Patent application title: GENERATION OF NEURAL STEM CELLS AND MOTOR NEURONS
Inventors:
IPC8 Class: AC12N50797FI
USPC Class:
1 1
Class name:
Publication date: 2020-12-03
Patent application number: 20200377854
Abstract:
A method of generating a population of cells useful for treating a brain
disorder in a subject is disclosed. The method comprises contacting
mesenchymal stem cells (MSCs) with at least one exogenous miRNA having a
nucleic acid sequence at least 90% identical to a sequence selected from
the group consisting of SEQ ID NOs: 15-19 and 27-35, thereby generating a
population of cells and/or generating neurotrophic factors that may
provide important signals to damaged tissues or locally residing stem
cells. MSCs differentiated by miRs may also secrete miRs and deliver them
to adjacent cells and therefore provide important signals to neighboring
endogenous normal or malignant cells.Claims:
1. A method of promoting mesenchymal stem cell (MSC) differentiation
toward a neuronal stem cell, the method comprising: (i) culturing a MSC
in a medium supporting neuronal stem cell growth and differentiation;
(ii) contacting said MSC with an exogenous agent that down-regulates an
amount, activity or both of Related to testis-specific, vespid and
pathogenesis protein 1 (RTVP-1); and (iii) confirming increased
expression at least one neuronal marker selected from the group
consisting of nestin and Sox2 by detecting expression of said marker on
said MSC, thereby promoting differentiation of the MSC into the neuronal
stem cell.
2. The method of claim 1, wherein said contacting comprises introducing into said MSC a microRNA (miR) or siRNA that down-regulates RTVP-1.
3. The method of claim 2, wherein said miR is miR-137.
4. The method of claim 2, wherein said siRNA comprises the nucleotide sequence provided in SEQ ID NO: 481.
5. The method of claim 2, wherein said introducing comprises any one of: (i) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes a pre-miRNA of said miR; (ii) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes said miR; (iii) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes an shRNA comprising said siRNA; and (iv) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes said siRNA.
6. The method of claim 1, further comprising introducing into said MSC an exogenous molecule selected from miR-218, miR-504, miR-9, miR-125 and a miR-31 antagomir before said confirming.
7. The method of claim 6, comprising introducing into said MSC exogenous miR-218.
8. The method of claim 6, wherein said introducing comprises any one of: (i) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes a pre-miRNA of said miR; and (ii) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes said miR.
9. A method of promoting mesenchymal stem cell (MSC) differentiation toward a neuronal stem cell, the method comprising: (i) culturing a MSC in a medium supporting neuronal stem cell growth and differentiation; (ii) contacting said MSC with an exogenous agent that down-regulates an amount, activity or both of Related to testis-specific, vespid and pathogenesis protein 1 (RTVP-1); and (iii) confirming expression of at least one neuronal stem cell marker selected from the group consisting of nestin and Sox2, wherein said expressing results in at least 50% of the MSCs expressing said neuronal stem cell marker, thereby promoting differentiation of the MSC into the neuronal stem cell.
10. The method of claim 9, wherein said contacting comprises introducing into said MSC a microRNA (miR) or siRNA that down-regulates RTVP-1.
11. The method of claim 10, wherein said miR is miR-137.
12. The method of claim 10, wherein said siRNA comprises the nucleotide sequence provided in SEQ ID NO: 481.
13. The method of claim 10, wherein said introducing comprises any one of: (i) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes a pre-miRNA of said miR; (ii) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes said miR; (iii) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes an shRNA comprising said siRNA; and (iv) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes said siRNA.
14. The method of claim 9, further comprising introducing into said MSC an exogenous molecule selected from miR-218, miR-504, miR-9, miR-125 and a miR-31 antagomir before said confirming.
15. The method of claim 14, comprising introducing into said MSC exogenous miR-218.
16. The method of claim 14, wherein said introducing comprises any one of: (i) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes a pre-miRNA of said miR; and (ii) transfecting said MSCs with an expression vector which comprises a polynucleotide sequence which encodes said miR.
17. A method of treating a subject suffering from a brain cancer, the method comprising administering to said subject an MSC differentiated toward a neuronal stem cell by the method of claim 1, thereby treating a subject suffering from a brain cancer.
18. The method of claim 17, wherein said brain cancer is a glioma.
19. A method of treating a subject suffering from a brain cancer, the method comprising administering to said subject an MSC differentiated toward a neuronal stem cell by the method of claim 9, thereby treating a subject suffering from a brain cancer.
20. The method of claim 17, wherein said brain cancer is a glioma.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent application Ser. No. 15/794,137 filed on Oct. 26, 2017, which is a continuation-in-part of U.S. patent application Ser. No. 14/380,165 filed on Aug. 21, 2014 and titled "Generation of Neural Stem Cells and Motor Neurons" and Issued as U.S. Pat. No. 9,803,175 on Oct. 31, 2017, which is a national phase of PCT Patent Application No. PCT/IB2013/051429 filed on Feb. 21, 2013, which claims the benefit of priority of U.S. Provisional Patent Application No. 61/601,596 filed on Feb. 22, 2012. The contents of the above applications are all incorporated by reference as if fully set forth herein in their entirety.
FIELD AND BACKGROUND OF THE INVENTION
[0002] The present invention, in some embodiments thereof, relates to methods of ex vivo differentiating mesenchymal stem cells towards neural stem cells and motor neurons using microRNAs (miRNAs).
[0003] Mesenchymal stem cells (MSCs) are a heterogeneous population of stromal cells that can be isolated from multiple species, residing in most connective tissues including bone marrow, adipose, placenta, umbilical cord and perivascular tissues. MSCs can also be isolated from the placenta, amniotic fluid and cord's Wharton's jelly.
[0004] The concentration of MSCs in all tissues, including bone marrow and adipose tissue is very low but their number can be expanded in vitro. Typically, expansion of MSCs using up to 15 passages does not result in mutations indicating genetic stability. MSC can differentiate into cells of the mesenchymal lineage, such as bone, cartilage and fat but, under certain conditions, have been reported to acquire the phenotype of cells of the endodermal and neuroectodermal lineage, suggesting some potential for "trans-differentiation".
[0005] Within the bone marrow compartment, these cells are tightly intermingled with and support hematopoiesis and the survival of hematopoietic stem cells in acquiescent state (7). In addition, after expansion in culture, MSCs retain their ability to modulate innate and adaptive immunity (8). Furthermore, MSCs migrate actively to sites of inflammation and protect damaged tissues, including the CNS, properties that supported their use as new immunosuppressive or rather immunoregulatory or anti-inflammatory agents for the treatment of inflammatory and immune-mediated diseases including autoimmune disorders (9). These features of MSCs merited their use to control life-threatening graft-versus-host-disease (GVHD) following allogeneic bone marrow transplantation, thus controlling one of the most serious complications of allogenic bone marrow transplantation, helping to lower transplant-related toxicity and mortality associated with multi-system organ injury (10).
[0006] Several studies have shown that MSCs following exposure to different factors in vitro, change their phenotype and demonstrate neuronal and glial markers [Kopen, G. C., et al., Proc Natl Acad USA. 96(19):10711-6, 1999; Sanchez-Ramos, et al. Exp Neurol. 164(2):247-56. 2000; Woodbury, D., J Neurosci Res. 61(4):364-70, 2000; Woodbury, D., et al., J Neurosci Res. 69(6):908-17, 2002; Black, I. B., Woodbury, D. Blood Cells Mol Dis. 27(3):632-6, 2001; Kohyama, J., et al. Differentiation. 68(4-5):235-44, 2001; Levy, Y. S. J Mol Neurosci. 21(2):121-32, 2003].
[0007] Accordingly, MSCs (both ex-vivo differentiated and non-differentiated) have been proposed as candidates for cell replacement therapy for the treatment of various neurological disorders including multiple sclerosis, Parkinson's disease, ALS, Alzheimer's disease, spinal cord injury and stroke.
[0008] Motor neurons in the spinal cord innervate skeletal muscles, and originate from neuroepithelial cells in a restricted area of the developing spinal cord (neural tube). During embryonic development, motor neurons extend their processes (nerves) to the periphery to innervate skeletal muscles that are adjacent to the spinal cord. In an adult human body, however, motor neuron's axons are projected large distances away from the cell bodies in the spinal cord to reach their target muscles. Because of this, motor neurons have a higher metabolic rate compared to smaller neurons, and this renders them more susceptible to genetic, epigenetic, and environmental changes. Motor neurons cannot renew themselves and therefore their loss or degeneration are generally associated with fatal neurological conditions including paralysis and disorders such as pediatric spinal muscular atrophy (SMA) and adult onset amyotrophic lateral sclerosis (ALS).
[0009] Roy et al., 2005 [Exp Neural. 2005; 196:224-234]; Zhang et al., 2006 [Stem Cells. 2006; 24:434-442]; Bohl et al., 2008 [Stem Cells. 2008; 26:2564-2575]; and Dimos et al., 2008 [Science. 2008; 321:1218-1221] the contents of which are incorporated by reference teach genetic modification of different stem cells to induce differentiation into motor neurons.
SUMMARY OF THE INVENTION
[0010] According to an aspect of some embodiments of the present invention there is provided a method of predisposing mesenchymal stem cells to differentiate into neural stem cells, the method comprising up-regulating a level of at least one exogenous miRNA selected from the group consisting of miR-1275, miR-891a, miR-154, miR-1202, miR-572, miR-935a, miR302b, miR-371, miR-134, miR-219, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132, let-7c, miR-665, miR-4258, miR-361-3p, miR-374a-star, miR-892b, miR-361-5p, miR-181a, miR-16, miR-636, miR-4284, miR-1208, miR-1274b, miR-30c-2-star, miR-501-3p, hsa-miR-92a, miR-378b, miR-1287, miR-425-star, miR-324-5p, miR-3178, miR-219-1-3p, miR-197, miR-181b, miR-500-star, miR-106b, miR-502-3p, miR-30c, miR-1275, miR-422a, miR-93, miR-181d, miR-1307, miR-1301, miR-99a, miR-505-star, miR-1202, miR-12, miR-532-5p, miR-195, miR-532-3p, miR-106a, miR-17, miR-1271, miR-769-3p, miR-15b, miR-324-3p, miR-20a, miR-501-5p, miR-330-3p, miR-874, miR-500, miR-25, miR-769-5p, miR-125b-2-star, miR-130b, miR-504, miR-181a-2-star, miR-885-3p, miR-1246, miR-92b, miR-362-5p, miR-572, miR-4270, miR-378c, miR-93-star, miR-149, miR-363, miR-9, miR-18a, miR-346, miR-497, miR-378, miR-1231, miR-139-5p, miR-3180-3p, miR-935 and miR-20b in the mesenchymal stem cells (MSCs), thereby predisposing the MSCs to differentiate into the neural stem cells.
[0011] According to an aspect of some embodiments of the present invention there is provided a method of predisposing MSCs to differentiate into neural stem cells, the method comprising down-regulating an expression of at least one miRNA selected from the group consisting of miR-4317, miR-153, miR-4288, miR-409-5p, miR-193a-5p, miR-lOb, miR-142-3p, miR-131a, miR-125b, miR-181a, miR-145, miR-143, miR-214, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-138, miR-31, miR-21, miR-193a-5p, miR-224-star, miR-196a, miR-487b, miR-409-5p, miR-193b-star, miR-379, miR-21-star, miR-27a-star, miR-27a, miR-4317, miR-193b, miR-27b, miR-22, 574-3p, miR-4288, miR-23a, miR-221-star, miR-2113, let-7i, miR-24, miR-23b, miR-299-3p, miR-518c-star, miR-221, miR-431-star, miR-523, miR-4313, miR-559, miR-614, miR-653, miR-2278, miR-768-5p, miR-154-star, miR-302a-star, miR-3199 and miR-3137 in the mesenchymal stem cells by up-regulating a level of at least one polynucleotide agent that hybridizes and inhibits a function of the at least one miRNA thereby predisposing the MSCs to differentiate into the neural stem cells.
[0012] According to an aspect of some embodiments of the present invention there is provided a method of predisposing MSCs to differentiate into neural stem cells, the method comprising up-regulating a level of exogenous miR-124 in the mesenchymal stem cells (MSCs) and down-regulating a level of miR-let-7 in the MSCs, thereby predisposing the MSCs to differentiate into the neural stem cells.
[0013] According to an aspect of some embodiments of the present invention there is provided a method of predisposing MSCs to differentiate into neural stem cells, the method comprising contacting the mesenchymal stem cells (MSCs) with an agent that down-regulates an amount and/or activity of Related to testis-specific, vespid and pathogenesis protein 1 (RTVP-1), thereby predisposing MSCs to differentiate into the neural stem cells.
[0014] According to an aspect of some embodiments of the present invention there is provided a method of predisposing neural stem cells to differentiate into motor neurons, the method comprising up-regulating a level of at least one exogenous miRNA selected from the group consisting of miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a, miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154, miR-20a and miR-130a in neural stem cells (NSCs), thereby predisposing NSCs to differentiate into the motor neurons.
[0015] According to an aspect of some embodiments of the present invention there is provided a method of predisposing MSCs to differentiate into motor neurons, the method comprising up-regulating a level of at least one exogenous miRNA selected from the group consisting of miR-648, miR-368, miR-365, miR-500, miR-491, miR-218, miR-155, miR-192, let-7b, miR-16, miR-210, miR-197, miR-21, miR-373, miR-27a, miR-122, miR-17, miR-494, miR-449, miR-503, miR-30a, miR-196a, miR-122, miR-7, miR-151-5p, miR-16, miR-22, miR-31, miR-424, miR-1, miR-29c, miR-942, miR-100, miR-520, miR-663a, miR-562, miR-449a, miR-449b-5p, miR-520b, miR-451, miR-532-59, miR-605, miR-504, miR-503, miR-155, miR-34a, miR-16, miR-7b, miR-103, miR-124, miR-1385p, miR-16, miR-330, miR-520, miR-608, miR-708, miR-107, miR-137, miR-132, miR-145, miR-204, miR-125b, miR-224, miR-30a, miR-375, miR-101, miR-106b, miR-128, miR-129-5p, miR-153, miR-203, miR-214, miR-338-3p, miR-346, miR-98, miR-107, miR-141, miR-217, miR-424, miR-449, miR-7, miR-9, miR-93, miR-99a, miR-100, miR-1228, miR-183, miR-185, miR-190, miR-522, miR-650, miR-675, miR-342-3p, miR-31 in the mesenchymal stem cells (MSCs), thereby predisposing MSCs to differentiate into the motor neurons.
[0016] According to an aspect of some embodiments of the present invention there is provided a method of predisposing NSCs to differentiate into motor neurons, the method comprising down-regulating an expression of at least one miRNA selected from the group consisting of miR-372, miR-373, miR-141, miR-199a, miR-32, miR-33, miR-221 and miR-223 by up-regulating a level of at least one polynucleotide agent that hybridizes and inhibits a function of the at least one miRNA in the NSCs thereby predisposing NSCs to differentiate into the motor neurons.
[0017] According to an aspect of some embodiments of the present invention there is provided a method of predisposing MSCs to differentiate into motor neurons, the method comprising down-regulating an expression of at least one miRNA selected from the group consisting of miR-372, miR-373, miR-942, miR-2113, miR-199a-3p, miR-199a-5p, miR-372, miR-373, miR-942, miR-2113, miR-301a-3p, miR-302c, miR-30b-5p, miR-30c, miR-326, miR-328, miR-331-3p, miR-340, miR-345, miR-361-5p, miR-363, miR-365a-3p, miR-371a-3p, miR-3'73-3p, miR-374a, miR-423-3p, miR-449b-5p, miR-451a, miR-494, miR-504, miR-515-3p, miR-516a-3p, miR-519e, miR-520a-3p, miR-520c-3p, miR-520g, miR-532-5p, miR-559, miR-562, miR-572, miR-590-5p, miR-605, miR-608, miR-626, miR-639, miR-654-3p, miR-657, miR-661, miR-708-5p, miR-942, miR-96, miR-99amo and miR-194 by up-regulating a level of at least one polynucleotide agent that hybridizes and inhibits a function of the at least one miRNA in the MSCs thereby predisposing MSCs to differentiate into the motor neurons.
[0018] According to an aspect of some embodiments of the present invention there is provided a genetically modified isolated population of cells which comprise at least one exogenous miRNA selected from the group consisting of miR302b, miR-371, miR-134, miR-219, miR-154, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132 and miR-137 and/or which comprise at least one polynucleotide agent that hybridizes and inhibits a function of at least one miRNA selected from the group consisting of miR-10b, miR-142-3p, miR-131a, miR-125b, miR-153 and miR-181a, wherein the cells have a neural stem cell phenotype.
[0019] According to an aspect of some embodiments of the present invention there is provided a genetically modified isolated population of cells which comprise at least one exogenous miRNA selected from the group consisting of miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a, miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154, miR-20a, miR-130a and/or which comprise at least one polynucleotide agent that hybridizes and inhibits a function of at least one miRNA selected from the group consisting of miR-372, miR-373, miR-141, miR-199a, miR-32, miR-33, miR-221 and miR-223, wherein the cells have a motor neuron phenotype.
[0020] According to an aspect of some embodiments of the present invention there is provided a method of treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the isolated population of cells of claim 33, thereby treating the brain disease or disorder.
[0021] According to an aspect of some embodiments of the present invention there is provided a pharmaceutical composition comprising the isolated population of cells described herein and a pharmaceutically acceptable carrier.
[0022] According to an aspect of some embodiments of the present invention there is provided a method of selecting a miRNA which may be regulated for the treatment of a motor neuron disease comprising:
[0023] (a) differentiating a population of neural stem cells towards a motor neuron phenotype; and
[0024] (b) analyzing a change in expression of a miRNA in the population of MSCs prior to and following the differentiating of the MSCs towards a motor neuron phenotype, wherein a change of expression of a miRNA above or below a predetermined level is indicative that the miRNA may be regulated for the treatment of the motor neuron disease.
[0025] According to an aspect of some embodiments of the present invention there is provided a method of treating a motor neuron disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the isolated population of cells of claim 35, thereby treating the brain disease or disorder.
[0026] According to an aspect of some embodiments of the present invention there is provided a genetically modified isolated population of cells which comprise at least one exogenous miRNA selected from the group consisting of miR-1275, miR-891a, miR-154, miR-1202, miR-572 and miR-935a and/or which comprise at least one polynucleotide agent that hybridizes and inhibits a function of at least one miRNA selected from the group consisting of miR-4317, miR-153, miR-4288, miR-409-5p, miR-193a-5p, wherein said cells have a neural stem cell phenotype.
[0027] According to an aspect of some embodiments of the present invention there is provided a genetically modified isolated population of cells which comprise at least one exogenous miRNA selected from the group consisting of miR-648, miR-368, miR-365, miR-500 and miR-491 and/or which comprise at least one polynucleotide agent that hybridizes and inhibits a function of at least one miRNA selected from the group consisting of miR-372, miR-373, miR-942, miR-2113, miR-199a-3p and miR-199a-5p, wherein said cells have a motor neuron phenotype.
[0028] According to some embodiments of the invention, the at least one exogenous miRNA is selected from the group consisting of miR-1275, miR-891a, miR-154, miR-1202, miR-572 and miR-935a.
[0029] According to some embodiments of the invention, the at least one exogenous miRNA is selected from the group consisting of miR-20b, miR-925, miR-891 and miR-378.
[0030] According to some embodiments of the invention, the at least one miRNA is selected from the group consisting of miR-4317, miR-153, miR-4288, miR-409-5p, and miR-193a-5p.
[0031] According to some embodiments of the invention, the at least one miRNA is selected from the group consisting of miR-138, miR-214, miR-199a and miR-199b.
[0032] According to some embodiments of the invention, the at least one miRNA is miR-138, the method further comprises:
[0033] (i) down-regulating an expression of miR-891 using a polynucleotide agent that hybridizes and inhibits the function of miR-891;
[0034] (ii) up-regulating a level of exogenous miR20b; or
[0035] (iii) up-regulating a level of exogenous miR378.
[0036] According to some embodiments of the invention, the miRNA is selected from the group consisting of miR-648, miR-368, miR-365, miR-500 and miR-491.
[0037] According to some embodiments of the invention, the miRNA is selected from the group consisting of miR-372, miR-373, miR-942, miR-2113, miR-199a-3p and miR-199a-5p.
[0038] According to some embodiments of the invention, the at least one miRNA comprises each of miR Let-7a, miR-124, miR-368 and miR-154.
[0039] According to some embodiments of the invention, the at least one miRNA comprises each of miR-125a, miR-9 and miR-130a.
[0040] According to some embodiments of the invention, the at least one miRNA comprises each of miR-218, miR-134 and miR-20a.
[0041] According to some embodiments of the invention, the method further comprises down-regulating each of miR-141, miR-32, miR-33, miR-221, miR-223 and miR-373.
[0042] According to some embodiments of the invention, the NSCs are generated by ex vivo differentiating MSCs.
[0043] According to some embodiments of the invention, the ex vivo differentiating is affected according to any of the methods described herein.
[0044] According to some embodiments of the invention, the MSCs are isolated from a tissue selected from the group consisting of bone marrow, adipose tissue, placenta, cord blood and umbilical cord.
[0045] According to some embodiments of the invention, the MSCs are autologous to the subject.
[0046] According to some embodiments of the invention, the MSCs are non-autologous to the subject.
[0047] According to some embodiments of the invention, the MSCs are semi-allogeneic to the subject.
[0048] According to some embodiments of the invention, the up-regulating comprises introducing into the MSCs the at least one miRNA.
[0049] According to some embodiments of the invention, the up-regulating is affected by transfecting the MSCs with an expression vector which comprises a polynucleotide sequence which encodes a pre-miRNA of the at least one miRNA.
[0050] According to some embodiments of the invention, the up-regulating is affected by transfecting the MSCs with an expression vector which comprises a polynucleotide sequence which encodes the at least one miRNA.
[0051] According to some embodiments of the invention, the method further comprises analyzing an expression of at least one marker selected from the group consisting of nestin and Sox2 following the generating.
[0052] According to some embodiments of the invention, the method further comprises analyzing an expression of at least one marker selected from the group consisting of Islet1, HB9 and the neuronal markers neurofilament and tubulin following the generating.
[0053] According to some embodiments of the invention, the method is effected in vivo. According to some embodiments of the invention, the method is effected ex vivo.
[0054] According to some embodiments of the invention, at least 50% of the populatio of cells express at least one marker selected from the group consisting of nestin and Sox2.
[0055] According to some embodiments of the invention, the at least 50% of the population of cells express at least one marker selected from the group consisting of Islet1, HB9 and the neuronal markers neurofilament and tubulin.
[0056] According to some embodiments of the invention, the isolated population of cells is for use in treating a brain disease or disorder.
[0057] According to some embodiments of the invention, the isolated population of cells is for brain disease or disorder is a neurodegenerative disorder.
[0058] According to some embodiments of the invention, the neurodegenerative disorder is selected from the group consisting of multiple sclerosis, Parkinson's, epilepsy, amyotrophic lateral sclerosis (ALS), stroke, Rett Syndrome, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, stroke, Alzheimer's disease and Huntingdon's disease.
[0059] According to some embodiments of the invention, the isolated population is for use in treating a motor neuron disease.
[0060] According to some embodiments of the invention, the motor neuron disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), pseudobulbar palsy and progressive bulbar palsy.
[0061] According to some embodiments of the invention, the nerve disease or disorder is a neurodegenerative disorder.
[0062] According to some embodiments of the invention, the neurodegenerative disorder is selected from the group consisting of multiple sclerosis, Parkinson's, epilepsy, amyotrophic lateral sclerosis (ALS), stroke, Rett Syndrome, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, stroke, Alzheimer's disease and Huntingdon's disease.
[0063] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
[0064] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings and images. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0065] In the drawings:
[0066] FIGS. 1A-B are photographs and graphs illustrating that mesenchymal stem cells (MSCs) may be induced to differentiate to neural stem cell (NSC)-like cells and express NSC markers. MSCs were plated in neurosphere medium on bacteria dishes as described in Methods. The MSC-derived spheroids were characterized by immunofluorescence (FIG. 1A) and real-time PCR (FIG. 1 B).
[0067] FIG. 2 is a bar graph illustrating exemplary miRNAs associated with stem cell signature and self renewal that were up-regulated during NSC differentiation.
[0068] FIG. 3 is a bar graph illustrating exemplary miRNAs associated with hematopoiesis that were up-regulated during NSC differentiation.
[0069] FIGS. 4A-D are bar graphs illustrating exemplary miRNAs associated with a neuronal signature and self renewal that were up-regulated (FIGS. 4A-C) or down-regulated (FIG. 4D) during NSC differentiation.
[0070] FIGS. 4E-F are photographs illustrating bone marrow MSCs transfected with antagomiR-138 and miR-891 using a nestin promoter reporter assay.
[0071] FIGS. 5A-D are graphs and photographs illustrating that RTVP-1 plays a role in differentiation of MSCs towards NSCs. RTVP-1 is expressed in high levels in BM-MSCs, similar to some glioma cells that are considered as the cells that expressed the highest levels of this protein, as determined by Western blot analysis (A). A diagram showing the mesenchymal lineage differentiation of MSCs (B). Silencing of RTVP-1 in BM-MSCs using siRNA duplexes decreases the osteogenic differentiation of these cells (C). Silencing of RTVP-1 in BM-MSCs decreases the expression of the different mesenchymal markers (D).
[0072] FIG. 5E is a bar graph illustrating the expression of RTVP-1 in MSCs and MSCs differentiated to NSCs.
[0073] FIG. 5F is a bar graph illustrating the effect of silencing of RTVP-1 on nestin expression in MSCs.
[0074] FIGS. 6A-D are photographs and graphs illustrating the effect of transfection of Olig2 and differentiation medium on placenta-derived MSCs. After 12 days in culture the cells were analyzed for the expression of motor neuron progenitor (FIG. 6C) and motor neuron markers (FIG. 6D) using real time PCR. FIG. 6A illustrates undifferentiated MSCs. FIG. 6B illustrates differentiated MSCs.
[0075] FIGS. 7A-B are graphs and photographs illustrating that NSCs may be induced to differentiate into motor neuron cells. The human neural progenitor cells (Lonza) were grown as spheroids and then plated on laminin and treated with the different factors as described in the methods. Following 12-14 days, the cells were analyzed for morphological appearance and for the different markers using real time PCR.
[0076] FIG. 8 is a bar graph illustrating exemplary miRNAs associated with stem cell signature and self renewal that were up-regulated during motor neuron differentiation.
[0077] FIG. 9 is a bar graph illustrating exemplary miRNAs associated with hematopoiesis that were up-regulated during motor neuron differentiation.
[0078] FIG. 10 is a bar graph illustrating exemplary miRNAs associated with a neuronal signature and self-renewal that were up-regulated during motor neuron differentiation.
[0079] FIG. 11 is a bar graph illustrating Islet1 and HB9 mRNA expression in control MSCs and MSCs trans-differentiated toward a motor neuron cell.
[0080] FIG. 12 is a bar graph illustrating nestin mRNA expression in control MSCs, MSCs with RTVP-1 silencing, and MSCs with RTVP-1 silencing and miR/antimiR transfection.
[0081] FIG. 13 is a bar graph illustrating the average score on the Basso, Beattie and Bresnahan (BBB) locomotor scale of rats with and without spinal cord injury and with injury treated with MSCs trans-differentiated toward a motor neuron cell.
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0082] The present invention, in some embodiments thereof, relates to methods of ex vivo differentiating mesenchymal stem cells towards neural progenitor cells and motor neurons using microRNAs.
[0083] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
[0084] Neural stem cells (NSCs) have been isolated from embryonic and fetal mammalian and human brains and propagated in vitro in a variety of culture systems (Doetsch et al., 1999, Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97:703-16, Johansson et al., 1999, Cell 96:25-34, Svendsen et al., 1998, J Neurosci Methods 85:141-52). A system for proliferating human neural stem cells (hNSCs) in serum-free culture medium containing human bFGF and human EGF also has been reported (Kim et al., 2002, Proc Natl Acad Sci USA 99: 4020-4025, Qu et al., 2001, NeuroReport 12: 1127-1132). Further, transplantation of hNSCs into experimental animals has been described (Qu et al., 2001, Id.; Qu et al., 2005, 35th Annual Meeting in Washington, D.C., November 2005).
[0085] However, challenges existed in the art of stem cell therapies using stem cells derived from embryonic/fetal tissue sources. Stem cell therapies using embryonic sources face challenges such as ethical issues, technical difficulties in cell isolation, and the need for long-term immunosuppressant administration to transplant recipients; the limitations of using fetal tissue sources have been set forth above. These challenges have hindered the applicability of hNSCs for human use.
[0086] Bone marrow (BM) contains stem cells involved not only in hematopoiesis but also for production of a variety of nonhematopoietic tissues. A subset of stromal cells in bone marrow, mesenchymal stem cells (MSCs), is capable of self-renewing and producing multiple mesenchymal cell lineages, including bone, cartilage, fat tendons, and other connective tissues (Majumdar et al., 1998, J Cell Physiol. 176:57-66, Pereira et al., 1995, Proc Natl Acad Sci USA. 92: 4857-61, Pittenger et al., 1999, Science 284: 143-7). Bone marrow mesenchymal stem cells normally are not committed to the neural lineage in differentiation. Although adult stem cells continue to possess some degrees of multipotency, cell types produced from adult stem cells are thought to be limited by their tissue-specific character. To overcome this barrier, it is necessary to alter the cell lineage of these adult stem cells.
[0087] Whilst reducing the present invention to practice, the present inventors have found that out of a vast number of potential micro RNAs (miRNAs), only particular miRNAs may be regulated in order to induce neural stem cell differentiation of mesenchymal stem cells (MSCs) and propose that such differentiated MSCs may be used to treat patients with brain diseases or disorders.
[0088] Further, the present inventors identified particular combinations of miRNAs whose regulation was found to synergistically increase the differentiation towards NSCs, as measured by nestin and SOX-2 expression.
[0089] Whilst further reducing the present invention to practice the present inventors uncovered that upon manipulation of the miRNA expression of NSCs, cells expressing motor neurons markers may be generated.
[0090] Thus, the present inventors showed that up-regulation of at least one of miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a, miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154, miR-20a, miR-130a in neural stem cells (NSCs), induced a motor neuron phenotype, whilst down-regulation of at least one of miR-372, miR-373, miR-141, miR-199a, miR-32, miR-33, miR-221 and miR-223 in NSCs also induced a motor neuron phenotype.
[0091] Further, the present inventors identified particular combinations of miRNAs whose regulation was found to synergistically increase the differentiation towards motor neurons, as measured by expression of motor neuron markers including isletl, HB9 and the neuronal markers neurofilament and tubulin.
[0092] Thus, according to one aspect of the present invention there is provided a method of predisposing mesenchymal stem cells to differentiate into neural stem cells, the method comprising up-regulating a level of at least one exogenous miRNA selected from the group consisting of miR302b, miR-371, miR-134, miR-219, miR-154, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132, miR-137, miR-572, miR-935a, miR-891a, miR-1202, miR-1275, let-7c, miR-665, miR-4258, miR-361-3p, miR-374a-star, miR-892b, miR-361-5p, miR-181a, miR-16, miR-636, miR-4284, miR-1208, miR-1274b, miR-30c-2-star, miR-501-3p, hsa-miR-92a, miR-378b, miR-1287, miR-425-star, miR-324-5p, miR-3178, miR-219-1-3p, miR-197, miR-181b, miR-500-star, miR-106b, miR-502-3p, miR-30c, miR-1275, miR-422a, miR-93, miR-181d, miR-1307, miR-1301, miR-99a, miR-505-star, miR-1202, miR-12, miR-532-5p, miR-195, miR-532-3p, miR-106a, miR-17, miR-1271, miR-769-3p, miR-15b, miR-324-3p, miR-20a, miR-501-5p, miR-330-3p, miR-874, miR-500, miR-25, miR-769-5p, miR-125b-2-star, miR-130b, miR-504, miR-181a-2-star, miR-885-3p, miR-1246, miR-92b, miR-362-5p, miR-572, miR-4270, miR-378c, miR-93-star, miR-149, miR-363, miR-9, miR-18a, miR-891a, miR-346, miR-124, miR-497, miR-378, miR-1231, miR-139-5p, miR-3180-3p, miR-9-star, miR-935 and miR-20b in mesenchymal stem cells (MSCs), thereby predisposing mesenchymal stem cells to differentiate into the neural stem cells.
[0093] As used herein, the phrase "predisposing MSCs to differentiate into neural stem cells (NSCs)" refers to causing the MSCs to differentiate along the NSC lineage. The generated cells may be fully differentiated into NSCs, or partially differentiated into NSCs.
[0094] The phrase "at least one" as used in the specification refers to one, two, three four, five six, seven, eight, nine, ten or more miRNAs. Examples of particular combinations of miRNAs are provided herein below.
[0095] Mesenchymal stem cells give rise to one or more mesenchymal tissues (e.g., adipose, osseous, cartilaginous, elastic and fibrous connective tissues, myoblasts) as well as to tissues other than those originating in the embryonic mesoderm (e.g., neural cells) depending upon various influences from bioactive factors such as cytokines. Although such cells can be isolated from embryonic yolk sac, placenta, umbilical cord, fetal and adolescent skin, blood and other tissues, their abundance in the easily accessible fat tissue and BM far exceeds their abundance in other tissues and as such isolation from BM and fat tissue is presently preferred.
[0096] Methods of isolating, purifying and expanding mesenchymal stem cells (MSCs) are known in the arts and include, for example, those disclosed by Caplan and Haynesworth in U.S. Pat. No. 5,486,359 and Jones E. A. et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12): 3349-60.
[0097] Mesenchymal stem cells may be isolated from various tissues including but not limited to bone marrow, peripheral blood, blood, chorionic and amniotic placenta (e.g. fetal side of the placenta), cord blood, umbilical cord, amniotic fluid, placenta and from adipose tissue.
[0098] A method of isolating mesenchymal stem cells from peripheral blood is described by Kassis et al [Bone Marrow Transplant. 2006 May; 37(10):967-76]. A method of isolating mesenchymal stem cells from placental tissue is described by Zhang et al [Chinese Medical Journal, 2004, 117 (6):882-887]. Methods of isolating and culturing adipose tissue, placental and cord blood mesenchymal stem cells are described by Kern et al [Stem Cells, 2006; 24:1294-1301].
[0099] According to a preferred embodiment of this aspect of the present invention, the mesenchymal stem cells are human.
[0100] According to another embodiment of this aspect of the present invention, the mesenchymal stem cells are isolated from placenta and umbilical cord of newborn humans.
[0101] Bone marrow can be isolated from the iliac crest of an individual by aspiration. Low-density BM mononuclear cells (BMMNC) may be separated by a FICOL-PAQUE density gradient or by elimination of red blood cells using Hetastarch (hydroxyethyl starch). Preferably, mesenchymal stem cell cultures are generated by diluting BM aspirates (usually 20 ml) with equal volumes of Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand Island, N.Y., USA) and layering the diluted cells over about 10 ml of a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, N.J., USA). Following 30 minutes of centrifugation at 2,500.times.g, the mononuclear cell layer is removed from the interface and suspended in HBSS. Cells are then centrifuged at 1,500.times.g for 15 minutes and resuspended in a complete medium (MEM, a medium without deoxyribonucleotides or ribonucleotides; GIBCO); 20% fetal calf serum (FCS) derived from a lot selected for rapid growth of MSCs (Atlanta Biologicals, Norcross, Ga.); 100 units/ml penicillin (GIBCO), 100 .mu.g/ml streptomycin (GIBCO); and 2 mM L-glutamine (GIBCO). Resuspended cells are plated in about 25 ml of medium in a 10 cm culture dish (Corning Glass Works, Corning, N.Y.) and incubated at 37.degree. C. with 5% humidified CO2. Following 24 hours in culture, non-adherent cells are discarded, and the adherent cells are thoroughly washed twice with phosphate buffered saline (PBS). The medium is replaced with a fresh complete medium every 3 or 4 days for about 14 days. Adherent cells are then harvested with 0.25% trypsin and 1 mM EDTA (Trypsin/EDTA, GIBCO) for 5 min at 37.degree. C., re-plated in a 6-cm plate and cultured for another 14 days. Cells are then trypsinized and counted using a cell counting device such as for example, a hemocytometer (Hausser Scientific, Horsham, Pa.). Cultured cells are recovered by centrifugation and resuspended with 5% DMSO and 30% FCS at a concentration of 1 to 2.times.106 cells per ml. Aliquots of about 1 ml each are slowly frozen and stored in liquid nitrogen.
[0102] Adipose tissue-derived MSCs can be obtained by liposuction and mononuclear cells can be isolated manually by removal of the fat and fat cells, or using the Celution System (Cytori Therapeutics) following the same procedure as described above for preparation of MSCs.
[0103] According to one embodiment the populations are plated on polystyrene plastic surfaces (e.g. in a flask) and mesenchymal stem cells are isolated by removing non-adherent cells. Alternatively, mesenchymal stem cell may be isolated by FACS using mesenchymal stem cell markers.
[0104] Preferably the MSCs are at least 50% purified, more preferably at least 75% purified and even more preferably at least 90% purified.
[0105] To expand the mesenchymal stem cell fraction, frozen cells are thawed at 37.degree. C., diluted with a complete medium and recovered by centrifugation to remove the DMSO. Cells are resuspended in a complete medium and plated at a concentration of about 5,000 cells/cm". Following 24 hours in culture, non-adherent cells are removed and the adherent cells are harvested using Trypsin/EDT A, dissociated by passage through a narrowed Pasteur pipette, and preferably re-plated at a density of about 1.5 to about 3.0 cells/cm". Under these conditions, MSC cultures can grow for about 50 population doublings and be expanded for about 2000 fold [Colter D C., et al. Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci USA. 97: 3213-3218, 2000].
[0106] MSC cultures utilized by some embodiments of the invention preferably include three groups of cells which are defined by their morphological features: small and agranular cells (referred to as RS-1, herein below), small and granular cells (referred to as RS-2, herein below) and large and moderately granular cells (referred to as mature MSCs, herein below). The presence and concentration of such cells in culture can be assayed by identifying a presence or absence of various cell surface markers, by using, for example, immunofluorescence, in situ hybridization, and activity assays.
[0107] When MSCs are cultured under the culturing conditions of some embodiments of the invention they exhibit negative staining for the hematopoietic stem cell markers CD34, CD11B, CD43 and CD45. A small fraction of cells (less than 10%) are dimly positive for CD31 and/or CD38 markers. In addition, mature MSCs are dimly positive for the hematopoietic stem cell marker, CD11 7 (c-Kit), moderately positive for the osteogenic MSCs marker, Stro-1 [Simmons, P. J. & Torok-Storb, B. (1991). Blood 78, and positive for the thymocytes and peripheral T lymphocytes marker, CD90 (Thy-1). On the other hand, the RS-1 cells are negative for the CD117 and Strol markers and are dimly positive for the CD90 marker, and the RS-2 cells are negative for all of these markers.
[0108] The mesenchymal stem cells of the present invention may be of autologous, syngeneic or allogeneic related (matched siblings or haploidentical family members) or unrelated fully mismatched source, as further described herein below.
[0109] Culturing of the mesenchymal stem cells can be performed in any media that supports neural stem cell differentiation (or at least does not prevent neural stem cell differentiation) such as those described in U.S. Pat. No. 6,528,245 and by Sanchez-Ramos et al. (2000); Woodburry et al. (2000); Woodburry et al. (J. Neurisci. Res. 96:908-917, 2001); Black and Woodbury (Blood Cells Mol. Dis. 27:632-635, 2001); Deng et al. (2001), Kohyama et al. (2001), Reyes and Verfatile (Ann. N.Y. Acad. Sci. 30 938:231-235, 2001) and Jiang et al. (Nature 418:47-49, 2002).
[0110] The differentiating media may be 05, neurobasal medium, DMEM or DMEM/F12, OptiMEM.TM. or any other medium that supports neuronal growth.
[0111] As mentioned, the mesenchymal stem cells are contacted (either ex vivo or in vivo) with at least one of the following miRNAs in order to induce differentiation into neural stem cells--miR302b, miR-371, miR-134, miR-219, miR-154, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132, miR-137, miR-572, miR-935a, miR-891a, miR-1202, miR-1275, let-7c, miR-665, miR-4258, miR-361-3p, miR-374a-star, miR-892b miR-361-5p, miR-181a, miR-16, miR-636, miR-4284, miR-1208, miR-1274b, miR-30c-2-star, miR-501-3p, hsa-miR-92a, miR-378b, miR-1287, miR-425-star, miR-324-5p, miR-3178, miR-219-1-3p, miR-197, miR-181b, miR-500-star, miR-106b, miR-502-3p, miR-30c, miR-1275, miR-422a, miR-93, miR-181d, miR-1307, miR-1301, miR-99a, miR-505-star, miR-1202, miR-12, miR-532-5p, miR-195, miR-532-3p, miR-106a, miR-17, miR-1271, miR-769-3p, miR-15b, miR-324-3p, miR-20a, miR-501-5p, miR-330-3p, miR-874, miR-500, miR-25, miR-769-5p, miR-125b-2-star, miR-130b, miR-504, miR-181a-2-star, miR-885-3p, miR-1246, miR-92b, miR-362-5p, miR-572, miR-4270, miR-378c, miR-93-star, miR-149, miR-363, miR-18a, miR-891a, miR-346, miR-497, miR-378, miR-1231, miR-139-5p, miR-3180-3p, miR-935 and miR-20b.
[0112] According to a particular embodiment, the miRNA is selected from the group consisting of miR302b, miR-371, miR-134, miR-219, miR-154, miR-155, miR-32, miR-33, miR-126, miR-127, miR-132.
[0113] According to another embodiment, the miRNA is selected from the group consisting of miR-20b, miR-925, miR-891 and miR-378.
[0114] The present invention also contemplates differentiation of mesenchymal stem cells towards a neural stem cell phenotype by down-regulation of particular miRNAs--namely miR-10b, miR-142-3p, miR-131a, miR-125b, miR-153 and miR-181a.
[0115] The present invention contemplates down-regulation of additional miRNAs for the differentiation of MSCs towards a neural stem cell phenotype. These miRNAs include miR-409-5p, miR-193a-5p, miR-4317, miR-4288, miR-145, miR-143, miR-214, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-138, miR-31, miR-21, miR-193a-5p, miR-224-star, miR-196a, miR-487b, miR-409-5p, miR-193b-star, miR-379, miR-21-star, miR-27a-star, miR-27a, miR-4317, miR-193b, miR-27b, miR-22, 5'74-3p, miR-30 4288, miR-23a, miR-221-star, miR-2113, let-7i, miR-24, miR-23b, miR-299-3p, miR-518c-star, miR-221, miR-431-star, miR-523, miR-4313, miR-559, miR-614, miR-653, miR-2278, miR-768-5p, miR-154-star, miR-302a-star, miR-3199 and miR-3137.
[0116] According to a particular embodiment, the miRNA which is to be downregulated is selected from the group consisting of miR-138, miR-214, miR-199a and miR-199b.
[0117] Down-regulating such miRNAs can be affected using a polynucleotide which is hybridizable in cells under physiological conditions to the miRNA.
[0118] According to a particular embodiment, the cell population is generated by up-regulating an expression of miR-124 in mesenchymal stem cells (MSCs) whilst simultaneously down-regulating an expression of miR-let-7 in the population of MSCs.
[0119] According to a particular embodiment, the cell population is generated by down-regulating an expression of miR-891 in mesenchymal stem cells (MSCs) whilst simultaneously down-regulating an expression of miR-138 in the population of MSCs.
[0120] According to a particular embodiment, the cell population is generated by up-regulating an expression of miR-20b in mesenchymal stem cells (MSCs) whilst simultaneously down-regulating an expression of miR-138 in the population of MSCs.
[0121] According to a particular embodiment, the cell population is generated by up-regulating an expression of miR-378 in mesenchymal stem cells (MSCs) whilst simultaneously down-regulating an expression of miR-138 in the population of MSCs.
[0122] As used herein, the term "hybridizable" refers to capable of hybridizing, i.e., forming a double strand molecule such as RNA:RNA, RNA:DNA and/or DNA:DNA molecules. "Physiological conditions" refer to the conditions present in cells, tissue or a whole organism or body. Preferably, the physiological conditions used by the present invention include a temperature between 34-40.degree. C., more preferably, a temperature between 35-38.degree. C., more preferably, a temperature between 36 and 37.5.degree. C., most preferably, a temperature between 37 to 37.5.degree. C.; salt concentrations (e.g., sodium chloride NaCl) between 0.8-1%, more preferably, about 0.9%; and/or pH values in the range of 6.5-8, more preferably, 6.5-7.5, most preferably, pH of 7-7.5.
[0123] As mentioned, the present inventors have also uncovered that upon manipulation of particular miRNAs in neural stem cells, cells expressing motor neurons markers may be generated.
[0124] Thus, according to another aspect of the present invention there is provided a method of predisposing neural stem cells to differentiate into motor neurons comprising up-regulating a level of at least one exogenous miRNA selected from the group consisting of miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a, miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154, miR-20a, miR-130a in neural stem cells (NSCs).
[0125] The neural stem cells of this aspect of the present invention may be non-committed neural stem cells that are not committed to any particular type of neural cell such as but not limited to neuronal and glial cell types. Preferably these cells have a potential to commit to a neural fate. Alternatively, the neural stem cells may be committed to a particular neural cell type, such as a motor neuron, but do not express/secrete markers of terminal differentiation e.g. do not secrete neurotransmitters.
[0126] According to a particular embodiment, the neural stem cells express at least one of nestin and/or SOX-2. Additional markers include SOXl, SOX3, PSA-NCAM and MUSASHI-1.
[0127] Methods of confirming expression of the markers are provided herein below. Formation of "neural rosettes" is another morphologic marker of neural stem cell formation.
[0128] According to one embodiment, the neural stem cells have been generated by ex vivo differentiation of mesenchymal stem cells or embryonic stem cells (or induced embryonic stem cells).
[0129] Mesenchymal stem cells have been described herein above. Numerous methods are known in the art for differentiating MSCs towards a neural stem cell fate including genetic modification and/or culturing in a medium which promotes differentiation towards that fate. The medium typically comprises growth factors and/or cytokines including, but not limited to epidermal growth factor (EGF), basic fibroblast growth factor (bFGF). Typically, the differentiation is affected in serum free medium, or serum replacements.
[0130] According to a particular embodiment, NSCs are generated by genetically modifying the MSCs to express an exogenous miRNA, as described herein above.
[0131] The phrase "embryonic stem cells" refers to embryonic cells which are capable of differentiating into cells of all three embryonic germ layers (i.e., endoderm, ectoderm and mesoderm), or remaining in an undifferentiated state. The phrase "embryonic stem cells" may comprise cells which are obtained from the embryonic tissue formed after gestation (e.g., blastocyst) before implantation of the embryo (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBCs) which are obtained from a post-implantation/pre-gastrulation stage blastocyst (see W02006/040763) and embryonic germ (EG) cells which are obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
[0132] Induced pluripotent stem cells (iPS; embryonic-like stem cells), are cells obtained by de-differentiation of adult somatic cells which are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm). According to some embodiments of the invention, such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics. According to some embodiments of the invention, the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell.
[0133] The embryonic stem cells of some embodiments of the invention can be obtained using well-known cell-culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo pre-implantation embryos or from in vitro fertilized (IVF) embryos. Alternatively, a single cell human embryo can be expanded to the blastocyst stage. For the isolation of human ES cells the zona pellucida is removed from the blastocyst and the inner cell mass (ICM) is isolated by immunosurgery, in which the trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting. The ICM is then plated in a tissue culture flask containing the appropriate medium which enables its outgrowth. Following 9 to 15 days, the ICM derived outgrowth is dissociated into clumps either by a mechanical dissociation or by an enzymatic degradation and the cells are then re-plated on a fresh tissue culture medium. Colonies demonstrating undifferentiated morphology are individually selected by micropipette, mechanically dissociated into clumps, and re-plated. Resulting ES cells are then routinely split every 4-7 days. For further details on methods of preparation human ES cells see Thomson et al., [U.S. Pat. No. 5,843,780; Science 282: 1145, 1998; Curr. Top. Dev. Biol. 38: 133, 1998; Proc. Natl. Acad. Sci. USA 92: 7844, 1995]; Bongso et al., [Hum Reprod 4: 706, 30 1989]; and Gardner et al., [Fertil. Steril. 69: 84, 1998].
[0134] It will be appreciated that commercially available stem cells can also be used with this aspect of some embodiments of the invention. Human ES cells can be purchased from the NIH human embryonic stem cells registry (www.escr.nih.gov). Non-limiting examples of commercially available embryonic stem cell lines are BGOl, BG02, BG03, BG04, CY12, CY30, CY92, CYlO, TE03 and TE32.
[0135] In addition, ES cells can be obtained from other species as well, including mouse (Mills and Bradley, 2001), golden hamster [Doetschman et al., 1988, Dev Biol. 127: 224-7], rat [Iannaccone et al., 1994, Dev Biol. 163: 288-92] rabbit [Giles et al. 1993, Mol Reprod Dev. 36: 130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36: 424-33], several domestic animal species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43: 255-60; Wheeler 1994, Reprod Fertil Dev. 6: 563-8; Mitalipova et al., 2001, Cloning. 3: 59-67] and non-human primate species (Rhesus monkey and marmoset) [Thomson et al., 1995, Proc Natl Acad Sci USA. 92: 7844-8; Thomson et al., 1996, Biol Reprod. 55: 254-9].
[0136] Induced pluripotent stem cells (iPS) (embryonic-like stem cells) can be generated from somatic cells by genetic manipulation of somatic cells, e.g., by retroviral transduction of somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KLF4 [Yamanaka S, Cell Stem Cell. 2007, 1(1):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb. 14. (Epub ahead of print); I H Park, Zhao R, West J A, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008; 451:141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131:861-872]. Other embryonic-like stem cells can be generated by nuclear transfer to oocytes, fusion with embryonic stem cells or nuclear transfer into zygotes if the recipient cells are arrested in mitosis.
[0137] Methods of generating neural stem cells from ESCs or iPS cells are known in the art and include for example those which induce differentiation via embryoid bodies and those which induce differentiation via adherent culture. Particular protocols for differentiating ESCs towards a neuronal fate are reviewed in Dhara et al., Journal of Cellular Biochemistry 105:633-640 (2008), the contents of which are incorporated herein by reference. It will be appreciated that many other methods are known for differentiating ESC, iPSCs and MSCs towards neuronal stem cells and the present application contemplates use of all these methods.
[0138] The neuronal stem cells of the present invention may be of autologous, syngeneic or allogeneic related (matched siblings or haploidentical family members) or unrelated fully mismatched source.
[0139] Culturing of neuronal stem cells can be performed in any media that supports neural stem cell differentiation, examples of which are described herein above.
[0140] As mentioned, the neuronal stem cells are contacted (either ex vivo or in vivo) with at least one of the following miRNAs in order to induce differentiation towards the motor neuron lineage--miR-368, miR-302b, miR-365-3p, miR-365-5p, miR-Let-7a miR-Let-7b, miR-218, miR-134, miR-124, miR-125a, miR-9, miR-154, miR-20a and miR-130a.
[0141] The present invention also contemplates differentiation of neuronal stem cells towards motor neuron phenotype by down-regulation of particular miRNAs--namely miR-372, miR-373, miR-141, miR-199a, miR-32, miR-33, miR-221 and miR-223.
[0142] Down-regulating such miRNAs can be affected using a polynucleotide which is hybridizable in cells under physiological conditions to the miRNA molecule.
[0143] According to a particular embodiment, the cell population is generated by up-regulating an expression of each of miR Let-7a, miR-124, miR-368 and miR-154 in the neural stem cells.
[0144] According to a particular embodiment, the cell population is generated by up-regulating an expression of each of miR-125a, miR-9 and miR-130a in the neural stem cells.
[0145] According to still another embodiment, the cell population is generated by up-regulating an expression of each of each of miR-218, miR-134 and miR-20a.
[0146] The present inventors further contemplate down-regulating each of miR-141, miR-32, miR-33, miR-221, miR-223 and miR-373 in addition to any of the methods described herein above to enhance the differentiation towards the motor neuron phenotype.
[0147] Mesenchymal stem cells were differentiated into motor neurons by overexpressing Olig2 and HB9. The present inventors performed a miRNA array analysis on the differentiated and non-differentiated cells and found a number of miRNAs that were overexpressed in a statistically significant manner (more than 3 fold) and a number of miRNAs that were downregulated in a statistically significant manner (more than 3 fold). The present inventors contemplate that the miRNAs whose expression was increased in the differentiated cells may be candidates for overexpression in order to generate motor neurons from MSCs. The present inventors contemplate that the miRNAs whose expression was decreased in the differentiated cells are candidates for downregulation in order to generate motor neurons from MSCs.
[0148] Thus, according to still another aspect of the present invention there is provided a method of predisposing MSCs to differentiate into motor neurons, the method comprising up-regulating a level of at least one exogenous miRNA selected from the group consisting of miR-368, miR-365, miR-500, miR-648, miR-491, miR-218, miR-155, miR-192, let-7b, miR-16, miR-210, miR-197, miR-21, miR-373, miR-27a, miR-122, miR-17, miR-494, miR-449, miR-503, miR-30a, miR-196a, miR-122, miR-7, miR-151-5p, miR-16, miR-22, miR-31, miR-424, miR-1, miR-29c, miR-942, miR-100, miR-520, miR-663a, miR-562, miR-449a, miR-449b-5p, miR-520b, miR-451, miR-532-59, miR-605, miR-504, miR-503, miR-155, miR-34a, miR-16, miR-7b, miR-103, miR-124, miR-1385p, miR-16, miR-330, miR-520, miR-608, miR-708, miR-107, miR-137, miR-132, miR-145, miR-204, miR-125b, miR-224, miR-30a, miR-375, miR-101, miR-106b, miR-128, miR-129-5p, miR-153, miR-203, miR-214, miR-338-3p, miR-346, miR-98, miR-107, miR-141, miR-217, miR-424, miR-449, miR-7, miR-9, miR-93, miR-99a, miR-100, miR-1228, miR-183, miR-185, miR-190, miR-522, miR-650, miR-675, miR-342-3p, miR-31 in the mesenchymal stem cells (MSCs).
[0149] According to yet another aspect of the present invention there is provided a method of predisposing MSCs to differentiate into motor neurons, the method comprising down-regulating an expression of at least one miRNA selected from the group consisting of miR-199a, miR-372, miR-373, miR-942, miR-2113, miR-301a-3p, miR-302c, miR-30b-5p, miR-30c, miR-326, miR-328, miR-331-3p, miR-340, miR-345, miR-361-5p, miR-363, miR-365a-3p, miR-371a-3p, miR-373-3p, miR-374a, miR-423-3p, miR-449b-5p, miR-451a, miR-494, miR-504, miR-515-3p, miR-516a-3p, miR-519e, miR-520a-3p, miR-520c-3p, miR-520g, miR-532-5p, miR-559, miR-562, miR-572, miR-590-5p, miR-605, miR-608, miR-626, miR-639, miR-654-3p, miR-657, miR-661, miR-708-5p, miR-942, miR-96, miR-99arno and miR-194 by up-regulating a level of at least one polynucleotide agent that hybridizes and inhibits a function of said at least one miRNA in the MSCs thereby predisposing MSCs to differentiate into the motor neurons.
[0150] The term "microRNA", "miRNA", and "miR" are synonymous and refer to a collection of non-coding single-stranded RNA molecules of about 19-28 nucleotides in length, which regulate gene expression. miRNAs are found in a wide range of organisms and have been shown to play a role in development, homeostasis, and disease etiology.
[0151] Below is a brief description of the mechanism of miRNA activity.
[0152] Genes coding for miRNAs are transcribed leading to production of a miRNA precursor known as the pri-miRNA. The pri-miRNA is typically part of a polycistronic RNA comprising multiple pri-miRNAs. The pri-miRNA may form a hairpin with a stem and loop. The stem may comprise mismatched bases.
[0153] The hairpin structure of the pri-miRNA is recognized by Drosha, which is an RNase III endonuclease. Drosha typically recognizes terminal loops in the pri-miRNA and cleaves approximately two helical turns into the stem to produce a 60-70 nt precursor known as the pre-miRNA. Drosha cleaves the pri-miRNA with a staggered cut typical of RNase III endonucleases yielding a pre-miRNA stem loop with a 5' phosphate and -2 nucleotide 3' overhang. It is estimated that approximately one helical turn of stem (-10 nucleotides) extending beyond the Drosha cleavage site is essential for efficient processing. The pre-miRNA is then actively transported from the nucleus to the cytoplasm by Ran-OTP and the export receptor exportin-5.
[0154] The double-stranded stem of the pre-miRNA is then recognized by Dicer, which is also an RNase III endonuclease. Dicer may also recognize the 5' phosphate and 3' overhang at the base of the stem loop. Dicer then cleaves off the terminal loop two helical turns away from the base of the stem loop leaving an additional 5' phosphate and -2 nucleotide 3' overhang. The resulting siRNA-like duplex, which may comprise mismatches, comprises the mature miRNA and a similar-sized fragment known as the miRNA*. The miRNA and miRNA* may be derived from opposing arms of the pri-miRNA and pre-miRNA. miRNA* sequences may be found in libraries of cloned miRNAs but typically at lower frequency than the miRNAs.
[0155] Although initially present as a double-stranded species with miRNA *, the miRNA eventually become incorporated as a single-stranded RNA into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can lead to variability in specificity for miRNA/miRNA * duplexes, binding site of the target gene, activity of miRNA (repress or activate), and which strand of the miRN A/miRNA* duplex is loaded in to the RISC.
[0156] When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex that is loaded into the RISC is the strand whose 5' end is less tightly paired. In cases where both ends of the miRNA:miRNA * have roughly equivalent 5' pairing, both miRNA and miRNA* may have gene silencing activity.
[0157] The RISC identifies target nucleic acids based on high levels of complementarity between the miRNA and the mRNA, especially by nucleotides 2-7 of the miRNA.
[0158] A number of studies have looked at the base-pairing requirement between miRNA and its mRNA target for achieving efficient inhibition of translation (reviewed by Bartel 2004, Cell 116-281). In mammalian cells, the first 8 nucleotides of the miRNA may be important (Doench & Sharp 2004 GenesDev 2004-504). However, other parts of the microRNA may also participate in mRNA binding. Moreover, sufficient base pairing at the 3' can compensate for insufficient pairing at the 5' (Brennecke et al, 2005 PLoS 3-e85). Computation studies, analyzing miRNA binding on whole genomes have suggested a specific role for bases 2-7 at the 5' of the miRNA in target binding but the role of the first nucleotide, found usually to be "A" was also recognized (Lewis et at 2005 Cell 120-15). Similarly, nucleotides 1-7 or 2-8 were used to identify and validate targets by Krek et al (2005, Nat Genet 37-495).
[0159] The target sites in the mRNA may be in the 5' UTR, the 3' UTR or in the coding region. Interestingly, multiple miRNAs may regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the cooperative action of multiple RISCs provides the most efficient translational inhibition.
[0160] miRNAs may direct the RISC to down-regulate gene expression by either of two mechanisms: mRNA cleavage or translational repression. The miRNA may specify cleavage of the mRNA if the mRNA has a certain degree of complementarity to the miRNA. When a miRNA guides cleavage, the cut is typically between the nucleotides pairing to residues 10 and 11 of the miRNA. Alternatively, the miRNA may repress translation if the miRNA does not have the requisite degree of complementarity to the miRNA. Translational repression may be more prevalent in animals since animals may have a lower degree of complementarity between the miRNA and binding site.
[0161] It should be noted that there may be variability in the 5' and 3' ends of any pair of miRNA and miRNA*. This variability may be due to variability in the enzymatic processing of Drosha and Dicer with respect to the site of cleavage. Variability at the 5' and 3' ends of miRNA and miRNA* may also be due to mismatches in the stem structures of the pri-miRNA and pre-miRNA. The mismatches of the stem strands may lead to a population of different hairpin structures. Variability in the stem structures may also lead to variability in the products of cleavage by Drosha and Dicer.
[0162] The term "microRNA mimic" refers to synthetic non-coding RNAs that are capable of entering the RNAi pathway and regulating gene expression. miRNA mimics imitate the function of endogenous microRNAs (miRNAs) and can be designed as mature, double stranded molecules or mimic precursors (e.g., or pre-miRNAs). miRNA mimics can be comprised of modified or unmodified RNA, DNA, RNA-DNA hybrids, or alternative nucleic acid chemistries (e.g., LNAs or 2'-0,4'-C-ethylene-bridged nucleic acids (ENA)). Other modifications are described herein below. For mature, double stranded miRNA mimics, the length of the duplex region can vary between 13-33, 18-20 24 or 21-23 nucleotides. The miRNA may also comprise a total of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. The sequence of the miRNA may be the first 13-33 nucleotides of the pre-miRNA. The sequence of the miRNA may also be the last 13-33 nucleotides of the pre-miRNA. The sequence of the miRNA may comprise any of the sequences described herein, or variants thereof.
[0163] It will be appreciated from the description provided herein above, that contacting mesenchymal stem cells may be affected in a number of ways:
[0164] 1. Transiently transfecting the mesenchymal stem cells with the mature miRNA (or modified form thereof, as described herein below). The miRNAs designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art, including both enzymatic syntheses and solid-phase syntheses. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. 5 (2001), "Molecular Cloning: A Laboratory Manual"; Ausubel, R. M. et al., eds. (1994, 1989), "Current Protocols in Molecular Biology," Volumes I-III, John Wiley & Sons, Baltimore, Md.; Perbal, B. (1988), "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York; and Gait, M. J., ed. (1984), "Oligonucleotide Synthesis"; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC.
[0165] 2. Stably, or transiently transfecting the mesenchymal stem cells with an expression vector which encodes the mature miRNA or with miRNA mimic.
[0166] 3. Stably, or transiently transfecting the mesenchymal stem cells with an expression vector which encodes the pre-miRNA. The pre-miRNA sequence may comprise from 45-90, 60-80 or 60-70 nucleotides. The sequence of the pre-miRNA may comprise a miRNA and a miRNA* as set forth herein. The sequence of the pre-miRNA may also be that of a pri-miRNA excluding from 0-160 nucleotides from the 5' and 3' ends of the pri-miRNA. The sequence of the pre-miRNA may comprise the sequence of the miRNA, or variants thereof.
[0167] 4. Stably, or transiently transfecting the mesenchymal stem cells with an expression vector which encodes the pri-miRNA. The pri-miRNA sequence may comprise from 45-30,000, 50-25,000, 100-20,000, 1,000-1,500 or 80-100 nucleotides. The sequence of the pri-miRNA may comprise a pre-miRNA, miRNA and miRNA*, as set forth herein, and variants thereof. Preparation of miRNAs mimics can be affected by chemical synthesis methods or by recombinant methods.
[0168] miRNA antagonists may be introduced into cells using transfection protocols known in the art using either siRNAs or expression vectors such as Anatgomirs.
[0169] As mentioned herein above, the polynucleotides which down-regulate the miRNAs described herein above may be provided as modified polynucleotides using various methods known in the art.
[0170] For example, the oligonucleotides (e.g. miRNAs) or polynucleotides of the present invention may comprise heterocylic nucleosides consisting of purines and the pyrimidines bases, bonded in a 3'-to-5' phosphodiester linkage.
[0171] Preferably used oligonucleotides or polynucleotides are those modified either in backbone, internucleoside linkages, or bases, as is broadly described herein under.
[0172] Specific examples of preferred oligonucleotides or polynucleotides useful according to this aspect of the present invention include oligonucleotides or polynucleotides containing modified backbones or non-natural internucleoside linkages. Oligonucleotides or polynucleotides having modified backbones include those that retain a phosphorus atom in the backbone, as disclosed in U.S. Pat. Nos. 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
[0173] Preferred modified oligonucleotide or polynucleotide backbones include, for example: phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3'-amino phosphoramidate and aminoalkylphosphoramidates; thionophosphoramidates; thionoalkylphosphonates; thionoalkylphosphotriesters; and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms of the above modifications can also be used.
[0174] Alternatively, modified oligonucleotide or polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts, as disclosed in U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677, 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.
[0175] Other oligonucleotides or polynucleotides which may be used according to the present invention are those modified in both sugar and the internucleoside linkage, i.e., the backbone of the nucleotide units is replaced with novel groups. The base units are maintained for complementation with the appropriate polynucleotide target. An example of such an oligonucleotide mimetic includes a peptide nucleic acid (PNA). A PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide-containing backbone, in particular an aminoethylglycine backbone. The bases are retained and are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone. United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262; each of which is herein incorporated by reference. Other backbone modifications which may be used in the present invention are disclosed in U.S. Pat. No. 6,303,374.
[0176] Oligonucleotides or polynucleotides of the present invention may also include base modifications or substitutions. As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). "Modified" bases include but are not limited to other synthetic and natural bases, such as: 5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3-deazaguanine and 3-deazaadenine. Additional modified bases include those disclosed in: U.S. Pat. No. 3,687,808; Kroschwitz, J. I., ed. (1990), "The Concise Encyclopedia Of Polymer Science And Engineering," pages 858-859, John Wiley & Sons; Englisch et al. (1991), "Angewandte Chemie," International Edition, 30, 613; and Sanghvi, Y. S., "Antisense Research and Applications," Chapter 15, pages 289-302, S. T. Crooke and B. Lebleu, eds., CRC Press, 1993. Such modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S. et al. (1993), "Antisense Research and Applications," pages 276-278, CRC Press, Boca Raton), and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
[0177] To express miRNAs or polynucleotide agents which regulate miRNAs in mesencyhymal stem cells or neural stem cells, a polynucleotide sequence encoding the miRNA (or pre-miRNA, or pri-miRNA, or polynucleotide which down-regulates the miRNAs) is preferably ligated into a nucleic acid construct suitable for mesenchymal stem cell (or neural stem cell) expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
[0178] It will be appreciated that the nucleic acid construct of some embodiments of the invention can also utilize miRNA homologues which exhibit the desired activity (e.g. motor neuron or neural stem cell differentiating ability). Such homologues can be, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any of the sequences described herein above, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.
[0179] In addition, the homologues can be, for example, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to the sequences described herein above, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.
[0180] Constitutive promoters suitable for use with some embodiments of the invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters suitable for use with some embodiments of the invention include for example tetracycline-inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
[0181] Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.
[0182] Preferably, the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed--i.e. mesenchymal stem cells or neural stem cells.
[0183] Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
[0184] In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
[0185] In addition to the elements already described, the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
[0186] The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
[0187] Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives. Other expression vectors are available from SBI or Sigma.
[0188] Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205. Other exemplary vectors include pMSG, pAV009/A+, pMTOlO/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
[0189] As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein. For example, bone marrow cells can be targeted using the human T cell leukemia virus type I (HTLV-1) and kidney cells may be targeted using the heterologous promoter present in the baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) as described in Liang C Y et al., 2004 (Arch Virol. 149: 51-60).
[0190] According to one embodiment, a lentiviral vector is used to transfect the mesenchymal stem cells or neural stem cells.
[0191] Various methods can be used to introduce the expression vector of some embodiments of the invention into mesenchymal stem cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
[0192] Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
[0193] Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
[0194] The miRNAs, miRNA mimics and pre-miRs can be transfected into cells also using nanoparticles such as gold nanoparticles and by ferric oxide magnetic NP--see for example Ghosh et al., Biomaterials. 2013 January; 34(3):807-16; Crew E, et al., Anal Chem. 2012 Jan. 3; 84(1):26-9.
[0195] Other modes of transfection that do not involved integration include the use of minicircle DNA vectors or the use of PiggyBac transposon that allows the transfection of genes that can be later removed from the genome.
[0196] As mentioned hereinabove, a variety of prokaryotic or eukaryotic cells can be used as host-expression systems to express the miRNAs or polynucleotide agent capable of down-regulating the miRNA of some embodiments of the invention. These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence. Mammalian expression systems can also be used to express the miRNAs of some embodiments of the invention.
[0197] Examples of bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185:60-89).
[0198] In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. No. 5,932,447. Alternatively, vectors can be used which promote integration of foreign DNA sequences into the yeast chromosome.
[0199] The conditions used for contacting the mesenchymal stem cells or neural stem cells are selected for a time period/concentration of cells/concentration of miRNA/ratio between cells and miRNA which enable the miRNA (or inhibitors thereof) to induce differentiation thereof. The present invention further contemplates incubation of the stem cells with a differentiation factor which promotes differentiation towards a motor neuron or neural stem cell lineage. The incubation with such differentiation factors may be affected prior to, concomitant with or following the contacting with the miRNA. Examples of such agents are provided in the Examples section herein below.
[0200] Alternatively, or additionally, the mesenchymal stem cells may be genetically modified so as to express such differentiation factors, using expression constructs such as those described herein above. Further, the mesenchymal stem cell can be genetically modified using the CRISPR/Cas9 system, or an equivalent system, to no long express a target which is being silenced/down-regulated, such as for example RTVP-1.
[0201] During or following the differentiation step the stem cells may be monitored for their differentiation state. Cell differentiation can be determined upon examination of cell or tissue-specific markers which are known to be indicative of differentiation.
[0202] For example, the neural stem cells may express at least one of nestin and SOX-2. Additional markers include SOX1, SOX3, PSA-NCAM and MUSASHI-1.
[0203] Below is a list of markers that may be used to confirm differentiation into motor neurons: ChAT (choline acetyltransferase), ChoxlO, Enl, Even-skipped (Eve) transcription factor, Evxl/2, Fibroblast growth factor-1 (FGFl or acidic FGF), HB9, Isll (lslet-1), Isl2, Islet1/2, Lim3, p75(NTR) (p75 neurotrophin receptor), REG2, Siml, SMI32 (SMI-32) and Zfhl.
[0204] Tissue/cell specific markers can be detected using immunological techniques well known in the art [Thomson J A et al., (1998). Science 282: 1145-7]. Examples include, but are not limited to, flow cytometry for membrane-bound markers, immunohistochemistry for extracellular and intracellular markers and enzymatic immunoassay, for secreted molecular markers.
[0205] It will be appreciated that the cells obtained according to the methods described herein may be enriched for a particular cell type--e.g. progenitor cell type or mature cell type. Thus for example, the time of differentiation may be selected to obtain an earlier progenitor type (e.g. one that expresses at least one of the following markers nestin, olig2 and Sox2) or a later mature cell type (e.g. one that expresses at least one of the following markers ChAT, isletl, HB9 and J33 tubulin).
[0206] Further enrichment of a particular cell type may be affected using cell sorting techniques such as FACS and magnetic sorting.
[0207] In addition, cell differentiation can be also followed by specific reporters that are tagged with GFP or RFP and exhibit increased fluorescence upon differentiation.
[0208] By determining the targets of the miRNAs of the present invention that are proposed for up-regulation, it will be appreciated that the scope of the present invention may be broadened to include down-regulation of the targets by means other than contacting with miRNA. Correspondingly, by determining the targets of the miRNAs of the present invention that are proposed for down-regulation, it will be appreciated that the scope of the present invention may be broadened to include up-regulation of the targets.
[0209] For example, the present inventors have shown that one of the targets of miR-137 is Related to testis-specific, vespid and pathogenesis protein 1 (RTVP-1) Thus the present invention contemplates that differentiation towards the neural stem cell lineage may be affected by down-regulation of this protein.
[0210] Thus, according to another aspect of the invention, there is provided a method of generating neural stem cells, the method comprising contacting mesenchymal stem cells (MSCs) with an agent that down-regulates an amount and/or activity of Related to testis-specific, vespid and pathogenesis protein 1 (RTVP-1), thereby generating the neural stem cells.
[0211] Related to testis-specific, vespid and pathogenesis protein 1 (RTVP-1) was cloned from human GBM cell lines by two groups and was termed glioma pathogenesis-related protein-GLIPRl or RTVP-1 [Rich T, et al., Gene 1996; 180: 125-30], incorporated herein by reference. RTVP-1 contains a putative signal peptide, a trans membrane domain and a SCP domain, with a yet unknown function which is also found in other RTVP-1 homologs including TPX-1, the venom allergen antigen 5 and group 1 of the plant pathogenesis-related proteins (PR-1).
[0212] Down-regulation of RTVP-1 (or any of the other miRNA targets of the present invention) can be obtained at the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation (e.g., RNA silencing agents, Ribozyme, DNAzyme and antisense), or on the protein level using e.g., antagonists, enzymes that cleave the polypeptide and the like.
[0213] Following is a list of agents capable of down-regulating expression level and/or activity of RTVP-1.
[0214] One example of an agent capable of down-regulating RTVP-1 is an antibody or antibody fragment capable of specifically binding thereto. Preferably, the antibody is capable of being internalized by the cell and entering the nucleus.
[0215] The term "antibody" as used in this invention includes intact molecules as well as functional fragments thereof, such as Fab, F(ab')2, and Fv that are capable of binding to macrophages. These functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (5) Single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
[0216] Down-regulation of RTVP-1 can be also achieved by RNA silencing. As used herein, the phrase "RNA silencing" refers to a group of regulatory mechanisms [e.g. RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression] mediated by RNA molecules which result in the inhibition or "silencing" of the expression of a corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.
[0217] As used herein, the term "RNA silencing agent" refers to an RNA which is capable of inhibiting or "silencing" the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g., the full translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. In one embodiment, the RNA silencing agent is capable of inducing RNA interference. In another embodiment, the RNA silencing agent is capable of mediating translational repression.
[0218] RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla. Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
[0219] The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.
[0220] Accordingly, the present invention contemplates use of dsRNA to down-regulate protein expression from the mRNA.
[0221] According to one embodiment, the dsRNA is greater than 30 bp. The use of long dsRNAs (i.e. dsRNA greater than 30 bp) has been very limited owing to the belief that these longer regions of double stranded RNA will result in the induction of the interferon and PKR response. However, the use of long dsRNAs can provide numerous advantages in that the cell can select the optimal silencing sequence alleviating the need to test numerous siRNAs; long dsRNAs will allow for silencing libraries to have less complexity than would be necessary for siRNAs; and, perhaps most importantly, long dsRNA could prevent viral escape mutations when used as therapeutics.
[0222] Various studies demonstrate that long dsRNAs can be used to silence gene expression without inducing the stress response or causing significant off-target effects--see for example [Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004; 13:115-125; Diallo M., et al., Oligonucleotides. 2003; 13:381-392; Paddison P. J., et al., Proc. Natl Acad. Sci. USA. 2002; 99:1443-1448; Tran N., et al., FEBS Lett. 2004; 573:127-134].
[0223] In particular, the present invention also contemplates introduction of long dsRNA (over 30 base transcripts) for gene silencing in cells where the interferon pathway is not activated (e.g. embryonic cells and oocytes) see for example Billy et al., PNAS 2001, Vol 98, pages 14428-14433. and Diallo et al, Oligonucleotides, Oct. 1, 2003, 13(5): 381-392. doi: 10.1089/154545703322617069.
[0224] The present invention also contemplates introduction of long dsRNA specifically designed not to induce the interferon and PKR pathways for down-regulating gene expression. For example, Shinagwa and Ishii [Genes & Dev. 17 (11): 1340-1345, 2003] have developed a vector, named pDECAP, to express long double-strand RNA from an RNA polymerase II (Pol II) promoter. Because the transcripts from pDECAP lack both the 5'-cap structure and the 3'-poly(A) tail that facilitate dsRNA export to the cytoplasm, long ds-RNA from pDECAP does not induce the interferon response.
[0225] Another method of evading the interferon and PKR pathways in mammalian systems is by introduction of small inhibitory RNAs (siRNAs) either via transfection or endogenous expression.
[0226] The term "siRNA" refers to small inhibitory RNA duplexes (generally between 18-30 basepairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3'-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100-fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is theorized to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.
[0227] It has been found that position of the 3'-overhang influences potency of an siRNA and asymmetric duplexes having a 3'-overhang on the antisense strand are generally more potent than those with the 3'-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.
[0228] The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as mentioned the RNA silencing agent of the present invention may also be a short hairpin RNA (shRNA).
[0229] The term "shRNA", as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5'-UUCAAGAGA-3'; (Brummelkamp, T. R. et al. (2002) Science 296: 550) and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem-loop or hairpin structure comprising a double-stranded region capable of interacting with the RNAi machinery.
[0230] According to another embodiment the RNA silencing agent may be a miRNA, as further described herein above.
[0231] Synthesis of RNA silencing agents suitable for use with the present invention can be affected as follows. First, the miRNA target mRNA sequence (e.g. CTGF sequence) is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl ChemBiochem. 2:239-245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5' UTR mediated about 90% decrease in cellular GAPDH mRNA and completely abolished protein level (www.ambion.com/techlib/tn/91/912.html).
[0232] Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov/BLAST/). Putative target sites which exhibit significant homology to other coding sequences are filtered out.
[0233] Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55%. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
[0234] The RNA silencing agents of the present invention may comprise nucleic acid analogs that may have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or 0-methylphosphoroamidite linkages and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, which are incorporated by reference. Nucleic acids containing one or more non-naturally occurring or modified nucleotides are also included within one definition of nucleic acids. The modified nucleotide analog may be located for example at the 5'-end and/or the 3'-end of the nucleic acid molecule. Representative examples of nucleotide analogs may be selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino) propyl uridine, 5-bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; 0- and N-alkylated nucleotides, e.g. N6-methyl adenosine are suitable. The 2'-0H-group may be replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. Modified nucleotides also include nucleotides conjugated with cholesterol through, e.g., a hydroxyprolinol linkage as described in Krutzfeldt et al., Nature 438:685-689 (2005), Soutschek et al., Nature 432:173-178 (2004), and U.S. Patent Publication No. 20050107325, which are incorporated herein by reference. Additional modified nucleotides and nucleic acids are described in U.S. Patent Publication No. 20050182005, which is incorporated herein by reference. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments, to enhance diffusion across cell membranes, or as probes on a biochip. The backbone modification may also enhance resistance to degradation, such as in the harsh endocytic environment of cells. The backbone modification may also reduce nucleic acid clearance by hepatocytes, such as in the liver and kidney. Mixtures of naturally occurring nucleic acids and analogs may be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
[0235] In some embodiments, the RNA silencing agent provided herein can be functionally associated with a cell-penetrating peptide." As used herein, a "cell-penetrating peptide" is a peptide that comprises a short (about 12-30 residues) amino acid sequence or functional motif that confers the energy-independent (i.e., non-endocytotic) translocation properties associated with transport of the membrane-permeable complex across the plasma and/or nuclear membranes of a cell. The cell-penetrating peptide used in the membrane-permeable complex of the present invention preferably comprises at least one non-functional cysteine residue, which is either free or derivatized to form a disulfide link with a double-stranded ribonucleic acid that has been modified for such linkage. Representative amino acid motifs conferring such properties are listed in U.S. Pat. No. 6,348,185, the contents of which are expressly incorporated herein by reference. The cell-penetrating peptides of the present invention preferably include, but are not limited to, penetratin, transportan, plsl, TAT(48-60), pVEC, MTS, and MAP.
[0236] Another agent capable of down-regulating RTVP-1 is a DNAzyme molecule capable of specifically cleaving an mRNA transcript or DNA sequence of CTGF. DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences (Breaker, R. R. and Joyce, G. Chemistry and Biology 1995; 2:655; Santoro, S. W. & Joyce, G. F. Proc. Natl, Acad. Sci. USA 1997; 943:4262) A general model (the "10-23" model) for the DNAzyme has been proposed. "10-23" DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (Santoro, S. W. & Joyce, G. F. Proc. Natl, Acad. Sci. USA 20 199; for rev of DNAzymes see Khachigian, L M [Curr Opin Mol Ther 4:119-21 (2002)].
[0237] Examples of construction and amplification of synthetic, engineered DNAzymes recognizing single and double-stranded target cleavage sites have been disclosed in U.S. Pat. No. 6,326,174 to Joyce et al.
[0238] Down-regulation of RTVP-1 can also be obtained by using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding RTVP-1.
[0239] Design of antisense molecules which can be used to efficiently down-regulate RTVP-1 should take into consideration two aspects important to the antisense approach. The first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells, while the second aspect is design of an oligonucleotide which specifically binds the designated mRNA within cells in a way which inhibits translation thereof.
[0240] The prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, for example, Luft J Mol Med 76: 75-6 (1998); Kronenwett et al. Blood 91: 852-62 (1998); Rajur et al. Bioconjug Chem 8: 935-40 (1997); Lavigne et al. Biochem Biophys Res Commun 237: 566-71 (1997) and Aoki et al. (1997) Biochem Biophys Res Commun 231: 540-5 (1997)].
[0241] In addition, algorithms for identifying those sequences with the highest predicted binding affinity for their target mRNA based on a thermodynamic cycle that accounts for the energetics of structural alterations in both the target mRNA and the oligonucleotide are also available [see, for example, Walton et al. Biotechnol Bioeng 65: 1-9 (1999)].
[0242] Such algorithms have been successfully used to implement an antisense approach in cells. For example, the algorithm developed by Walton et al. enabled scientists to successfully design antisense oligonucleotides for rabbit beta-globin (RBG) and mouse tumor necrosis factor-alpha (TNF alpha) transcripts. The same research group has more recently reported that the antisense activity of rationally selected oligonucleotides against three model target mRNAs (human lactate dehydrogenase A and B and rat gp 130) in cell culture as evaluated by a kinetic PCR technique proved effective in almost all cases, including tests against three different targets in two cell types with phosphodiester and phosphorothioate oligonucleotide chemistries.
[0243] In addition, several approaches for designing and predicting efficiency of specific oligonucleotides using an in vitro system were also published (Matveeva et al., Nature Biotechnology 16: 1374-1375 (1998)].
[0244] Another agent capable of down-regulating RTVP-1 is a ribozyme molecule capable of specifically cleaving an mRNA transcript encoding RTVP-1. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)]. The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications.
[0245] An additional method of regulating the expression of a RTVP-1 gene in cells is via triplex forming oligonuclotides (TFOs). Recent studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical DNA in a sequence-specific manner. These recognition rules are outlined by Maher III, L. J., et al., Science, 1989; 245:725-730; Moser, H. E., et al., Science, 1987; 238:645-630; Beal, P. A., et al, Science, 1992; 251:1360-1363; Cooney, M., et al., Science, 1988; 241:456-459; and Hogan, M. E., et al., EP Publication 375408.
[0246] Modification of the oligonuclotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, J Clin Invest 2003; 112:487-94).
[0247] In general, the triplex-forming oligonucleotide has the sequence correspondence:
TABLE-US-00001 oligo 3'--A G G T duplex 5'--A G C T duplex 3'--T C G A
[0248] However, it has been shown that the A-AT and G-GC triplets have the greatest triple helical stability (Reither and Jeltsch, BMC Biochem, 2002, Septl2, Epub). The same authors have demonstrated that TFOs designed according to the A-AT and G-GC rule do not form non-specific triplexes, indicating that the triplex formation is indeed sequence specific.
[0249] Triplex-forming oligonucleotides preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.
[0250] Transfection of cells (for example, via cationic liposomes) with TFOs, and formation of the triple helical structure with the target DNA induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and resulting in the specific down-regulation of gene expression. Examples of such suppression of gene expression in cells treated with TFOs include knockout of episomal supFG 1 and endogenous HPRT genes in mammalian cells (Vasquez et al., Nucl Acids Res. 1999; 27:1176-81, and Puri, et al, J Biol Chem, 2001; 276:28991-98), and the sequence- and target specific down-regulation of expression of the Ets2 transcription factor, important in prostate cancer etiology (Carbone, et al, Nucl Acid Res. 2003; 31:833-43) and the pro-inflammatory ICAM-1 gene (Besch et al, J Biol Chem, 2002; 277:32473-79). In addition, Vuyisich and Beal have recently shown that sequence specific TFOs can bind to dsRNA, inhibiting activity of dsRNA-dependent enzymes such as RNA-dependent kinases (Vuyisich and Beal, Nuc. Acids Res 2000; 28:2369-74).
[0251] Additionally, TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both down-regulation and up-regulation of expression of endogenous genes (Seidman and Glazer, J Clin Invest 2003; 112:487-94). Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et al, and 2002 0128218 and 2002 0123476 to Emanuele et al, and U.S. Pat. No. 5,721,138 to Lawn.
[0252] The invention also contemplates silencing RTVP-1 by genetic modification of the RTVP-1 locus. This modification can include complete deletion of part or all of the coding region such that no functional protein is produced. Modification can also include mutation or deletion of the part or all of the promotor, such that the coding region is not transcribed. In some embodiments, silencing of RTVP-1 comprises introduction of CRISPR/Cas9 reagents to genetically delete and/or modify the RTVP-1 genomic locus.
[0253] The conditions used for contacting the mesenchymal stem cells are selected for a time period/concentration of cells/concentration of RTVP-1 down-regulatory agent/ratio between cells and RTVP-1 down-regulatory agent which enable the RTVP-1 down-regulatory agent to induce differentiation thereof.
[0254] Isolated cell populations obtained according to the methods describe herein are typically non-homogeneous, although homogeneous cell populations are also contemplated.
[0255] According to a particular embodiment, the cell populations are genetically modified to express an exogenous miRNA or a polynucleotide agent capable of down-regulating the miRNA.
[0256] The term "isolated" as used herein refers to a population of cells that has been removed from its in-vivo location (e.g. bone marrow, neural tissue). Preferably the isolated cell population is substantially free from other substances (e.g., other cells) that are present in its in-vivo location.
[0257] Cell populations may be selected such that more than about 50% (alternatively more than about 60%, more than about 70%, more than about 80%, more than about 90% or even more than about 95%) of the cells express at least one, at least two, at least three, at least four, at least five of the markers for motor neurons or at least one, at least two, at least three, at least four, at least five of the markers for neural stem cells.
[0258] Isolation of particular subpopulations of cells may be affected using techniques known in the art including fluorescent activated cell sorting and/or magnetic separation of cells.
[0259] The cells of the populations of this aspect of the present invention may comprise structural motor neuron or neural stem cell phenotypes including a cell size, a cell shape, an organelle size and an organelle number. These structural phenotypes may be analyzed using microscopic techniques (e.g. scanning electro microscopy). Antibodies or dyes may be used to highlight distinguishing features in order to aid in the analysis.
[0260] The cells and cell populations of the present invention may be useful for a variety of therapeutic purposes. Representative examples of CNS diseases or disorders that can be beneficially treated with the cells described herein include, but are not limited to, a pain disorder, a motion disorder, a dissociative disorder, a mood disorder, an affective disorder, a neurodegenerative disease or disorder, psychiatric disorders and a convulsive disorder.
[0261] More specific examples of such conditions include, but are not limited to, Parkinson's, ALS, Multiple Sclerosis, Huntingdon's disease, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, diabetic neuropathy, glaucatomus neuropathy, macular degeneration, action tremors and tardive dyskinesia, panic, anxiety, depression, alcoholism, insomnia, manic behavior, schizophrenia, autism-spectrum disorder, manic-depressive disorders, Alzheimer's and epilepsy.
[0262] The use of differentiated MSCs may be also indicated for treatment of traumatic lesions of the nervous system including spinal cord injury and also for treatment of stroke caused by bleeding or thrombosis or embolism because of the need to induce neurogenesis and provide survival factors to minimize insult to damaged neurons.
[0263] The motor neuron like cells of the present invention may be useful for motor neuron diseases including, but not limited to amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), pseudobulbar palsy and progressive bulbar palsy.
[0264] In any of the methods described herein the cells may be obtained from an autologous, semi-allogeneic or non-autologous (i.e., allogeneic or xenogeneic) human donor or embryo or cord/placenta. For example, cells may be isolated from a human cadaver or a donor subject.
[0265] The term semi-allogeneic refers to donor cells which are partially-mismatched to recipient cells at a major histocompatibility complex (MHC) class I or class II locus.
[0266] The cells of the present invention can be administered to the treated individual using a variety of transplantation approaches, the nature of which depends on the site of implantation.
[0267] The term or phrase "transplantation", "cell replacement" or "grafting" are used interchangeably herein and refer to the introduction of the cells of the present invention to target tissue. As mentioned, the cells can be derived from the recipient or from an allogeneic, semi-allogeneic or xenogeneic donor.
[0268] The cells can be injected systemically into the circulation, administered intrathecally or grafted into the central nervous system, the spinal cord or into the ventricular cavities or subdurally onto the surface of a host brain. Conditions for successful transplantation include: (i) viability of the implant; (ii) retention of the graft at the site of transplantation; and (iii) minimum amount of pathological reaction at the site of transplantation. Methods for transplanting various nerve tissues, for example embryonic brain tissue, into host brains have been described in: "Neural grafting in the mammalian CNS", Bjorklund and Stenevi, eds. (1985); Freed et al., 2001; Olanow et al., 2003). These procedures include intraparenchymal transplantation, i.e. within the host brain (as compared to outside the brain or extraparenchymal transplantation) achieved by injection or deposition of tissue within the brain parenchyma at the time of transplantation.
[0269] Intraparenchymal transplantation can be performed using two approaches: (i) injection of cells into the host brain parenchyma or (ii) preparing a cavity by surgical means to expose the host brain parenchyma and then depositing the graft into the cavity.
[0270] Both methods provide parenchymal deposition between the graft and host brain tissue at the time of grafting, and both facilitate anatomical integration between the graft and host brain tissue. This is of importance if it is required that the graft becomes an integral part of the host brain and survives for the life of the host.
[0271] Alternatively, the graft may be placed in a ventricle, e.g. a cerebral ventricle or subdurally, i.e. on the surface of the host brain where it is separated from the host brain parenchyma by the intervening pia mater or arachnoid and pia mater. Grafting to the ventricle may be accomplished by injection of the donor cells or by growing the cells in a substrate such as 3% collagen to form a plug of solid tissue which may then be implanted into the ventricle to prevent dislocation of the graft. For subdural grafting, the cells may be injected around the surface of the brain after making a slit in the dura. Injections into selected regions of the host brain may be made by drilling a hole and piercing the dura to permit the needle of a microsyringe to be inserted. The microsyringe is preferably mounted in a stereotaxic frame and three dimensional stereotaxic coordinates are selected for placing the needle into the desired location of the brain or spinal cord. The cells may also be introduced into the putamen, nucleus basalis, hippocampus cortex, striatum, substantia nigra or caudate regions of the brain, as well as the spinal cord.
[0272] The cells may also be transplanted to a healthy region of the tissue. In some cases the exact location of the damaged tissue area may be unknown and the cells may be inadvertently transplanted to a healthy region. In other cases, it may be preferable to administer the cells to a healthy region, thereby avoiding any further damage to that region. Whatever the case, following transplantation, the cells preferably migrate to the damaged area.
[0273] For transplanting, the cell suspension is drawn up into the syringe and administered to anesthetized transplantation recipients. Multiple injections may be made using this procedure.
[0274] The cellular suspension procedure thus permits grafting of the cells to any predetermined site in the brain or spinal cord, is relatively non-traumatic, allows multiple grafting simultaneously in several different sites or the same site using the same cell suspension, and permits mixtures of cells from different anatomical regions.
[0275] Multiple grafts may consist of a mixture of cell types, and/or a mixture of transgenes inserted into the cells. Preferably from approximately 104 to approximately 109 cells are introduced per graft. Cells can be administered concomitantly to different locations such as combined administration intrathecally and intravenously to maximize the chance of targeting into affected areas.
[0276] For transplantation into cavities, which may be preferred for spinal cord grafting, tissue is removed from regions close to the external surface of the central nerve system (CNS) to form a transplantation cavity, for example as described by Stenevi et al. (Brain Res. 114:1-20, 1976), by removing bone overlying the brain and stopping bleeding with a material such a gelfoam. Suction may be used to create the cavity. The graft is then placed in the cavity. More than one transplant may be placed in the same cavity using injection of cells or solid tissue implants. Preferably, the site of implantation is dictated by the CNS disorder being treated. Demyelinated MS lesions are distributed across multiple locations throughout the CNS, such that effective treatment of MS may rely more on the migratory ability of the cells to the appropriate target sites.
[0277] Intranasal administration of the cells is also contemplated.
[0278] MSCs typically down regulate MEW class 2 and are therefore less immunogenic. Embryonal or newborn cells obtained from the cord blood, cord's Warton's gelly or placenta are further less likely to be strongly immunogenic and therefore less likely to be rejected, especially since such cells are immunosuppressive and immunoregulatory to start with.
[0279] Notwithstanding, since non-autologous cells may induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non-autologous cells. Furthermore, since diseases such as multiple sclerosis are inflammatory based diseases, the problem of immune reaction is exacerbated. These include either administration of cells to privileged sites, or alternatively, suppressing the recipient's immune system, providing anti-inflammatory treatment which may be indicated to control autoimmune disorders to start with and/or encapsulating the non-autologous/semi-autologous cells in immunoisolating, semipermeable membranes before transplantation.
[0280] As mentioned herein above, the present inventors also propose use of cord and placenta-derived MSCs that express very low levels of MHCII molecules and therefore limit immune response.
[0281] The following experiments may be performed to confirm the potential use of newborn's MSCs isolated from the cord I placenta for treatment of neurological disorders:
[0282] 1) Differentiated MSCs (to various neural cells or neural progenitor cells) may serve as stimulators in one-way mixed lymphocyte culture with allogeneic T-cells and proliferative responses in comparison with T cells responding against allogeneic lymphocytes isolated from the same donor may be evaluated by 3H Thymidine uptake to document hyporesponsiveness.
[0283] 2) Differentiated MSCs may be added/co-cultured to one-way mixed lymphocyte cultures and to cell cultures with T cell mitogens (phytohemmaglutinin and concanavalin A) to confirm the immunosuppressive effects on proliferative responses mediated by T cells.
[0284] 3) Cord and placenta cells cultured from Brown Norway rats (unmodified and differentiated), may be enriched for MSCs and these cells may be infused into Lewis rats with induced experimental autoimmune encephalomyelitis (EAE). Alternatively, cord and placenta cells cultured from BALB/c mice, (BALB/cxC57BL/6)F1 or xenogeneic cells from Brown Norway rats (unmodified and differentiated), may be enriched for MSCs and these cells may be infused into C57BL/6 or SJL/j recipients with induced experimental autoimmune encephalomyelitis (EAE). The clinical effects against paralysis may be investigated to evaluate the therapeutic effects of xenogeneic, fully MHC mismatched or haploidentically mismatched MSCs. Such experiments may provide the basis for treatment of patients with a genetic disorder or genetically proned disorder with family member's haploidentical MSCs.
[0285] 4) BALB/c MSCs cultured from cord and placenta may be transfused with pre-miR labeled with GFP or RFP, which will allow the inventors to follow the migration and persistence of these cells in the brain of C57BL/6 recipients with induced EAE. The clinical effects of labeled MHC mismatched differentiated MSCs may be evaluated by monitoring signs of disease, paralysis and histopathology. The migration and localization of such cells may be also monitored by using fluorescent cells from genetically transduced GFP "green" or Red2 "red" donors.
[0286] As mentioned, the present invention also contemplates encapsulation techniques to minimize an immune response.
[0287] Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludag, H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64).
[0288] Methods of preparing microcapsules are known in the arts and include for example those disclosed by Lu M Z, et al., Cell encapsulation with alginate and alpha phenoxycinnamylidene-acetylated poly(allylamine). Biotechnol Bioeng. 2000, 70: 479-83, Chang T M and Prakash S. Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms. Mol. Biotechnol. 2001, 17: 249-60, and Lu M Z, et al., A novel cell encapsulation method using photosensitive poly(allylamine alpha-cyanocinnamylideneacetate). J. Microencapsul. 2000, 17: 245-51.
[0289] For example, microcapsules are prepared by complexing modified collagen with a per-polymer shell of 2-hydroxyethyl methylacrylate (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA), resulting in a capsule thickness of 2-5 um. Such microcapsules can be further encapsulated with additional 2-5 um per-polymer shells in order to impart a negatively charged smooth surface and to minimize plasma protein absorption (Chia, S. M. et al. Multi-layered microcapsules for cell encapsulation Biomaterials. 2002 23: 849-56).
[0290] Other microcapsules are based on alginate, a marine polysaccharide (Sambanis, A. Encapsulated islets in diabetes treatment. Diabetes Technol. Ther. 2003, 5: 665-8) or its derivatives. For example, microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guanidine) hydrochloride in the presence of calcium chloride.
[0291] It will be appreciated that cell encapsulation is improved when smaller capsules are used. Thus, the quality control, mechanical stability, diffusion properties, and in vitro activities of encapsulated cells improved when the capsule size was reduced from 1 mm to 400 um (Canaple L. et al., Improving cell encapsulation through size control. J Biomater Sci Polym Ed. 2002; 13:783-96). Moreover, nanoporous biocapsules with well-controlled pore size as small as 7 nm, tailored surface chemistries and precise microarchitectures were found to successfully immunoisolate microenvironments for cells (Williams D. Small is beautiful: microparticle and nanoparticle technology in medical devices. Med Device Technol. 1999, 10: 6-9; Desai, T. A. Microfabrication technology for pancreatic cell encapsulation. Expert Opin Biol Ther. 2002, 2: 633-46).
[0292] Examples of immunosuppressive agents include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporin A, chloroquine, hydroxychloroquine, sulfasalazine (sulphasalazopyrine), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE.TM.), etanercept, TNF alpha blockers, a biological agent that targets an inflammatory cytokine, and Non-Steroidal Anti-Inflammatory Drug (NSAIDs). Examples of NSAIDs include, but are not limited to acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium, salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors and tramadol.
[0293] In any of the methods described herein, the cells can be administered either per se or, preferably as a part of a pharmaceutical composition that further comprises a pharmaceutically acceptable carrier.
[0294] As used herein a "pharmaceutical composition" refers to a preparation of one or more of the cell compositions described herein, with other chemical components such as pharmaceutically suitable carders and excipients. The purpose of a pharmaceutical composition is to facilitate administration of the cells to a subject.
[0295] Hereinafter, the term "pharmaceutically acceptable earlier" refers to a carrier or a diluent that does not cause significant irritation to a subject and does not abrogate the biological activity and properties of the administered compound. Examples, without limitations, of carriers are propylene glycol, saline, emulsions and mixtures of organic solvents with water.
[0296] Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
[0297] Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.
[0298] Suitable routes of administration include direct administration into the circulation (intravenously or intra-arterial), into the spinal fluid or into the tissue or organ of interest. Thus, for example the cells may be administered directly into the brain.
[0299] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. Preferably, a dose is formulated in an animal model to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
[0300] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. For example, animal models of demyelinating diseases include shiverer (shi/shi, MBP deleted) mouse, MD rats (PLP deficiency), Jimpy mouse (PLP mutation), dog shaking pup (PLP mutation), twitcher mouse (galactosylceramidase defect, as in human Krabbe disease), trembler mouse (PMP-22 deficiency). Virus induced demyelination model comprise use if Theiler's virus and mouse hepatitis virus. Autoimmune EAE is a possible model for multiple sclerosis.
[0301] The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition, (see e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. 1). For example, a multiple sclerosis patient can be monitored symptomatically for improved motor functions indicating positive response to treatment.
[0302] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
[0303] Dosage amount and interval may be adjusted individually to levels of the active ingredient which are sufficient to effectively treat the brain disease/disorder. Dosages necessary to achieve the desired effect will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
[0304] Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or diminution of the disease state is achieved.
[0305] The amount of a composition to be administered will, of course, be dependent on the individual being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. The dosage and timing of administration will be responsive to a careful and continuous monitoring of the individual changing condition. For example, a treated multiple sclerosis patient will be administered with an amount of cells which is sufficient to alleviate the symptoms of the disease, based on the monitoring indications.
[0306] The cells of the present invention may be co-administered with therapeutic agents useful in treating neurodegenerative disorders, such as gangliosides; antibiotics, neurotransmitters, neurohormones, toxins, neurite promoting molecules; and antimetabolites and precursors of neurotransmitter molecules such as L-DOPA.
[0307] As used herein the term "about" refers to +1-10%.
[0308] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0309] As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
[0310] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
[0311] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".
[0312] The term "consisting of" means "including and limited to".
[0313] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0314] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
[0315] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0316] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there between.
[0317] It is noted that for each miR described herein the corresponding sequence (mature and pre) is provided in the sequence listing which should be regarded as part of the specification.
[0318] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0319] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0320] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.
[0321] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cclls-e-A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, Calif. (1990); Marshak et al., "Strategies for Protein Purification and Characterization=--A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Example 1
Differentiation of Mesenchymal Stem Cells (MSCs) to Neural Stem Cells (NSCs)
Methods
[0322] Mesenchymal stem cells (MSCs) from either bone marrow, adipose, placenta or umbilical cord were plated in high density in bacterial dishes in serum free medium supplemented with 10 mg/ml EGF and bFGF for 10 days. The cells started to aggregate and after 4-5 days were disaggregated mechanically to promote their detachment from the plates. The cells were then maintained for two weeks after which they were analyzed for the expression of NSC markers and for their ability to generate neurons, astrocytes and oligodendrocytes when plated on laminin in low-serum (5%) medium.
[0323] The cells were then subjected to miRNA microarray as described.
Results
[0324] As illustrated in FIGS. 1A-B, the mesenchymal stem cells expressed neuronal markers following neural stem cell differentiation.
Example 2
Changes in miRNA Expression During NSC Differentiation
Materials and Methods
[0325] miRNAs have been shown to play a role in the differentiation of various neural cells and neural stem cells. To analyze the expression and function of specific miRNAs in MSC-derived NSCs, the MSCs were differentiated towards NSCs as described in Example 1 and miRNA array analysis was performed to the control and differentiated cells. A qRT-PCR microarray was run that contained 96 miRNAs, all of which were related to stem cells and that were divided into subgroups based on their known association with stem cells, neural-related, hematopoietic and organ-related miRNAs.
[0326] For analyzing the differential expression of specific miRNA in control and differentiated MSCs, the Stem cell microRNA qPCR array was employed with quantiMiR from SBI company (catalog #RA620A-1), according to the user protocol, the contents of which are incorporated herein by reference. For the qPCR, the Applied Biosystems Power SYBR master mix (cat #4367659) was used.
[0327] The system allows for the ability to quantitate fold differences of 95 separate microRNAs between 2 separate experimental RNA samples. The array plate also includes the U6 transcript as a normalization signal. All 95 microRNAs chosen for the array have published implications with regard to potential roles in stem cell self-renewal, hematopoiesis, neuronal development and differentiated tissue identification.
[0328] The array plate also includes the U6 RNA as a normalization signal.
[0329] Total RNA was isolated from 105-106 cells of control and differentiated MSCs using miRneasy total RNA isolation kit from Qiagen (catalog #217004) that isolate RNA fraction with sizes <200 bp. 500 ng of total RNA was processed according to "SBI Stem Cell MicroRNA qPCR Array with QuantiMir.TM." (Cat. #RA620A-1) user protocol. For the qPCR, the Applied Biosystems Power SYBR master mix (cat #4367659) was used.
[0330] For validation, sybr-green qPCR of the specific miRNA of interest was performed on the same RNA samples processed according to QIAGEN miScript System handbook (cat #218061 & 218073) Hu hsa-miR MicroRNA Profiling Kit (System Biosciences) "SBI Stem Cell MicroRNA qPCR Array with QuantiMir.TM." (Cat. #RA620A-1) which detects the expression of 96 miRNAs, was used to profile the miRNAs in unmodified BM-MSC compared with MSCs differentiated to astrocytes. 500 ng of total RNA was tagged with poly(A) to its 3' end by poly A polymerase, and reverse-transcribed with oligo-dT adaptors by QuantiMir RT technology. Expression levels of the miRNAs were measured by quantitative PCR using SYBR green reagent and VIIA7, Real-Time PCR System (Applied Biosystems). All miRNAs could be measured with miRNA specific forward primers and a universal reverse primer (SBI). Expression level of the miRNAs was normalized to U6 snRNA, using the comparative CT method for relative quantification as calculated with the following equation: 2-[(CT astrocyte diff miRNA-CT astrocyte endogenous control)-(CTDMEM miRNA-CT DMEM endogenous control).
[0331] In addition, an Affymetrix miRNA 3.0 array was used to compare BM-MSCs and human NSCs and identify differentially expressed miRNAs.
Results
[0332] As presented in FIGS. 2, 3 and 4A, there were significant changes in the expression of specific miRNA of each group between the control MSCs and the differentiated ones.
[0333] The results of the Affymetrix miRNA 3.0 array analysis are detailed in Table 1 herein below.
[0334] Using a nestin promoter based reporter assay, the present inventors confirmed that overexpression of miR-20b, miR-935, miR-891 and miR-378 also induced differentiation of the MSCs into NSCs (FIG. 4B).
[0335] Similarly, silencing of miR-138, miR-214, miR-199a and miR-199b decreased the mesenchymal phenotypes of all the MSCs and induced their NSC differentiation (FIG. 4C).
[0336] Co-transfection of the MSCs with combination of miR-20b or miR-378 with antagomiR-138 further increased the differentiation of the MSCs to nestin positive cells (FIG. 4D).
[0337] As presented in FIGS. 4E-F, overexpression of antagomiR-138 and miR-891 mimic induced a significant increase in the generation of nestin positive cells in the transfected MSCs as demonstrated by the increased fluorescence intensity of cells transduced with the nestin-GFP reporter.
TABLE-US-00002 TABLE 1 MSCs/NSCs Up regulated MSCs/NSCs Down regulated miRNA Fold change miRNA Fold change miRNA Fold change hsa-miR- 1379.78 hsa-let- -1.53698 hsa-miR- -7.34456 145_st 7c_st 324-3p_st hsa-miR- 752.7381 hsa-miR- -1.58884 hsa-miR- -7.83858 143_st 665_st 20a_st hsa-miR- 552.6854 hsa-miR- -1.61841 hsa-miR- -8.36351 214_st 4258_st 501-5p_st hsa-miR- 511.1263 hsa-miR- -1.63684 hsa-miR- -8.71869 199a-3p_st 361-3p_st 330-3p_st hsa-miR- 362.5667 hsa-miR- -1.76218 hsa-miR- -9.13392 199a-5p_st 374a-star_st 874_st hsa-miR- 347.4311 hsa-miR- -1.85672 hsa-miR- -9.68441 199b-3p_st 892b_st 500_st hsa-miR- 229.2463 hsa-miR- -1.90874 hsa-miR- -9.86881 138_st 361-5p_st 25_st hsa-miR- 190.5331 hsa-miR- -1.93941 hsa-miR- -10.1382 31_st 181a_st 769-5p_st hsa-miR- 59.83459 hsa-miR- -2.19583 hsa-miR- -10.3325 21_st 16_st 125b-2-star_st hsa-miR- 23.8986 hsa-miR- -2.27398 hsa-miR- -16.7436 193a-5p_st 636_st 130b_st hsa-miR- 21.60842 hsa-miR- -2.79417 hsa-miR- -16.9435 224-star_st 4284_st 504_st hsa-miR- 21.38142 hsa-miR- -3.00768 hsa-miR- -17.7877 196a_st 1208_st 181a-2-star_st hsa-miR- 19.18475 hsa-miR- -3.01855 hsa-miR- -20.1501 487b_st 1274b_st 885-3p_st hsa-miR- 17.45522 hsa-miR- -3.46182 hsa-miR- -21.0971 409-5p_st 30c-2-star_st 1246_st hsa-miR- 10.34438 hsa-miR- -3.49025 hsa-miR- -22.8735 193b-star_st 501-3p_st 92b_st hsa-miR- 9.571106 hsa-miR- -3.7152 hsa-miR- -23.3686 379_st 92a_st 362-5p_st hsa-miR- 8.401508 hsa-miR- -3.72739 hsa-miR- -23.3743 21-star_st 378b_st 572_st hsa-miR- 7.080883 hsa-miR- -3.87466 hsa-miR- -24.4173 27a-star_st 1287_st 4270_st hsa-miR- 6.122331 hsa-miR- -4.0524 hsa-miR- -26.6758 27a_st 425-star_st 378c_st hsa-miR- 5.715753 hsa-miR- -4.37339 hsa-miR- -28.4948 4317_st 324-5p_st 93-star_st hsa-miR- 4.920511 hsa-miR- -4.40631 hsa-miR- -28.7369 193b_st 3178_st 149_st hsa-miR- 4.889609 hsa-miR- -4.52146 hsa-miR- -28.9968 27b_st 219-1-3p_st 363_st hsa-miR- 4.798265 hsa-miR- -4.609 hsa-miR- -31.2283 22_st 197_st 9_st hsa-miR- 3.402782 hsa-miR- -4.61406 hsa-miR- -32.3908 574-3p_st 181b_st 18a_st hsa-miR- 3.375774 hsa-miR- -4.72807 hsa-miR- -33.1912 4288_st 500-star_st 891a_st hsa-miR- 3.34163 hsa-miR- -4.96582 hsa-miR- -38.7283 23a_st 106b_st 346_st hsa-miR- 3.09015 hsa-miR- -4.97984 hsa-miR- -50.7583 221-star_st 502-3p_st 124_st hsa-miR- 3.030064 hsa-miR- -5.17107 hsa-miR- -72.2314 2113_st 30c_st 497_st hsa-let- 2.551577 hsa-miR- -5.29365 hsa-miR- -73.6306 7i_st 1275_st 378_st hsa-miR- 2.300083 hsa-miR- -5.54416 hsa-miR- -82.7066 24_st 422a_st 1231_st hsa-miR- 2.217338 hsa-miR- -5.6233 hsa-miR- -92.6078 23b_st 93_st 139-5p_st hsa-miR- 2.201907 hsa-miR- -5.74741 hsa-miR- -94.3695 299-3p_st 181d_st 3180-3p_st hsa-miR- 2.197822 hsa-miR- -5.82664 hsa-miR- -114.107 518c-star_st 1307_st 9-star_st hsa-miR- 2.186328 hsa-miR- -5.84397 hsa-miR- -140.688 221_st 1301_st 935_st hsa-miR- 2.177192 hsa-miR- -5.88481 hsa-miR- -156.762 431-star_st 99a_st 20b_st hsa-miR- 2.116276 hsa-miR- -5.9383 523_st 505-star_st hsa-miR- 1.937531 hsa-miR- -5.94177 4313_st 1202_st hsa-miR- 1.916531 hsa-miR- -6.05212 559_st 128_st hsa-miR- 1.894046 hsa-miR- -6.11976 614_st 532-5p_st hsa-miR- 1.803374 hsa-miR- -6.5161 653_st 195_st hsa-miR- 1.675887 hsa-miR- -6.66014 2278_st 532-3p_st v11_hsa- 1.647103 hsa-miR- -6.91155 miR-768- 106a_st 5p_st hsa-miR- 1.608659 hsa-miR- -6.91565 154-star_st 17_st hsa-miR- 1.598961 hsa-miR- -7.05548 302a-star_st 1271_st hsa-miR- 1.580479 hsa-miR- -7.1367 3199_st 769-3p_st hsa-miR- 1.476948 hsa-miR- -7.31636 3137_st 15b_st
Example 3
miRNAs that Play a Role in the Differentiation of MSCs to NSCs
[0338] The present inventors further examined the role of the specific miRNAs that were found to be altered in the miR microarray on the differentiation of the MSCs to NSCs. These experiments were performed by transfecting MSCs with either specific or combination of mature miRNA mimics or miRNA inhibitors and then their ability to generate neurospheres and express the markers nestin and Sox2 was examined.
Results
[0339] It was found that the inhibition of let-7 together with expression of miR-124 increased NSC differentiation.
[0340] In addition, it was found that up-regulation of the following miRNAs: miR302b, miR-371, miR-134, miR-219, miR-154, miR-155, miR-32, miR-33, miR-126 and miR-127 and down-regulation of the following miRs-miR-10b, miR-142-3p, miR-131a, miR-125b, miR-153 and miR-181a either alone or in various combinations induced differentiation of the MSCs to NSCs albeit to different degrees.
[0341] In addition to the miRNAs that were described in the miRNA array, it was also found that transfection of the MSCs with miR-132 and miR-137 also increased the NSC differentiation.
Example 4
Additional Factors that Promote the Differentiation of MSCs to NSCs
[0342] Related to testis-specific, vespid and pathogenesis protein 1 (RTVP-1) was cloned from human GBM cell lines by two groups and was termed glioma pathogenesis-related protein-GLIPR1 or RTVP-1 [3]. RTVP-1 contains a putative signal peptide, a transmembrane domain and a SCP domain, with a yet unknown function which is also found in other RTVP-1 homologs including TPX-1 [4], the venom allergen antigen 5 [5] and group 1 of the plant pathogenesis-related proteins (PR-1). It has recently been reported that RTVP-1 acts as a tumor promoter in gliomas. Thus, the expression of RTVP-1 correlates with the degree of malignancy of astrocytic tumors and over-expression of RTVP-1 increases cell proliferation, invasion, migration and anchorage independent growth. Moreover, silencing of RTVP-1 induces apoptosis in glioma cell lines and primary glioma cultures [6]. Interestingly, RTVP-1 acts as a tumor suppressor in prostate cancer cells and adenovirus mediated delivery of RTVP-1 has therapeutic effects in a mouse prostate cancer model [7-9].
Results
[0343] Expression of RTVP-1 in MSCs is very high, as determined by Western blot (FIG. 5A). Moreover, silencing of RTVP-1 in MSCs abrogated their ability to differentiate to mesenchymal lineage cells (FIGS. 5C-D).
[0344] Further, silencing of RTVP-1 in MSCs increased the expression of both nestin and Sox 2 and some levels of beta 3 tubulin (data not shown). Interestingly, it was found that RTVP-1 is a novel target of miR-137, suggesting that the positive effect of miR-137 on the NSC differentiation of MSCs may be mediated by RTVP-1.
[0345] To further examine the role of RTVP-1, its expression was examined in MSCs, NSCs and in MSCs that were differentiated into NSCs. Human NSCs did not express RTVP-1 at all (data not shown) and the expression of RTVP-1 in MSCs was significantly higher than that of MSCs differentiated to NSCs irrespective of the source of MSCs that were examined (FIG. 5E).
[0346] The effect of RTVP-1 overexpression in human NSCs was examined. It was found that these cells acquired mesenchymal phenotypes and especially were predisposed to differentiate into adipocytes (data not shown).
[0347] Silencing of RTVP-1 in the different MSCs examined increased the expression of nestin in these cells (FIG. 5F).
[0348] To further analyze the effect of RTVP-1 on mesenchymal transformation, gene array analysis was performed on BM-MSCs in which the expression of RTVP-1 was silenced. Silencing of RTVP-1 decreased the expression of ALDH1A3 by 3.2-fold, VAV3 by 15 fold, CD200 by 5 fold and the sternness markers Oct4, Nanog and Sox2 by 2.3, 3.4 and 4.2, respectively. Collectively these results indicate that RTVP-1 decreases the proliferation and sternness signature of these cells.
[0349] In contrast, RTVP-1 silencing increased the expression of certain genes such as nestin (3.4 fold), NKX2.2 (4.7 fold) and calcium channel, voltage dependent (3 fold).
[0350] Together, these results implicate RTVP-1 as a major mesenchymal regulator and demonstrate that silencing of RTVP-1 induces differentiation of MSCs to cells with neural phenotypes.
Example 5
Differentiation of Neural Progenitor Cells to Motor Neurons
Materials and Methods
[0351] Plates were coated with 20 .mu.g/ml laminin overnight and were then washed twice with PBS. The NPC were plated in the confluency of 50% and after 24 hr were incubated with priming medium: NM medium with heparin (use 10 .mu.g/mL) and bFGF (100 .mu.g/mL) for 5 days. After day 5 the medium was changed to the differentiation medium: F12 with 1 mL of B27 in 50 mL F12 (or 2%), retinoic acid (RA, 1 .mu.M), and SHH (200 ng/mL). The RA was added every other day. After 5 days GDNF and BDNF were added to the medium (10 ng/mL).
Results
[0352] In the developing spinal cord, there is sequential generation of motor neurons (MNs) and oligodendrocytes (OLPs). There are common progenitors called pMN that first generate MN and then oligodendrocytes. The basic helix-loop-helix (bHLH) transcription factor Olig2, is expressed in the pMN domain and it's one of the important transcription factors that play a role in the development of both cell types. Over-expression of Olig2 in MSCs that were grow in NM medium supplemented with 200 ng/ml recombinant SHH, 20 ng/ml of each, GDNF, BDNF, CNTF and NT-3 and 1 mM retinoic acid induced the expression of two specific markers of motor neurons Hb9 and Islet1 (FIGS. 6A-D).
Example 6
Involvement of miRNAs in the Differentiation of NPCs to Motor Neurons
Materials and Methods
[0353] To identify specific miRNAs involved with motor neuron differentiation, the present inventors differentiated two types of neural stem/progenitor cells into motor neurons at different stages of development using the protocol described in Example 5. The characterization of the cells as motor neurons was characterized by the expression of the specific markers, isletl, HB9 and the neuronal markers neurofilament and tubulin.
[0354] To analyze the expression and function of specific miRNAs in motor neurons the neural progenitor cell system described herein above was used. miRNA array analysis was performed on the control and differentiated cells. A qRT-PCR microarray that contained 96 miRNAs, all of which were related to stem cells and that were divided into subgroups based on their known association with stem cells, neural-related, hematopoietic and organ-related miRNAs, as described in Example 2.
Results
[0355] As illustrated in FIGS. 7A-B, neural stem cells may be induced to differentiate into motor neurons.
[0356] As presented in FIGS. 8-10, there were significant changes in the expression of specific miRNA of each group between the control MSCs and the differentiated MSCs.
[0357] qRT-PCR studies were performed to validate the differences in the miRNA expression that were observed between the control and differentiated cells.
[0358] Similar to the results that were obtained with the microarray data, the qRT-PCR results demonstrated a decrease in miRs, 372, 373, 141, 199a, 32, 33, 221 and 223.
[0359] In contrast a significant increase was observed in all the miRNAs that increased in the array and specifically the following miRNAs: miR-368, 302b, 365-3p, 365-5p, Let-7a, Let-7b, 218, 134, 124, 125a, 9, 154, 20a, 130a.
[0360] The present inventors further examined the role of the specific miRNAs in the differentiation of MSCs to motor neurons. It was found that the combination of Let-7a and miR-124, 368 and miR-154 increased the expression of Hb9 and Islet-1. Similarly, transfection with combinations of miR-125a, 9, 130a and 218, 134 and 20a together and in combination with miRNA inhibitors of miR-141, 32, 33, 221, 223 and miR373 also induced differentiation of MSCs to either motor neuron progenitors or to immature motor neurons.
Example 7
Sequences
TABLE-US-00003
[0361] TABLE 2 Sequence of Sequence of Name mature miRNA premiRNA hsa-let-7a seq id no: 1 seq id no: 73 seq id no: 74 seq id no: 75 hsa-let-7b seq id no: 2 seq id no: 76 hsa-let-7c seq id no: 3 seq id no: 77 hsa-let-7d seq id no: 4 seq id no: 78 hsa-let-7e seq id no: 5 seq id no: 79 hsa-let-7f seq id no: 6 seq id no: 80 hsa-let-7g seq id no: 7 seq id no: 81 hsa-let-7i seq id no: 8 seq id no: 82 hsa-mir-106a seq id no: 9 seq id no: 83 hsa-mir-106b seq id no: 10 seq id no: 84 hsa-mir-1294 seq id no: 11 seq id no: 85 hsa-mir-1297 seq id no: 12 seq id no: 86 hsa-mir-143 seq id no: 13 seq id no: 87 hsa-mir-144 seq id no: 14 seq id no: 88 hsa-mir-145 seq id no: 15 seq id no: 89 hsa-mir-17 seq id no: 16 seq id no: 90 miR-181a seq id no: 17 seq id no: 91 miR-181a seq id no: 18 seq id no: 92 miR-181b seq id no: 19 seq id no: 93 miR-181b seq id no: 20 seq id no: 94 miR-181c seq id no: 21 seq id no: 95 hsa-mir-181d seq id no: 22 seq id no: 96 hsa-mir-199a-3p seq id no: 23 seq id no: 97 hsa-mir-199b-3p seq id no: 24 seq id no: 98 hsa-mir-202 seq id no: 25 seq id no: 99 hsa-mir-20a seq id no: 26 seq id no: 100 hsa-mir-20b seq id no: 27 seq id no: 101 hsa-mir-2113 seq id no: 28 seq id no: 102 hsa-mir-25 seq id no: 29 seq id no: 103 hsa-mir-26a seq id no: 30 seq id no: 104 seq id no: 31 seq id no: 105 hsa-mir-26b seq id no: 32 seq id no: 106 hsa-mir-29a seq id no: 33 seq id no: 107 hsa-mir-29b seq id no: 34 seq id no: 108 seq id no: 109 hsa-mir-29c seq id no: 35 seq id no: 110 hsa-mir-3129-5p seq id no: 36 seq id no: 111 hsa-mir-3177-5p seq id no: 37 seq id no: 112 hsa-mir-32 seq id no: 38 seq id no: 113 hsa-mir-326 seq id no: 39 seq id no: 114 hsa-mir-330-5p seq id no: 40 seq id no: 115 hsa-mir-363 seq id no: 41 seq id no: 116 hsa-mir-3659 seq id no: 42 seq id no: 117 hsa-mir-3662 seq id no: 43 seq id no: 118 hsa-mir-367 seq id no: 44 seq id no: 119 hsa-mir-372 seq id no: 45 seq id no: 120 hsa-mir-373 seq id no: 46 seq id no: 121 hsa-mir-3927 seq id no: 47 seq id no: 122 hsa-mir-4262 seq id no: 48 seq id no: 123 hsa-mir-4279 seq id no: 49 seq id no: 124 hsa-mir-4458 seq id no: 50 seq id no: 125 hsa-mir-4465 seq id no: 51 seq id no: 126 hsa-mir-4500 seq id no: 52 seq id no: 127 hsa-mir-4658 seq id no: 53 seq id no: 128 hsa-mir-4724-3p seq id no: 54 seq id no: 129 hsa-mir-4742-3p seq id no: 55 seq id no: 130 hsa-mir-4770 seq id no: 56 seq id no: 131 hsa-mir-519d seq id no: 57 seq id no: 132 hsa-mir-520a-3p seq id no: 58 seq id no: 133 hsa-mir-520b seq id no: 59 seq id no: 134 hsa-mir-520c-3p seq id no: 60 seq id no: 135 hsa-mir-520d-3p seq id no: 61 seq id no: 136 hsa-mir-520d-5p seq id no: 62 seq id no: 137 hsa-mir-520e seq id no: 63 seq id no: 138 hsa-mir-524-5p seq id no: 64 seq id no: 139 hsa-mir-642b seq id no: 65 seq id no: 140 hsa-mir-656 seq id no: 66 seq id no: 141 hsa-mir-767-5p seq id no: 67 seq id no: 142 hsa-mir-92a seq id no: 68 seq id no: 143 seq id no: 69 seq id no: 144 hsa-mir-92b seq id no: 70 seq id no: 145 hsa-mir-93 seq id no: 71 seq id no: 146 hsa-mir-98 seq id no: 72 seq id no: 147
TABLE-US-00004 TABLE 3 Sequence of Sequence of Name mature premiRNA hsa-mir-410 seq id no: 148 seq id no: 156 hsa-mir-3163 seq id no: 149 seq id no: 157 hsa-mir-148a seq id no: 150 seq id no: 158 hsa-mir-148b seq id no: 151 seq id no: 159 hsa-mir-152 seq id no: 152 seq id no: 160 hsa-mir-3121-3p seq id no: 153 seq id no: 161 hsa-mir-495 seq id no: 154 seq id no: 162 hsa-mir-4680-3p seq id no: 155 seq id no: 163
TABLE-US-00005 TABLE 4 Sequence of Sequence of Name mature PMIR id premiRNA miR-92ap seq id no: 164 MI0000093 seq id no: 269 seq id no: 165 MI0000094 seq id no: 270 miR-21 seq id no: 166 MI0000077 seq id no: 271 miR-26a 5P seq id no: 167 MI0000083 seq id no: 272 seq id no: 168 MI0000750 seq id no: 273 miR-18a seq id no: 169 MI0000072 seq id no: 274 miR-124 seq id no: 170 MI0000445 seq id no: 275 seq id no: 171 MI0000443 seq id no: 276 seq id no: 172 MI0000444 seq id no: 277 miR-99a seq id no: 173 MI0000101 seq id no: 278 miR-30c seq id no: 174 MI0000736 seq id no: 279 MI0000254 seq id no: 280 miR-301a 3P seq id no: 175 MI0000745 seq id no: 281 miR-145-50 seq id no: 176 MI0000461 seq id no: 282 miR-143-3p seq id no: 177 MI0000459 seq id no: 283 miR-373 3P seq id no: 178 MI0000781 seq id no: 284 miR-20b seq id no: 179 MI0001519 seq id no: 285 miR-29c 3P seq id no: 180 MI0000735 seq id no: 286 miR-29b 3P seq id no: 181 MI0000105 seq id no: 287 MI0000107 seq id no: 288 miR-143 let-7g seq id no: 182 MI0000433 seq id no: 289 let-7a seq id no: 183 MI0000060 seq id no: 290 MI0000061 seq id no: 291 MI0000062 seq id no: 292 let-7b seq id no: 184 MI0000063 seq id no: 293 miR-98 seq id no: 185 MI0000100 seq id no: 294 miR-30a* seq id no: 186 MI0000088 seq id no: 295 miR-17 seq id no: 187 MI0000071 seq id no: 296 miR-1-1 seq id no: 188 MI0000651 seq id no: 297 miR-1-2 seq id no: 189 MI0000437 seq id no: 298 miR-192 seq id no: 190 MI0000234 seq id no: 299 miR-155 seq id no: 191 MI0000681 seq id no: 300 miR-516-ap a1-5p-- seq id no: 192 MI0003180 seq id no: 301 a2-3p-- seq id no: 193 MI0003181 seq id no: 302 miR-31 seq id no: 194 MI0000089 seq id no: 303 miR-181a seq id no: 195 MI0000289 seq id no: 304 seq id no: 196 MI0000269 seq id no: 305 miR-181b seq id no: 197 MI0000270 seq id no: 306 seq id no: 198 MI0000683 seq id no: 307 miR-181c seq id no: 199 MI0000271 seq id no: 308 miR-34-c seq id no: 200 MI0000743 seq id no: 309 miR-34b* seq id no: 201 MI0000742 seq id no: 310 miR-103a seq id no: 202 MI0000109 seq id no: 311 seq id no: 203 MI0000108 seq id no: 312 miR-210 seq id no: 204 MI0000286 seq id no: 313 miR-16 seq id no: 205 MI0000070 seq id no: 314 seq id no: 206 MI0000115 seq id no: 315 miR-30a seq id no: 207 MI0000088 seq id no: 316 miR-31 seq id no: 208 MI0000089 seq id no: 317 miR-222 seq id no: 209 MI0000299 seq id no: 318 miR-17 seq id no: 210 MI0000071 seq id no: 319 miR-17* seq id no: 211 MI0000071 seq id no: 320 miR-200b seq id no: 212 MI0000342 seq id no: 321 miR-200c seq id no: 213 MI0000650 seq id no: 322 miR-128 seq id no: 214 MI0000447 seq id no: 323 MI0000727 seq id no: 324 miR-503 seq id no: 215 MI0003188 seq id no: 325 miR-424 seq id no: 216 MI0001446 seq id no: 326 miR-195 seq id no: 217 MI0000489 seq id no: 327 miR-1256 seq id no: 218 MI0006390 seq id no: 328 miR-203a seq id no: 219 MI0000283 seq id no: 329 miR-199 ?? hsa-miR-199a-3p_st seq id no: 220 MI0000242 seq id no: 330 hsa-miR-199a-5p_st seq id no: 221 MI0000242 seq id no: 331 hsa-miR-199b-3p_st seq id no: 222 MI0000282 seq id no: 332 miR-93 seq id no: 223 MI0000095 seq id no: 333 miR-98 seq id no: 224 MI0000100 seq id no: 334 miR-125-a seq id no: 225 MI0000469 seq id no: 335 miR-133a seq id no: 226 MI0000450 seq id no: 336 MI0000451 seq id no: 337 miR-133b seq id no: 227 MI0000822 seq id no: 338 miR-126 seq id no: 228 MI0000471 seq id no: 339 miR-194 seq id no: 229 MI0000488 seq id no: 340 MI0000732 seq id no: 341 miR-346 seq id no: 230 MI0000826 seq id no: 342 miR-15b seq id no: 231 MI0000438 seq id no: 343 miR-338-3p seq id no: 232 MI0000814 seq id no: 344 miR-373 miR-205 seq id no: 233 MI0000285 seq id no: 345 miR-210 miR-125 miR-1226 seq id no: 234 MI0006313 seq id no: 346 miR-708 seq id no: 235 MI0005543 seq id no: 347 miR-449 seq id no: 236 MI0001648 seq id no: 348 miR-422 seq id no: 237 MI0001444 seq id no: 349 miR-340 seq id no: 238 MI0000802 seq id no: 350 miR-605 seq id no: 239 MI0003618 seq id no: 351 miR-522 seq id no: 240 MI0003177 seq id no: 352 miR-663 seq id no: 241 MI0003672 seq id no: 353 miR-130a seq id no: 242 MI0000448 seq id no: 354 miR-130b seq id no: 243 MI0000748 seq id no: 355 miR-942 seq id no: 244 MI0005767 seq id no: 356 miR-572 seq id no: 245 MI0003579 seq id no: 357 miR-520 miR-639 seq id no: 246 MI0003654 seq id no: 358 miR-654 seq id no: 247 MI0003676 seq id no: 359 miR-519 miR-204 seq id no: 248 MI0000284 miR-224 seq id no: 249 MI0000301 seq id no: 360 miR-616 seq id no: 250 MI0003629 seq id no: 361 miR-122 seq id no: 251 MI0000442 seq id no: 362 miR-299 3p- seq id no: 252 MI0000744 seq id no: 363 5p- seq id no: 253 seq id no: 364 miR-100 seq id no: 254 MI0000102 miR-138 seq id no: 255 MI0000476 seq id no: 365 miR-140 seq id no: 256 MI0000456 seq id no: 366 miR-375 seq id no: 257 MI0000783 seq id no: 367 miR-217 seq id no: 258 MI0000293 seq id no: 368 miR-302 seq id no: 369 miR-372 seq id no: 259 MI0000780 miR-96 seq id no: 260 MI0000098 seq id no: 370 miR-127-3p seq id no: 261 MI0000472 seq id no: 371 miR-449 seq id no: 372 miR-135b seq id no: 262 MI0000810 miR-101 seq id no: 263 MI0000103 seq id no: 373 MI0000739 seq id no: 374 miR-326 seq id no: 264 MI0000808 seq id no: 375 miR-3245p- seq id no: 265 MI0000813 seq id no: 376 3p- seq id no: 266 MI0000813 seq id no: 377 miR-335 seq id no: 267 MI0000816 seq id no: 378 miR-141 seq id no: 268 MI0000457 seq id no: 379
TABLE-US-00006 TABLE 5 Sequence of Sequence of Name mature miRNA premiRNA miR-1275 seq id no: 381 seq id no: 414 miR-891a seq id no: 382 seq id no: 415 miR-154 seq id no: 383 seq id no: 416 miR-1202 seq id no: 384 seq id no: 417 miR-572 seq id no: 385 seq id no: 418 miR-935a seq id no: 386 seq id no: 419 miR-4317 seq id no: 387 seq id no: 420 miR-153 seq id no: 388 seq id no: 421 seq id no: 422 miR-4288 seq id no: 389 seq id no: 423 miR-409-5p seq id no: 390 seq id no: 424 miR-193a-5p seq id no: 391 seq id no: 425 miR-648 seq id no: 392 seq id no: 426 miR-368 miR-365 seq id no: 393 seq id no: 427 miR-500 seq id no: 394 seq id no: 428 miR-491 seq id no: 395 seq id no: 429 hsa-miR-199a- seq id no: 396 seq id no: 430 3p_st seq id no: 397 seq id no: 431 hsa-miR-199a- seq id no: 398 seq id no: 432 5p_st seq id no: 399 seq id no: 433 miR-2113 seq id no: 400 seq id no: 434 miR-372 seq id no: 401 seq id no: 435 miR-373 seq id no: 402 seq id no: 436 miR-942 seq id no: 403 seq id no: 437 miR-1293 seq id no: 404 seq id no: 438 miR-18 seq id no: 405 seq id no: 439 miR-1182 seq id no: 406 seq id no: 440 miR-1185 seq id no: 407 seq id no: 441 seq id no: 442 miR-1276 seq id no: 408 seq id no: 443 miR-193b seq id no: 409 seq id no: 444 miR-1238 seq id no: 410 seq id no: 445 miR-889 seq id no: 411 seq id no: 446 miR-370 seq id no: 412 seq id no: 447 miR-548-d1 seq id no: 413 seq id no: 448
TABLE-US-00007 TABLE 6 mir designation seq id no: hsa-miR-302b seq id no: 449 hsa-miR-371 seq id no: 450 hsa-miR-134 seq id no: 451 hsa-miR-219 seq id no: 452 hsa-miR-154 seq id no: 453 hsa-miR-155 seq id no: 454 hsa-miR-32 seq id no: 455 hsa-miR-33 seq id no: 456 hsa-miR-126 seq id no: 457 hsa-miR-127 seq id no: 458 hsa-miR-132 seq id no: 459 hsa-miR-137 seq id no: 460 hsa-miR-10b seq id no: 461 hsa-miR-142-3p seq id no: 462 hsa-miR-131a hsa-miR-125b seq id no: 463 hsa-miR-153 seq id no: 464 hsa-miR-181a seq id no: 465 hsa-miR-123 hsa-miR-let-7a seq id no: 466 hsa-miR-let-7b seq id no: 467 hsa-miR-368 seq id no: 468 hsa-miR-365-3p hsa-miR-365-5p hsa-miR-218 seq id no: 469 hsa-miR-124 seq id no: 470 hsa-miR-125a seq id no: 471 hsa-miR-9 seq id no: 472 hsa-miR-20a seq id no: 473 hsa-miR-130a seq id no: 474 hsa-miR-372 seq id no: 475 hsa-miR-373 seq id no: 476 hsa-miR-141 seq id no: 477 hsa-miR-199a seq id no: 478 hsa-miR-221 seq id no: 479 hsa-miR-223 seq id no: 480
Example 8
miRNAs that Play a Role in the Differentiation of MSCs to Motor Neurons
Materials and Methods
[0362] Plates were coated with 20 .mu.g/ml laminin overnight and were then washed twice with PBS. The MSCs were plated in the confluency of 50% and after 24 hr were incubated with priming medium: NM medium with heparin (use 10 .mu.g/mL) and bFGF (10 .mu.g/mL) for 5 days. After day 5 the medium was changed to the differentiation medium: F12 with 1 mL of B27 in 50 .mu.L F12 (or 2%), retinoic acid (RA, 0.1-1 .mu.M), and SHH (200 ng/mL). The RA was added every other day. After 5 days GDNF and BDNF were added to the medium (10 ng/mL).
Results
[0363] Transfection of MSCs with various miRs and miR inhibitors to induce trans-differentiation to motor neuron progenitors and immature motor neurons was already discussed in Example 6, however, further effective combinations are herein described. MSCs were transfected with a control miR, miR-9, miR-218, miR-375, all three miRs, all three miRs and an antagomir to miR-221, and all three miRs and an antagomir to miR-373 and mRNA expression of the motor neuron markers Islet1 and HB9 was measured (FIG. 11). Expression was standardized to the control miR transfected MSCs, which was set as 1, and the results are presented in Table 7. Each miR on its own caused about a doubling in expression of Islet1 and HB9. Unexpectedly, expression of all three miRs had a synergistic effect on trans-differentiation and Islet1 was increased by more than 5 fold, while HB9 was increased by more than 6 fold. The three miR combination was also transfected in combination with antagomirs that knockdown expression of miR-221 or miR-373. These combinations were even more effective, as 8-9 fold increases in Islet1 and HB9 were observed.
TABLE-US-00008 TABLE 7 (Relative mRNA expression/S12 mRNA) Islet1 HB9 Con miR 1 1 miR-9 1.8 2.12 miR-218 2.09 1.96 miR-375 2.43 2.39 miR-9 + 218 + 375 5.23 6.48 3 miRs + anti-miR-221 8.6 7.9 3 miRs + anti-miR-373 9.2 8.45
Example 9
Combination RTVP-1 Silencing and miRNA Expression to Differentiate MSCs to NSCs
[0364] Already having shown that RTVP-1 silencing alone was sufficient to drive MSC trans-differentiation to NSCs as measured by nestin mRNA expression, it was next investigated whether the silencing in combination with miR expression could enhance the levels of nestin expressed. MSCs were contacted with a control siRNA, RTVP-1 silencing agent alone (an siRNA against RTVP-1, with the sequence AAGACTGCGTTCGAATCCATA (SEQ ID NO: 481), or the agent in combination with miR-218, miR-504, miR-9, miR-125 or anti-miR-31 (FIG. 12). As compared to the siRNA control cells, RTVP-1 knockdown alone increased nestin mRNA expression by 3.9-fold. Addition of any of the above enumerated miRs or anti-miRs further increased nestin expression; and the addition of miR-504 or miR-9 more than doubled nestin expression. Knockdown of miR-31 in combination with RTVP-1 silencing also had a very strong synergistic effect, although not quite a doubling as compared to RTVP-1 silencing alone.
Example 10
Use of Motor Neuron-Differentiated MSCs to Treat ALS
[0365] SOD1G93A mice were used as a model for amyotrophic lateral sclerosis (ALS). Placenta-derived MSCs were trans-differentiated to motor neurons as described in Example 8 (transfection of miR-9, miR-218 and miR-375) and these cells were administered intrathecally (5.times.10 5-1.times.106 cells) to pre-symptomatic mice (90 days old). Cells were subsequently re-administered 1 week later. SOD1G93A mice were also administered placenta-derived MSCs that had been transfected with control miRs and well as administered PBS as a control. The mean survival of eight control mice who received only PBS was 135.1. The mean survival of eight control mice who received control MSCs was 132.5 days. Administration of motor neuron differentiated MSCs resulted in a statistically significant increase in the mean survival of the eight test mice, as these mice survived, on average, 160.4 days.
Example 11
Use of Motor Neuron-Differentiated MSCs to Treat Spinal Cord Injury
[0366] The ability of the motor neuron-differentiated MSCs to treat nerve, and specifically spinal cord, injury was investigated. Wild-type rats underwent spinal cord perfusion injury by blocking the abdominal aorta below the left renal artery for 15 minutes. The injured rats were then treated with PBS or motor neuron-differentiated MSCs (1.times.10 7 cells) injected at the L5-L6 segment of the spine. Four days later lower limb movement in the rats was evaluated using the Basso, Beattie and Bresnahan (BBB) locomotor scale method. Uninjured rats were also evaluated as a control. The BBB scale is a well-established and discriminating method for measuring behavioral outcome and for evaluating treatments after spinal cord injury. The scale ranges from zero to 21, with a higher score indicating superior movement. The scoring can be summarized by the following breakdown:
0-7: Isolated joint movements with little or no hindlimb movement. 8-13: Intervals of uncoordinated stepping. 14-21: Forelimb and hindlimb coordination.
[0367] As can be seen in FIG. 13, uninjured mice had a nearly perfect score of 20.6 on the BBB scale, whereas control injured mice treated with only PBS scored in the lowest category with an average score of 4.2. Mice treated with motor neuron-transdifferentiated MSCs showed a strong improvement in locomotion, with an average score of 11.8, which is the upper half of the middle category, and were capable of uncoordinated stepping.
Example 12
Use of NSC-Differentiated MSCs to Glioma
[0368] The ability of MSC transdifferentiated to NSCs by silencing of RTVP-1 to treat gliomas was investigated. Glioma stem cell (GSC)-derived xenografts were grown in immune-compromised mice, and the mice were treated with either RTVP-1 silenced MSCs transdifferentiated to NSCs (as described in Example 9), or MSCs expressing control molecules. The transdifferentiated MSCs decreased tumor growth by 59.7% as compared to the control MSC where the decrease was only 41.1%. Further, glioma cells highly express RTVP-1, indeed its other name is glioma pathogenesis-related protein-GLIPR1, but normal healthy brain tissue does not. After dissection of the GSC xenografts it was found that RTVP-1 silenced MSCs greatly reduced RTVP-1 levels in the tumor. Isolated exosomes from the transdifferentiated MSCs contained high levels of the siRNA, suggesting that the decrease in RTVP-1 in the tumor was likely a result of MSC-derived exosome transfer of the siRNA to tumor cells.
[0369] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0370] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.
Sequence CWU
1
1
481122RNAHomo sapiens 1ugagguagua gguuguauag uu
22222RNAHomo sapiens 2ugagguagua gguugugugg uu
22322RNAHomo sapiens 3ugagguagua
gguuguaugg uu 22422RNAHomo
sapiens 4agagguagua gguugcauag uu
22522RNAHomo sapiens 5ugagguagga gguuguauag uu
22622RNAHomo sapiens 6ugagguagua gauuguauag uu
22722RNAHomo sapiens 7ugagguagua
guuuguacag uu 22822RNAHomo
sapiens 8ugagguagua guuugugcug uu
22923RNAHomo sapiens 9aaaagugcuu acagugcagg uag
231021RNAHomo sapiens 10uaaagugcug acagugcaga u
211122RNAHomo sapiens
11ugugagguug gcauuguugu cu
221217RNAHomo sapiens 12uucaaguaau ucaggug
171322RNAHomo sapiens 13ggugcagugc ugcaucucug gu
221420RNAHomo sapiens
14uacaguauag augauguacu
201523RNAHomo sapiens 15guccaguuuu cccaggaauc ccu
231623RNAHomo sapiens 16caaagugcuu acagugcagg uag
231723RNAHomo sapiens
17aacauucaac gcugucggug agu
231823RNAHomo sapiens 18aacauucaac gcugucggug agu
231923RNAHomo sapiens 19aacauucauu gcugucggug ggu
232023RNAHomo sapiens
20aacauucauu gcugucggug ggu
232122RNAHomo sapiens 21aacauucaac cugucgguga gu
222223RNAHomo sapiens 22aacauucauu guugucggug ggu
232322RNAHomo sapiens
23acaguagucu gcacauuggu ua
222422RNAHomo sapiens 24acaguagucu gcacauuggu ua
222520RNAHomo sapiens 25agagguauag ggcaugggaa
202623RNAHomo sapiens
26uaaagugcuu auagugcagg uag
232723RNAHomo sapiens 27caaagugcuc auagugcagg uag
232821RNAHomo sapiens 28auuugugcuu ggcucuguca c
212922RNAHomo sapiens
29cauugcacuu gucucggucu ga
223022RNAHomo sapiens 30uucaaguaau ccaggauagg cu
223122RNAHomo sapiens 31uucaaguaau ccaggauagg cu
223221RNAHomo sapiens
32uucaaguaau ucaggauagg u
213322RNAHomo sapiens 33uagcaccauc ugaaaucggu ua
223423RNAHomo sapiens 34uagcaccauu ugaaaucagu guu
233522RNAHomo sapiens
35uagcaccauu ugaaaucggu ua
223622RNAHomo sapiens 36gcaguagugu agagauuggu uu
223723RNAHomo sapiens 37uguguacaca cgugccaggc gcu
233822RNAHomo sapiens
38uauugcacau uacuaaguug ca
223920RNAHomo sapiens 39ccucugggcc cuuccuccag
204023RNAHomo sapiens 40gcaaagcaca cggccugcag aga
234122RNAHomo sapiens
41aauugcacgg uauccaucug ua
224221RNAHomo sapiens 42ugaguguugu cuacgagggc a
214324RNAHomo sapiens 43gaaaaugaug aguagugacu gaug
244422RNAHomo sapiens
44aauugcacuu uagcaauggu ga
224523RNAHomo sapiens 45aaagugcugc gacauuugag cgu
234623RNAHomo sapiens 46gaagugcuuc gauuuugggg ugu
234722RNAHomo sapiens
47cagguagaua uuugauaggc au
224817RNAHomo sapiens 48gacauucaga cuaccug
174916RNAHomo sapiens 49cucuccuccc ggcuuc
165019RNAHomo sapiens
50agagguaggu guggaagaa
195122RNAHomo sapiens 51cucaaguagu cugaccaggg ga
225217RNAHomo sapiens 52ugagguagua guuucuu
175323RNAHomo sapiens
53gugagugugg auccuggagg aau
235421RNAHomo sapiens 54guaccuucug guucagcuag u
215523RNAHomo sapiens 55ucuguauucu ccuuugccug cag
235618RNAHomo sapiens
56ugagaugaca cuguagcu
185722RNAHomo sapiens 57caaagugccu cccuuuagag ug
225822RNAHomo sapiens 58aaagugcuuc ccuuuggacu gu
225921RNAHomo sapiens
59aaagugcuuc cuuuuagagg g
216022RNAHomo sapiens 60aaagugcuuc cuuuuagagg gu
226122RNAHomo sapiens 61aaagugcuuc ucuuuggugg gu
226220RNAHomo sapiens
62cuacaaaggg aagcccuuuc
206321RNAHomo sapiens 63aaagugcuuc cuuuuugagg g
216422RNAHomo sapiens 64cuacaaaggg aagcacuuuc uc
226522RNAHomo sapiens
65agacacauuu ggagagggac cc
226621RNAHomo sapiens 66aauauuauac agucaaccuc u
216723RNAHomo sapiens 67ugcaccaugg uugucugagc aug
236822RNAHomo sapiens
68uauugcacuu gucccggccu gu
226922RNAHomo sapiens 69uauugcacuu gucccggccu gu
227022RNAHomo sapiens 70uauugcacuc gucccggccu cc
227123RNAHomo sapiens
71caaagugcug uucgugcagg uag
237222RNAHomo sapiens 72ugagguagua aguuguauug uu
227380RNAHomo sapiens 73ugggaugagg uaguagguug
uauaguuuua gggucacacc caccacuggg agauaacuau 60acaaucuacu gucuuuccua
807472RNAHomo sapiens
74agguugaggu aguagguugu auaguuuaga auuacaucaa gggagauaac uguacagccu
60ccuagcuuuc cu
727574RNAHomo sapiens 75gggugaggua guagguugua uaguuugggg cucugcccug
cuaugggaua acuauacaau 60cuacugucuu uccu
747683RNAHomo sapiens 76cggggugagg uaguagguug
ugugguuuca gggcagugau guugccccuc ggaagauaac 60uauacaaccu acugccuucc
cug 837784RNAHomo sapiens
77gcauccgggu ugagguagua gguuguaugg uuuagaguua cacccuggga guuaacugua
60caaccuucua gcuuuccuug gagc
847887RNAHomo sapiens 78ccuaggaaga gguaguaggu ugcauaguuu uagggcaggg
auuuugccca caaggaggua 60acuauacgac cugcugccuu ucuuagg
877979RNAHomo sapiens 79cccgggcuga gguaggaggu
uguauaguug aggaggacac ccaaggagau cacuauacgg 60ccuccuagcu uuccccagg
798087RNAHomo sapiens
80ucagagugag guaguagauu guauaguugu gggguaguga uuuuacccug uucaggagau
60aacuauacaa ucuauugccu ucccuga
878184RNAHomo sapiens 81aggcugaggu aguaguuugu acaguuugag ggucuaugau
accacccggu acaggagaua 60acuguacagg ccacugccuu gcca
848284RNAHomo sapiens 82cuggcugagg uaguaguuug
ugcuguuggu cggguuguga cauugcccgc uguggagaua 60acugcgcaag cuacugccuu
gcua 848381RNAHomo sapiens
83ccuuggccau guaaaagugc uuacagugca gguagcuuuu ugagaucuac ugcaauguaa
60gcacuucuua cauuaccaug g
818482RNAHomo sapiens 84ccugccgggg cuaaagugcu gacagugcag auaguggucc
ucuccgugcu accgcacugu 60ggguacuugc ugcuccagca gg
8285142RNAHomo sapiens 85caccuaaugu gugccaagau
cuguucauuu augaucucac cgaguccugu gagguuggca 60uuguugucug gcauugucug
auauacaaca gugccaaccu cacaggacuc agugagguga 120aacugaggau uaggaaggug
ua 1428677RNAHomo sapiens
86uguuuaucuc uaggguugau cuauuagaau uacuuaucug agccaaagua auucaaguaa
60uucaggugua gugaaac
7787106RNAHomo sapiens 87gcgcagcgcc cugucuccca gccugaggug cagugcugca
ucucugguca guugggaguc 60ugagaugaag cacuguagcu caggaagaga gaaguuguuc
ugcagc 1068886RNAHomo sapiens 88uggggcccug gcugggauau
caucauauac uguaaguuug cgaugagaca cuacaguaua 60gaugauguac uaguccgggc
accccc 868988RNAHomo sapiens
89caccuugucc ucacggucca guuuucccag gaaucccuua gaugcuaaga uggggauucc
60uggaaauacu guucuugagg ucaugguu
889084RNAHomo sapiens 90gucagaauaa ugucaaagug cuuacagugc agguagugau
augugcaucu acugcaguga 60aggcacuugu agcauuaugg ugac
8491110RNAHomo sapiens 91ugaguuuuga gguugcuuca
gugaacauuc aacgcugucg gugaguuugg aauuaaaauc 60aaaaccaucg accguugauu
guacccuaug gcuaaccauc aucuacucca 11092110RNAHomo sapiens
92agaagggcua ucaggccagc cuucagagga cuccaaggaa cauucaacgc ugucggugag
60uuugggauuu gaaaaaacca cugaccguug acuguaccuu gggguccuua
11093110RNAHomo sapiens 93ccugugcaga gauuauuuuu uaaaagguca caaucaacau
ucauugcugu cgguggguug 60aacugugugg acaagcucac ugaacaauga augcaacugu
ggccccgcuu 1109489RNAHomo sapiens 94cugauggcug cacucaacau
ucauugcugu cgguggguuu gagucugaau caacucacug 60aucaaugaau gcaaacugcg
gaccaaaca 8995110RNAHomo sapiens
95cggaaaauuu gccaaggguu ugggggaaca uucaaccugu cggugaguuu gggcagcuca
60ggcaaaccau cgaccguuga guggacccug aggccuggaa uugccauccu
11096137RNAHomo sapiens 96guccccuccc cuaggccaca gccgagguca caaucaacau
ucauuguugu cgguggguug 60ugaggacuga ggccagaccc accgggggau gaaugucacu
guggcugggc cagacacggc 120uuaaggggaa uggggac
1379771RNAHomo sapiens 97gccaacccag uguucagacu
accuguucag gaggcucuca auguguacag uagucugcac 60auugguuagg c
7198110RNAHomo sapiens
98ccagaggaca ccuccacucc gucuacccag uguuuagacu aucuguucag gacucccaaa
60uuguacagua gucugcacau ugguuaggcu gggcuggguu agacccucgg
11099110RNAHomo sapiens 99cgccucagag ccgcccgccg uuccuuuuuc cuaugcauau
acuucuuuga ggaucuggcc 60uaaagaggua uagggcaugg gaaaacgggg cggucggguc
cuccccagcg 11010071RNAHomo sapiens 100guagcacuaa agugcuuaua
gugcagguag uguuuaguua ucuacugcau uaugagcacu 60uaaaguacug c
7110169RNAHomo sapiens
101aguaccaaag ugcucauagu gcagguaguu uuggcaugac ucuacuguag uaugggcacu
60uccaguacu
6910291RNAHomo sapiens 102uuuucaaagc aaugugugac agguacaggg acaaaucccg
uuaauaagua agaggauuug 60ugcuuggcuc ugucacaugc cacuuugaaa a
9110384RNAHomo sapiens 103ggccaguguu gagaggcgga
gacuugggca auugcuggac gcugcccugg gcauugcacu 60ugucucgguc ugacagugcc
ggcc 8410477RNAHomo sapiens
104guggccucgu ucaaguaauc caggauaggc ugugcagguc ccaaugggcc uauucuuggu
60uacuugcacg gggacgc
7710584RNAHomo sapiens 105ggcuguggcu ggauucaagu aauccaggau aggcuguuuc
caucugugag gccuauucuu 60gauuacuugu uucuggaggc agcu
8410677RNAHomo sapiens 106ccgggaccca guucaaguaa
uucaggauag guugugugcu guccagccug uucuccauua 60cuuggcucgg ggaccgg
7710764RNAHomo sapiens
107augacugauu ucuuuuggug uucagaguca auauaauuuu cuagcaccau cugaaaucgg
60uuau
6410881RNAHomo sapiens 108cuucaggaag cugguuucau auggugguuu agauuuaaau
agugauuguc uagcaccauu 60ugaaaucagu guucuugggg g
8110981RNAHomo sapiens 109cuucuggaag cugguuucac
augguggcuu agauuuuucc aucuuuguau cuagcaccau 60uugaaaucag uguuuuagga g
8111088RNAHomo sapiens
110aucucuuaca caggcugacc gauuucuccu gguguucaga gucuguuuuu gucuagcacc
60auuugaaauc gguuaugaug uaggggga
8811176RNAHomo sapiens 111guacuugggc aguaguguag agauugguuu gccuguuaau
gaauucaaac uaaucucuac 60acugcugccc aagagc
7611282RNAHomo sapiens 112ccacgugcca uguguacaca
cgugccaggc gcugucuuga gacauucgcg cagugcacgg 60cacuggggac acguggcacu
gg 8211370RNAHomo sapiens
113ggagauauug cacauuacua aguugcaugu ugucacggcc ucaaugcaau uuagugugug
60ugauauuuuc
7011495RNAHomo sapiens 114cucaucuguc uguugggcug gaggcagggc cuuugugaag
gcggguggug cucagaucgc 60cucugggccc uuccuccagc cccgaggcgg auuca
9511594RNAHomo sapiens 115cuuuggcgau cacugccucu
cugggccugu gucuuaggcu cugcaagauc aaccgagcaa 60agcacacggc cugcagagag
gcagcgcucu gccc 9411675RNAHomo sapiens
116uguugucggg uggaucacga ugcaauuuug augaguauca uaggagaaaa auugcacggu
60auccaucugu aaacc
7511799RNAHomo sapiens 117ucuacaagca gauacaagga ugcccuugua cacaacacac
gugcugcuug uauagacaug 60aguguugucu acgagggcau ccuugugucu gugugugug
9911895RNAHomo sapiens 118uguguuuucc ucaacgcuca
caguuacacu ucuuacucuc aauccauuca uauugaaaau 60gaugaguagu gacugaugaa
gcacaaauca gccaa 9511968RNAHomo sapiens
119ccauuacugu ugcuaauaug caacucuguu gaauauaaau uggaauugca cuuuagcaau
60ggugaugg
6812067RNAHomo sapiens 120gugggccuca aauguggagc acuauucuga uguccaagug
gaaagugcug cgacauuuga 60gcgucac
6712169RNAHomo sapiens 121gggauacuca aaaugggggc
gcuuuccuuu uugucuguac ugggaagugc uucgauuuug 60ggguguccc
6912271RNAHomo sapiens
122ugccaaugcc uaucacauau cugccugucc uaugacaaac auggcaggua gauauuugau
60aggcauuggc a
7112354RNAHomo sapiens 123gaaagcugca ggugcugaug uuggggggac auucagacua
ccugcagcag agcc 5412458RNAHomo sapiens 124ugcucugugg agcugaggag
cagauucucu cucucuccuc ccggcuucac cuccugag 5812575RNAHomo sapiens
125gagcgcacag agguaggugu ggaagaaagu gaaacacuau uuuagguuuu aguuacacuc
60ugcuguggug ugcug
7512670RNAHomo sapiens 126cauguguccc cuggcacgcu auuugagguu uacuauggaa
ccucaaguag ucugaccagg 60ggacacauga
7012776RNAHomo sapiens 127caggagagaa aguacugccc
agaagcuaaa guguagauca aacgcauaau ggcugaggua 60guaguuucuu gaacuu
7612865RNAHomo sapiens
128gcugcccuuc acucagagca ucuacaccca cuaccgguga guguggaucc uggaggaauc
60guggc
6512989RNAHomo sapiens 129acgcaaaaug aacugaacca ggagugagcu ucguguacau
uaucuauuag aaaaugaagu 60accuucuggu ucagcuaguc ccugugcgu
8913085RNAHomo sapiens 130ucaggcaaag ggauauuuac
agauacuuuu uaaaauuugu uugaguugag gcagauuaaa 60uaucuguauu cuccuuugcc
ugcag 8513158RNAHomo sapiens
131gaguuauggg gucaucuauc cuucccuugg aaaaugaucu gagaugacac uguagcuc
5813288RNAHomo sapiens 132ucccaugcug ugacccucca aagggaagcg cuuucuguuu
guuuucucuu aaacaaagug 60ccucccuuua gaguguuacc guuuggga
8813385RNAHomo sapiens 133cucaggcugu gacccuccag
agggaaguac uuucuguugu cugagagaaa agaaagugcu 60ucccuuugga cuguuucggu
uugag 8513461RNAHomo sapiens
134cccucuacag ggaagcgcuu ucuguugucu gaaagaaaag aaagugcuuc cuuuuagagg
60g
6113587RNAHomo sapiens 135ucucaggcug ucguccucua gagggaagca cuuucuguug
ucugaaagaa aagaaagugc 60uuccuuuuag aggguuaccg uuugaga
8713687RNAHomo sapiens 136ucucaagcug ugagucuaca
aagggaagcc cuuucuguug ucuaaaagaa aagaaagugc 60uucucuuugg uggguuacgg
uuugaga 8713787RNAHomo sapiens
137ucucaagcug ugagucuaca aagggaagcc cuuucuguug ucuaaaagaa aagaaagugc
60uucucuuugg uggguuacgg uuugaga
8713887RNAHomo sapiens 138ucuccugcug ugacccucaa gauggaagca guuucuguug
ucugaaagga aagaaagugc 60uuccuuuuug aggguuacug uuugaga
8713987RNAHomo sapiens 139ucucaugcug ugacccuaca
aagggaagca cuuucucuug uccaaaggaa aagaaggcgc 60uucccuuugg aguguuacgg
uuugaga 8714077RNAHomo sapiens
140gaguugggag guucccucuc caaauguguc uugauccccc accccaagac acauuuggag
60agggacccuc ccaacuc
7714178RNAHomo sapiens 141cugaaauagg uugccuguga gguguucacu uucuauauga
ugaauauuau acagucaacc 60ucuuuccgau aucgaauc
78142109RNAHomo sapiens 142gcuuuuauau uguagguuuu
ugcucaugca ccaugguugu cugagcaugc agcaugcuug 60ucugcucaua ccccaugguu
ucugagcagg aaccuucauu gucuacugc 10914378RNAHomo sapiens
143cuuucuacac agguugggau cgguugcaau gcuguguuuc uguaugguau ugcacuuguc
60ccggccuguu gaguuugg
7814475RNAHomo sapiens 144ucaucccugg guggggauuu guugcauuac uuguguucua
uauaaaguau ugcacuuguc 60ccggccugug gaaga
7514596RNAHomo sapiens 145cgggccccgg gcgggcggga
gggacgggac gcggugcagu guuguuuuuu cccccgccaa 60uauugcacuc gucccggccu
ccggcccccc cggccc 9614680RNAHomo sapiens
146cugggggcuc caaagugcug uucgugcagg uagugugauu acccaaccua cugcugagcu
60agcacuuccc gagcccccgg
80147119RNAHomo sapiens 147aggauucugc ucaugccagg gugagguagu aaguuguauu
guuguggggu agggauauua 60ggccccaauu agaagauaac uauacaacuu acuacuuucc
cuggugugug gcauauuca 11914821RNAHomo sapiens 148aauauaacac agauggccug
u 2114922RNAHomo sapiens
149uauaaaauga gggcaguaag ac
2215022RNAHomo sapiens 150ucagugcacu acagaacuuu gu
2215122RNAHomo sapiens 151ucagugcauc acagaacuuu gu
2215221RNAHomo sapiens
152ucagugcaug acagaacuug g
2115322RNAHomo sapiens 153uaaauagagu aggcaaagga ca
2215422RNAHomo sapiens 154aaacaaacau ggugcacuuc uu
2215521RNAHomo sapiens
155ucugaauugu aagaguuguu a
2115680RNAHomo sapiens 156gguaccugag aagagguugu cugugaugag uucgcuuuua
uuaaugacga auauaacaca 60gauggccugu uuucaguacc
8015773RNAHomo sapiens 157uuccucaucu auaaaaugag
ggcaguaaga ccuuccuucc uugucuuacu acccccauuu 60uauagaugag gaa
7315868RNAHomo sapiens
158gaggcaaagu ucugagacac uccgacucug aguaugauag aagucagugc acuacagaac
60uuugucuc
6815999RNAHomo sapiens 159caagcacgau uagcauuuga ggugaaguuc uguuauacac
ucaggcugug gcucucugaa 60agucagugca ucacagaacu uugucucgaa agcuuucua
9916087RNAHomo sapiens 160uguccccccc ggcccagguu
cugugauaca cuccgacucg ggcucuggag cagucagugc 60augacagaac uugggcccgg
aaggacc 8716177RNAHomo sapiens
161aaaugguuau guccuuugcc uauucuauuu aagacacccu guaccuuaaa uagaguaggc
60aaaggacaga aacauuu
7716282RNAHomo sapiens 162ugguaccuga aaagaaguug cccauguuau uuucgcuuua
uaugugacga aacaaacaug 60gugcacuucu uuuucgguau ca
8216366RNAHomo sapiens 163uauaagaacu cuugcagucu
uagauguuau aaaaauauau aucugaauug uaagaguugu 60uagcac
6616422RNAHomo sapiens
164uauugcacuu gucccggccu gu
2216522RNAHomo sapiens 165uauugcacuu gucccggccu gu
2216622RNAHomo sapiens 166uagcuuauca gacugauguu ga
2216722RNAHomo sapiens
167uucaaguaau ccaggauagg cu
2216822RNAHomo sapiens 168uucaaguaau ccaggauagg cu
2216923RNAHomo sapiens 169uaaggugcau cuagugcaga uag
2317020RNAHomo sapiens
170uaaggcacgc ggugaaugcc
2017120RNAHomo sapiens 171uaaggcacgc ggugaaugcc
2017220RNAHomo sapiens 172uaaggcacgc ggugaaugcc
2017322RNAHomo sapiens
173aacccguaga uccgaucuug ug
2217423RNAHomo sapiens 174uguaaacauc cuacacucuc agc
2317523RNAHomo sapiens 175cagugcaaua guauugucaa agc
2317623RNAHomo sapiens
176guccaguuuu cccaggaauc ccu
2317722RNAHomo sapiens 177ggugcagugc ugcaucucug gu
2217823RNAHomo sapiens 178gaagugcuuc gauuuugggg ugu
2317923RNAHomo sapiens
179caaagugcuc auagugcagg uag
2318022RNAHomo sapiens 180uagcaccauu ugaaaucggu ua
2218123RNAHomo sapiens 181uagcaccauu ugaaaucagu guu
2318222RNAHomo sapiens
182ugagguagua guuuguacag uu
2218322RNAHomo sapiens 183ugagguagua gguuguauag uu
2218422RNAHomo sapiens 184ugagguagua gguugugugg uu
2218522RNAHomo sapiens
185ugagguagua aguuguauug uu
2218622RNAHomo sapiens 186cuuucagucg gauguuugca gc
2218723RNAHomo sapiens 187caaagugcuu acagugcagg uag
2318822RNAHomo sapiens
188uggaauguaa agaaguaugu au
2218922RNAHomo sapiens 189uggaauguaa agaaguaugu au
2219021RNAHomo sapiens 190cugaccuaug aauugacagc c
2119123RNAHomo sapiens
191uuaaugcuaa ucgugauagg ggu
2319223RNAHomo sapiens 192uucucgagga aagaagcacu uuc
2319318RNAHomo sapiens 193ugcuuccuuu cagagggu
1819421RNAHomo sapiens
194aggcaagaug cuggcauagc u
2119523RNAHomo sapiens 195aacauucaac gcugucggug agu
2319623RNAHomo sapiens 196aacauucaac gcugucggug agu
2319723RNAHomo sapiens
197aacauucauu gcugucggug ggu
2319823RNAHomo sapiens 198aacauucauu gcugucggug ggu
2319922RNAHomo sapiens 199aacauucaac cugucgguga gu
2220023RNAHomo sapiens
200aggcagugua guuagcugau ugc
2320123RNAHomo sapiens 201uaggcagugu cauuagcuga uug
2320223RNAHomo sapiens 202agcagcauug uacagggcua uga
2320323RNAHomo sapiens
203agcagcauug uacagggcua uga
2320422RNAHomo sapiens 204cugugcgugu gacagcggcu ga
2220522RNAHomo sapiens 205uagcagcacg uaaauauugg cg
2220622RNAHomo sapiens
206uagcagcacg uaaauauugg cg
2220722RNAHomo sapiens 207uguaaacauc cucgacugga ag
2220821RNAHomo sapiens 208aggcaagaug cuggcauagc u
2120921RNAHomo sapiens
209agcuacaucu ggcuacuggg u
2121023RNAHomo sapiens 210caaagugcuu acagugcagg uag
2321122RNAHomo sapiens 211acugcaguga aggcacuugu ag
2221222RNAHomo sapiens
212uaauacugcc ugguaaugau ga
2221323RNAHomo sapiens 213uaauacugcc ggguaaugau gga
2321421RNAHomo sapiens 214ucacagugaa ccggucucuu u
2121523RNAHomo sapiens
215uagcagcggg aacaguucug cag
2321622RNAHomo sapiens 216cagcagcaau ucauguuuug aa
2221721RNAHomo sapiens 217uagcagcaca gaaauauugg c
2121822RNAHomo sapiens
218aggcauugac uucucacuag cu
2221922RNAHomo sapiens 219gugaaauguu uaggaccacu ag
2222022RNAHomo sapiens 220acaguagucu gcacauuggu ua
2222123RNAHomo sapiens
221cccaguguuc agacuaccug uuc
2322222RNAHomo sapiens 222acaguagucu gcacauuggu ua
2222323RNAHomo sapiens 223caaagugcug uucgugcagg uag
2322422RNAHomo sapiens
224ugagguagua aguuguauug uu
2222524RNAHomo sapiens 225ucccugagac ccuuuaaccu guga
2422622RNAHomo sapiens 226uuuggucccc uucaaccagc ug
2222722RNAHomo sapiens
227uuuggucccc uucaaccagc ua
2222822RNAHomo sapiens 228ucguaccgug aguaauaaug cg
2222922RNAHomo sapiens 229uguaacagca acuccaugug ga
2223023RNAHomo sapiens
230ugucugcccg caugccugcc ucu
2323122RNAHomo sapiens 231uagcagcaca ucaugguuua ca
2223222RNAHomo sapiens 232uccagcauca gugauuuugu ug
2223322RNAHomo sapiens
233uccuucauuc caccggaguc ug
2223422RNAHomo sapiens 234ucaccagccc uguguucccu ag
2223523RNAHomo sapiens 235aaggagcuua caaucuagcu ggg
2323622RNAHomo sapiens
236uggcagugua uuguuagcug gu
2223722RNAHomo sapiens 237acuggacuua gggucagaag gc
2223822RNAHomo sapiens 238uuauaaagca augagacuga uu
2223923RNAHomo sapiens
239uaaaucccau ggugccuucu ccu
2324022RNAHomo sapiens 240aaaaugguuc ccuuuagagu gu
2224122RNAHomo sapiens 241aggcggggcg ccgcgggacc gc
2224222RNAHomo sapiens
242cagugcaaug uuaaaagggc au
2224322RNAHomo sapiens 243cagugcaaug augaaagggc au
2224422RNAHomo sapiens 244ucuucucugu uuuggccaug ug
2224520RNAHomo sapiens
245guccgcucgg cgguggccca
2024623RNAHomo sapiens 246aucgcugcgg uugcgagcgc ugu
2324722RNAHomo sapiens 247uggugggccg cagaacaugu gc
2224822RNAHomo sapiens
248uucccuuugu cauccuaugc cu
2224921RNAHomo sapiens 249caagucacua gugguuccgu u
2125022RNAHomo sapiens 250agucauugga ggguuugagc ag
2225122RNAHomo sapiens
251uggaguguga caaugguguu ug
2225222RNAHomo sapiens 252uaugugggau gguaaaccgc uu
2225322RNAHomo sapiens 253ugguuuaccg ucccacauac au
2225422RNAHomo sapiens
254aacccguaga uccgaacuug ug
2225523RNAHomo sapiens 255agcugguguu gugaaucagg ccg
2325622RNAHomo sapiens 256cagugguuuu acccuauggu ag
2225722RNAHomo sapiens
257uuuguucguu cggcucgcgu ga
2225823RNAHomo sapiens 258uacugcauca ggaacugauu gga
2325923RNAHomo sapiens 259aaagugcugc gacauuugag cgu
2326023RNAHomo sapiens
260uuuggcacua gcacauuuuu gcu
2326122RNAHomo sapiens 261ucggauccgu cugagcuugg cu
2226223RNAHomo sapiens 262uauggcuuuu cauuccuaug uga
2326321RNAHomo sapiens
263uacaguacug ugauaacuga a
2126420RNAHomo sapiens 264ccucugggcc cuuccuccag
2026523RNAHomo sapiens 265cgcauccccu agggcauugg ugu
2326620RNAHomo sapiens
266acugccccag gugcugcugg
2026723RNAHomo sapiens 267ucaagagcaa uaacgaaaaa ugu
2326822RNAHomo sapiens 268uaacacuguc ugguaaagau gg
2226978RNAHomo sapiens
269cuuucuacac agguugggau cgguugcaau gcuguguuuc uguaugguau ugcacuuguc
60ccggccuguu gaguuugg
7827075RNAHomo sapiens 270ucaucccugg guggggauuu guugcauuac uuguguucua
uauaaaguau ugcacuuguc 60ccggccugug gaaga
7527172RNAHomo sapiens 271ugucggguag cuuaucagac
ugauguugac uguugaaucu cauggcaaca ccagucgaug 60ggcugucuga ca
7227277RNAHomo sapiens
272guggccucgu ucaaguaauc caggauaggc ugugcagguc ccaaugggcc uauucuuggu
60uacuugcacg gggacgc
7727384RNAHomo sapiens 273ggcuguggcu ggauucaagu aauccaggau aggcuguuuc
caucugugag gccuauucuu 60gauuacuugu uucuggaggc agcu
8427471RNAHomo sapiens 274uguucuaagg ugcaucuagu
gcagauagug aaguagauua gcaucuacug cccuaagugc 60uccuucuggc a
7127587RNAHomo sapiens
275ugagggcccc ucugcguguu cacagcggac cuugauuuaa ugucuauaca auuaaggcac
60gcggugaaug ccaagagagg cgccucc
8727685RNAHomo sapiens 276aggccucucu cuccguguuc acagcggacc uugauuuaaa
uguccauaca auuaaggcac 60gcggugaaug ccaagaaugg ggcug
85277109RNAHomo sapiens 277aucaagauua gaggcucugc
ucuccguguu cacagcggac cuugauuuaa ugucauacaa 60uuaaggcacg cggugaaugc
caagagcgga gccuacggcu gcacuugaa 10927881RNAHomo sapiens
278cccauuggca uaaacccgua gauccgaucu uguggugaag uggaccgcac aagcucgcuu
60cuaugggucu gugucagugu g
8127989RNAHomo sapiens 279accaugcugu agugugugua aacauccuac acucucagcu
gugagcucaa gguggcuggg 60agaggguugu uuacuccuuc ugccaugga
8928072RNAHomo sapiens 280agauacugua aacauccuac
acucucagcu guggaaagua agaaagcugg gagaaggcug 60uuuacucuuu cu
7228186RNAHomo sapiens
281acugcuaacg aaugcucuga cuuuauugca cuacuguacu uuacagcuag cagugcaaua
60guauugucaa agcaucugaa agcagg
8628288RNAHomo sapiens 282caccuugucc ucacggucca guuuucccag gaaucccuua
gaugcuaaga uggggauucc 60uggaaauacu guucuugagg ucaugguu
88283106RNAHomo sapiens 283gcgcagcgcc cugucuccca
gccugaggug cagugcugca ucucugguca guugggaguc 60ugagaugaag cacuguagcu
caggaagaga gaaguuguuc ugcagc 10628469RNAHomo sapiens
284gggauacuca aaaugggggc gcuuuccuuu uugucuguac ugggaagugc uucgauuuug
60ggguguccc
6928569RNAHomo sapiens 285aguaccaaag ugcucauagu gcagguaguu uuggcaugac
ucuacuguag uaugggcacu 60uccaguacu
6928688RNAHomo sapiens 286aucucuuaca caggcugacc
gauuucuccu gguguucaga gucuguuuuu gucuagcacc 60auuugaaauc gguuaugaug
uaggggga 8828781RNAHomo sapiens
287cuucaggaag cugguuucau auggugguuu agauuuaaau agugauuguc uagcaccauu
60ugaaaucagu guucuugggg g
8128881RNAHomo sapiens 288cuucuggaag cugguuucac augguggcuu agauuuuucc
aucuuuguau cuagcaccau 60uugaaaucag uguuuuagga g
8128984RNAHomo sapiens 289aggcugaggu aguaguuugu
acaguuugag ggucuaugau accacccggu acaggagaua 60acuguacagg ccacugccuu
gcca 8429080RNAHomo sapiens
290ugggaugagg uaguagguug uauaguuuua gggucacacc caccacuggg agauaacuau
60acaaucuacu gucuuuccua
8029172RNAHomo sapiens 291agguugaggu aguagguugu auaguuuaga auuacaucaa
gggagauaac uguacagccu 60ccuagcuuuc cu
7229274RNAHomo sapiens 292gggugaggua guagguugua
uaguuugggg cucugcccug cuaugggaua acuauacaau 60cuacugucuu uccu
7429383RNAHomo sapiens
293cggggugagg uaguagguug ugugguuuca gggcagugau guugccccuc ggaagauaac
60uauacaaccu acugccuucc cug
83294119RNAHomo sapiens 294aggauucugc ucaugccagg gugagguagu aaguuguauu
guuguggggu agggauauua 60ggccccaauu agaagauaac uauacaacuu acuacuuucc
cuggugugug gcauauuca 11929571RNAHomo sapiens 295gcgacuguaa acauccucga
cuggaagcug ugaagccaca gaugggcuuu cagucggaug 60uuugcagcug c
7129684RNAHomo sapiens
296gucagaauaa ugucaaagug cuuacagugc agguagugau augugcaucu acugcaguga
60aggcacuugu agcauuaugg ugac
8429771RNAHomo sapiens 297ugggaaacau acuucuuuau augcccauau ggaccugcua
agcuauggaa uguaaagaag 60uauguaucuc a
7129885RNAHomo sapiens 298accuacucag aguacauacu
ucuuuaugua cccauaugaa cauacaaugc uauggaaugu 60aaagaaguau guauuuuugg
uaggc 85299110RNAHomo sapiens
299gccgagaccg agugcacagg gcucugaccu augaauugac agccagugcu cucgucuccc
60cucuggcugc caauuccaua ggucacaggu auguucgccu caaugccagc
11030065RNAHomo sapiens 300cuguuaaugc uaaucgugau agggguuuuu gccuccaacu
gacuccuaca uauuagcauu 60aacag
6530190RNAHomo sapiens 301ucucaggcug ugaccuucuc
gaggaaagaa gcacuuucug uugucugaaa gaaaagaaag 60ugcuuccuuu cagaggguua
cgguuugaga 9030290RNAHomo sapiens
302ucucagguug ugaccuucuc gaggaaagaa gcacuuucug uugucugaaa gaaaagaaag
60ugcuuccuuu cagaggguua cgguuugaga
9030371RNAHomo sapiens 303ggagaggagg caagaugcug gcauagcugu ugaacuggga
accugcuaug ccaacauauu 60gccaucuuuc c
71304110RNAHomo sapiens 304ugaguuuuga gguugcuuca
gugaacauuc aacgcugucg gugaguuugg aauuaaaauc 60aaaaccaucg accguugauu
guacccuaug gcuaaccauc aucuacucca 110305110RNAHomo sapiens
305agaagggcua ucaggccagc cuucagagga cuccaaggaa cauucaacgc ugucggugag
60uuugggauuu gaaaaaacca cugaccguug acuguaccuu gggguccuua
110306110RNAHomo sapiens 306ccugugcaga gauuauuuuu uaaaagguca caaucaacau
ucauugcugu cgguggguug 60aacugugugg acaagcucac ugaacaauga augcaacugu
ggccccgcuu 11030789RNAHomo sapiens 307cugauggcug cacucaacau
ucauugcugu cgguggguuu gagucugaau caacucacug 60aucaaugaau gcaaacugcg
gaccaaaca 89308110RNAHomo sapiens
308cggaaaauuu gccaaggguu ugggggaaca uucaaccugu cggugaguuu gggcagcuca
60ggcaaaccau cgaccguuga guggacccug aggccuggaa uugccauccu
11030977RNAHomo sapiens 309agucuaguua cuaggcagug uaguuagcug auugcuaaua
guaccaauca cuaaccacac 60ggccagguaa aaagauu
7731084RNAHomo sapiens 310gugcucgguu uguaggcagu
gucauuagcu gauuguacug uggugguuac aaucacuaac 60uccacugcca ucaaaacaag
gcac 8431178RNAHomo sapiens
311uacugcccuc ggcuucuuua cagugcugcc uuguugcaua uggaucaagc agcauuguac
60agggcuauga aggcauug
7831278RNAHomo sapiens 312uugugcuuuc agcuucuuua cagugcugcc uuguagcauu
caggucaagc agcauuguac 60agggcuauga aagaacca
78313110RNAHomo sapiens 313acccggcagu gccuccaggc
gcagggcagc cccugcccac cgcacacugc gcugccccag 60acccacugug cgugugacag
cggcugaucu gugccugggc agcgcgaccc 11031489RNAHomo sapiens
314gucagcagug ccuuagcagc acguaaauau uggcguuaag auucuaaaau uaucuccagu
60auuaacugug cugcugaagu aagguugac
8931581RNAHomo sapiens 315guuccacucu agcagcacgu aaauauuggc guagugaaau
auauauuaaa caccaauauu 60acugugcugc uuuaguguga c
8131671RNAHomo sapiens 316gcgacuguaa acauccucga
cuggaagcug ugaagccaca gaugggcuuu cagucggaug 60uuugcagcug c
7131771RNAHomo sapiens
317ggagaggagg caagaugcug gcauagcugu ugaacuggga accugcuaug ccaacauauu
60gccaucuuuc c
71318110RNAHomo sapiens 318gcugcuggaa gguguaggua cccucaaugg cucaguagcc
aguguagauc cugucuuucg 60uaaucagcag cuacaucugg cuacuggguc ucugauggca
ucuucuagcu 11031984RNAHomo sapiens 319gucagaauaa ugucaaagug
cuuacagugc agguagugau augugcaucu acugcaguga 60aggcacuugu agcauuaugg
ugac 8432084RNAHomo sapiens
320gucagaauaa ugucaaagug cuuacagugc agguagugau augugcaucu acugcaguga
60aggcacuugu agcauuaugg ugac
8432195RNAHomo sapiens 321ccagcucggg cagccguggc caucuuacug ggcagcauug
gauggaguca ggucucuaau 60acugccuggu aaugaugacg gcggagcccu gcacg
9532268RNAHomo sapiens 322cccucgucuu acccagcagu
guuugggugc gguugggagu cucuaauacu gccggguaau 60gauggagg
6832382RNAHomo sapiens
323ugagcuguug gauucggggc cguagcacug ucugagaggu uuacauuucu cacagugaac
60cggucucuuu uucagcugcu uc
8232484RNAHomo sapiens 324ugugcagugg gaaggggggc cgauacacug uacgagagug
aguagcaggu cucacaguga 60accggucucu uucccuacug uguc
8432571RNAHomo sapiens 325ugcccuagca gcgggaacag
uucugcagug agcgaucggu gcucuggggu auuguuuccg 60cugccagggu a
7132698RNAHomo sapiens
326cgaggggaua cagcagcaau ucauguuuug aaguguucua aaugguucaa aacgugaggc
60gcugcuauac ccccucgugg ggaagguaga aggugggg
9832787RNAHomo sapiens 327agcuucccug gcucuagcag cacagaaaua uuggcacagg
gaagcgaguc ugccaauauu 60ggcugugcug cuccaggcag gguggug
87328119RNAHomo sapiens 328agucagccug uugaagcuuu
gaagcuuuga ugccaggcau ugacuucuca cuagcuguga 60aaguccuagc uaaagagaag
ucaaugcaug acaucuuguu ucaauagaug gcuguuuca 119329110RNAHomo sapiens
329guguugggga cucgcgcgcu ggguccagug guucuuaaca guucaacagu ucuguagcgc
60aauugugaaa uguuuaggac cacuagaccc ggcgggcgcg gcgacagcga
11033071RNAHomo sapiens 330gccaacccag uguucagacu accuguucag gaggcucuca
auguguacag uagucugcac 60auugguuagg c
7133171RNAHomo sapiens 331gccaacccag uguucagacu
accuguucag gaggcucuca auguguacag uagucugcac 60auugguuagg c
71332110RNAHomo sapiens
332ccagaggaca ccuccacucc gucuacccag uguuuagacu aucuguucag gacucccaaa
60uuguacagua gucugcacau ugguuaggcu gggcuggguu agacccucgg
11033380RNAHomo sapiens 333cugggggcuc caaagugcug uucgugcagg uagugugauu
acccaaccua cugcugagcu 60agcacuuccc gagcccccgg
80334119RNAHomo sapiens 334aggauucugc ucaugccagg
gugagguagu aaguuguauu guuguggggu agggauauua 60ggccccaauu agaagauaac
uauacaacuu acuacuuucc cuggugugug gcauauuca 11933586RNAHomo sapiens
335ugccagucuc uaggucccug agacccuuua accugugagg acauccaggg ucacagguga
60gguucuuggg agccuggcgu cuggcc
8633688RNAHomo sapiens 336acaaugcuuu gcuagagcug guaaaaugga accaaaucgc
cucuucaaug gauuuggucc 60ccuucaacca gcuguagcua ugcauuga
88337102RNAHomo sapiens 337gggagccaaa ugcuuugcua
gagcugguaa aauggaacca aaucgacugu ccaauggauu 60ugguccccuu caaccagcug
uagcugugca uugauggcgc cg 102338119RNAHomo sapiens
338ccucagaaga aagaugcccc cugcucuggc uggucaaacg gaaccaaguc cgucuuccug
60agagguuugg uccccuucaa ccagcuacag cagggcuggc aaugcccagu ccuuggaga
11933985RNAHomo sapiens 339cgcuggcgac gggacauuau uacuuuuggu acgcgcugug
acacuucaaa cucguaccgu 60gaguaauaau gcgccgucca cggca
8534085RNAHomo sapiens 340augguguuau caaguguaac
agcaacucca uguggacugu guaccaauuu ccaguggaga 60ugcuguuacu uuugaugguu
accaa 8534185RNAHomo sapiens
341ugguucccgc ccccuguaac agcaacucca uguggaagug cccacugguu ccaguggggc
60ugcuguuauc uggggcgagg gccag
8534295RNAHomo sapiens 342ggucucugug uugggcgucu gucugcccgc augccugccu
cucuguugcu cugaaggagg 60caggggcugg gccugcagcu gccugggcag agcgg
9534398RNAHomo sapiens 343uugaggccuu aaaguacugu
agcagcacau caugguuuac augcuacagu caagaugcga 60aucauuauuu gcugcucuag
aaauuuaagg aaauucau 9834467RNAHomo sapiens
344ucuccaacaa uauccuggug cugagugaug acucaggcga cuccagcauc agugauuuug
60uugaaga
67345110RNAHomo sapiens 345aaagauccuc agacaaucca ugugcuucuc uuguccuuca
uuccaccgga gucugucuca 60uacccaacca gauuucagug gagugaaguu caggaggcau
ggagcugaca 11034675RNAHomo sapiens 346gugagggcau gcaggccugg
auggggcagc ugggaugguc caaaagggug gccucaccag 60cccuguguuc ccuag
7534788RNAHomo sapiens
347aacugcccuc aaggagcuua caaucuagcu ggggguaaau gacuugcaca ugaacacaac
60uagacuguga gcuucuagag ggcaggga
8834891RNAHomo sapiens 348cuguguguga ugagcuggca guguauuguu agcugguuga
auaugugaau ggcaucggcu 60aacaugcaac ugcugucuua uugcauauac a
9134990RNAHomo sapiens 349gagagaagca cuggacuuag
ggucagaagg ccugagucuc ucugcugcag augggcucuc 60ugucccugag ccaagcuuug
uccucccugg 9035095RNAHomo sapiens
350uuguaccugg ugugauuaua aagcaaugag acugauuguc auaugucguu ugugggaucc
60gucucaguua cuuuauagcc auaccuggua ucuua
9535183RNAHomo sapiens 351gcccuagcuu gguucuaaau cccauggugc cuucuccuug
ggaaaaacag agaaggcacu 60augagauuua gaaucaaguu agg
8335287RNAHomo sapiens 352ucucaggcug ugucccucua
gagggaagcg cuuucuguug ucugaaagaa aagaaaaugg 60uucccuuuag aguguuacgc
uuugaga 8735393RNAHomo sapiens
353ccuuccggcg ucccaggcgg ggcgccgcgg gaccgcccuc gugucugugg cggugggauc
60ccgcggccgu guuuuccugg uggcccggcc aug
9335489RNAHomo sapiens 354ugcugcuggc cagagcucuu uucacauugu gcuacugucu
gcaccuguca cuagcagugc 60aauguuaaaa gggcauuggc cguguagug
8935582RNAHomo sapiens 355ggccugcccg acacucuuuc
ccuguugcac uacuauaggc cgcugggaag cagugcaaug 60augaaagggc aucggucagg
uc 8235686RNAHomo sapiens
356auuaggagag uaucuucucu guuuuggcca uguguguacu cacagccccu cacacauggc
60cgaaacagag aaguuacuuu ccuaau
8635795RNAHomo sapiens 357gucgaggccg uggcccggaa guggucgggg ccgcugcggg
cggaagggcg ccugugcuuc 60guccgcucgg cgguggccca gccaggcccg cggga
9535898RNAHomo sapiens 358uggccgacgg ggcgcgcgcg
gccuggaggg gcggggcgga cgcagagccg cguuuagucu 60aucgcugcgg uugcgagcgc
uguagggagc cugugcug 9835981RNAHomo sapiens
359ggguaagugg aaagauggug ggccgcagaa caugugcuga guucgugcca uaugucugcu
60gaccaucacc uuuagaagcc c
81360110RNAHomo sapiens 360ggcuacaguc uuucuucaug ugacucgugg acuucccuuu
gucauccuau gccugagaau 60auaugaagga ggcugggaag gcaaagggac guucaauugu
caucacuggc 11036181RNAHomo sapiens 361gggcuuucaa gucacuagug
guuccguuua guagaugauu gugcauuguu ucaaaauggu 60gcccuaguga cuacaaagcc c
8136297RNAHomo sapiens
362uuagguaauu ccuccacuca aaacccuuca gugacuucca ugacaugaaa uaggaaguca
60uuggaggguu ugagcagagg aaugaccugu uuuaaaa
9736385RNAHomo sapiens 363ccuuagcaga gcuguggagu gugacaaugg uguuuguguc
uaaacuauca aacgccauua 60ucacacuaaa uagcuacugc uaggc
8536463RNAHomo sapiens 364aagaaauggu uuaccguccc
acauacauuu ugaauaugua ugugggaugg uaaaccgcuu 60cuu
6336580RNAHomo sapiens
365ccuguugcca caaacccgua gauccgaacu ugugguauua guccgcacaa gcuuguaucu
60auagguaugu gucuguuagg
8036699RNAHomo sapiens 366cccuggcaug gugugguggg gcagcuggug uugugaauca
ggccguugcc aaucagagaa 60cggcuacuuc acaacaccag ggccacacca cacuacagg
99367100RNAHomo sapiens 367ugugucucuc ucuguguccu
gccagugguu uuacccuaug guagguuacg ucaugcuguu 60cuaccacagg guagaaccac
ggacaggaua ccggggcacc 10036864RNAHomo sapiens
368ccccgcgacg agccccucgc acaaaccgga ccugagcguu uuguucguuc ggcucgcgug
60aggc
64369110RNAHomo sapiens 369aguauaauua uuacauaguu uuugaugucg cagauacugc
aucaggaacu gauuggauaa 60gaaucaguca ccaucaguuc cuaaugcauu gccuucagca
ucuaaacaag 11037067RNAHomo sapiens 370gugggccuca aauguggagc
acuauucuga uguccaagug gaaagugcug cgacauuuga 60gcgucac
6737178RNAHomo sapiens
371uggccgauuu uggcacuagc acauuuuugc uugugucucu ccgcucugag caaucaugug
60cagugccaau augggaaa
7837297RNAHomo sapiens 372ugugaucacu gucuccagcc ugcugaagcu cagagggcuc
ugauucagaa agaucaucgg 60auccgucuga gcuuggcugg ucggaagucu caucauc
9737397RNAHomo sapiens 373cacucugcug uggccuaugg
cuuuucauuc cuaugugauu gcugucccaa acucauguag 60ggcuaaaagc caugggcuac
agugaggggc gagcucc 9737475RNAHomo sapiens
374ugcccuggcu caguuaucac agugcugaug cugucuauuc uaaagguaca guacugugau
60aacugaagga uggca
7537579RNAHomo sapiens 375acuguccuuu uucgguuauc augguaccga ugcuguauau
cugaaaggua caguacugug 60auaacugaag aaugguggu
7937695RNAHomo sapiens 376cucaucuguc uguugggcug
gaggcagggc cuuugugaag gcggguggug cucagaucgc 60cucugggccc uuccuccagc
cccgaggcgg auuca 9537783RNAHomo sapiens
377cugacuaugc cuccccgcau ccccuagggc auugguguaa agcuggagac ccacugcccc
60aggugcugcu ggggguugua guc
8337883RNAHomo sapiens 378cugacuaugc cuccccgcau ccccuagggc auugguguaa
agcuggagac ccacugcccc 60aggugcugcu ggggguugua guc
8337994RNAHomo sapiens 379uguuuugagc gggggucaag
agcaauaacg aaaaauguuu gucauaaacc guuuuucauu 60auugcuccug accuccucuc
auuugcuaua uuca 9438095RNAHomo sapiens
380cggccggccc uggguccauc uuccaguaca guguuggaug gucuaauugu gaagcuccua
60acacugucug guaaagaugg cucccgggug gguuc
9538117RNAHomo sapiens 381gugggggaga ggcuguc
1738222RNAHomo sapiens 382ugcaacgaac cugagccacu ga
2238322RNAHomo sapiens
383uagguuaucc guguugccuu cg
2238421RNAHomo sapiens 384gugccagcug caguggggga g
2138520RNAHomo sapiens 385guccgcucgg cgguggccca
2038623RNAHomo sapiens
386ccaguuaccg cuuccgcuac cgc
2338717RNAHomo sapiens 387acauugccag ggaguuu
1738822RNAHomo sapiens 388uugcauaguc acaaaaguga uc
2238917RNAHomo sapiens
389uugucugcug aguuucc
1739023RNAHomo sapiens 390agguuacccg agcaacuuug cau
2339122RNAHomo sapiens 391ugggucuuug cgggcgagau ga
2239219RNAHomo sapiens
392aagugugcag ggcacuggu
1939322RNAHomo sapiens 393uaaugccccu aaaaauccuu au
2239423RNAHomo sapiens 394uaauccuugc uaccugggug aga
2339522RNAHomo sapiens
395aguggggaac ccuuccauga gg
2239622RNAHomo sapiens 396acaguagucu gcacauuggu ua
2239722RNAHomo sapiens 397acaguagucu gcacauuggu ua
2239823RNAHomo sapiens
398cccaguguuc agacuaccug uuc
2339923RNAHomo sapiens 399cccaguguuc agacuaccug uuc
2340021RNAHomo sapiens 400auuugugcuu ggcucuguca c
2140123RNAHomo sapiens
401aaagugcugc gacauuugag cgu
2340223RNAHomo sapiens 402gaagugcuuc gauuuugggg ugu
2340322RNAHomo sapiens 403ucuucucugu uuuggccaug ug
2240422RNAHomo sapiens
404uggguggucu ggagauuugu gc
2240523RNAHomo sapiens 405uaaggugcau cuagugcaga uag
2340623RNAHomo sapiens 406gagggucuug ggagggaugu gac
2340721RNAHomo sapiens
407agaggauacc cuuuguaugu u
2140820RNAHomo sapiens 408uaaagagccc uguggagaca
2040922RNAHomo sapiens 409aacuggcccu caaagucccg cu
2241020RNAHomo sapiens
410cuuccucguc ugucugcccc
2041121RNAHomo sapiens 411uuaauaucgg acaaccauug u
2141222RNAHomo sapiens 412gccugcuggg guggaaccug gu
2241322RNAHomo sapiens
413caaaaaccac aguuucuuuu gc
2241480RNAHomo sapiens 414ccucugugag aaagggugug ggggagaggc ugucuugugu
cuguaaguau gccaaacuua 60uuuuccccaa ggcagaggga
8041579RNAHomo sapiens 415ccuuaauccu ugcaacgaac
cugagccacu gauucaguaa aauacucagu ggcacauguu 60uguugugagg gucaaaaga
7941684RNAHomo sapiens
416gugguacuug aagauagguu auccguguug ccuucgcuuu auuugugacg aaucauacac
60gguugaccua uuuuucagua ccaa
8441783RNAHomo sapiens 417ccugcugcag aggugccagc ugcagugggg gaggcacugc
cagggcugcc cacucugcuu 60agccagcagg ugccaagaac agg
8341895RNAHomo sapiens 418gucgaggccg uggcccggaa
guggucgggg ccgcugcggg cggaagggcg ccugugcuuc 60guccgcucgg cgguggccca
gccaggcccg cggga 9541991RNAHomo sapiens
419ggcgggggcg cgggcggcag uggcgggagc ggccccucgg ccauccuccg ucugcccagu
60uaccgcuucc gcuaccgccg ccgcucccgc u
9142065RNAHomo sapiens 420aaaaggcgag acauugccag ggaguuuauu uuguagcucu
cuugauaaaa uguuuuagca 60aacac
6542190RNAHomo sapiens 421cucacagcug ccagugucau
uuuugugauc ugcagcuagu auucucacuc caguugcaua 60gucacaaaag ugaucauugg
cagguguggc 9042287RNAHomo sapiens
422agcgguggcc agugucauuu uugugauguu gcagcuagua auaugagccc aguugcauag
60ucacaaaagu gaucauugga aacugug
8742367RNAHomo sapiens 423auggaggugg agagucauca gcagcacuga gcaggcagug
uugucugcug aguuuccacg 60ucauuug
6742479RNAHomo sapiens 424ugguacucgg ggagagguua
cccgagcaac uuugcaucug gacgacgaau guugcucggu 60gaaccccuuu ucgguauca
7942588RNAHomo sapiens
425cgaggauggg agcugagggc ugggucuuug cgggcgagau gagggugucg gaucaacugg
60ccuacaaagu cccaguucuc ggcccccg
8842694RNAHomo sapiens 426aucacagaca ccuccaagug ugcagggcac uggugggggc
cggggcaggc ccagcgaaag 60ugcaggaccu ggcacuuagu cggaagugag ggug
9442787RNAHomo sapiens 427accgcaggga aaaugaggga
cuuuuggggg cagauguguu uccauuccac uaucauaaug 60ccccuaaaaa uccuuauugc
ucuugca 8742884RNAHomo sapiens
428gcucccccuc ucuaauccuu gcuaccuggg ugagagugcu gucugaaugc aaugcaccug
60ggcaaggauu cugagagcga gagc
8442984RNAHomo sapiens 429uugacuuagc uggguagugg ggaacccuuc caugaggagu
agaacacucc uuaugcaaga 60uucccuucua ccuggcuggg uugg
8443071RNAHomo sapiens 430gccaacccag uguucagacu
accuguucag gaggcucuca auguguacag uagucugcac 60auugguuagg c
71431110RNAHomo sapiens
431aggaagcuuc uggagauccu gcuccgucgc cccaguguuc agacuaccug uucaggacaa
60ugccguugua caguagucug cacauugguu agacugggca agggagagca
11043271RNAHomo sapiens 432gccaacccag uguucagacu accuguucag gaggcucuca
auguguacag uagucugcac 60auugguuagg c
71433110RNAHomo sapiens 433aggaagcuuc uggagauccu
gcuccgucgc cccaguguuc agacuaccug uucaggacaa 60ugccguugua caguagucug
cacauugguu agacugggca agggagagca 11043491RNAHomo sapiens
434uuuucaaagc aaugugugac agguacaggg acaaaucccg uuaauaagua agaggauuug
60ugcuuggcuc ugucacaugc cacuuugaaa a
9143567RNAHomo sapiens 435gugggccuca aauguggagc acuauucuga uguccaagug
gaaagugcug cgacauuuga 60gcgucac
6743669RNAHomo sapiens 436gggauacuca aaaugggggc
gcuuuccuuu uugucuguac ugggaagugc uucgauuuug 60ggguguccc
6943786RNAHomo sapiens
437auuaggagag uaucuucucu guuuuggcca uguguguacu cacagccccu cacacauggc
60cgaaacagag aaguuacuuu ccuaau
8643871RNAHomo sapiens 438agguuguucu ggguggucug gagauuugug cagcuuguac
cugcacaaau cuccggacca 60cuuagucuuu a
7143971RNAHomo sapiens 439uguucuaagg ugcaucuagu
gcagauagug aaguagauua gcaucuacug cccuaagugc 60uccuucuggc a
7144097RNAHomo sapiens
440gggacuuguc acugccuguc uccucccucu ccagcagcga cuggauucug gaguccaucu
60agagggucuu gggagggaug ugacuguugg gaagccc
9744186RNAHomo sapiens 441uuugguacuu gaagagagga uacccuuugu auguucacuu
gauuaauggc gaauauacag 60ggggagacuc uuauuugcgu aucaaa
8644286RNAHomo sapiens 442uuugguacuu aaagagagga
uacccuuugu auguucacuu gauuaauggc gaauauacag 60ggggagacuc ucauuugcgu
aucaaa 8644383RNAHomo sapiens
443ccccagcuag guaaagagcc cuguggagac accuggauuc agagaacaug ucuccacuga
60gcacuugggc cuugauggcg gcu
8344483RNAHomo sapiens 444guggucucag aaucgggguu uugagggcga gaugaguuua
uguuuuaucc aacuggcccu 60caaagucccg cuuuuggggu cau
8344583RNAHomo sapiens 445gugaguggga gccccagugu
gugguugggg ccauggcggg ugggcagccc agccucugag 60ccuuccucgu cugucugccc
cag 8344679RNAHomo sapiens
446gugcuuaaag aauggcuguc cguaguaugg ucucuauauu uaugaugauu aauaucggac
60aaccauuguu uuaguaucc
7944775RNAHomo sapiens 447agacagagaa gccaggucac gucucugcag uuacacagcu
cacgagugcc ugcuggggug 60gaaccugguc ugucu
7544897RNAHomo sapiens 448aaacaaguua uauuagguug
gugcaaaagu aauugugguu uuugccugua aaaguaaugg 60caaaaaccac aguuucuuuu
gcaccagacu aauaaag 9744922RNAHomo sapiens
449acuuuaacau ggaagugcuu uc
2245023RNAHomo sapiens 450aagugccgcc aucuuuugag ugu
2345122RNAHomo sapiens 451ugugacuggu ugaccagagg gg
2245221RNAHomo sapiens
452ugauugucca aacgcaauuc u
2145322RNAHomo sapiens 453uagguuaucc guguugccuu cg
2245423RNAHomo sapiens 454uuaaugcuaa ucgugauagg ggu
2345522RNAHomo sapiens
455uauugcacau uacuaaguug ca
2245621RNAHomo sapiens 456gugcauugua guugcauugc a
2145721RNAHomo sapiens 457cauuauuacu uuugguacgc g
2145822RNAHomo sapiens
458ucggauccgu cugagcuugg cu
2245922RNAHomo sapiens 459uaacagucua cagccauggu cg
2246023RNAHomo sapiens 460uuauugcuua agaauacgcg uag
2346123RNAHomo sapiens
461uacccuguag aaccgaauuu gug
2346223RNAHomo sapiens 462uguaguguuu ccuacuuuau gga
2346322RNAHomo sapiens 463ucccugagac ccuaacuugu ga
2246422RNAHomo sapiens
464uugcauaguc acaaaaguga uc
2246523RNAHomo sapiens 465aacauucaac gcugucggug agu
2346622RNAHomo sapiens 466ugagguagua gguuguauag uu
2246722RNAHomo sapiens
467ugagguagua gguugugugg uu
2246821RNAHomo sapiens 468aacauagagg aaauuccacg u
2146921RNAHomo sapiens 469uugugcuuga ucuaaccaug u
2147020RNAHomo sapiens
470uaaggcacgc ggugaaugcc
2047124RNAHomo sapiens 471ucccugagac ccuuuaaccu guga
2447223RNAHomo sapiens 472ucuuugguua ucuagcugua uga
2347323RNAHomo sapiens
473uaaagugcuu auagugcagg uag
2347422RNAHomo sapiens 474cagugcaaug uuaaaagggc au
2247523RNAHomo sapiens 475aaagugcugc gacauuugag cgu
2347622RNAHomo sapiens
476acucaaaaug ggggcgcuuu cc
2247722RNAHomo sapiens 477uaacacuguc ugguaaagau gg
2247823RNAHomo sapiens 478cccaguguuc agacuaccug uuc
2347923RNAHomo sapiens
479agcuacauug ucugcugggu uuc
2348022RNAHomo sapiens 480ugucaguuug ucaaauaccc ca
2248121DNAHomo sapiens 481aagactgcgt tcgaatccat a
21
User Contributions:
Comment about this patent or add new information about this topic: