Ile Asp Phe Glu Met Lys Lys Lys Asp Gly145
150 155 160Thr Gln Gln Phe Tyr His Tyr
Ala Ser Ser Val Lys Pro Ala Arg Val 165
170 175Ile Phe Thr Asp Ser Lys Pro Glu Ile Glu Leu Gly
Leu Gln Ser Gly 180 185 190Gln
Phe Trp Arg Lys Phe Glu Val Tyr Glu Gly Asp Lys Lys Leu Pro 195
200 205Ile Lys Leu Val Ser Tyr Asp Thr Val
Lys Asp Tyr Ala Tyr Ile Arg 210 215
220Phe Ser Val Ser Asn Gly Thr Lys Ala Val Lys Ile Val Ser Ser Thr225
230 235 240His Phe Asn Asn
Lys Glu Glu Lys Tyr Asp Tyr Thr Leu Met Glu Phe 245
250 255Ala Gln Pro Ile Tyr Asn Ser Ala Asp Lys
Phe Lys Thr Glu Glu Asp 260 265
270Tyr Lys Ala Glu Lys Leu Leu Ala Pro Tyr Lys Lys Ala Lys Thr Leu
275 280 285Glu Arg Gln Val Tyr Glu Leu
Asn Lys Ile Gln Asp Lys Leu Pro Glu 290 295
300Lys Leu Lys Ala Glu Tyr Lys Lys Lys Leu Glu Asp Thr Lys Lys
Ala305 310 315 320Leu Asp
Glu Gln Val Lys Ser Ala Ile Thr Glu Phe Gln Asn Val Gln
325 330 335Pro Thr Asn Glu Lys Met Thr
Asp Leu Gln Asp Thr Lys Tyr Val Val 340 345
350Tyr Glu Ser Val Glu Asn Asn Glu Ser Met Met Asp Thr Phe
Val Lys 355 360 365His Pro Ile Lys
Thr Gly Met Leu Asn Gly Lys Lys Tyr Met Val Met 370
375 380Glu Thr Thr Asn Asp Asp Tyr Trp Lys Asp Phe Met
Val Glu Gly Gln385 390 395
400Arg Val Arg Thr Ile Ser Lys Asp Ala Lys Asn Asn Thr Arg Thr Ile
405 410 415Ile Phe Pro Tyr Val
Glu Gly Lys Thr Leu Tyr Asp Ala Ile Val Lys 420
425 430Val His Val Lys Thr Ile Asp Tyr Asp Gly Gln Tyr
His Val Arg Ile 435 440 445Val Asp
Lys Glu Ala Phe Thr Lys Ala Asn Thr Asp Lys Ser Asn Lys 450
455 460Lys Glu Gln Gln Asp Asn Ser Ala Lys Lys Glu
Ala Thr Pro Ala Thr465 470 475
480Pro Ser Lys Pro Thr Pro Ser Pro Val Glu Lys Glu Ser Gln Lys Gln
485 490 495Asp Ser Gln Lys
Asp Asp Asn Lys Gln Leu Pro Ser Val Glu Lys Glu 500
505 510Asn Asp Ala Ser Ser Glu Ser Gly Lys Asp Lys
Thr Pro Ala Thr Lys 515 520 525Pro
Thr Lys Gly Glu Val Glu Ser Ser Ser Thr Thr Pro Thr Lys Val 530
535 540Val Ser Thr Thr Gln Asn Val Ala Lys Pro
Thr Thr Ala Ser Ser Lys545 550 555
560Thr Thr Lys Asp Val Val Gln Thr Ser Ala Gly Ser Ser Glu Ala
Lys 565 570 575Asp Ser Ala
Pro Leu Gln Lys Ala Asn Ile Lys Asn Thr Asn Asp Gly 580
585 590His Thr Gln Ser Gln Asn Asn Lys Asn Thr
Gln Glu Asn Lys Ala Lys 595 600
605Ser Leu Pro Gln Thr Gly Glu Glu Ser Asn Lys Asp Met Thr Leu Pro 610
615 620Leu Met Ala Leu Leu Ala Leu Ser
Ser Ile Val Ala Phe Val Leu Pro625 630
635 640Arg Lys Arg Lys Asn
64524347PRTArtificial SequenceDescription of Artificial Sequence
Synthetic chimeric protein ClfA-CTA2 polypeptide 24Met Ser Phe Lys
Lys Ile Ile Lys Ala Phe Val Ile Met Ala Ala Leu1 5
10 15Val Ser Val Gln Ala His Ala Gly Val Thr
Ser Thr Ala Lys Val Pro 20 25
30Pro Ile Met Ala Gly Asp Gln Val Leu Ala Asn Gly Val Ile Asp Ser
35 40 45Asp Gly Asn Val Ile Tyr Thr Phe
Thr Asp Tyr Val Asn Thr Lys Asp 50 55
60Asp Val Lys Ala Thr Leu Thr Met Pro Ala Tyr Ile Asp Pro Glu Asn65
70 75 80Val Lys Lys Thr Gly
Asn Val Thr Leu Ala Thr Gly Ile Gly Ser Thr 85
90 95Thr Ala Asn Lys Thr Val Leu Val Asp Tyr Glu
Lys Tyr Gly Lys Phe 100 105
110Tyr Asn Leu Ser Ile Lys Gly Thr Ile Asp Gln Ile Asp Lys Thr Asn
115 120 125Asn Thr Tyr Arg Gln Thr Ile
Tyr Val Asn Pro Ser Gly Asp Asn Val 130 135
140Ile Ala Pro Val Leu Thr Gly Asn Leu Lys Pro Asn Thr Asp Ser
Asn145 150 155 160Ala Leu
Ile Asp Gln Gln Asn Thr Ser Ile Lys Val Tyr Lys Val Asp
165 170 175Asn Ala Ala Asp Leu Ser Glu
Ser Tyr Phe Val Asn Pro Glu Asn Phe 180 185
190Glu Asp Val Thr Asn Ser Val Asn Ile Thr Phe Pro Asn Pro
Asn Gln 195 200 205Tyr Lys Val Glu
Phe Asn Thr Pro Asp Asp Gln Ile Thr Thr Pro Tyr 210
215 220Ile Val Val Val Asn Gly His Ile Asp Pro Asn Ser
Lys Gly Asp Leu225 230 235
240Ala Leu Arg Ser Thr Leu Tyr Gly Tyr Asn Ser Asn Ile Ile Trp Arg
245 250 255Ser Met Ser Trp Asp
Asn Glu Val Ala Phe Asn Asn Gly Ser Gly Ser 260
265 270Gly Asp Gly Ile Asp Lys Pro Val Val Pro Glu Gln
Pro Asp Glu Pro 275 280 285Gly Glu
Ile Glu Pro Ile Pro Ser Arg Ser Thr Val Ser Met Ser Asn 290
295 300Thr Ser Asp Glu Lys Thr Gln Ser Leu Gly Val
Lys Phe Leu Asp Glu305 310 315
320Tyr Gln Ser Lys Val Lys Arg Gln Ile Phe Ser Gly Tyr Gln Ser Asp
325 330 335Ile Asp Thr His
Asn Arg Ile Lys Asp Glu Leu 340
34525933PRTStaphylococcus aureus 25Met Asn Met Lys Lys Lys Glu Lys His
Ala Ile Arg Lys Lys Ser Ile1 5 10
15Gly Val Ala Ser Val Leu Val Gly Thr Leu Ile Gly Phe Gly Leu
Leu 20 25 30Ser Ser Lys Glu
Ala Asp Ala Ser Glu Asn Ser Val Thr Gln Ser Asp 35
40 45Ser Ala Ser Asn Glu Ser Lys Ser Asn Asp Ser Ser
Ser Val Ser Ala 50 55 60Ala Pro Lys
Thr Asp Asp Thr Asn Val Ser Asp Thr Lys Thr Ser Ser65 70
75 80Asn Thr Asn Asn Gly Glu Thr Ser
Val Ala Gln Asn Pro Ala Gln Gln 85 90
95Glu Thr Thr Gln Ser Ser Ser Thr Asn Ala Thr Thr Glu Glu
Thr Pro 100 105 110Val Thr Gly
Glu Ala Thr Thr Thr Thr Thr Asn Gln Ala Asn Thr Pro 115
120 125Ala Thr Thr Gln Ser Ser Asn Thr Asn Ala Glu
Glu Leu Val Asn Gln 130 135 140Thr Ser
Asn Glu Thr Thr Ser Asn Asp Thr Asn Thr Val Ser Ser Val145
150 155 160Asn Ser Pro Gln Asn Ser Thr
Asn Ala Glu Asn Val Ser Thr Thr Gln 165
170 175Asp Thr Ser Thr Glu Ala Thr Pro Ser Asn Asn Glu
Ser Ala Pro Gln 180 185 190Ser
Thr Asp Ala Ser Asn Lys Asp Val Val Asn Gln Ala Val Asn Thr 195
200 205Ser Ala Pro Arg Met Arg Ala Phe Ser
Leu Ala Ala Val Ala Ala Asp 210 215
220Ala Pro Ala Ala Gly Thr Asp Ile Thr Asn Gln Leu Thr Asn Val Thr225
230 235 240Val Gly Ile Asp
Ser Gly Thr Thr Val Tyr Pro His Gln Ala Gly Tyr 245
250 255Val Lys Leu Asn Tyr Gly Phe Ser Val Pro
Asn Ser Ala Val Lys Gly 260 265
270Asp Thr Phe Lys Ile Thr Val Pro Lys Glu Leu Asn Leu Asn Gly Val
275 280 285Thr Ser Thr Ala Lys Val Pro
Pro Ile Met Ala Gly Asp Gln Val Leu 290 295
300Ala Asn Gly Val Ile Asp Ser Asp Gly Asn Val Ile Tyr Thr Phe
Thr305 310 315 320Asp Tyr
Val Asn Thr Lys Asp Asp Val Lys Ala Thr Leu Thr Met Pro
325 330 335Ala Tyr Ile Asp Pro Glu Asn
Val Lys Lys Thr Gly Asn Val Thr Leu 340 345
350Ala Thr Gly Ile Gly Ser Thr Thr Ala Asn Lys Thr Val Leu
Val Asp 355 360 365Tyr Glu Lys Tyr
Gly Lys Phe Tyr Asn Leu Ser Ile Lys Gly Thr Ile 370
375 380Asp Gln Ile Asp Lys Thr Asn Asn Thr Tyr Arg Gln
Thr Ile Tyr Val385 390 395
400Asn Pro Ser Gly Asp Asn Val Ile Ala Pro Val Leu Thr Gly Asn Leu
405 410 415Lys Pro Asn Thr Asp
Ser Asn Ala Leu Ile Asp Gln Gln Asn Thr Ser 420
425 430Ile Lys Val Tyr Lys Val Asp Asn Ala Ala Asp Leu
Ser Glu Ser Tyr 435 440 445Phe Val
Asn Pro Glu Asn Phe Glu Asp Val Thr Asn Ser Val Asn Ile 450
455 460Thr Phe Pro Asn Pro Asn Gln Tyr Lys Val Glu
Phe Asn Thr Pro Asp465 470 475
480Asp Gln Ile Thr Thr Pro Tyr Ile Val Val Val Asn Gly His Ile Asp
485 490 495Pro Asn Ser Lys
Gly Asp Leu Ala Leu Arg Ser Thr Leu Tyr Gly Tyr 500
505 510Asn Ser Asn Ile Ile Trp Arg Ser Met Ser Trp
Asp Asn Glu Val Ala 515 520 525Phe
Asn Asn Gly Ser Gly Ser Gly Asp Gly Ile Asp Lys Pro Val Val 530
535 540Pro Glu Gln Pro Asp Glu Pro Gly Glu Ile
Glu Pro Ile Pro Glu Asp545 550 555
560Ser Asp Ser Asp Pro Gly Ser Asp Ser Gly Ser Asp Ser Asn Ser
Asp 565 570 575Ser Gly Ser
Asp Ser Gly Ser Asp Ser Thr Ser Asp Ser Gly Ser Asp 580
585 590Ser Ala Ser Asp Ser Asp Ser Ala Ser Asp
Ser Asp Ser Ala Ser Asp 595 600
605Ser Asp Ser Ala Ser Asp Ser Asp Ser Ala Ser Asp Ser Asp Ser Asp 610
615 620Asn Asp Ser Asp Ser Asp Ser Asp
Ser Asp Ser Asp Ser Asp Ser Asp625 630
635 640Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
Ser Asp Ser Asp 645 650
655Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
660 665 670Ser Asp Ser Asp Ser Asp
Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp 675 680
685Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
Ser Asp 690 695 700Ser Asp Ser Asp Ser
Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp705 710
715 720Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
Ser Asp Ser Asp Ser Asp 725 730
735Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
740 745 750Ser Asp Ser Asp Ser
Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Ala 755
760 765Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
Ser Asp Ser Asp 770 775 780Ser Asp Ser
Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp785
790 795 800Ser Asp Ser Asp Ser Asp Ser
Glu Ser Asp Ser Asp Ser Glu Ser Asp 805
810 815Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp Ser Asp
Ser Asp Ser Asp 820 825 830Ser
Asp Ser Asp Ser Ala Ser Asp Ser Asp Ser Gly Ser Asp Ser Asp 835
840 845Ser Ser Ser Asp Ser Asp Ser Glu Ser
Asp Ser Asn Ser Asp Ser Glu 850 855
860Ser Gly Ser Asn Asn Asn Val Val Pro Pro Asn Ser Pro Lys Asn Gly865
870 875 880Thr Asn Ala Ser
Asn Lys Asn Glu Ala Lys Asp Ser Lys Glu Pro Leu 885
890 895Pro Asp Thr Gly Ser Glu Asp Glu Ala Asn
Thr Ser Leu Ile Trp Gly 900 905
910Leu Leu Ala Ser Ile Gly Ser Leu Leu Leu Phe Arg Arg Lys Lys Glu
915 920 925Asn Lys Asp Lys Lys
930266PRTArtificial SequenceDescription of Artificial Sequence Synthetic
6xHis tag 26His His His His His His1 5
User Contributions:
Comment about this patent or add new information about this topic: