Patent application title: METHOD FOR PRODUCING FRAGRANT ALCOHOLS
Inventors:
IPC8 Class: AC12P500FI
USPC Class:
Class name:
Publication date: 2022-02-24
Patent application number: 20220056485
Abstract:
This invention relates generally to methods and compositions for
producing a sesquiterpene alcohol comprising contacting a sesquiterpene
with a P450 polypeptide with monooxygenase activity.Claims:
1. A method of producing an sesquiterpene alcohol comprising: i)
contacting a terpene of Formula I: ##STR00002## with a polypeptide
comprising an amino acid sequence having at least 90% sequence identify
to a polypeptide selected from the group consisting of SEQ ID NO: 2, SEQ
ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 30, SEQ
ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40,
SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO:
54, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID
NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 79, and
SEQ ID NO: 81; and ii) optionally isolating the alcohol, wherein R is a
saturated, mono-unsaturated or poly-unsaturated aliphatic group composed
of 9 carbons and wherein R can be a branched chain or composed of one or
more non-aromatic rings.
2. The method of claim 1, wherein the alcohol comprises .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof.
3. A method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the sesquiterpene alcohol produced comprises at least about 36% of a cis isomer.
4. The method of claim 3, wherein the sesquiterpene alcohol produced comprises at least 46%, 50%, 72%, 96% or 100% of a cis isomer.
5. The method of claim 3, wherein the polypeptide comprises an amino acid sequence having at least 90%, 95%, 98%, or 100% sequence identity to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
6. The method of claim 4, wherein the polypeptide comprises an amino acid sequence having at least 90%, 95%, 98% or 100% sequence identity to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
7. An isolated polypeptide having monooxygenase activity comprising an amino acid sequence having at least 90%, 95%, 98% or 100% sequence identity to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 79, and SEQ ID NO: 81.
8. An isolated nucleic acid molecule comprising: i) the nucleic acid sequence of SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 78 or SEQ ID NO: 80; or ii) a nucleic acid molecule that encodes the polypeptide of claim 7.
9. A method for producing a polypeptide having P450 monoxygenase activity comprising transforming a host cell or non-human organism with the nucleic acid of claim 8; and culturing the host cell or organism under conditions that allow for the production of the polypeptide.
10. The method of claim 3 comprising i) cultivating an isolated cell under conditions suitable to produce a P450 polypeptide having monooxygenase activity, wherein the cell: a) produces a acyclic pyrophosphate terpene precursor; b) expresses a P450 reductase, c) expresses a polypeptide that has .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene synthase activity and that produces one ore more .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene, and d) expresses the polypeptide having P450 monooxygenase activity; and ii) optionally isolating the alcohol from the cell.
11. The method of claim 10, wherein the acyclic pyrophosphate terpene precursor is selected from the group consisting of geranyl-pyrophosphate (GPP), farnesyl-diphosphate (FPP) and geranylgeranyl-pyrophosphate (GGPP).
12. A vector comprising i) the nucleic acid molecule of claim 8; or ii) a nucleic acid encoding a polypeptide having a P450 monoxygenase activity comprising an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 78 or SEQ ID NO: 80.
13. The vector of claim 12, wherein the vector is a prokaryotic vector, viral vector or a eukaryotic vector.
14. The vector of claim 12, wherein the vector is an expression vector.
15. A host cell or non-human organism comprising the nucleic acid molecule of claim 8, or a vector comprising said nucleic acid molecule.
16. The method of claim 10, wherein the cell is a prokaryotic cell or a eukaryotic cell.
17. The method of claim 16, wherein the prokaryotic cell is a bacterial cell.
18. The method of claim 16, wherein the eukaryotic cell is a yeast cell or a plant cell.
19. The method of claim 1 comprising i) cultivating an isolated cell under conditions suitable to produce the polypeptide having P450 monooxygenase activity, wherein the cell: a) produces a acyclic pyrophosphate terpene precursor; b) expresses a P450 reductase, c) expresses a polypeptide that has .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene synthase activity and that produces one or more .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene, and d) expresses the polypeptide; and ii) optionally isolating the alcohol from the cell.
20. The method of claim 1, wherein step a) comprises cultivating a non-human host organism or cell capable of producing a acyclic pyrophosphate terpene precursor and transformed to express one or more of the polypeptide.
Description:
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent application Ser. No. 16/738,563 filed on Jan. 9, 2020, which is a continuation of U.S. patent application Ser. No. 15/877,183 filed on Jan. 22, 2018, now U.S. Pat. No. 10,570,420, which was a divisional of U.S. patent application Ser. No. 15/023,640, now U.S. Pat. No. 9,909,145, filed Mar. 21, 2016, which is a national stage application under 35 U.S.C. .sctn. 371 of International Patent Application PCT/EP2014/070060 filed on Sep. 19, 2014, which claims the benefit of U.S. provisional application 61/880,149, filed on Sep. 19, 2013. The entire contents of each of these applications are hereby incorporated by reference herein in their entirety.
SUBMISSION OF SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporated by reference into the specification in its entirety. The name of the text file containing the Sequence Listing is 9000US_DIV_SequenceListing. The size of the text file is 423 KB, and the text file was created on Jan. 16, 2018.
FIELD
[0003] The field relates to cytochrome P450s and uses to produce sesquiterpene alcohols.
BACKGROUND
[0004] Terpenes hydrocarbons such as alpha and beta santalenes have been produced via biochemical processes for example such as through genetically altered cells. These terpenes and the alcohol derived from them are major constituents of sandalwood oil and the alcohols are important perfumery ingredients typically obtained commercially through the distillation of the heartwood of Santalum species (e.g., Sandalwood). Examples of such alcohols include .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol and epi-.beta.-santalol. Although new biochemical pathways have been developed, including genetically engineered cells, to generate the terpene hydrocarbons, it is desirable to find a biochemical pathway to generate and produce the alcohols derived from the santalenes. It is further desirable to use a biochemical pathway to not only generate such alcohols but it is further desirable to selectively produce, via a biochemical pathway, cis-isomers of the alcohols such as iso-.alpha.-sinensol, iso-.beta.-sinensol, (Z)-.alpha.-santalol, (Z)-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (Z)-epi-.beta.-santalol.
[0005] Cytochrome P450s represent a family of enzymes of oxidases. P450s commonly catalyze a monooxygenase reaction. Cytochrome P450 enzymes are classified into families and subfamilies based on the amino acid sequences homology. Members of a same subfamily share over 55% amino acid sequence identity and have usually similar enzymatic activities (substrate and/or product selectivity). CYP71AV1 (NCBI accession No ABB82944.1, SEQ ID No. 51 and 52) and CYP71AV8 (NCBI accession No ADM86719.1, SEQ ID No. 1 and 2) are two members of the CYP71AV sub-family and shares 78% sequence identity. CYP71AV1 has previously been shown to oxidize amorphadiene (Teoh et al, FEBS letters 580 (2006) 1411-1416). CYP71AV8 has previously been shown to oxidize (+)-valencene, germacrene A and amorphadiene (Cankar et al, FEBS Lett. 585(1), 178-182 (2011)).
[0006] Processes using engineered cells have been reported that use terpene synthases to catalyze the production of a diterpene or sesquiterpene. The diterpenes or sesquiterpenes were further processed using a cytochromeP450 polypeptide to catalyze the hydroxylation, oxidation, demethylation or methylation of the diterpene or sesquiterpene produced by the cell.
SUMMARY
[0007] Provided herein is a method of producing an sesquiterpene alcohol comprising:
i) contacting a terpene of Formula I:
##STR00001##
with a polypeptide having an amino acid sequence having at least, or at least about, 45% of sequence identify to a polypeptide selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 79, and SEQ ID NO: 81; and ii) optionally isolating the alcohol wherein R is a saturated, mono-unsaturated or poly-unsaturated aliphatic group composed of 9 carbons and wherein R can be a branched chain or composed of one or more non-aromatic rings.
[0008] Further provided herein is a method of producing a sesquiterpene comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or or mixtures thereof comprising:
[0009] i) contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene, with a polypeptide having an amino acid sequence having at least, or at least about, 45% of sequence identify to a polypeptide selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 79, and SEQ ID NO: 81 to produce the alcohol; and
[0010] ii) optionally isolating the alcohol.
[0011] Also provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide having a P450 monooxygenase activity wherein the sesquiterpene alcohol produced comprises at least, or at least about, 36% of a cis isomer.
[0012] Further provided herein is an isolated polypeptide having monooxygenase activity comprising an amino acid sequence that is at least, or at least about 45%, 50%, 55%, 50%, 65%, 70%, 80%, 90%, 95%, 98% or more identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 71, and SEQ ID NO:73.
[0013] Further provided herein is an isolated polypeptide having monooxygenase activity comprising an amino acid sequence that is at least, or at least about 45%, 50%, 55%, 50%, 65%, 70%, 80%, 90%, 95%, 98% or more identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 79, and SEQ ID NO: 81.
[0014] Also provided herein is an isolated polypeptide having monooxygenase activity comprising an amino acid sequence selected from the group consisting of SEQ ID NO: SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO: 34, SEQ ID NO:36, SEQ ID NO:71, SEQ ID NO:73 SEQ ID NO: 79, and SEQ ID NO: 81.
[0015] Further provided herein is method of producing a sesquiterpene alcohol selected from the group consisting of .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, and lancelol or mixtures thereof:
[0016] i) cultivating a cell under conditions suitable to produce a p450 polypeptide having monooxygenase activity wherein the cell: a) produces a acylic pyrophosphate terpene precursor; b) expresses a P450 reductase, c) expresses a polypeptide that has .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, synthase activity and produces .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene and d) expresses a polypeptide with an amino acid sequence having at least, or at least about, 45% of sequence identify to a polypeptide selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 73 SEQ ID NO: 79, and SEQ ID NO: 81; and
[0017] ii) optionally isolating the alcohol from the cell.
DETAILED DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1. Amino acid sequence alignment of the N-terminal region of the different CYP71AV8 variants: CYP71AV8_wt (SEQ ID NO: 2), cyp71AV8-65188 (SEQ ID NO: 4), CYP71AV8-P2 (SEQ ID NO: 6), CYP71AV8-P20 (SEQ ID NO: 8).
[0019] FIG. 2A-D. Alignment of DNA sequences of the different CYP71AV8 variants: CYP71AV8_wt (SEQ ID NO: 1), cyp71AV8-65188 (SEQ ID NO: 3), CYP71AV8-P2 (SEQ ID NO: 5), CYP71AV8-P20 (SEQ ID NO: 6). The encoded amino acid sequences are shown below each sequence using the one-letter code.
[0020] FIG. 3. GCMS analysis of the conversion of sesquiterpenes by E. Coli cells expressing the CYP71AV8 and the CPRm proteins. A, Bioconversion of (+)-alpha-santalene. B, Bioconversion of a (+)-alpha-santalene/(-)-beta-santalene mixture.
[0021] FIG. 4. Organisation of the synthetic bi-cistronic operon containing a P450 and a CPR cDNA.
[0022] FIG. 5. Comparison of the bioconversion of (+)-.alpha.-santalene and the .alpha./.beta.-santalene mixture by E. coli cells transformed with different bi-cistronic operons composed of a P450 and a CPR cDNA. 1, CYP71AV8-65188 and aaCPR. 2, CYP71AV8-P2 and aaCPR. 3, CYP71AV8-P2O and aaCPR. 4, CYP71AV8-65188 and CPRm. 5, CYP71AV8-P2 and CPRm. 6, CYP71AV8-P2O and CPRm.
[0023] FIG. 6. GCMS analysis of the sesquiterpene molecules produced by E. Coli cells expressing CYP71AV8, CPRm, an alpha-santalene synthase (A) or a alpha-santalene/beta-santalene synthase (B), and mevalonate pathway enzymes. 1, (+)-.alpha.-santalene; 2 (-)-.alpha.-trans-bergamotene; 3, (+)-epi-.beta.-santalene; 4, (-)-.beta.-santalene.
[0024] FIG. 7. Oxidation of (+)-.alpha.-santalene by CYP71AV8 wild type (A) and mutant L-358 (B). GC-MS profiles of the sesquiterpene products generated by E. Coli KRX cells expressing CPRm, ClASS, the mevalonate pathway enzymes and CYP71AV8 (A) or CYP71AV8-L358F (B). The cultivations were performed in TB medium containing 3% glycerol as carbon source. The different products were identified as .alpha.-santalene (1), (E)-.alpha.-santalal (2), (Z)-.alpha.-santalol (4), and (E)-.alpha.-santalol (3).
[0025] FIG. 8. GC-MS profiles of the sesquiterpene products generated by E. Coli KRX cells expressing CPRm, SaSAS, the mevalonate pathway enzymes and CYP71AV8-L358F. The cultivations were performed in TB medium containing 3% glycerol as carbon source. The different products identified by their mass spectra are indicated.
[0026] FIG. 9. GCMS analysis of the conversion of (+)-.alpha.-santalene by E. Coli cells expressing the CYP71AV1 and the CPRm proteins.
[0027] FIG. 10: GC analysis of the in vivo conversion of (+)-.alpha.-santalene to (Z)-.alpha.-santalol by a P450-BM3 double-mutant (variant #17). Solvent extracts of cultures of recombinant E. coli cells co-expressing a Clausena lansium .alpha.-santalene synthase and either the wild-type P450-BM3 (A) or the P450-BM3 variant #17 (B) were analyzed as described in example 11. 1, (+)-.alpha.-santalene; 2, (-)-.alpha.-trans-bergamotene; 3, (Z)-.alpha.-santalol; The chromatograms are shown in selected ion mode (M/Z 93).
[0028] FIG. 11: GC analysis of the in vivo conversion of (+)-.alpha.-santalene, (-)-.beta.-santalene, .alpha.-trans-bergamotene and (+)-epi-.beta.-santalene by a P450-BM3 double-mutant. Solvent extracts of cultures of recombinant E. coli cells co-expressing an alpha-santalene/beta-santalene synthase from Santalum album and either the wild-type P450-BM3 (A) or the P450-BM3 variant #17 (B) were analyzed as described in example 11. 1, (+)-.alpha.-santalene; 2, (-)-.alpha.-trans-bergamotene; 3, (+)-epi-.beta.-santalene; 4, (-)-.beta.-santalene; 5, (Z)-.alpha.-santalol; 6, (Z)-.alpha.-trans-bergamotol; 7, (Z)-epi-.beta.-santalol; 8, (Z)-.beta.-santalol. The chromatograms are shown in selected ion (M/Z 93).
[0029] FIG. 12: GCMS analysis of the conversion of (+)-.alpha.-santalene by the recombinant SaCP816 enzyme. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. C. Sandalwood oil for comparison of the retention times. All assays were performed in-vitro as described in example 4. 1, (+)-.alpha.-santalene; 5, (Z)-.alpha.-santalol; 6, (Z)-.alpha.-trans-bergamotol; 7, (Z)-epi-.beta.-santalol; 8, (Z)-.beta.-santalol. The identity of the sequiterpene molecules were confirmed by matching of the mass spectra with authentic standards.
[0030] FIG. 13: GCMS analysis of the conversion of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene by the recombinant SaCP816 enzyme. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. C. Sandalwood oil for comparison of the retention times. All assays were performed in-vitro as described in example 4. 1, (+)-.alpha.-santalene; 2, (-)-.alpha.-trans-bergamotene; 3, (+)-epi-.beta.-santalene; 4, (-)-.beta.-santalene; 5, (Z)-.alpha.-santalol; 6, (Z)-.alpha.-trans-bergamotol; 7, (Z)-epi-.beta.-santalol; 8, (Z)-.beta.-santalol. The identity of the sequiterpene molecules were confirmed by matching of the mass spectra with authentic standards.
[0031] FIG. 14: GCMS analysis of the molecules produced by E. coli engineered to produced sesquiterpenes and expressing SaCP816, CPRm, an alpha-santalene synthase (CLASS) (A) or a alpha-santalene/beta-santalene synthase (SaSAS) (B). 1, (+)-.alpha.-santalene; 2, (-)-.alpha.-trans-bergamotene; 3, (+)-epi-.beta.-santalene; 4, (-)-.beta.-santalene; 5, (Z)-.alpha.-santalol; 6, (Z)-.alpha.-trans-bergamotol; 7, (Z)-epi-.beta.-santalol; 8, (Z)-.beta.-santalol (co-eluted with farnesol produced from an excess pool of farnesyl diphosphate). The identity of the sequiterpene molecules were confirmed by matching of the mass spectra with authentic standards.
[0032] FIG. 15: GCMS analysis of the conversion of (+)-.alpha.-santalene (21) by the recombinant SaCP10374 P450 enzyme. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0033] FIG. 16: GCMS analysis of the conversion of a mixture composed of (+)-.alpha.-santalene (21), (-)-.alpha.-trans-bergamotene (17); (+)-epi-.beta.-santalene and (-)-.beta.-santalene (25) (prepared using the SaTp8201 recombinant protein, example 4) by the recombinant SaCP10374 P450s enzymes. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0034] FIG. 17: GCMS analysis of the conversion of .beta.-farnesene (1) by the recombinant S. album P450s enzymes. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. C. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0035] FIG. 18: GCMS analysis of the conversion of .alpha.-farnesene (5) by the recombinant S. album P450s enzymes. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. C. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0036] FIG. 19: GCMS analysis of the conversion of (-)-sesquisabinene B (9) by the recombinant S. album P450s enzymes. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. C. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0037] FIG. 20: GCMS analysis of the conversion of (-)-.beta.-bisabolene (13) by the recombinant S. album P450s enzymes. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. C. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0038] FIG. 21: GCMS analysis of the conversion of (-)-.alpha.-bergamotene (17) by the recombinant S. album P450s enzymes. A. Control without the recombinant P450 enzyme. B. Assay with E. coli crude protein extract containing the recombinant SaCP10374 protein. C. Assay with E. coli crude protein extract containing the recombinant SaCP816 protein. The numbers indicated on the chromatograms refer to the structures presented in FIG. 27.
[0039] FIG. 22: GCMS analysis of the products generated in-vivo as described in example 23 by E. coli KRX cells transformed with the plasmids pACYC-29258-4506 and the plasmid pD444-SR-AaBFS (A), SaCP10374-CPRm-AaBFS-pCWori (B), or SaCP816-CPRm-AaBFS-pCWori (C). The chromatograms show the formation of (E)-.beta.-farnesene (1) as well as oxidized derivatives (2-3) (see FIG. 27 for corresponding structures).
[0040] FIG. 23: GCMS analysis of the products generated in-vivo as described in example 23 by E. coli KRX cells transformed with the plasmids pACYC-29258-4506 and the plasmid pD444-SR-PaBAFS (A), SaCP10374-CPRm-PaAFS-pCWori (B), or SaCP816-CPRm-PaAFS-pCWori (C). The chromatograms show the formation of (E,E)-.alpha.-farnesene (5) as well as oxidized derivatives (6-8) (see FIG. 27 for corresponding structures). The peak of farnesol resulting from the hydrolysis of excess FPP is inducated on each chromatogram.
[0041] FIG. 24: GCMS analysis of the products generated in-vivo as described in example 23 by E. Coli KRX cells transformed with the plasmids pACYC-29258-4506 and the plasmid pETDuet-SaTps647 (A), SaCP10374-CPRm-SaTps647-pCWori (B), or SaCP816-CPRm-SaTPS647-pCWori(C). The chromatograms show the formation of (-)-sesquisabinene B (9) as well as oxidized derivatives (10-12) (see FIG. 27 for corresponding structures).
[0042] FIG. 25: GCMS analysis of the products generated in-vivo as described in example 23 by E. Coli KRX cells transformed with the plasmids pACYC-29258-4506 and the plasmid pETDuet-ClTps2 (A) or SaCP10374-CPRm-ClTps2-pCWori (B). The chromatograms show the formation of (+)-.alpha.-santalene (21) as well as oxidized derivatives (23-24) (see FIG. 27 for corresponding structures).
[0043] FIG. 26: GCMS analysis of the products generated in-vivo as described in example 23 by E. Coli KRX cells transformed with the plasmids pACYC-29258-4506 and the plasmid pETDuet-SaTps8201 (A) or SaCP10374-CPRm-SaTps8201-pCWori (B). The chromatograms show the formation of (+)-.alpha.-santalene (21), (-)-.beta.-santalene (25) and (-)-trans-.alpha.-Bergamotene (17) as well as oxidized derivatives (19, 20, 23, 24, 27 and 28) (see FIG. 27 for corresponding structures).
[0044] FIG. 27A-B: Structure of the enzymes substrates and products discussed in the text.
DETAILED DESCRIPTION
[0045] In some embodiments, provided herein is a method of producing a sesquiterpene comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, and lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 2. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0046] In some embodiments, provided herein is a method of producing a .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 4. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0047] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 6. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0048] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 8. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0049] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 28. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0050] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 30. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0051] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 32. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0052] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 34. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0053] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 36. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0054] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 38. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0055] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 40. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0056] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 42. In a particular embodiment, the method comprises a cell that expresses the polypeptide
[0057] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 44. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0058] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 50. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0059] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 52. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0060] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 54. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0061] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 58. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0062] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO:60. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0063] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 62. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0064] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 64. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0065] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 66. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0066] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 68. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0067] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 71. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0068] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 73. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0069] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 79. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0070] In some embodiments, provided herein is a method of producing .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol and/or mixtures thereof comprising contacting .alpha.-farnesene, .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene and/or epi-.beta.-santalene, with a polypeptide comprising an amino acid sequence having at least, or at least about, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to SEQ ID NO: 81. In a particular embodiment, the method comprises a cell that expresses the polypeptide.
[0071] The nucleotide sequences provided herein for producing a polypeptide for use in producing an alcohol have a nucleic acid sequence at least, or at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 70 SEQ ID NO: 72, SEQ ID NO: 78 and SEQ ID NO: 80. The nucleotide sequences provided herein are heterologous in that they are not typically or normally produced by a cell in which it is expressed herein and is generally not endogenous to the cell into which it is introduced--it being typically obtained from another cell or could be made synthetically.
[0072] In another embodiment, provided herein is a method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol, and/or mixtures thereof comprising contacting trans-.alpha.-farnesene trans-.beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the alcohol produced comprises at least, or at least about, 36%, of a cis isomer and wherein the polpeptide e comprises an amino acid sequence having at least or at least about 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
[0073] In another embodiment, provided herein is a method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol, and/or mixtures thereof comprising contacting trans-.alpha.-farnesene trans .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the alcohol produced comprises at least, or at least about, 46%, of a cis isomer and wherein the polpeptide e comprises an amino acid sequence having at least or at least about 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
[0074] In another embodiment, provided herein is a method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol, and/or mixtures thereof comprising contacting trans-.alpha.-farnesene trans .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the alcohol produced comprises at least, or at least about, 50%, of a cis isomer and wherein the polpeptide e comprises an amino acid sequence having at least or at least about 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
[0075] In another embodiment, provided herein is a method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol, and/or mixtures thereof comprising contacting trans-.alpha.-farnesene trans .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the alcohol produced comprises at least, or at least about, 72%, of a cis isomer and wherein the polpeptide e comprises an amino acid sequence having at least or at least about 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
[0076] In another embodiment, provided herein is a method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol, and/or mixtures thereof comprising contacting trans-.alpha.-farnesene trans .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the alcohol produced comprises at least, or at least about, 96%, of a cis isomer and wherein the polpeptide e comprises an amino acid sequence having at least or at least about 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of ID NO: 68, SEQ ID NO: 71, and SEQ ID NO: 73.
[0077] In another embodiment, provided herein is a method of producing a sesquiterpene alcohol comprising .alpha.-sinensol, .beta.-sinensol, .alpha.-santalol, .beta.-santalol, .alpha.-trans-bergamotol, epi-.beta.-santalol, lancelol, and/or mixtures thereof comprising contacting trans-.alpha.-farnesene trans .beta.-farnesene, .alpha.-santalene, .beta.-santalene, .alpha.-trans-bergamotene, epi-.beta.-santalene, and/or .beta.-bisabolene with a polypeptide having a P450 monoxygenase activity wherein the alcohol produced comprises at least, or at least about, 100%, of a cis isomer and wherein the polpeptide e comprises an amino acid sequence having at least or at least about 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 98% % sequence identify to a polypeptide having an amino acid sequence selected from the group consisting of EQ ID NO: 71, and 73.
[0078] Provided herein is also an isolated nucleic acid molecule selected from the group consisting of: i) a nucleic acid having an nucleic acid sequence selected from the group consisting SEQ ID. NO: 70 and 72; and ii) a nucleic acid molecule that encodes a polypeptide having p450 monooxygenase activity wherein the polypeptide comprises an amino acid sequence that is at least, or at least about 45%, 50%, 55%, 50%, 65%, 70%, 80%, 90%, 95%, or 98% or more identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 71, and SEQ ID NO: 73. More particularly the polypeptide encoded has the sequence selected from the group consisting of SEQ ID NOs: 71, and SEQ ID NO: 73.
[0079] Provided herein is also an isolated nucleic acid molecule selected from the group consisting of: i) a nucleic acid having an nucleic acid sequence selected from the group consisting SEQ ID. NO: 78 and 80; and ii) a nucleic acid molecule that encodes a polypeptide having p450 monooxygenase activity wherein the polypeptide comprises an amino acid sequence that is at least, or at least about 45%, 50%, 55%, 50%, 65%, 70%, 80%, 90%, 95%, or 98% or more identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 79, and SEQ ID NO: 82. More particularly the polypeptide encoded has the sequence selected from the group consisting of SEQ ID NOs: 79, and SEQ ID NO: 82.
[0080] Also provided herein is an isolated nucleic acid molecule selected from the group consisting of: i) a nucleic acid having an nucleic acid sequence selected from the group consisting SEQ ID. NO: 27, 29, 31, 33, and 35; and ii) a nucleic acid molecule that encodes a polypeptide having p450 monooxygenase activity wherein the polypeptide has the sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36.
[0081] In another embodiment provided herein is a method for producing a polypeptide having P450 monoxygenase activity comprising the steps of transforming a host cell or non-human organism with a nucleic acid encoding a polypeptide having at least, or at least about, 45%, 50%, 55%, 50%, 65%, 70%, 80%, 90%, 95%, or 98% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 71, and SEQ ID NO: 73 and culturing the host cell or organism under conditions that allow for the production of the polypeptide.
[0082] In a further embodiment provided here is a method for producing a polypeptide having P450 monoxygenase activity comprising the steps of transforming a host cell or non-human organism with a nucleic acid encoding a polypeptide having the sequence selected from the group consisting of SEQ ID NO: 71, and SEQ ID NO: 73 and culturing the host cell or organism under conditions that allow for the production of the polypeptide.
[0083] In another embodiment provided herein is a method for producing a polypeptide having P450 monoxygenase activity comprising the steps of transforming a host cell or non-human organism with a nucleic acid encoding a polypeptide having at least, or at least about, 45%, 50%, 55%, 50%, 65%, 70%, 80%, 90%, 95%, or 98% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 79, and SEQ ID NO: 81 and culturing the host cell or organism under conditions that allow for the production of the polypeptide.
[0084] In a further embodiment provided here is a method for producing a polypeptide having P450 monoxygenase activity comprising the steps of transforming a host cell or non-human organism with a nucleic acid encoding a polypeptide having the sequence selected from the group consisting of SEQ ID NO: 79, and SEQ ID NO: 81 and culturing the host cell or organism under conditions that allow for the production of the polypeptide.
[0085] The alcohols can be converted to aldehydes or acids such as but not limited to sinensals, santalals, bergamotenals, and lanceals. The alcohols, aldehydes or acids can be further converted to derivatives such as, but not limited to esters, amides, glycosides, ethers or acetals.
[0086] Nucleic acid and polypeptides described herein may be isolated for example from Cichoriurn intybus L., Bacillus megaterium, Santalum album and Artemisia annua. CYP71AV8, P450-BM3 (CYP102A1), and CYP71AV1 including variants are described herein.
[0087] CYP71AV8 from the plant Cichoriurn intybus L. was previously characterized as a P450 mono-oxygenase able to oxidize region-selectively (+)-valencene producing trans-nootkatol, cis-nootkatol and (+)-nootkatone. CYP71AV8 was also found to catalyse the oxidation of germacrene A and amorpha-4,11-diene in the C-12 position (Cankar et al, FEBS Lett. 585(1), 178-182 (2011)). The amino acid sequence of the wild type enzyme (NCBI accession No ADM86719.1, SEQ ID No 1 and 2) was used to design a cDNA sequence optimized for expression in E. coli.
[0088] In eukaryotes, the P450 monooxygenases are membrane-bound proteins and the N-terminal sequence of these proteins constitute a membrane anchor essential for the membrane localization of these enzymes. This part of the protein, usually delimited by a proline-rich domaine, is not essential for the control of the specificity of the enzymatic activity. This region can thus be modified by deletion, insertion or mutation without effect on the catalytic activity. However, specific modification of the N-terminal region of eukaryotic P450s, including plant P450s, have been shown to have a positive effect on the levels of functional recombinant proteins when expressed in microorganisms (Halkier et al (1995) Arch. Biochem. Biophys. 322, 369-377; Haudenschield et al (2000) Arch. Biochem. Biophys. 379, 127-136).
[0089] In P450 monooxygenases the recognition and binding of the substrate is controlled by several amino acid residues distributed in different regions along the protein amino acid sequences. These regions, defined as substrate recognition sites (SRS), can be localized in the amino acid sequence of any P450 by simple sequence alignment based for example on the work made by Gotoh (Gotoh O (1992) J. Biol. Chem. 267(1), 83-90). Thus residues in the CYP71AV8 protein that interact with the substrate and can influence the regioselectivity of the hydroxylation reaction are the amino acids Asn98 to Gly121, Thr198 to Leu205, Lys232 to Ile 240, Asn282 to Ala300, His355 to Arg367 and Thr469 to Val 476. The modification of one or more residues in these regions can potentially alter the substrate specificity, the stereochemistry of the reaction or its regioselectivity. One example of alteration of the regioselectivity of the reaction catalyzed by a P450 can be found in Schalk et al (2002) Proc. Natl. Acad. Sci. USA 97(22), 11948-11953. In this publication a single residue change in plant P450 enzymes led to a complete conversion to the regiospecificity of the enzymatique reaction.
[0090] A "sesquiterpene synthase" or a "polypeptide having a sesquiterpene synthase activity" is intended for the purpose of the present application as a polypeptide capable of catalyzing the synthesis of a sesquiterpene molecule or of a mixture of sesquiterpene molecules from a acyclic pyrophosphate terpene precursor selected from the group consisting of geranyl-pyrophosphate (GPP), farnesy-diphosphate (FPP) and geranylgeranyl-pyrophosphate (GGPP).
[0091] Alpha santalene, beta-santalene, alpha-trans-bergamotene, and/or epi-beta santalene may be prepared using the synthases described for example in U.S. Patent Publication No.: 2011-0008836, published Jan. 13, 20111 and in U.S. Patent Publication No.: 2011-0281257, published Nov. 27, 2011, both of which are incorporated herein in their entirety.
[0092] According to the present invention, polypeptides are also meant to include truncated polypeptides provided that they keep their P450 monooxygenase activity as defined in any of the above embodiments.
[0093] The percentage of identity between two peptidic or nucleotide sequences is a function of the number of amino acids or nucleotide residues that are identical in the two sequences when an alignment of these two sequences has been generated. Identical residues are defined as residues that are the same in the two sequences in a given position of the alignment. The percentage of sequence identity, as used herein, is calculated from the optimal alignment by taking the number of residues identical between two sequences dividing it by the total number of residues in the shortest sequence and multiplying by 100. The optimal alignment is the alignment in which the percentage of identity is the highest possible. Gaps may be introduced into one or both sequences in one or more positions of the alignment to obtain the optimal alignment. These gaps are then taken into account as non-identical residues for the calculation of the percentage of sequence identity.
[0094] Alignment for the purpose of determining the percentage of amino acid or nucleic acid sequence identity can be achieved in various ways using computer programs and for instance publicly available computer programs available on the world wide web. Particularly, the BLAST program (Tatiana et al, FEMS Microbiol Lett., 1999, 174:247-250, 1999) set to the default parameters, available from the National Center for Biotechnology Information (NCBI) at their webpage ncbi.nlm.nih.gov/BLAST/bl2seq/wblast2.cgi, can be used to obtain an optimal alignment of peptidic or nucleotide sequences and to calculate the percentage of sequence identity.
[0095] A particular organism or cell is meant to be "capable of producing FPP" when it produces FPP naturally or when it does not produce FPP naturally but is transformed to produce FPP, either prior to the transformation with a nucleic acid as described herein or together with said nucleic acid. Organisms or cells transformed to produce a higher amount of FPP than the naturally occurring organism or cell are also encompassed by the "organisms or cells capable of producing FPP". Methods to transform organisms, for example microorganisms, so that they produce FPP are already known in the art. Such methods can for example be found in the literature, for example in the following publications: Martin, V. J., Pitera, D. J., Withers, S. T., Newman, J. D., and Keasling, J. D. Nat Biotechnol., 2003, 21(7), 796-802 (transformation of E. coli); Wu, S., Schalk, M., Clark, A., Miles, R. B., Coates, R., and Chappell, J., Nat Biotechnol., 2006, 24(11), 1441-1447 (transformation of plants); Takahashi, S., Yeo, Y., Greenhagen, B. T., McMullin, T., Song, L., Maurina-Brunker, J., Rosson, R., Noel, J., Chappell, J, Biotechnology and Bioengineering, 2007, 97(1), 170-181 (transformation of yeast).
[0096] Non-human host organisms suitable to carry out the method described herein in vivo may be any non-human multicellular or unicellular organisms. In a particular embodiment, the non-human host organism used to carry out the invention in vivo is a plant, a prokaryote or a fungus. Any plant, prokaryote or fungus can be used. Particularly useful plants are those that naturally produce high amounts of terpenes. In a more particular embodiment, the plant is selected from the family of Solanaceae, Poaceae, Brassicaceae, Fabaceae, Malvaceae, Asteraceae or Lamiaceae. For example, the plant is selected from the genera Nicotiana, Solanum, Sorghum, Arabidopsis, Brassica (rape), Medicago (alfalfa), Gossypium (cotton), Artemisia, Salvia and Mentha. Particularly, the plant belongs to the species of Nicotiana tabacum.
[0097] In a more particular embodiment the non-human host organism used to carry out the method of the invention in vivo is a microorganism. Any microorganism can be used but according to an even more particular embodiment said microorganism is a bacteria or yeast. Most particularly, said bacteria is E. coli and said yeast is Saccharomyces cerevisiae.
[0098] Some of these organisms do not produce FPP naturally. To be suitable to carry out the method of the invention, these organisms have to be transformed to produce said precursor. They can be so transformed either before the modification with the nucleic acid described according to any of the above embodiments or simultaneously, as explained above.
[0099] Isolated higher eukaryotic cells can also be used, instead of complete organisms, as hosts to carry out the method of the invention in vivo. Suitable eukaryotic cells may be any non-human cell, but are particularly plant or fungal cells.
[0100] As used herein, the polypeptide is intended as a polypeptide or peptide fragment that encompasses the amino acid sequences identified herein, as well as truncated or variant polypeptides, provided that they keep their P450 monooxygenaseactivity as defined above and that they share at least the defined percentage of identity with the corresponding polypeptide.
[0101] Examples of variant polypeptides are naturally occurring proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the polypeptides described herein. Variations attributable to proteolysis include, for example, differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acids from the polypeptides of the invention. Polypeptides encoded by a nucleic acid obtained by natural or artificial mutation of a nucleic acid of the invention, as described thereafter, are also encompassed by the invention.
[0102] Polypeptide variants resulting from a fusion of additional peptide sequences at the amino and carboxyl terminal ends can also be used in the methods of the invention. In particular such a fusion can enhance expression of the polypeptides, be useful in the purification of the protein or improve the enzymatic activity of the polypeptide in a desired environment or expression system. Such additional peptide sequences may be signal peptides, for example. Accordingly, the present invention encompasses methods using variant polypeptides, such as those obtained by fusion with other oligo- or polypeptides and/or those which are linked to signal peptides. Polypeptides resulting from a fusion with another functional protein, such as another protein from the terpene biosynthesis pathway, can also be advantageously be used in the methods of the invention.
[0103] As used herein, the polypeptide is intended as a polypeptide or peptide fragment that encompasses the amino acid sequence identified herein, as well as truncated or variant polypeptides, provided that they keep their activity as defined above.
[0104] Examples of variant polypeptides are naturally occurring proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the polypeptides described herein. Variations attributable to proteolysis include, for example, differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acids from the polypeptides of the invention. Polypeptides encoded by a nucleic acid obtained by natural or artificial mutation of a nucleic acid of the invention, as described thereafter, are also encompassed by the invention.
[0105] Polypeptide variants resulting from a fusion of additional peptide sequences at the amino and carboxyl terminal ends are also encompassed by the polypeptides of the invention. In particular such a fusion can enhance expression of the polypeptides, be useful in the purification of the protein or improve the enzymatic activity of the polypeptide in a desired environment or expression system. Such additional peptide sequences may be signal peptides, for example. Accordingly, the present invention encompasses variants of the polypeptides of the invention, such as those obtained by fusion with other oligo- or polypeptides and/or those which are linked to signal peptides. Polypeptides resulting from a fusion with another functional protein, such as another protein from the terpene biosynthesis pathway, are also encompassed by the polypeptides of the invention.
[0106] The nucleic acid of the invention can be defined as including deoxyribonucleotide or ribonucleotide polymers in either single- or double-stranded form (DNA and/or RNA). The terms "nucleotide sequence" should also be understood as comprising a polynucleotide molecule or an oligonucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid. Nucleic acids of the invention also encompass certain isolated nucleotide sequences including those that are substantially free from contaminating endogenous material. The nucleic acid of the invention may be truncated, provided that it encodes a polypeptide encompassed by the present invention, as described above.
[0107] Another important tool for transforming host organisms or cells suitable to carry out the method of the invention in vivo is an expression vector comprising a nucleic acid according to any embodiment of the invention. Such a vector is therefore also an object of the present invention.
[0108] An "expression vector" as used herein includes any linear or circular recombinant vector including but not limited to viral vectors, bacteriophages and plasmids. The skilled person is capable of selecting a suitable vector according to the expression system. In one embodiment, the expression vector includes the nucleic acid of the invention operably linked to at least one regulatory sequence, which controls transcription, translation, initiation and termination, such as a transcriptional promoter, operator or enhancer, or an mRNA ribosomal binding site and, optionally, including at least one selection marker. Nucleotide sequences are "operably linked" when the regulatory sequence functionally relates to the nucleic acid of the invention.
[0109] The expression vectors of the present invention may be used in the methods for preparing a genetically transformed host organism and/or cell, in host organisms and/or cells harboring the nucleic acids of the invention and in the methods for making polypeptides having a P450 monooxygenase activity, as disclosed further below.
[0110] Recombinant non-human host organisms and cells transformed to harbor at least one nucleic acid of the invention so that it heterologously expresses or over-expresses at least one polypeptide of the invention are also very useful tools to carry out the method of the invention. Such non-human host organisms and cells are therefore another object of the present invention.
[0111] A nucleic acid according to any of the above-described embodiments can be used to transform the non-human host organisms and cells and the expressed polypeptide can be any of the above-described polypeptides.
[0112] Non-human host organisms of the invention may be any non-human multicellular or unicellular organisms. In a particular embodiment, the non-human host organism is a plant, a prokaryote or a fungus. Any plant, prokaryote or fungus is suitable to be transformed according to the present invention. Particularly useful plants are those that naturally produce high amounts of terpenes. In a more particular embodiment, the plant is selected from the family of Solanaceae, Poaceae, Brassicaceae, Fabaceae, Malvaceae, Asteraceae or Lamiaceae. For example, the plant is selected from the genera Nicotiana, Solanum, Sorghum, Arabidopsis, Brassica (rape), Medicago (alfalfa), Gossypium (cotton), Artemisia, Salvia and Mentha. Particularly, the plant belongs to the species of Nicotiana tabacum.
[0113] In a more particular embodiment the non-human host organism is a microorganism. Any microorganism is suitable for the present invention, but according to an even more particular embodiment said microorganism is a bacteria or yeast. Most particularly, said bacteria is E. coli and said yeast is Saccharomyces cerevisiae.
[0114] Isolated higher eukaryotic cells can also be transformed, instead of complete organisms. As higher eukaryotic cells, we mean here any non-human eukaryotic cell except yeast cells. Particular higher eukaryotic cells are plant cells or fungal cells.
[0115] The term "transformed" refers to the fact that the host was subjected to genetic engineering to comprise one, two or more copies of each of the nucleic acids required in any of the above-described embodiment. Particularly the term "transformed" relates to hosts heterologously expressing the polypeptides encoded by the nucleic acid with which they are transformed, as well as over-expressing said polypeptides. Accordingly, in an embodiment, the present invention provides a transformed organism, in which the polypeptides are expressed in higher quantity than in the same organism not so transformed.
[0116] There are several methods known in the art for the creation of transgenic host organisms or cells such as plants, fungi, prokaryotes, or cultures of higher eukaryotic cells. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, plant and mammalian cellular hosts are described, for example, in Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, Elsevier, New York and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd edition, 1989, Cold Spring Harbor Laboratory Press. Cloning and expression vectors for higher plants and/or plant cells in particular are available to the skilled person. See for example Schardl et al. Gene 61: 1-11, 1987.
[0117] Methods for transforming host organisms or cells to harbor transgenic nucleic acids are familiar to the skilled person. For the creation of transgenic plants, for example, current methods include: electroporation of plant protoplasts, liposome-mediated transformation, agrobacterium-mediated transformation, polyethylene-glycol-mediated transformation, particle bombardement, microinjection of plant cells, and transformation using viruses.
[0118] In one embodiment, transformed DNA is integrated into a chromosome of a non-human host organism and/or cell such that a stable recombinant system results. Any chromosomal integration method known in the art may be used in the practice of the invention, including but not limited to recombinase-mediated cassette exchange (RMCE), viral site-specific chromosomal insertion, adenovirus and pronuclear injection.
[0119] A "polypeptide variant" as referred to herein means a polypeptide having the above described activity and being substantially homologous to the polypeptide according to any of the above embodiments, but having an amino acid sequence different from that encoded by any of the nucleic acid sequences of the invention because of one or more deletions, insertions or substitutions.
[0120] Variants can comprise conservatively substituted sequences, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics. Examples of conservative substitutions include substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; Glu and Asp; or Gln and Asn. See Zubay, Biochemistry, 1983, Addison-Wesley Pub. Co. The effects of such substitutions can be calculated using substitution score matrices such a PAM-120, PAM-200, and PAM-250 as discussed in Altschul, J. Mol. Biol., 1991, 219, 555-565. Other such conservative substitutions, for example substitutions of entire regions having similar hydrophobicity characteristics, are well known.
[0121] Naturally occurring peptide variants are also encompassed by the invention. Examples of such variants are proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the polypeptides described herein. Variations attributable to proteolysis include, for example, differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acid from the polypeptides encoded by the sequences of the invention.
[0122] Variants of the polypeptides of the invention may be used to attain for example desired enhanced or reduced enzymatic activity, modified regiochemistry or stereochemistry, or altered substrate utilization or product distribution, increased affinity for the substrate, improved specificity for the production of one or more desired compounds, increased velocity of the enzyme reaction, higher activity or stability in a specific environment (pH, temperature, solvent, etc), or improved expression level in a desired expression system. A variant or site directed mutant may be made by any method known in the art. Variants and derivatives of native polypeptides can be obtained by isolating naturally-occurring variants, or the nucleotide sequence of variants, of other or same plant lines or species, for examples plants from the Santalum species, or by artificially programming mutations of nucleotide sequences coding for the polypeptides of the invention. Alterations of the native amino acid sequence can be accomplished by any of a number of conventional methods.
[0123] Polypeptide variants resulting from a fusion of additional peptide sequences at the amino and carboxyl terminal ends of the polypeptides of the invention can be used to enhance expression of the polypeptides, be useful in the purification of the protein or improve the enzymatic activity of the polypeptide in a desired environment or expression system. Such additional peptide sequences may be signal peptides, for example. Accordingly, the present invention encompasses variants of the polypeptides of the invention, such as those obtained by fusion with other oligo- or polypeptides and/or those which are linked to signal peptides. Fusion polypeptide encompassed by the invention also comprise fusion polypeptides resulting from a fusion of other functional proteins, such as other proteins from the terpene biosynthesis pathway.
[0124] The alcohols produced herein may be isolated by extraction for example using known methods to extract the alcohols generated in nature (e.g., extraction from Sandalwood). The alcohols produced herein have use as fragrant compounds that may be used in perfumery.
Abbreviations Used
[0125] aaCPR Arthemisia annua Cytochrome P450 reductase bp base pair kb kilo base DNA deoxyribonucleic acid cDNA complementary DNA ClASS Clausena lansium (+)-.alpha.-santalene synthase CPRm Mentha piperita Cytochrome P450 reductase DTT dithiothreitol EDTA ethylene-diamine-tetraacetic acid FPP farnesyl pyrophosphate GC gaseous chromatograph IPTG isopropyl-D-thiogalacto-pyranoside LB lysogeny broth MS mass spectrometer MTBE methyl tert-buthyl ether PCR polymerase chain reaction RMCE recombinase-mediated cassette exchange RNA ribonucleic acid mRNA messenger ribonucleic acid SaSAS Santalum album (+)-.alpha.-santalene/(-)-.beta.-santalene synthase
[0126] The following examples are illustrative only and are not meant to limit the scope of invention as set forth in the Summary, Description or in the Claims.
EXAMPLES
Example 1
Optimization of the CYP71AV8 cDNA Sequence for Expression in Bacteria
[0127] The membrane anchor region of CYP71AV8 was redesigned to introduce the modifications detailed bellow.
[0128] In the optimized CYP71AV8 sequences the 5'-end was modified to replace the first amino acids of the membrane anchor region with a peptide sequence shown to improve the heterologous expression of membrane-bound P450s in bacterial cells (Alkier, B. A. et al. Arch. Biochem. Biophys. 322, 369-377 (1995), Haudenschield, et al Arch. Biochem. Biophys. 379, 127-136 (2000)). In addition, for the entire cDNA, the codon usage was adapted to match the E. coli codon usage. Thus, several cDNA were designed for CYP71AV8 with different 3'-end modifications and optimizations:
[0129] CYP71AV8-65188: in this construct the 22 first codons were replaced by a sequence coding for the MALLLAVFWSALIILV peptide (SEQ ID NO 3 and 4).
[0130] CYP71AV8-P2: the entire anchor-encoding sequence was replaced by the anchor sequence of an optimized limonene-hydroxylase from mint (PM2 in Haudenschield, et al Arch. Biochem. Biophys. 379, 127-136 (2000)) (SEQ ID NO 5 and 6).
[0131] CYP71AV8-P2O: this construct encodes for the same protein as the previous one but the membrane anchor region was further codon optimize (SEQ ID NO 7 and 8).
[0132] The FIG. 1 compares the amino acid sequences of the N-terminal regions of the different CYP71AV8 variants and FIG. 2 compares the DNA sequences of the 3 constructs. The three optimized CYP71AV8 cDNAs were synthesized in-vitro (DNA2.0, Menlo Park, Calif., USA) and cloned as NdeI-HindIII fragment into the pCWori+ expression plasmid (Barnes, H. J. Method Enzymol. 272, 3-14; (1996)).
Example 2
Functional Expression of CYP71AV8 in Bacterial Cells
[0133] For heterologous expression, the JM109 E. coli cells were transformed with the CYP71AV8 expression plasmids (example 1). Single colonies of transformants were used to inoculated cultures of 5 mL LB medium containing 50 .mu.g/mL ampicillin. The cells are grown for 10 to 12 hours at 37.degree. C. The cultures were then used to inoculate 250 mL TB Medium (Terrific Broth) supplemented with 50 .mu.g/mL ampicillin and 1 mM Thiamine HCL. The cultures were incubated at 28.degree. C. for 3-4 h with moderate shaking (200 rpm) before 75 mg/L .delta.-aminolevulinic acid (sigma) and 1 mM IPTG (Isopropyl (.beta.-D-1-thiogalactopyranoside) was added, and the cultures were maintained at 28.degree. C. for 24-48 h with 200 rpm shaking.
[0134] The expression of the P450 enzymes can be evaluated qualitatively and quantitatively by measuring the CO-binding spectrum (Omura, T. & Sato, R. (1964) J. Biol. Chem. 239, 2379-2387) in the E. coli protein fractions. For protein extraction, the cells are centrifuged (10 min, 5000 g, 4.degree. C.) and resuspended in 35 mL ice-cold buffer 1 (100 mM Tris-HCl pH 7.5, 20% glycerol, 0.5 mM EDTA). One volume of 0.3 mg/ml lysozyme (Sigma-Aldrich) in water was added and the suspension left 10-15 min at 4.degree. C. with agitation. The suspension is centrifuged 10 min at 7000 g and 4.degree. C. and the pellet is resuspended in 20 mL buffer 2 (25 mM KPO.sub.4 pH 7.4, 0.1 mM EDTA, 0.1 mM DTT, 20% glycerol). The suspension is subject to one cycle of freeze-thaw at -80.degree. C., 0.5 mM PMSF (phenylmethylsulfonyl fluoride, Sigma-Aldrich) is added and the suspension is sonicated 3 times for 20 sec. The suspension is centrifuged 10 min at 10000 g (to remove cell debris) and the supernatant is recovered and centrifuged 2 hours at 100,000 g. The pellet (membrane protein fraction) is resuspended in 2-3 ml of buffer 3 (50 mM Tris-HCl pH 7.4, 1 mM EDTA, 20% glycerol). To measure the CO-spectrum, the protein fraction is diluted (1/10) in buffer 3 to a final volume of 2 mL. Some crystals of sodium dithionite (Na.sub.2S.sub.2O.sub.4) are added, the sample is divided into two cuvettes and the baseline recorded between 370 and 500 nm. The sample cuvette is then saturated with carbon monoxide and the difference spectrum is recorded. The concentration of P450 enzyme can be estimated from the amplitude of the peak at 450 nm using the extension coefficient for the reduced CO complex of 91 mM.sup.-1cm.sup.-1 (Omura, T. & Sato, R. (1964) J. Biol. Chem. 239, 2379-2387).
[0135] Following this procedure, typical CO-spectra with a maximum absorbance at 450 nm were measured for the recombinant CYP71AV8, attesting for a proper folding into functional P450 enzymes.
Example 3
Co-Expression of CYP71AV8 and a P450-Reductase in Bacteria
[0136] To reconstitute the activity of plant P450s, the presence of a second membrane protein is essential. This protein, the P450-reductase (CPR), is involved in the transfer of electrons from the cofactor NADPH (reduced Nicotinamide adenine dinucleotide phosphate) to the P450 active site. It has been shown that a CPR from one plant can complement the activity of P450 enzyme from another plant (Jensen and Moller (2010) Phytochemsitry 71, 132-141). Several CPR-encoding DNA sequences have been reported from different plant sources. We first selected a CPR previously isolated from Mentha piperita (CPRm, unpublished data, SEQ ID NO 10), optimized the codon usage of the full-length cDNA (SEQ ID No 9) and cloned it into the NcoI and HindIII restriction sites of the pACYCDuet-1 expression plasmid (Novagen) providing the plasmid pACYC-CPRm.
[0137] CYP71AV8 and CPRm were co-expressed in E. coli cells using the two plasmids pCWori-CYP71AV8-65188 and pACYCDuet-CPRm. BL21 Star.TM.(DE3) E. coli cells (Invitrogen, Carlsbad, Calif.) were co-transformed with these two plasmids. Transformed cells were selected on carbenicillin (50 .mu.g/ml) and chloramphenicol (34 .mu.g/ml) LB-agarose plates. Single colonies were used to inoculate 5 mL liquid LB medium supplemented with the same antibiotics. The culture was incubated overnight at 37.degree. C. The next day, 2 to 250 mL of TB medium supplemented with the same antibiotics were inoculated with 0.2 to 2 mL of the overnight culture. After 6 hours incubation at 37.degree. C., the culture was cooled down to 28.degree. C. and 1 mM IPTG and 75 mg/L .delta.-aminolevulinic acid were added. After 16 to 24 hours, the cells were harvested in exponential growing phase, centrifuged and resuspended in 0.5 volume of potassium phosphate buffer 50 mM pH 7.0 supplemented with 5% glycerol or 3% glucose. These cells were used for evaluation of the enzymatic activities of the P450 enzymes.
Example 4
Bioconversion of (+)-.alpha.-Santalene, (-)-.beta.-Santalene, (-)-.alpha.-Trans-Bergamotene and (+)-Epi-.beta.-Santalene Using E coli Cells Expressing CYP71AV8
[0138] The different sequiterpene hydrocarbons used as substrates in the bioconversion assays were prepared as described previously using E. coli cells engineered to produced farnesyl diphosphate (FPP) from an heterologous mevalonate pathway and expressing a plant derived sesquiterpene synthase. The engineering and use of the E. coli host cells was described in patent WO2013064411 or in Schalk et al (2013) J. Am. Chem. Soc. 134, 18900-18903. Briefly, an expression plasmid was prepared containing two operons composed of the genes encoding the enzymes for a complete mevalonate pathway. A first synthetic operon consisting of an E. coli acetoacetyl-CoA thiolase (atoB), a Staphylococcus aureus HMG-CoA synthase (mvaS), a Staphylococcus aureus HMG-CoA reductase (mvaA) and a Saccharomyces cerevisiae FPP synthase (ERG20) genes was synthetized in-vitro (DNA2.0, Menlo Park, Calif., USA) and ligated into the NcoI-BamHI digested pACYCDuet-1 vector (Invitrogen) yielding pACYC-29258. A second operon containing a mevalonate kinase (MvaK1), a phosphomevalonate kinase (MvaK2), a mevalonate diphosphate decarboxylase (MvaD), and an isopentenyl diphosphate isomerase (idi) was amplified from genomic DNA of Streptococcus pneumoniae (ATCC BAA-334) and ligated into the second multicloning site of pACYC-29258 providing the plasmid pACYC-29258-4506. This plasmid thus contains the genes encoding all enzymes of the biosynthetic pathway leading from acetyl-coenzyme A to FPP. E. coli cells (BL21 Star.TM.(DE3), Invitrogen) were co-transformed with the plasmid pACYC-29258-4506 and either the plasmid pET101-Cont21 (containing a cDNA encoding for the Clausena lansium (+)-.alpha.-santalene synthase (CLASS), WO2009109597) or the plasmid pETDuet-SCH10-Tps8201-opt (containing a cDNA encoding for a Santalum album (+)-.alpha.-santalene/(-)-.beta.-santalene synthase (SaSAS), WO2010067309) and this cells were used to produce and purify (+)-.alpha.-santalene or a mixture of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene.
[0139] The enzymatic activity of CYP71AV8 was evaluated by bioconversion in E. coli cells using the sesquiterpene molecules listed above as substrates. BL21 Star.TM.(DE3) E. coli cells (Invitrogen) transformed with the plasmids pACYCDuet-CPRm and pCWori-CYP71AV8-65188 were cultivated and harvested as described in example 3. The substrates (sesquiterpene hydrocarbons) were added to the cell suspension to a final concentration of 0.5 mg/ml as mixture composed of 10 mg Tween.RTM. 20 (sigma-Aldrich), 10 mg antifoam (Erol DF, PMC Ouvrie, Lesquin, France), 20 mg sesquiterpene and 1 ml water. The conversion was allowed to proceed for 24 hours at 20.degree. C. with moderate shaking. The media were extracted with 2 volumes of MTBE (Methyl tert-buthyl ether, Sigma) and the extracts were analyzed by GCMS on an Agilent 6890 Series GC system connected to an Agilent 5975 mass detector. The GC was equipped with 0.25 mm inner diameter by 30 m SPB-1 capillary column (Supelco, Bellefonte, Pa.). The carrier gas was He at a constant flow of 1 mL/min. The initial oven temperature was 80.degree. C. (1 min hold) followed by a gradient of 10.degree. C./min to 300.degree. C. The identification of the products was based on the comparison of the mass spectra and retention indices with authentic standards and internal databases.
[0140] In these conditions, oxidation of (+)-.alpha.-santalene was observed. The primary product of the conversion was (E)-.alpha.-santalol. Other products derived from the conversion of (E)-.alpha.-santalol by E. Coli endogenous enzymes were detected: (E)-.alpha.-santalal (produced by an alcohol dehydrogenase) and (E)-.alpha.-dihydrosantalol (produced by an enoate reductase) (FIG. 3A). Similarly, using a mixture of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene as substrate the formation of (E)-.alpha.-santalol, (E)-.beta.-santalol, (E)-.alpha.-trans-bergamotol and (E)-epi-.beta.-santalol was observed as well as further metabolized products were obtained (FIG. 3B). This example shows that CYP71AV8 can be used for the terminal oxidation of (+)-.alpha.-santalene, (-)-.beta.-santalene, and structurally similar molecules.
Example 5
Construction of Synthetic Operons to Co-Express CYP71AV8 and a CPR from a Single Plasmid
[0141] Several bicistronic operons were designed to express the P450 enzyme and a CPR from a single plasmid and under the control of a unique promoter. The three variants of optimized CYP71AV8 cDNAs (example 1) were combined with 2 CPR cDNAs: the codon optimized CPRm cDNA (example 2) and a codon optimized cDNA (Seq ID No 11) encoding for an Artemisia annua CPR (NCBI accession No. ABM88789.1, SEQ ID No 12). Thus, six constructs were designed (Seq ID No 13-18), each containing a P450 cDNA followed by a linker sequence including a ribosome binding site (RBS) and a CPR cDNA (FIG. 4). This constructs were prepared by PCR: the P450 and CPR cDNAs were amplified separately and with 5' and 3' overhangs suitable for the cloning using the In-Fusion.RTM. procedure (Clontech) in the NdeI-HindIII sites of the pCWori+ plasmid.
[0142] To evaluate the effect of the different N-terminal modification made on the P450s and the coupling with the CPRs, the 6 plasmids were transferred into E. coli BL21 Star.TM.(DE3) cells and the recombinant cells were used in bio-conversion assays as described in example 4. The (+)-.alpha.-santalene and the (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene mixture were used as substrates and quantities of total oxygenated sesquiterpene products were evaluated. The results presented in FIG. 5 show that all recombinant bacterial cells transformed with one of the 6 plasmids described above can be used for the oxidation of (+)-.alpha.-santalene, (-)-.beta.-santalene and the structurally similar molecules. The highest titer was obtained with the operon combining the CYP71AV8-P2O cDNA and the CPRm cDNA. This construct (plasmid pCWori-CYP71AV8-P2O-CPRm) was used for further experiments.
Example 6
In-Vivo Production of Oxygenated Sesquiterpenes in Engineered Cells
[0143] The oxidized products of (+)-.alpha.-santalene and the (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene, (+)-epi-.beta.-santalene or other structurally similar molecules can also be produced directly in E. coli cells engineered to produce sesquiterpenes from a carbon source such as glucose or glycerol. Plasmids were prepared consisting of the pCWori+ plasmid (Barnes H. J (1996) Method Enzymol. 272, 3-14) containing a synthetic operon composed of a P450, a CPR and the terpene synthase. For the P450, the CYP71AV8-P2 or CYP71AV8-P2O cDNA was used and for the terpene synthase, the Clausena lansium (+)-.alpha.-santalene synthase cDNA (ClASS) (WO2009109597) or a cDNA encoding for a Santalum album (+)-.alpha.-santalene/(-)-.beta.-santalene synthase (SaSAS) (WO2010067309) was used. Four plasmids were thus constructed using the following procedure. A codon optimized version of the ClASS cDNA (SEQ ID NO 19-20) was designed and synthesized (DNA 2.0) and cloned in the NdeI-KpnI sites of the pETDUET-1 plasmid (Novagen) providing the plasmid pETDuet-Tps2opt. For SaSAS an optimized full-length cDNA was designed (SEQ ID NO 21-22), synthesized and cloned in the pJexpress414 plasmid (DNA2.0) providing the plasmid pJ414-SaTps8201-1-FLopt. For each constructs primer were designed for cloning using the In-Fusion.RTM. technique (Clontech, Takara Bio Europe). The optimized ClASS cDNA and the optimized SaSAS cDNA were amplified using these primers and the pETDuet-Tps2opt and pJ414-SaTps8201-1-FLopt plasmids as template, respectively. The two PCR products were ligated in the plasmids pCWori-CYP71AV8-P2-CPRm or pCWori-CYP71AV8-P20-CPRm digested with the HindIII restriction enzyme and using the In-Fusion.RTM. Dry-Down PCR Cloning Kit (Clontech, Takara Bio Europe), providing four new plasmids: pCWori-CYP71AV8-P2-CPRm-ClASS, pCWori-CYP71AV8-P2-CPRm-SaSAS, pCWori-CYP71AV8-P20-CPRm-ClASS, and pCWori-CYP71AV8-P2O-CPRm-SaSAS (SEQ ID NO 23-26).
[0144] The evaluation of the performance of these operons was performed in the E. coli BL21 Star.TM.(DE3) (Invitrogen) cells co-transformed with either of the 4 plasmids and with the plasmid pACYC-29258-4506 carrying a complete mevalonate pathway (example 4). Transformed cells were selected on carbenicillin (50 .mu.g/ml) and chloramphenicol (34 .mu.g/ml) LB-agarose plates. Single colonies were used to inoculate 5 mL of LB medium supplemented with appropriate antibiotics. Cultures were incubated overnight at 37.degree. C. and 250 rpm. The next day 2 mL of TB medium in glass culture tubes containing 100 .mu.g/L carbenicilin and 17 .mu.g/L chloramphenicol, were inoculated with 200 .mu.l of the LB pre-culture and incubated at 37.degree. C. and 250 rpm. After 6 hours of cultivation (or when the optical density at 600 nm of the culture reach a value of 3), the culture were cooled down to 20.degree. C. and the expression of the proteins was induced with 0.1 mM IPTG (Isopropyl .beta.-D-1-thiogalactopyranoside), and 75 .mu.g/L .delta.-aminolevulinic acid (sigma) and 2% (v/v) of decane were added. After 48 h incubation with 250 rpm shaking, the whole culture broth was extracted with 1 volume of MTBE and analyzed by GCMS as described in example 4.
[0145] All resulting strains produced the sesquiterpene hydrocarbons as well as the corresponding oxygenated products also observed in the bioconversion experiments (FIG. 6). This experiment shows that using engineered cells expressing CYP71AV8, the sesquiterpenes (E)-.alpha.-santalol, (E)-.beta.-santalol and other structurally similar molecules can be produced.
Example 7
Production of (E)-.alpha.-Santalol and (E)-.beta.-Santalol Using CYP71AV8 Variants
[0146] In previous examples we showed that CYP71AV8 is highly selective for the `terminal trans carbon` of (+)-.alpha.-santalene and (-)-.beta.-santalene and produced exclusively (E)-.alpha.-santalol, (E)-.beta.-santalol. In this example, we describe a site directed mutagenesis approach to modify the CYP71AV8 enzyme activity in order to produce (Z)-.alpha.-santalol and (Z)-.beta.-santalol. L358 was first selected as an active site residue controlling the enzyme activity. A series of variant of CYP71AV8 were generated by replacing the codon encoding for L358 by codons encoding for other amino acids. The mutation was introduced in a two-step PCR procedure using a combination of degenerated oligonucleotide (containing the NBT (N=A, C, G, T; B=C, G, T) codon in place of L358 encoding codon) and specific oligonucleotides. This combination of oligonucleotides allow to change the L358 encoding codon with codons encoding for 12 other residues including all the amino acids with a hydrophobic side chain. A first PCR was performed to amplify the 5' portion of the cDNA using the mutagenesis reverse primer AV8-L358-rev (5'-CACGCGGCATCACCAGCGGAVNCGGCGGATGCAGGCGCAGGGTTTCTTTAAT C-3') (SEQ ID NO: 93) and the primer AV8-pcw-fw (5'-CATCGATGCTTAGGAGGTCATATGGCTCTGTTATTAGCAG-3') (SEQ ID NO: 94). A second PCR product was amplified using the primer AV8-L358-fw (5'-TCCGCTGGTGATGCCGCGTGAGTGC-3') (SEQ ID NO: 95) and AV8-CPR-rev (5'-ATATATCTCCTTCTTAAAGTTAGTCGACTCATTAGGTG-3') (SEQ ID NO: 96). For both amplifications the pCWori-CYP71AV8-P2-CPRm-ClASS was use for the template. A second round of amplification was performed using the two above PCR products as template and the primers AV8-L358-fw+AV8-CPR-rev and allowed to amplify the full-length CYP71AV8 variant cDNAs. All the PCR reactions were performed using the PfuUltra II fusion HS DNA polymerase (Stratagene) following the manufacturer instruction. The modified cDNA were ligated into the NdeI-SalI digested pCWori-CYP71AV8-P2-CPRm-ClASS using the Gibson Assembly Master Mix (New England Biolabs). The final constructions were controlled by sequencing and one plasmid clone was selected for each desired CYP71AV8 variant. Twelve variants were thus generated by replacing Leu358 by Ala, Phe, Thr, Ser, Val, Gly, Ile, Met, Pro, Tyr, Trp, and Arg (SEQ ID NO 27 to 50).
[0147] The evaluation of each CYP71AV8 variant was performed using the in-vivo sesquiterpene production method described in example 6. Briefly, the pCWori+ plasmid containing one of the CYP71AV8 variant cDNA, the CPRm cDNA and the ClASS cDNA was co-transformed with the pACYC-29258 plasmid into KRX E. Coli cells (Promega). The transformed cells were selected, cultivated and the production of sesquiterpenes was evaluated as described in example 6. As shown in FIG. 7, compared to the wild type P450 enzyme, with some of the variants (Z)-.alpha.-santalol was produced in addition to the trans oxidation products. For each variant, the ratio of cis to trans oxidation was calculated by dividing the total amount of (Z)-.alpha.-santalol produced by the total amount of oxygenated .alpha.-santalene derivatives. The results of these calculations for each variants is presented in Table 1 below:
TABLE-US-00001 TABLE 1 Regio-selectivity of the CYP71AV8 wild-type enzyme and active site variants for the oxidation of .alpha.-santalene. % (Z)-.alpha.-santalol CYp71AV8 Titer [mg/L] of total santalol variants sesquiterpenes Oxygenated products content CYP71AV8 wt 97.7 .+-. 2.8 78.1 .+-. 3.5 0% L358A 28 .+-. 1.5 40.3 .+-. 2.8 36% L358F 88.4 .+-. 3.9 40.7 .+-. 0.4 46% L358T 90.9 .+-. 5.6 33.8 .+-. 1.5 5% L358S 43.4 .+-. 1.8 15.3 .+-. 0.8 17% L358V 56.1 .+-. 3.5 66.1 .+-. 1.1 1% L358G 84.3 .+-. 2.8 85 .+-. 2.2 0% L358I 71.2 .+-. 3.7 41 .+-. 0.3 0% L358M 84 .+-. 4.5 2.3 .+-. 0.3 0% L358P 71.6 .+-. 2.0 21 .+-. 1.1 0% L358Y 71.6 .+-. 2.9 0 .+-. 0 0% L358W 78.2 .+-. 0.6 0 .+-. 0 0% L358R 76 .+-. 1.1 2.3 .+-. 0.3 0%
[0148] The data presented in Table 1 above show that CYP71AV8 can be engineered and used to produce the (Z)-.alpha.-santalol. Particularly, the L358T, L358S, L358A and L358F variants can be used for the terminal oxidation of (+)-.alpha.-santalene with a selectivity up to 46% for the cis terminal carbon.
[0149] In a similar approach the variants of CYP71AV8 were evaluated for the production of (Z)-.beta.-santalol. New plasmids were prepared by replacing the ClASS cDNA in the above plasmid by the SaSAS cDNA. Thus the plasmid pCW-CYP71AV8-L358F-CPRm-ClASS was digested with the restriction enzymes HindIII and EcoRI to remove the ClASS cDNA. In parallel, the pCWori-CYP71AV8-P2-CPRm-SaSAS was digested with the same enzymes to recover the SaSAS cDNA with the compatible cohesive ends. The linearized vector and the digested insert were ligated using the T4 DNA ligase (New England Biolabs). The plasmid thus obtained was used for in-vivo production of oxygenated sesquiterpenes in E. coli cells in the same condition as described above. The FIG. 8 present the GCMS profile of the analysis of the products formed by CYP71AV8-L358F and shows that modified CYP71AV8 enzymes can also be used to produce (Z)-.beta.-santalol.
Example 8
Evaluation of Other Members of CYP71AV Family
[0150] CYP71AV1 (NCBI accession No ABB82944.1) was evaluated for the oxidation of sesquiterpenes with the santalene skeleton. A plasmid was prepared with a configuration similar to the plasmids described in example 5: a bi-cistronic operon containing an optimized cDNA encoding for an N-terminal modified CYP71AV1 protein (SEQ ID NO 53 and 54) and the aaCPR cDNA (example 5) was designed, synthesized in-vitro (DNA2.0) and cloned as a bi-cistronic operon into the pCWori+ plasmid. The plasmid was used to transform KRX E. coli cells (Promega). The transformed cells were cultivated and protein expression was induced as described in example 3. A bioconversion experiment using (+)-.alpha.-santalene as substrate was conducted as described in example 4. As shown in FIG. 9 the same products as with CYP71AV8 were obtained (i.e. (E)-.alpha.-santalol and (E)-.alpha.-santalal) showing that other members of the CYP71AV P450 family can be use for the terminal oxidation of santalenes.
[0151] Using CYP71AV1, a synthetic operon containing the CYP71AV1 cDNA, the aaCPR and the (+)-.alpha.-santalene synthase cDNA (ClASS) was prepared. The pCWori+ plasmid containing the CYP71AV8-P2-CPRm-ClASS operon (example 6) was digested with NdeI and HindIII to cut out the P450 encoding cDNA. In parallel, the CYP71AV1 cDNA was recovered from the bi-cistronic operon described in the previous paragraph by digestion with the same enzymes and ligated, using the T4 DNA ligase (New England Biolabs), into the digested pCWori plasmid described above yielding the plasmid pCWori-CYP71AV1-CPRm-ClASS. This plasmid together with the plasmid pACYC-29258-4506 were used to co-transform E. coli BL21 Star.TM.(DE3) (Invitrogen) cells. The recombinant cells were cultivated in conditions allowing the production of sesquiterpene molecules as described in example 6. The GCMS analysis of the sesquiterpene produced revealed the formation of the same product as in the bio-conversion experiments. This experiment shows that CYP71AV1 can also be used oxidize santalene molecules and to produce santalols (FIG. 9).
Example 9
Construction of a P450-BM3 (CYP102A1) Mutant Library
[0152] A P450-BM3 mutant library of 24 variants was constructed by systematically combining five hydrophobic amino-acids (alanine, valine, phenylalanine, leucine and isoleucine) in two positions located close to the centre of the heme group of P450-BM3. Altering the side chain size of these two amino acids has been shown to drastically change the shape of the substrate binding cavity in close proximity of the heme group (Appl Microbiol Biotechnol 2006, 70:53; Adv Synth Catal 2006, 348:763). The first hot spot (Phe 87) is known to alter substrate specificity and regioselectivity while the second position (Ala 328) has been predicted to interact with all substrates during oxidation (ChemBiochem 2009, 10:853). The P450-BM3 variants were either generated using the QuickChange.TM. site-directed mutagenesis kit (Invitrogen, Carlsbad, Calif.) or were chemically synthetized by DNA2.0 (Menlo Park, Calif.). The P450-BM3 variants and wild-type were subcloned into the bacteria expression plasmids pET22b, pET28+, pETDuet-1 and pCDFDuet-1 (Novagen, Madison, Wis.) and were transformed in Escherichia coli BL21(DE3) or BL21Star.TM.(DE3) (Invitrogen, Carlsbad, Calif.).
Example 10
Alpha-Santalene: In Vitro Screening of the P450-BM3 Library
[0153] The 24 P450-BM3 mutants and the wild-type version of the enzyme were heterologously expressed in E. coli BL21(DE3) cells as reported previously (Adv. Synth. Catal. 2003, 345:802). In brief, a single colony of transformed cells was used to inoculate 2 ml of Luria-Bertani (LB) medium supplemented with 30 .mu.g/ml kanamycin and grown at 37.degree. C. with orbital shaking (150 rpm) until OD.sub.578 reaches a value of 0.6 to 1.0. This pre-culture was used to inoculate 200 ml of LB medium containing 30 .mu.g/ml kanamycin. The cells were grown at 37.degree. C. with orbital shaking at 160 rpm to an OD.sub.578 of 0.8. Expression of the protein was then induced by the addition of 0.35 mM isopropyl .beta.-D-1-thiogalactopyranoside (IPTG). After 6 hours of growth at 30.degree. C. under agitation, the cells were harvested by centrifugation and lysed by sonication.
[0154] The alpha-santalene used as substrate in the bioconversion assays was prepared as described in Example 4. The conversions were carried out in 1 ml of 50 mM potassium phosphate buffer containing .about.0.5 .mu.M CYP enzyme, 2% (v/v) DMSO, and 0.2 mM .mu.-santalene substrate. Reaction was started by adding 0.1 mM NADPH and was carried out for 22 h at room temperature with moderate shaking.
[0155] Samples were then analyzed on a GC/MS QP-2010 instrument (Shimadzu, Japan) equipped with a FS-Supreme-5 column (30 m.times.0.25 mm.times.0.25 .mu.m), helium as carrier gas (flow rate: 0.68 ml/min; linear velocity: 30 cm/s). Mass spectra were collected using electrospray ionization. The injector temperature was set at 250.degree. C. The column oven was set at 50.degree. C. for 1 min, then raised to 170.degree. C. at 30.degree. C./min, then raised to 185.degree. C. at 5.degree. C./min, held isotherm for 3 min, then raised to 200.degree. C. at 5.degree. C./min, then raised to 300.degree. C. at 30.degree. C./min, and finally held isotherm for 1 min.
Example 11
Alpha-Santalene In Vivo Screening of the P450-BM3 Library
[0156] The P450-BM3 mutant library was also screened in vivo using a bacteria strain engineered to produce (+)-.alpha.-santalene from a simple carbon source. To this end, the FPP-overproducing strain described in Example 4 was transformed with a pETDuet-1 plasmid containing a codon-optimized version of a (+)-.alpha.-santalene synthase from Clausena lansium (ClASS) (WO2009109597) (SEQ ID No 19 and 20) and each of the P450-BM3 variants cloned into the first and second multiple cloning sites (MCS) of the vector, respectively. Alternatively, the (+)-.alpha.-santalene synthase cDNA was cloned into the pET101expression plasmid (Novagen) and each of the P450-BM3 mutants from the library into the pCDFDuet-1 vector (Novagen). The resulting recombinant vectors were co-transformed in the FPP-overproducing strain.
[0157] Single colonies of transformed cells were used to inoculate 5 mL of LB medium supplemented with the appropriate antibiotics. Cultures were then incubated overnight at 37.degree. C. and 250 rpm. The following day, 2 mL of Terrific Broth (TB) medium supplemented with 3% glycerol, 1 mM thiamine-HCl (Sigma-Aldrich, St Louis, Mich.) and 75 .mu.g/L .delta.-aminolevulinic acid (Sigma-Aldrich) were inoculated with 200 .mu.l of the overnight culture and incubated at 37.degree. C. and 250 rpm. After 4 to 6 hours of cultivation (or when the optical density at 600 nm of the culture reach a value of 2 to 3), the cultures were cooled down to 28.degree. C. and the protein expression was induced with 0.1 mM IPTG. At that time, 10% (v/v) of dodecane were added to the growth media. After 48 h incubation with orbital shaking (250 rpm), the cell culture was extracted twice with one volume of methyl tert-butyl ether (MTBE) and the solvent extract analyzed by GC/MS. GC/MS was performed on an Agilent 6890 series GC system equipped with a DB1 column (30 m.times.0.25 mm.times.0.25 mm film thickness; Agilent) and coupled with a 5975 series mass spectrometer. The carrier gas was helium at a constant flow of 1 ml/min. Injection was in split-less mode with the injector temperature set at 250.degree. C. and the oven temperature was programmed from 50.degree. C. to 225.degree. C. at 10.degree. C./min and to 320.degree. C. at 20.degree. C./min. The identities of the products were confirmed based on the concordance of the retention indices and mass spectra of authentic standards.
[0158] The in vitro (Example 10) and in vivo screening of the P450-BM3 mutant library gave comparable results that are summarized in Table 2. While P450-BM3 wild-type (SEQ ID No 55 and 56) did not show any detectable activity on (+)-.alpha.-santalene, 6 P450-BM3 variants were able to convert .alpha.-santalene to the desired .alpha.-santalol(s). These variants revealed between 45% to 96% preference for oxidation of the cis-terminal carbon of (+)-.alpha.-santalene. The single mutant #23 (A328V) (SEQ ID No 67 and 68) and the double mutants #7 (F87I/A328I) (SEQ ID No 57 and 58), #17 (F87V/A328I) (SEQ ID No 59 and 60) and #18 (F87V/A328L) (SEQ ID No 61 and 62) showed the highest regioselectivity ranging from 72% to 96% (Table 2 and FIG. 10). Two additional variants #19 (F87V/A328V) (SEQ ID No 63 and 64) and #20 (F87V/A328F) (SEQ ID No 65 and 66) were less selective for the cis-hydroxylation (in the range of 45%-50%) and generated additional oxidation products.
TABLE-US-00002 TABLE 2 Alpha-santalene conversion to alpha-santalol(s) by P450-BM3 variants cis-.alpha.- trans-.alpha.- Additional Con- santalol santalol oxydation version P450-BM3 (%) (%) products (%) (%) Wild-type F87/A328 Variant #7 F87 I/A328 I 87 13 6 Variant #17 F87 V/A328 I 78 11 11 16 Variant #18 F87 V/A328 L 72 13 15 9 Variant #19 F87 V/A328 V 45.5 4 50.5 8 Variant #20 F87 V/A328 F 49 8 43 3 Variant #23 F87/A328 V 96 4 5
[0159] These results indicate that P450-BM3 active site mutations enable binding of the non-native substrate (+)-.alpha.-santalene. Selected P450-BM3 variants incorporating these mutations were shown to selectively hydroxylate the cis-terminal carbon of (+)-.alpha.-santalene to generate the olfactively important compound (Z)-.alpha.-santalol (FIG. 10).
Example 12
In Vivo Production of (Z)-.alpha.-Santalol, (Z)-.beta.-Santalol, (Z)-.alpha.-Trans-Bergamotol and (Z)-Epi-.beta.-Santalol Using a P450-BM3 Double Mutant
[0160] One of the P450-BM3 variants identified in the .alpha.-santalene screen (variant #17; Table 2) was tested for its ability to oxidize a sandalwood oil-like mixture of sesquiterpene hydrocarbons consisting of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene. To this end, the FPP-overproducing bacteria strain described in Example 4 was transformed with a recombinant pETDuet-1 expression vector containing a codon-optimized cDNA encoding for a Santalum album (+)-.alpha.-santalene/(-)-.beta.-santalene synthase (WO2010067309) (SEQ ID No 21 and 22) into the first MCS and the P450-BM3 variant #17 in the second MCS. Cell growth, induction conditions, culture extraction and product analysis were performed essentially as described in Example 11.
[0161] As shown in FIG. 11, (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene were efficiently oxidized by the P450-BM3 double-mutant to yield (Z)-.alpha.-santalol, (Z)-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (Z)-epi-.beta.-santalol. Remarkably, only the desired cis-isomers of the sesquiterpene alcohols were detected under these experimental conditions. These data show that the Bacillus megaterium CYP102A1 (P450-BM3) can be efficiently engineer to selectively hydroxylate the cis-terminal carbon of (+)-.alpha.-santalene, (-)-.beta.-santalene and structurally related terpenes such as bergamotane sesquiterpenes and to generate the key sesquiterpene alcohols found in Sandalwood oil.
Example 13
Isolation of a cDNA Encoding for SaCP816, a Cytochrome P450 from Santalum album
[0162] The seeds of S. album were obtained from B&T World Seeds (Aigues-Vives, France) and from Sandeman Seeds (Lalongue, France). The seeds were first surface sterilised in 2.5% Hypochlorous acid (HClO) for 120 min, and rinsed 3 times in sterile ultrapure water. The seeds were then shelled and placed on MS basal medium (Murashige & Skoog, 1962, Physiologia Plantarum 15, 473-497) supplemented with 15 g/L sucrose and 7.8 g/L agar, pH 5.7. Germination was typically observed after 9 to 18 days with a yield of approximately 40%. Seedlings of Santalum album obtained from the aseptically germinated seeds were transferred to soil 5 to 10 weeks after germination. Since Santalum species are root hemiparasites, the soil adaptation was made in close contact with 6-months to 1-year old citrus (Citrus sinensis) plants. The roots of the santalum plants were harvested, 2-3 years after the transfer to the soils and separated from the host plant roots. GC-MS analysis of an extract of these roots showed the presence of the sandalwood oil characteristic sesquiterpenes. Total RNA was extracted from the roots using the Concert.TM. Plant RNA Reagent (Invitrogen). From 12 grams of tissue, 640 micrograms of total RNA were isolated.
[0163] The whole transcriptome was sequenced using the Illumina Total RNA-Seq technique and the Illumina HiSeq 2000 sequencer. A total of 108.7 millions of paired-reads of 2.times.100 bp were generated. The reads were assembled using the De Novo Assembly application of CLC-Bio Genomic Workbench (CLCBo, Denmark). A total 82'479 of contigs with an average size of 683 bp were assembled. The contigs were search using the tBlastn algorithm (Altschul et al, J. Mol. Biol. 215, 403-410, 1990) and using as query sequence known P450 amino acid sequences such as the sequence of CYP71AV1 (NCBI accession No ABB82944.1). This approach allowed identifying several contigs encoding for proteins with characteristic cytochrome P450 motifs. One selected contig, SCH37-Ct816 (SED ID NO 69), contained a 1503 bp length open reading frame (ORF) (SEQ ID NO 70) encoding for a 500 amino acid protein, SaCP816 (SEQ ID NO 71). This amino acid showed homology with know cytochrome P450 sequences the closest sequence being a P450 from Vitis vinifera, CYP71D10 (NCBI accession No AAB94588.1) sharing 62% amino acid sequence identity.
Example 14
Heterologous Expression of SaCP816 in Bacterial Cells
[0164] For functional characterization of the protein encoded by SCH37-Ct816, the protein was heterologously expressed in E. coli cells. The ORF sequence was modified for improved expression in E. coli: the first 17 codons were replaced by the codons encoding for the MALLLAVFWSALIILV peptide (first 17 amino acids of SEQ ID NO: 73) and the codon usage of the whole ORF sequence was modified to match the E. coli codon usage. This cDNA (SaCP120293 (SEQ ID NO: 72) encoding for the modified SaCP816 (SEQ ID NO: 73) was synthesized in-vitro (DNA2.0) and cloned in the pJExpress404 plasmid (DNA2.0). The heterologous expression was performed as described in example 2.
Example 15
Co-Expression of SaCP816 and a P450-Reductase in Bacteria
[0165] A bicistronic operons was designed to express the P450 enzyme and a CPR from a single plasmid and under the control of a unique promoter. The optimized SaCP120293 cDNA was combined with the CPRm cDNA (SEQ ID No 9, Example 3) to prepare a bicistronic construct (SEQ ID NO 74) containing successively the P450 cDNA a linker sequence including a ribosome binding site (RBS) and the CPRm cDNA. This construct was prepared by PCR by amplifying the P450 and CPR cDNAs separately and with 5' and 3' overhangs suitable for the cloning using the In-Fusion.RTM. procedure (Clotech) in the NdeI-HindIII sites of the pCWori+ plasmid (Barnes H. J (1996) Method Enzymol. 272, 3-14) providing the plasmid SaCP816-CPRm-pCWori (SEQ ID NO 74).
[0166] The JM109 E. coli cells were transformed with the SaCP816-CPRm-pCWori expression plasmid. The transformed cells were grown and the cell-free extract containing the recombinant proteins were prepared as described in example 2. This protein fraction was used for the evaluation the enzymatique conversion of sesquiterpene molecules (example 16).
Example 16
In-Vitro Conversion of (+)-.alpha.-Santalene, (-)-.beta.-Santalene, (-)-.alpha.-Trans-Bergamotene and (+)-Epi-.beta.-Santalene Using the Recombinant SaCP816 P450 Enzyme
[0167] The different sequiterpene hydrocarbons used as substrates in the bioconversion assays were prepared as described in example 4.
[0168] The crude protein extract from E. coli cells expressing the recombinant SaCP816 and CPRm proteins (example 15) was used for the in-vitro oxidation of these sesquiterpene molecules. The assays were performed in 1 mL of 100 mM Tris-HCL pH 7.4 buffer containing 20 to 50 microL protein extract, 500 microM NADPH (reduced Nicotinamide adenine dinucleotide phosphate), 5 microM FAD (Flavine adenine dinucleotide), 5 microM FMN (flavine mononucleotide), and 300 microM of sesquiterpenes (either (a)-santalene or a mixture of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene). After 2 hours of incubation in Teflon sealed glass tubes with gentle agitation, the reaction was stopped on ice and extraction with 1 volume of MTBE (Methyl tert-buthyl ether, Sigma). The extracts were analyzed by GCMS as described in example 4.
[0169] In these conditions, oxidation of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene was observed. FIG. 12 shows that the oxidation of (+)-.alpha.-santalene by SaCP816 provides (Z)-.alpha.-santalol. FIG. 13 shows that (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene were oxidized by SaCP816 to forme (Z)-.alpha.-santalol, (Z)-.beta.-santalol, (Z)-.alpha.-trans-bergamotol and (Z)-epi-.beta.-santalol. In all assays, no detectable amounts of the corresponding trans-isomers of the sesquiterpene alcohols was observed (the trans and cis isomers of each sesquiterpene alcohol are easily separated in the chromatographic conditions used in these assays).
[0170] This experiments show that the cytochrome P450 enzymes, SaCP816, isolated from Santalum album can be used for the selective hydroxylates the cis-terminal carbon of (+)-.alpha.-santalene, (-)-.beta.-santalene and similar sesquiterpene structures.
Example 17
In-Vivo Production of Oxygenated Sesquiterpenes in Engineered Cells Using the Recombinant SaCP816 P450 Enzyme
[0171] The oxidized products of (+)-.alpha.-santalene and the (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene, (+)-epi-.beta.-santalene or other structurally similar molecules can also be produced directly in E. coli cells engineered to produce sesquiterpenes from a carbon source such as glucose or glycerol. Plasmids were prepared consisting of the pCWori+ plasmid containing a synthetic operon composed of the SaCP120293 cDNA (SEQ ID No 72), the CPRm cDNA (SEQ ID No 9) and a terpene synthase encoding cDNA. For the terpene synthase, the Clausena lansium (+)-.alpha.-santalene synthase cDNA (CLASS) (WO2009109597) or a cDNA encoding for a Santalum album (+)-.alpha.-santalene/(-)-.beta.-santalene synthase (SaSAS) (WO2010067309) was used.
[0172] Two plasmids were thus constructed using a procedure similar to the procedure described in example 6. The codon optimized (+)-.alpha.-santalene synthase cDNA (SEQ ID NO 19) and the (+)-.alpha.-santalene/(-)-.beta.-santalene synthase cDNA (SEQ ID NO 21) were amplified as described in example 6 and ligated using the In-Fusion.RTM. Dry-Down PCR Cloning Kit (Clontech, Takara Bio Europe) in the plasmids SaCP816-CPRm-pCWori digested with the HindIII restriction enzyme providing the two new plasmids SaCP816-CPRm-C1ASS-pCWori (SEQ ID NO 75) and SaCP816-CPRm-SaSAS-pCWori (SEQ ID NO 76).
[0173] The evaluation of the performance of these operons was performed in the E. coli XRX cells (Promega) co-transformed with either of these 2 plasmids and with the plasmid pACYC-29258-4506 carrying a complete mevalonate pathway (example 4). Transformed cells were selected on carbenicillin (50 .mu.g/ml) and chloramphenicol (34 .mu.g/ml) LB-agarose plates. Single colonies were used to inoculate 5 mL of LB medium supplemented with appropriate antibiotics. Cultures were incubated overnight at 37.degree. C. and 250 rpm. The next day 2 mL of TB medium in glass culture tubes containing 100 .mu.g/L carbenicilin and 17 .mu.g/L chloramphenicol, were inoculated with 200 .mu.l of the LB pre-culture and incubated at 37.degree. C. and 250 rpm. After 6 hours of cultivation (or when the optical density at 600 nm of the culture reach a value of 3), the culture were cooled down to 20.degree. C. and the expression of the proteins was induced with 0.1 mM IPTG (Isopropyl (3-D-1-thiogalactopyranoside) and 0.1% Rhamnose, and 75 .mu.g/L .delta.-aminolevulinic acid (sigma) and 2% (v/v) of decane were added. After 48 h incubation with 250 rpm shaking, the whole culture broth was extracted with 1 volume of MTBE and analyzed by GCMS as described in example 4.
[0174] All resulting strains produced the sesquiterpene hydrocarbons as well as the corresponding oxygenated products also observed in the in-vitro experiments (FIG. 14). This experiment shows that using engineered cells expressing SaCP816, the sesquiterpenes (Z)-.alpha.-santalol, (Z)-.beta.-santalol and other structurally similar molecules can be produced.
Example 18
Isolation of a cDNA Encoding SaCP10374, a Cytochrome P450 from Santalum album
[0175] As described in example 13, several P450-encoding contig sequences were identified in the transcriptome from Santalum album roots. Beside SCH37-Ct816, another contig was selected: SCH37-Ct10374 (SED ID NO 77), contained a 1533 bp length ORF (SEQ ID NO 78) encoding for a protein composed of 510 amino acids, SaCP10374 (SEQ ID NO 79), showing homology with know cytochrome P450 sequences and 58% identity with CYP71D10 from Vitis vinifera, CYP71D10.
Example 19
Heterologous Expression of SaCP10374 in Bacterial Cells and Co-Expression with a P450-Reductase in Bacteria
[0176] For functional characterization of the enzymes encoded by SCH37-Ct10374, the protein was heterologously expressed in E. coli cells. The ORFs sequence were modified to improve the expression in E. coli: the 18 first codons were replaced by the codons encoding for the MALLLAVFWSALII peptide and the codon usage of the whole ORF sequence was optimized. The new cDNA, SaCP120292 (SEQ ID NO 80), encoding for the modified SaCP10374 (SEQ ID NO 81) was synthesized in-vitro (DNA2.0) and cloned in the pJExpress404 plasmid (DNA2.0).
[0177] The heterologous expression was performed as described in example 2. Following this procedure, typical CO-spectra with a maximum absorbance at 450 nm was measured for this new recombinant S. abum P450, attesting for a proper folding into functional P450 enzymes.
[0178] To reconstitute the activity of this P450 enzyme, a P450 reductase (CPR) was coexpressed. For this purpose, a bicistronic operons was designed similarly as described in example 15 to express SaCP10374 and CPRm (a mint P450 reductase) from a single plasmid and under the control of a unique promoter. The optimized SaCP12092 cDNA was combined with the CPRm cDNA to prepare the bicistronic constructs (SEQ ID NO 82) containing successively the P450 cDNA a linker sequence including a ribosome binding site (RBS) and the CPRm cDNA. This construct was prepared by PCR as described in example 15. and cloned in the pCWori+ plasmid (Barnes H. J (1996) Method Enzymol. 272, 3-14) providing the plasmid SaCP10374-CPRm-pCWori.
[0179] The JM109 E. coli cells were transformed with these bicistronic expression plasmid. The transformed cells were grown and the cell-free extract containing the recombinant proteins were prepared as described in example 2. The membrane protein fractions were used for the evaluation the enzymatique conversion of sesquiterpene molecules (example 21)
Example 21
In-Vitro Conversion of (+)-.alpha.-Santalene, (-)-.beta.-Santalene and (-)-.alpha.-Trans-Bergamotene Using the Recombinant SaCP10374 P450 Enzyme
[0180] The different sequiterpene hydrocarbons (either (a)-santalene or a mixture of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene) used as substrates in this example of bioconversion assays were prepared as described in example 4.
[0181] The crude protein extract from E. coli cells expressing the recombinant SaCP10374 and CPRm proteins (example 20) was used for the in-vitro oxidation of these sesquiterpene molecules and the assays were performed as described in example 16. After 2 hours of incubation in Teflon sealed glass tubes with gentle agitation, the reaction was stopped on ice and extraction with 1 volume of MTBE (Methyl tert-buthyl ether, Sigma). The extracts were analyzed by GCMS as described in example 4.
[0182] In these conditions, oxidation of (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene by SaCP10374 was observed. FIGS. 15 and 16 show that (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene and (+)-epi-.beta.-santalene were oxidized by SaCP10374 to form (E)-.alpha.-santalol, (E)-.beta.-santalol, (E)-.alpha.-trans-bergamotol and (E)-epi-.beta.-santalol. In all assays, no detectable amounts of the corresponding cis-isomers of the sesquiterpene alcohols was observed (the trans and cis isomers of each sesquiterpene alcohol are easily separated in the chromatographic conditions used in these assays).
[0183] This experiments show that the cytochrome P450 enzyme SaCP10374, isolated from Santalum album, can be used for the selective hydroxylation of the trans-terminal carbon of (+)-.alpha.-santalene, (-)-.beta.-santalene and structurally similar sesquiterpene molecules.
Example 22
In-Vitro Conversion of (E)-.beta.-Farnesene, (E)-.alpha.-Farnesene, (-)-Sesquisabinene B, (-)-.beta.-Bisabolene and (-)-.alpha.-Trans-Bergamotene Using the Recombinant SaCP816 and SaCP10374 P450s Enzyme
[0184] Using the method described in example 4, several sequiterpene hydrocarbons structurally similar to the santalenes were prepared. The (-)-sesquisabinene B and (-)-.beta.-bisabolene were produced using the pETDuet expression plasmid containing either a cDNA encoding for SaTps647, a Santalum album (-)-sesquisabinene B synthase (NCBI accession No. ADP37190.1) or a cDNA encoding for SaTps30, a Santalum album (-)-.beta.-bisabolene synthase (NCBI accession No. ADP37189.1), in combination with the pACYC-29258-4506 plasmid described in example 4. The .beta.-farnesene was obtained from Bedoukian (Dambury, Ct, USA), .alpha.-farnesene was from Treatt (Suffolk, UK) and (-)-.alpha.-trans-bergamotene was purified from citrus oil.
[0185] The crude protein extracts from E. coli cells expressing the recombinant SaCP816 or SaCP10374 together with CPRm proteins (example 15 and 20) were used for the in-vitro oxidation of these sesquiterpene molecules. The assays and product identification by GCMS analysis was performed as described in example 16.
[0186] In these conditions oxidation of (E)-.beta.-farnesene, (E)-.alpha.-farnesene, (-)-sesquisabinene B, (-)-.beta.-bisabolene and (-)-.alpha.-trans-bergamotene, was observed (FIGS. 17 to 21). For all these compounds, the two S. album P450s are regioselective for one of the two carbons of the terminal gem-dimethyl group (R1 or R2 in FIG. 27): SaCP816 catalyzes the selective oxidation of the carbon atom of the methyl in cis position relative to the terminal doubel bond (R1 in FIG. 27), whereas SaCP10374 catalyzes the oxidation of the same substrates exclusively on the carbon atom of the methyl group in trans relative to the terminal doubel bond (R2 in FIG. 27). The trans and cis isomers of each sesquiterpene alcohol are easily separated in the chromatographic conditions used in these assays. The formation of the corresponding aldehyde when the trans-methyl group is oxidyzes is attributed to E. coli endogenous alcohol dehydrogenase activity.
[0187] This experiments show that the cytochrome P450 enzymes, SaCP816 and SaCP10374, isolated from Santalum album can be used for the selective hydroxylation of the cis-terminal and trans-terminal carbon, respectively, of various sesquiterpene molecules have structure similarities with .beta.-farnesene, .alpha.-farnesene, (+)-.alpha.-santalene, (-)-.beta.-santalene, (-)-.alpha.-trans-bergamotene, (-)-sesquisabinene B or (-)-.beta.-bisabolene.
Example 23
In-Vivo Production of Various Oxygenated Sesquiterpenes in Engineered Cells Using the Recombinant SaCP816 or SaCP10374 P450s Enzyme
[0188] The oxidized sesquiterpene molecules described in example 21 and 22 can also be produced directly using whole cells, such as for example E. coli cells engineered to produce sesquiterpenes from a carbon source such as glucose or glycerol. Plasmids were prepared consisting of the pCWori+ plasmid containing a synthetic operon composed of the SaCP120293 cDNA (SEQ ID No 72), or the SaCP120292 (SEQ ID No 80), the CPRm cDNA (SEQ ID No 9) and a terpene synthase encoding cDNA (encoding either for an Artemisia annua .beta.-farnesene synthase cDNA (NCBI accession No AAX39387.1.1), a Picea abies .alpha.-farnesene synthase (NCBI accession No AAS47697.1), a S. album (-)-Sesquisabinene B (NCBI accession No ADP37190.1), a S. album (-)-.beta.-Bisabolene synthase (NCBI accession No ADP37189.1), a Clausena lansium .alpha.-santalene synthase (NCBI accession No ADR71055.1) or a S. album .alpha.-/.beta.-santalene synthase (NCBI accession No ADP30867.1)).
[0189] The plasmids carrying the different combinations of synthetic operons were prepared using the following procedure. The plasmid pD444-SR-AaBFS (containing an optimized cDNA encoding for AaBFS, an Artemisia annua (E)-.beta.-farnesene synthase (NCBI accession No AAX39387.1), the plasmid pD444-SR-PaAFS (containing an optimized cDNA encoding for PaAFS, a Picea abies (E)-.alpha.-farnesene synthase (NCBI accession No. AAS47697.1) were used to amplify by PCR the (E)-.beta.-farnesene synthase and (E)-.alpha.-farnesene synthase cDNAs, respectively. The plasmids pETDuet-SaTps647 and pETDuet-SaTps30 (example 22) were used as template to amplify by PCR the sesquisabinene B synthase and the bisabolene synthase cDNAs, respectively. For each constructs primer were designed for the cloning using the In-Fusion.RTM. technique (Clontech, Takara Bio Europe). The AaBFS cDNA was amplified using the forward primer CPRm_aaBFS_Inf1 (TTACCTGCGTGATGTGTGGTAATAAAAGCTTAGGAGGTAAAAATGTCTACCC TGCCAATTTCTTC) (SEQ ID NO: 97) and the reverse primer AaBFS_Inf2 (ATGTTTGACAGCTTATCATCGATAAGCTGAATTCTTACACAACCATCGGGTG CACAAAGAATG) (SEQ ID NO: 98). The PaAFS cDNA was amplified using the forward primer CPRm_PaAFS_Inf1 (TTACCTGCGTGATGTGTGGTAATAAAAGCTTAGGAGGTAAAAATGGATCTGG CAGTGGAAATCGC) (SEQ ID NO: 99) and the reverse primer PaAFS_Inf2 (CTCATGTTTGACAGCTTATCATCGATAAGCTGAATTCTTACATCGGGACCGGC TCCAGGACGGTGC) (SEQ ID NO: 100). The SaTps647 cDNA was amplified using the primer forward CPRm_Tps647_inf1 (5'GCGTGATGTGTGGTAATAAAAGCTTAGGAGGTAAAAAT GGCGACCGTTGTGGATGATTCT-3') (SEQ ID NO: 101) and the primer reverse Tps647_Inf2 (GCTTATCATCGATAAGCTGAATTCTTACTCTTCATCCAGGGTAATCGGGTGG) (SEQ ID NO: 102). The SaTps30 cDNA was amplified using the primer forward CPRm_Tps30_Inf1-(GCGTGATGTGTGGTAATAAAAGCTTAGGAGGTAAAAATGGACGCATTCGCA ACGAGCC) (SEQ ID NO: 103) and the primer reverse Tps30_Inf2 (GTGATGTGTGGTAATAAAAAGCTGAATTCTTAGTCCTCTTCATTCA GCGGGATCGGGTG) (SEQ ID NO: 104).
[0190] The PCR products were ligated in the plasmids SaCP816-CPRm-pCWori (SEQ ID No 74) or SaCP10374-CPRm-pCWOri (SEQ ID NO 82) digested with the HindIII restriction enzyme and using the In-Fusion Dry-Down PCR Cloning Kit (Clontech, Takara Bio Europe), providing the new plasmids SaCP816-CPRm-SaTPS647-pCWori (SEQ ID NO 83), SaCP10374-CPRm-SaTPS647-pCWori (SEQ ID NO 84), SaCP816-CPRm-SaTPS30-pCWori (SEQ ID NO 85), SaCP10374-CPRm-SaTPS30-pCWori (SEQ ID NO 86), SaCP816-CPRm-AaBFS-pCWori (SEQ ID NO 87), SaCP10374-CPRm-AaBFS-pCWori (SEQ ID NO 88), SaCP816-CPRm-PaAFS-pCWori (SEQ ID NO 89), SaCP10374-CPRm-PaAFS-pCWori (SEQ ID NO 90), SaCP10374-CPRm-C1Tps2-pCWori (SEQ ID NO 91), and SaCP10374-CPRm-SaTps8201-pCWori (SEQ ID NO 92).
[0191] The in-vivo production of oxygenated sesquiterpenes in E coli cells using the above plasmids was performed as described in example 17. All recombinant bacteria cells transformed with these plasmids produced the expected sesquiterpene hydrocarbons as well as the corresponding oxygenated products also observed in the in-vitro experiments (FIGS. 22 to 26).
Sequence CWU
1
1
10411500DNACichorium intybus 1atggagattt ctatccccac tacccttggc cttgccgtca
tcatcttcat cattttcaag 60ttgctaacgc gtaccacatc aaagaaaaac ctactcccag
agccatggag actaccaata 120atcggacaca tgcatcatct gataggtacg atgccacatc
gtggtgtcat ggaactagcc 180aggaagcatg gatctctcat gcatctacaa cttggagaag
tgtccactat tgtggtctca 240tccccacgtt gggcaaaaga ggttctgaca acgtacgata
ttacgtttgc aaacagaccg 300gagactttaa ccggtgagat tgttgcatat cacaataccg
atattgtcct tgctccgtat 360ggtgaatact ggaggcagtt gcgaaagctt tgcaccttgg
agcttttaag caacaagaaa 420gtgaagtcgt ttcagtccct tcgtgaggag gaatgttgga
atctggttaa agacattcga 480tcaactgggc agggatcccc aatcaatctt tcagaaaaca
ttttcaagat gattgccacc 540atacttagta gggcagcatt cggaaaggga atcaaagacc
aaatgaaatt tacagaatta 600gtaaaagaaa tactaaggct tacgggaggt tttgatgtgg
cggacatctt tccttctaaa 660aagttacttc accatctttc aggcaagaga gctaagttaa
ccaacataca caataagctt 720gacaatttga tcaacaatat catcgctgag caccctggaa
accgtacaag ctcatcacag 780gagactctac ttgatgttct gttaagactg aaagaaagcg
cagagtttcc attgacagca 840gacaatgtca aagcagtcat tttggatatg tttggagctg
gcacggatac ttcgtcagcc 900acaattgaat gggcaatctc agaattgata aggtgtccga
gagccatgga gaaagttcaa 960acagaattaa ggcaagcact aaatggaaag gaaaggatcc
aagaagaaga tctacaggaa 1020ctaaattacc taaagctagt gatcaaagaa acattgaggt
tgcatccacc actaccgttg 1080gttatgccta gagagtgtag ggagccatgt gtgttggggg
gatacgatat acccagcaag 1140acgaaactta ttgtcaacgt gtttgccata aacagggatc
ctgaatactg gaaagatgct 1200gaaactttca tgccagagag atttgaaaac agccccatca
ctgtaatggg ttcagagtat 1260gagtatctcc cgtttggtgc aggaagaaga atgtgtccag
gcgctgccct tggtttagcc 1320aacgtggaac ttcctcttgc tcatatactt tactacttca
attggaagct cccaaatgga 1380aaaacatttg aagacttgga catgactgag agctttggag
ccactgtcca aagaaagacg 1440gagttgttac tagttccaac ggatttccaa acacttacgg
catctactta atgactcgag 15002496PRTCichorium intybus 2Met Glu Ile Ser Ile
Pro Thr Thr Leu Gly Leu Ala Val Ile Ile Phe1 5
10 15Ile Ile Phe Lys Leu Leu Thr Arg Thr Thr Ser
Lys Lys Asn Leu Leu 20 25
30Pro Glu Pro Trp Arg Leu Pro Ile Ile Gly His Met His His Leu Ile
35 40 45Gly Thr Met Pro His Arg Gly Val
Met Glu Leu Ala Arg Lys His Gly 50 55
60Ser Leu Met His Leu Gln Leu Gly Glu Val Ser Thr Ile Val Val Ser65
70 75 80Ser Pro Arg Trp Ala
Lys Glu Val Leu Thr Thr Tyr Asp Ile Thr Phe 85
90 95Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu Ile
Val Ala Tyr His Asn 100 105
110Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg
115 120 125Lys Leu Cys Thr Leu Glu Leu
Leu Ser Asn Lys Lys Val Lys Ser Phe 130 135
140Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn Leu Val Lys Asp Ile
Arg145 150 155 160Ser Thr
Gly Gln Gly Ser Pro Ile Asn Leu Ser Glu Asn Ile Phe Lys
165 170 175Met Ile Ala Thr Ile Leu Ser
Arg Ala Ala Phe Gly Lys Gly Ile Lys 180 185
190Asp Gln Met Lys Phe Thr Glu Leu Val Lys Glu Ile Leu Arg
Leu Thr 195 200 205Gly Gly Phe Asp
Val Ala Asp Ile Phe Pro Ser Lys Lys Leu Leu His 210
215 220His Leu Ser Gly Lys Arg Ala Lys Leu Thr Asn Ile
His Asn Lys Leu225 230 235
240Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu His Pro Gly Asn Arg Thr
245 250 255Ser Ser Ser Gln Glu
Thr Leu Leu Asp Val Leu Leu Arg Leu Lys Glu 260
265 270Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn Val Lys
Ala Val Ile Leu 275 280 285Asp Met
Phe Gly Ala Gly Thr Asp Thr Ser Ser Ala Thr Ile Glu Trp 290
295 300Ala Ile Ser Glu Leu Ile Arg Cys Pro Arg Ala
Met Glu Lys Val Gln305 310 315
320Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys Glu Arg Ile Gln Glu Glu
325 330 335Asp Leu Gln Glu
Leu Asn Tyr Leu Lys Leu Val Ile Lys Glu Thr Leu 340
345 350Arg Leu His Pro Pro Leu Pro Leu Val Met Pro
Arg Glu Cys Arg Glu 355 360 365Pro
Cys Val Leu Gly Gly Tyr Asp Ile Pro Ser Lys Thr Lys Leu Ile 370
375 380Val Asn Val Phe Ala Ile Asn Arg Asp Pro
Glu Tyr Trp Lys Asp Ala385 390 395
400Glu Thr Phe Met Pro Glu Arg Phe Glu Asn Ser Pro Ile Thr Val
Met 405 410 415Gly Ser Glu
Tyr Glu Tyr Leu Pro Phe Gly Ala Gly Arg Arg Met Cys 420
425 430Pro Gly Ala Ala Leu Gly Leu Ala Asn Val
Glu Leu Pro Leu Ala His 435 440
445Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro Asn Gly Lys Thr Phe Glu 450
455 460Asp Leu Asp Met Thr Glu Ser Phe
Gly Ala Thr Val Gln Arg Lys Thr465 470
475 480Glu Leu Leu Leu Val Pro Thr Asp Phe Gln Thr Leu
Thr Ala Ser Thr 485 490
49531473DNAArtificial SequenceCYP71AV8-65188 DNA sequence 3atggcactct
tactggcagt attctggtcc gccctgatca ttcttgtaac ccgcacgact 60agcaaaaaga
atctgttgcc ggagccatgg cgtctgccga ttatcggtca catgcaccat 120ttgatcggca
ccatgccgca tcgtggtgtt atggaactgg cccgtaagca tggcagcctg 180atgcacctgc
aactgggtga agtctctacg attgttgtca gcagcccgcg ttgggcgaaa 240gaggtcttga
ccacctatga tatcaccttc gccaatcgcc cggaaaccct gactggcgag 300atcgtcgcat
accacaacac ggatatcgtc ctggcgccgt atggtgagta ttggcgtcaa 360ctgcgtaaac
tgtgcacgct ggagctgctg agcaacaaga aagtgaagag cttccagagc 420ctgcgcgaag
aagagtgttg gaacctggtc aaggacatcc gcagcaccgg ccaaggtagc 480ccaatcaatc
tgtcggagaa cattttcaag atgattgcga cgattctgag ccgtgctgcg 540ttcggtaagg
gtattaagga tcaaatgaag tttaccgaac tggtgaaaga aatcctgcgt 600ctgaccggcg
gttttgatgt cgctgacatc ttccctagca agaagttgct gcaccacctg 660agcggcaagc
gtgcaaaact gaccaatatc cataacaagc tggataatct gatcaataac 720atcatcgcag
agcacccggg caaccgtacc tcgtcctccc aggaaacgct gctggacgtt 780ctgctgcgcc
tgaaagagtc tgcggagttt ccgctgaccg ccgacaacgt taaagcagtg 840atcctggata
tgttcggcgc tggtacggat accagcagcg cgacgatcga gtgggcgatt 900agcgagctga
ttcgctgccc tcgcgcgatg gagaaagtgc agacggaatt gcgtcaggca 960ctgaatggca
aagagcgtat tcaggaagag gatttgcagg agctgaatta tctgaagctg 1020gtgattaaag
aaaccctgcg cctgcatccg ccgttgccgc tggtgatgcc gcgtgagtgc 1080cgtgaaccgt
gtgttttggg cggttacgac attccgagca aaacgaagct gatcgttaat 1140gttttcgcga
ttaaccgtga cccggaatac tggaaagacg cggaaacgtt tatgccggag 1200cgttttgaga
atagcccgat taccgttatg ggttccgagt acgaatacct gccatttggt 1260gctggtcgtc
gtatgtgtcc tggtgcagcg ctgggtctgg ccaacgtgga actgccgctg 1320gcgcacattc
tgtactattt caactggaaa ctgccgaacg gcaagacctt cgaagatttg 1380gacatgaccg
agagctttgg tgccactgtg cagcgcaaaa ccgagctgct gctggttccg 1440accgactttc
aaacgctgac tgcgagcacc taa
14734490PRTArtificial SequenceCYP71AV8-65188 amino acid sequence 4Met Ala
Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1 5
10 15Thr Arg Thr Thr Ser Lys Lys Asn
Leu Leu Pro Glu Pro Trp Arg Leu 20 25
30Pro Ile Ile Gly His Met His His Leu Ile Gly Thr Met Pro His
Arg 35 40 45Gly Val Met Glu Leu
Ala Arg Lys His Gly Ser Leu Met His Leu Gln 50 55
60Leu Gly Glu Val Ser Thr Ile Val Val Ser Ser Pro Arg Trp
Ala Lys65 70 75 80Glu
Val Leu Thr Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro Glu Thr
85 90 95Leu Thr Gly Glu Ile Val Ala
Tyr His Asn Thr Asp Ile Val Leu Ala 100 105
110Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg Lys Leu Cys Thr
Leu Glu 115 120 125Leu Leu Ser Asn
Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu Glu 130
135 140Glu Cys Trp Asn Leu Val Lys Asp Ile Arg Ser Thr
Gly Gln Gly Ser145 150 155
160Pro Ile Asn Leu Ser Glu Asn Ile Phe Lys Met Ile Ala Thr Ile Leu
165 170 175Ser Arg Ala Ala Phe
Gly Lys Gly Ile Lys Asp Gln Met Lys Phe Thr 180
185 190Glu Leu Val Lys Glu Ile Leu Arg Leu Thr Gly Gly
Phe Asp Val Ala 195 200 205Asp Ile
Phe Pro Ser Lys Lys Leu Leu His His Leu Ser Gly Lys Arg 210
215 220Ala Lys Leu Thr Asn Ile His Asn Lys Leu Asp
Asn Leu Ile Asn Asn225 230 235
240Ile Ile Ala Glu His Pro Gly Asn Arg Thr Ser Ser Ser Gln Glu Thr
245 250 255Leu Leu Asp Val
Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe Pro Leu 260
265 270Thr Ala Asp Asn Val Lys Ala Val Ile Leu Asp
Met Phe Gly Ala Gly 275 280 285Thr
Asp Thr Ser Ser Ala Thr Ile Glu Trp Ala Ile Ser Glu Leu Ile 290
295 300Arg Cys Pro Arg Ala Met Glu Lys Val Gln
Thr Glu Leu Arg Gln Ala305 310 315
320Leu Asn Gly Lys Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu
Asn 325 330 335Tyr Leu Lys
Leu Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Leu 340
345 350Pro Leu Val Met Pro Arg Glu Cys Arg Glu
Pro Cys Val Leu Gly Gly 355 360
365Tyr Asp Ile Pro Ser Lys Thr Lys Leu Ile Val Asn Val Phe Ala Ile 370
375 380Asn Arg Asp Pro Glu Tyr Trp Lys
Asp Ala Glu Thr Phe Met Pro Glu385 390
395 400Arg Phe Glu Asn Ser Pro Ile Thr Val Met Gly Ser
Glu Tyr Glu Tyr 405 410
415Leu Pro Phe Gly Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu Gly
420 425 430Leu Ala Asn Val Glu Leu
Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn 435 440
445Trp Lys Leu Pro Asn Gly Lys Thr Phe Glu Asp Leu Asp Met
Thr Glu 450 455 460Ser Phe Gly Ala Thr
Val Gln Arg Lys Thr Glu Leu Leu Leu Val Pro465 470
475 480Thr Asp Phe Gln Thr Leu Thr Ala Ser Thr
485 49051509DNAArtificial
SequenceCYP71AV8-P2 DNA sequence 5atggctctgt tattagcagt tttttggtcg
gcgcttataa tcctcgtagt aacctacacc 60atatccctcc taatcaacca atggcgaaaa
ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc tgccgattat cggtcacatg
caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg aactggcccg taagcatggc
agcctgatgc acctgcaact gggtgaagtc 240tctacgattg ttgtcagcag cccgcgttgg
gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca atcgcccgga aaccctgact
ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg cgccgtatgg tgagtattgg
cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca acaagaaagt gaagagcttc
cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg acatccgcag caccggccaa
ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga ttgcgacgat tctgagccgt
gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta ccgaactggt gaaagaaatc
ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc ctagcaagaa gttgctgcac
cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata acaagctgga taatctgatc
aataacatca tcgcagagca cccgggcaac 780cgtacctcgt cctcccagga aacgctgctg
gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc tgaccgccga caacgttaaa
gcagtgatcc tggatatgtt cggcgctggt 900acggatacca gcagcgcgac gatcgagtgg
gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga aagtgcagac ggaattgcgt
caggcactga atggcaaaga gcgtattcag 1020gaagaggatt tgcaggagct gaattatctg
aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgt tgccgctggt gatgccgcgt
gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc cgagcaaaac gaagctgatc
gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga aagacgcgga aacgtttatg
ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt ccgagtacga atacctgcca
tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg gtctggccaa cgtggaactg
ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc cgaacggcaa gaccttcgaa
gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc gcaaaaccga gctgctgctg
gttccgaccg actttcaaac gctgactgcg 1500agcacctaa
15096502PRTArtificial
SequenceCYP71AV8-P2 amino acid sequence 6Met Ala Leu Leu Leu Ala Val Phe
Trp Ser Ala Leu Ile Ile Leu Val1 5 10
15Val Thr Tyr Thr Ile Ser Leu Leu Ile Asn Gln Trp Arg Lys
Pro Lys 20 25 30Pro Gln Gly
Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile Ile Gly 35
40 45His Met His His Leu Ile Gly Thr Met Pro His
Arg Gly Val Met Glu 50 55 60Leu Ala
Arg Lys His Gly Ser Leu Met His Leu Gln Leu Gly Glu Val65
70 75 80Ser Thr Ile Val Val Ser Ser
Pro Arg Trp Ala Lys Glu Val Leu Thr 85 90
95Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro Glu Thr Leu
Thr Gly Glu 100 105 110Ile Val
Ala Tyr His Asn Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu 115
120 125Tyr Trp Arg Gln Leu Arg Lys Leu Cys Thr
Leu Glu Leu Leu Ser Asn 130 135 140Lys
Lys Val Lys Ser Phe Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn145
150 155 160Leu Val Lys Asp Ile Arg
Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu 165
170 175Ser Glu Asn Ile Phe Lys Met Ile Ala Thr Ile Leu
Ser Arg Ala Ala 180 185 190Phe
Gly Lys Gly Ile Lys Asp Gln Met Lys Phe Thr Glu Leu Val Lys 195
200 205Glu Ile Leu Arg Leu Thr Gly Gly Phe
Asp Val Ala Asp Ile Phe Pro 210 215
220Ser Lys Lys Leu Leu His His Leu Ser Gly Lys Arg Ala Lys Leu Thr225
230 235 240Asn Ile His Asn
Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu 245
250 255His Pro Gly Asn Arg Thr Ser Ser Ser Gln
Glu Thr Leu Leu Asp Val 260 265
270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn
275 280 285Val Lys Ala Val Ile Leu Asp
Met Phe Gly Ala Gly Thr Asp Thr Ser 290 295
300Ser Ala Thr Ile Glu Trp Ala Ile Ser Glu Leu Ile Arg Cys Pro
Arg305 310 315 320Ala Met
Glu Lys Val Gln Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys
325 330 335Glu Arg Ile Gln Glu Glu Asp
Leu Gln Glu Leu Asn Tyr Leu Lys Leu 340 345
350Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Leu Pro Leu
Val Met 355 360 365Pro Arg Glu Cys
Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp Ile Pro 370
375 380Ser Lys Thr Lys Leu Ile Val Asn Val Phe Ala Ile
Asn Arg Asp Pro385 390 395
400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met Pro Glu Arg Phe Glu Asn
405 410 415Ser Pro Ile Thr Val
Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly 420
425 430Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu Gly
Leu Ala Asn Val 435 440 445Glu Leu
Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro 450
455 460Asn Gly Lys Thr Phe Glu Asp Leu Asp Met Thr
Glu Ser Phe Gly Ala465 470 475
480Thr Val Gln Arg Lys Thr Glu Leu Leu Leu Val Pro Thr Asp Phe Gln
485 490 495Thr Leu Thr Ala
Ser Thr 50071509DNAArtificial SequenceCYP71AV8-P2O DNA
sequence 7atggcactgt tgctggctgt cttttggtct gctctgatta ttttggtggt
tacctacacc 60atctccctgc tgattaacca gtggcgtaaa ccgaaaccac agggtaaatt
cccgccgggt 120ccgtggcgtc tgccgattat cggtcacatg caccatttga tcggcaccat
gccgcatcgt 180ggtgttatgg aactggcccg taagcatggc agcctgatgc acctgcaact
gggtgaagtc 240tctacgattg ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac
ctatgatatc 300accttcgcca atcgcccgga aaccctgact ggcgagatcg tcgcatacca
caacacggat 360atcgtcctgg cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg
cacgctggag 420ctgctgagca acaagaaagt gaagagcttc cagagcctgc gcgaagaaga
gtgttggaac 480ctggtcaagg acatccgcag caccggccaa ggtagcccaa tcaatctgtc
ggagaacatt 540ttcaagatga ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat
taaggatcaa 600atgaagttta ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt
tgatgtcgct 660gacatcttcc ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc
aaaactgacc 720aatatccata acaagctgga taatctgatc aataacatca tcgcagagca
cccgggcaac 780cgtacctcgt cctcccagga aacgctgctg gacgttctgc tgcgcctgaa
agagtctgcg 840gagtttccgc tgaccgccga caacgttaaa gcagtgatcc tggatatgtt
cggcgctggt 900acggatacca gcagcgcgac gatcgagtgg gcgattagcg agctgattcg
ctgccctcgc 960gcgatggaga aagtgcagac ggaattgcgt caggcactga atggcaaaga
gcgtattcag 1020gaagaggatt tgcaggagct gaattatctg aagctggtga ttaaagaaac
cctgcgcctg 1080catccgccgt tgccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt
tttgggcggt 1140tacgacattc cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa
ccgtgacccg 1200gaatactgga aagacgcgga aacgtttatg ccggagcgtt ttgagaatag
cccgattacc 1260gttatgggtt ccgagtacga atacctgcca tttggtgctg gtcgtcgtat
gtgtcctggt 1320gcagcgctgg gtctggccaa cgtggaactg ccgctggcgc acattctgta
ctatttcaac 1380tggaaactgc cgaacggcaa gaccttcgaa gatttggaca tgaccgagag
ctttggtgcc 1440actgtgcagc gcaaaaccga gctgctgctg gttccgaccg actttcaaac
gctgactgcg 1500agcacctaa
15098502PRTArtificial SequenceCYP71AV8-P2O amino acid sequence
8Met Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser
Leu Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro
Ile Ile Gly 35 40 45His Met His
His Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50
55 60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln
Leu Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Leu Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
50092133DNAMentha piperita 9atggaaccta gctctcagaa actgtctccg ttggaatttg
ttgctgctat cctgaagggc 60gactacagca gcggtcaggt tgaaggtggt ccaccgccag
gtctggcagc tatgttgatg 120gaaaataagg atttggtgat ggttctgacg acgtccgtgg
cagtcctgat cggctgtgtc 180gtggtcctgg catggcgtcg tgcggcaggt agcggtaagt
acaagcaacc tgaactgcct 240aaactggtgg tcccgaaagc agccgaaccg gaggaggcag
aggatgataa aaccaagatc 300agcgtgtttt tcggcaccca aaccggtacg gcagaaggtt
tcgcgaaggc ttttgttgaa 360gaggccaagg cgcgttatca gcaggcccgt ttcaaagtta
tcgacctgga cgactatgcg 420gcagacgatg acgagtacga agagaaactg aagaaggaaa
acttggcatt cttcttcttg 480gcgtcctacg gtgacggcga gccgacggac aacgcggcac
gcttttacaa atggtttacg 540gagggtaagg accgtggtga atggctgaac aatctgcagt
acggcgtttt tggtctgggt 600aaccgtcaat atgagcattt caataagatc gccattgtcg
tcgatgatct gatcttcgag 660caaggtggca agaagctggt tccggtgggt ctgggtgacg
atgaccagtg cattgaggat 720gattttgcgg cgtggcgtga actggtctgg ccggaactgg
ataaactgct gcgtaacgaa 780gacgacgcta ccgtggcaac cccgtacagc gccgctgtgc
tgcaataccg cgtggttttc 840cacgatcaca ttgacggcct gattagcgaa aacggtagcc
cgaacggtca tgctaatggc 900aataccgtgt acgatgcgca acacccgtgc cgtagcaacg
tcgcggtcaa gaaggaattg 960catactccgg cgagcgatcg cagctgcacc cacctggaat
ttaacattag cggtaccggc 1020ctgatgtacg agacgggtga ccacgtcggt gtgtattgcg
agaacctgtt ggaaaccgtg 1080gaggaggccg agaagttgtt gaacctgagc ccgcagacgt
acttctccgt tcacaccgac 1140aacgaggacg gtacgccgtt gagcggcagc agcctgccgc
caccgtttcc gccgtgcacc 1200ttgcgcacgg cattgaccaa atacgcagac ttgacttctg
caccgaaaaa gtcggtgctg 1260gtggcgctgg ccgagtacgc atctgaccag ggtgaagcgg
atcgtttgcg tttcttggcg 1320agcccgagcg gcaaagagga atatgcacag tacatcttgg
caagccagcg cacgctgctg 1380gaggtcatgg cggagttccc gtcggcgaaa ccgccgctgg
gtgtcttttt cgcgggtgtc 1440gctccgcgcc tgcagccgcg tttctattcc attagctcta
gcccgaagat cgcaccgttc 1500cgtattcacg tgacctgcgc cctggtttat gacaaatccc
ctaccggtcg cgttcataag 1560ggcatctgta gcacgtggat gaaaaatgcg gtcccgctgg
aagaaagcaa cgattgttcc 1620tgggctccga tcttcgtccg caacagcaac ttcaagctgc
cgaccgaccc gaaggttccg 1680attatcatga ttggtccggg taccggtctg gccccttttc
gtggcttttt gcaagagcgc 1740ttggcgttga aagagagcgg tgctgaattg ggtccggcga
tcttgttctt tggttgccgt 1800aaccgtaaaa tggactttat ttacgaggat gaactgaatg
atttcgtcaa agcgggcgtt 1860gtcagcgagc tgatcgtcgc ttttagccgc gaaggcccga
tgaaagaata cgtgcaacac 1920aaaatgagcc aacgtgcctc cgatgtgtgg aacatcatta
gcgacggtgg ttatgtttat 1980gtttgcggtg acgcgaaggg tatggctcgt gatgttcacc
gtaccctgca taccatcgca 2040caggagcaag gtagcatgtc cagctcggag gccgaaggta
tggtcaaaaa cctgcaaacc 2100accggtcgtt acctgcgtga tgtgtggtaa taa
213310709PRTMentha piperita 10Met Glu Pro Ser Ser
Gln Lys Leu Ser Pro Leu Glu Phe Val Ala Ala1 5
10 15Ile Leu Lys Gly Asp Tyr Ser Ser Gly Gln Val
Glu Gly Gly Pro Pro 20 25
30Pro Gly Leu Ala Ala Met Leu Met Glu Asn Lys Asp Leu Val Met Val
35 40 45Leu Thr Thr Ser Val Ala Val Leu
Ile Gly Cys Val Val Val Leu Ala 50 55
60Trp Arg Arg Ala Ala Gly Ser Gly Lys Tyr Lys Gln Pro Glu Leu Pro65
70 75 80Lys Leu Val Val Pro
Lys Ala Ala Glu Pro Glu Glu Ala Glu Asp Asp 85
90 95Lys Thr Lys Ile Ser Val Phe Phe Gly Thr Gln
Thr Gly Thr Ala Glu 100 105
110Gly Phe Ala Lys Ala Phe Val Glu Glu Ala Lys Ala Arg Tyr Gln Gln
115 120 125Ala Arg Phe Lys Val Ile Asp
Leu Asp Asp Tyr Ala Ala Asp Asp Asp 130 135
140Glu Tyr Glu Glu Lys Leu Lys Lys Glu Asn Leu Ala Phe Phe Phe
Leu145 150 155 160Ala Ser
Tyr Gly Asp Gly Glu Pro Thr Asp Asn Ala Ala Arg Phe Tyr
165 170 175Lys Trp Phe Thr Glu Gly Lys
Asp Arg Gly Glu Trp Leu Asn Asn Leu 180 185
190Gln Tyr Gly Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His
Phe Asn 195 200 205Lys Ile Ala Ile
Val Val Asp Asp Leu Ile Phe Glu Gln Gly Gly Lys 210
215 220Lys Leu Val Pro Val Gly Leu Gly Asp Asp Asp Gln
Cys Ile Glu Asp225 230 235
240Asp Phe Ala Ala Trp Arg Glu Leu Val Trp Pro Glu Leu Asp Lys Leu
245 250 255Leu Arg Asn Glu Asp
Asp Ala Thr Val Ala Thr Pro Tyr Ser Ala Ala 260
265 270Val Leu Gln Tyr Arg Val Val Phe His Asp His Ile
Asp Gly Leu Ile 275 280 285Ser Glu
Asn Gly Ser Pro Asn Gly His Ala Asn Gly Asn Thr Val Tyr 290
295 300Asp Ala Gln His Pro Cys Arg Ser Asn Val Ala
Val Lys Lys Glu Leu305 310 315
320His Thr Pro Ala Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asn Ile
325 330 335Ser Gly Thr Gly
Leu Met Tyr Glu Thr Gly Asp His Val Gly Val Tyr 340
345 350Cys Glu Asn Leu Leu Glu Thr Val Glu Glu Ala
Glu Lys Leu Leu Asn 355 360 365Leu
Ser Pro Gln Thr Tyr Phe Ser Val His Thr Asp Asn Glu Asp Gly 370
375 380Thr Pro Leu Ser Gly Ser Ser Leu Pro Pro
Pro Phe Pro Pro Cys Thr385 390 395
400Leu Arg Thr Ala Leu Thr Lys Tyr Ala Asp Leu Thr Ser Ala Pro
Lys 405 410 415Lys Ser Val
Leu Val Ala Leu Ala Glu Tyr Ala Ser Asp Gln Gly Glu 420
425 430Ala Asp Arg Leu Arg Phe Leu Ala Ser Pro
Ser Gly Lys Glu Glu Tyr 435 440
445Ala Gln Tyr Ile Leu Ala Ser Gln Arg Thr Leu Leu Glu Val Met Ala 450
455 460Glu Phe Pro Ser Ala Lys Pro Pro
Leu Gly Val Phe Phe Ala Gly Val465 470
475 480Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser
Ser Ser Pro Lys 485 490
495Ile Ala Pro Phe Arg Ile His Val Thr Cys Ala Leu Val Tyr Asp Lys
500 505 510Ser Pro Thr Gly Arg Val
His Lys Gly Ile Cys Ser Thr Trp Met Lys 515 520
525Asn Ala Val Pro Leu Glu Glu Ser Asn Asp Cys Ser Trp Ala
Pro Ile 530 535 540Phe Val Arg Asn Ser
Asn Phe Lys Leu Pro Thr Asp Pro Lys Val Pro545 550
555 560Ile Ile Met Ile Gly Pro Gly Thr Gly Leu
Ala Pro Phe Arg Gly Phe 565 570
575Leu Gln Glu Arg Leu Ala Leu Lys Glu Ser Gly Ala Glu Leu Gly Pro
580 585 590Ala Ile Leu Phe Phe
Gly Cys Arg Asn Arg Lys Met Asp Phe Ile Tyr 595
600 605Glu Asp Glu Leu Asn Asp Phe Val Lys Ala Gly Val
Val Ser Glu Leu 610 615 620Ile Val Ala
Phe Ser Arg Glu Gly Pro Met Lys Glu Tyr Val Gln His625
630 635 640Lys Met Ser Gln Arg Ala Ser
Asp Val Trp Asn Ile Ile Ser Asp Gly 645
650 655Gly Tyr Val Tyr Val Cys Gly Asp Ala Lys Gly Met
Ala Arg Asp Val 660 665 670His
Arg Thr Leu His Thr Ile Ala Gln Glu Gln Gly Ser Met Ser Ser 675
680 685Ser Glu Ala Glu Gly Met Val Lys Asn
Leu Gln Thr Thr Gly Arg Tyr 690 695
700Leu Arg Asp Val Trp705111992DNAArtemisia annua 11atggcactgg acaaactgga
cctgtacgta atcatcacct tagtcgtcgc cgtggccgcg 60tattttgcga aaaatcgccg
ctcgtctagc gcagccaaga aagccgcgga gagcccggtt 120attgtcgtcc cgaagaaggt
tacggaggac gaagtggacg acggtcgtaa aaaggtcacg 180gtgttcttcg gcacgcagac
tggtaccgct gaaggtttcg cgaaggcgct ggttgaagaa 240gcaaaggcgc gctatgaaaa
ggcagtgttc aaggttatcg atctggacga ttacgccgca 300gaggacgacg aatacgagga
gaagttgaaa aaggagtccc tcgccttctt cttcctggcg 360acgtacggcg atggtgagcc
gaccgataac gcagctcgtt tctacaagtg gttcaccgag 420ggtgaggaga agggtgagtg
gctggataaa ctgcaatatg cggtctttgg tctgggcaac 480cgccaatatg agcacttcaa
taagatcgca aaggttgtgg atgagaaact ggtcgagcag 540ggtgccaagc gcctggtgcc
ggttggcatg ggtgatgacg atcagtgcat cgaggatgac 600ttcaccgcct ggaaggagct
ggtgtggccg gagctggacc aactgttgcg cgacgaagat 660gacaccagcg ttgcgacgcc
gtataccgcg gcagttggcg aatatcgtgt tgtttttcat 720gataagccgg aaacctacga
tcaggatcaa ctgaccaatg gtcatgctgt gcatgacgcg 780cagcacccgt gcagaagcaa
tgttgctgtt aagaaagaat tgcactctcc gctgtccgat 840cgcagctgca cccacctgga
atttgacatc agcaataccg gtttgagcta cgaaacgggc 900gatcacgtcg gtgtgtatgt
ggaaaatctg agcgaagttg tcgatgaggc tgagaagctg 960atcggtttac caccgcacac
ctacttcagc gtgcatactg acaatgagga tggcacccca 1020ctgggcggtg ctagcctgcc
accgcctttc ccgccttgca ccctgcgcaa agccctcgct 1080agctacgctg atgtgctgag
cagcccgaag aagagcgcac tgctggcact ggcagcacac 1140gctaccgatt ccaccgaagc
cgatcgcctg aagtttttcg ctagcccggc aggcaaggac 1200gagtatgcgc agtggattgt
cgcgagccac cgtagcctgc tggaagtgat ggaggcgttc 1260ccgagcgcga agcctccgct
cggcgtcttt ttcgcatcgg ttgcgcctcg cctgcaaccg 1320cgttattact caatcagcag
ctctccgaaa ttcgcgccga atcgtattca cgttacttgc 1380gcgctggttt atgagcaaac
tccgagcggt cgtgttcaca agggcgtttg ctctacctgg 1440atgaaaaacg cggttcctat
gacggagagc caagactgta gctgggctcc gatttatgtt 1500cgcacgtcta actttcgcct
gcctagcgac ccgaaggtgc cagtgattat gattggtccg 1560ggtaccggtc tggcaccgtt
ccgcggtttc ctgcaagaac gtctggcaca gaaagaagct 1620ggtacggaat tgggcaccgc
aattctgttc tttggttgtc gtaatcgtaa agtggacttt 1680atctatgagg atgaactgaa
caacttcgtg gaaaccggtg ccctgagcga attggtgacg 1740gctttttctc gtgagggtgc
gaccaaagaa tacgtgcagc acaagatgac gcagaaagca 1800agcgacattt ggaatctgct
gtccgaaggt gcgtacctgt atgtctgtgg cgacgcgaag 1860ggcatggcaa aagacgttca
ccgtaccctg cacaccattg tgcaggagca aggtagcctg 1920gactcttcga aggcggaatt
gtacgtcaaa aacctgcaaa tggccggtcg ttatctgcgt 1980gacgtttggt aa
199212663PRTArtemisia annua
12Met Ala Leu Asp Lys Leu Asp Leu Tyr Val Ile Ile Thr Leu Val Val1
5 10 15Ala Val Ala Ala Tyr Phe
Ala Lys Asn Arg Arg Ser Ser Ser Ala Ala 20 25
30Lys Lys Ala Ala Glu Ser Pro Val Ile Val Val Pro Lys
Lys Val Thr 35 40 45Glu Asp Glu
Val Asp Asp Gly Arg Lys Lys Val Thr Val Phe Phe Gly 50
55 60Thr Gln Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala
Leu Val Glu Glu65 70 75
80Ala Lys Ala Arg Tyr Glu Lys Ala Val Phe Lys Val Ile Asp Leu Asp
85 90 95Asp Tyr Ala Ala Glu Asp
Asp Glu Tyr Glu Glu Lys Leu Lys Lys Glu 100
105 110Ser Leu Ala Phe Phe Phe Leu Ala Thr Tyr Gly Asp
Gly Glu Pro Thr 115 120 125Asp Asn
Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Gly Glu Glu Lys 130
135 140Gly Glu Trp Leu Asp Lys Leu Gln Tyr Ala Val
Phe Gly Leu Gly Asn145 150 155
160Arg Gln Tyr Glu His Phe Asn Lys Ile Ala Lys Val Val Asp Glu Lys
165 170 175Leu Val Glu Gln
Gly Ala Lys Arg Leu Val Pro Val Gly Met Gly Asp 180
185 190Asp Asp Gln Cys Ile Glu Asp Asp Phe Thr Ala
Trp Lys Glu Leu Val 195 200 205Trp
Pro Glu Leu Asp Gln Leu Leu Arg Asp Glu Asp Asp Thr Ser Val 210
215 220Ala Thr Pro Tyr Thr Ala Ala Val Gly Glu
Tyr Arg Val Val Phe His225 230 235
240Asp Lys Pro Glu Thr Tyr Asp Gln Asp Gln Leu Thr Asn Gly His
Ala 245 250 255Val His Asp
Ala Gln His Pro Cys Arg Ser Asn Val Ala Val Lys Lys 260
265 270Glu Leu His Ser Pro Leu Ser Asp Arg Ser
Cys Thr His Leu Glu Phe 275 280
285Asp Ile Ser Asn Thr Gly Leu Ser Tyr Glu Thr Gly Asp His Val Gly 290
295 300Val Tyr Val Glu Asn Leu Ser Glu
Val Val Asp Glu Ala Glu Lys Leu305 310
315 320Ile Gly Leu Pro Pro His Thr Tyr Phe Ser Val His
Thr Asp Asn Glu 325 330
335Asp Gly Thr Pro Leu Gly Gly Ala Ser Leu Pro Pro Pro Phe Pro Pro
340 345 350Cys Thr Leu Arg Lys Ala
Leu Ala Ser Tyr Ala Asp Val Leu Ser Ser 355 360
365Pro Lys Lys Ser Ala Leu Leu Ala Leu Ala Ala His Ala Thr
Asp Ser 370 375 380Thr Glu Ala Asp Arg
Leu Lys Phe Phe Ala Ser Pro Ala Gly Lys Asp385 390
395 400Glu Tyr Ala Gln Trp Ile Val Ala Ser His
Arg Ser Leu Leu Glu Val 405 410
415Met Glu Ala Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala
420 425 430Ser Val Ala Pro Arg
Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser 435
440 445Pro Lys Phe Ala Pro Asn Arg Ile His Val Thr Cys
Ala Leu Val Tyr 450 455 460Glu Gln Thr
Pro Ser Gly Arg Val His Lys Gly Val Cys Ser Thr Trp465
470 475 480Met Lys Asn Ala Val Pro Met
Thr Glu Ser Gln Asp Cys Ser Trp Ala 485
490 495Pro Ile Tyr Val Arg Thr Ser Asn Phe Arg Leu Pro
Ser Asp Pro Lys 500 505 510Val
Pro Val Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg 515
520 525Gly Phe Leu Gln Glu Arg Leu Ala Gln
Lys Glu Ala Gly Thr Glu Leu 530 535
540Gly Thr Ala Ile Leu Phe Phe Gly Cys Arg Asn Arg Lys Val Asp Phe545
550 555 560Ile Tyr Glu Asp
Glu Leu Asn Asn Phe Val Glu Thr Gly Ala Leu Ser 565
570 575Glu Leu Val Thr Ala Phe Ser Arg Glu Gly
Ala Thr Lys Glu Tyr Val 580 585
590Gln His Lys Met Thr Gln Lys Ala Ser Asp Ile Trp Asn Leu Leu Ser
595 600 605Glu Gly Ala Tyr Leu Tyr Val
Cys Gly Asp Ala Lys Gly Met Ala Lys 610 615
620Asp Val His Arg Thr Leu His Thr Ile Val Gln Glu Gln Gly Ser
Leu625 630 635 640Asp Ser
Ser Lys Ala Glu Leu Tyr Val Lys Asn Leu Gln Met Ala Gly
645 650 655Arg Tyr Leu Arg Asp Val Trp
660133534DNAArtificial SequencepCWori-CYP71AV8-P2-aaCPR insert
DNA sequence 13catatggctc tgttattagc agttttttgg tcggcgctta taatcctcgt
agtaacctac 60accatatccc tcctaatcaa ccaatggcga aaaccgaaac cccaagggaa
gttccccccg 120ggcccatggc gtctgccgat tatcggtcac atgcaccatt tgatcggcac
catgccgcat 180cgtggtgtta tggaactggc ccgtaagcat ggcagcctga tgcacctgca
actgggtgaa 240gtctctacga ttgttgtcag cagcccgcgt tgggcgaaag aggtcttgac
cacctatgat 300atcaccttcg ccaatcgccc ggaaaccctg actggcgaga tcgtcgcata
ccacaacacg 360gatatcgtcc tggcgccgta tggtgagtat tggcgtcaac tgcgtaaact
gtgcacgctg 420gagctgctga gcaacaagaa agtgaagagc ttccagagcc tgcgcgaaga
agagtgttgg 480aacctggtca aggacatccg cagcaccggc caaggtagcc caatcaatct
gtcggagaac 540attttcaaga tgattgcgac gattctgagc cgtgctgcgt tcggtaaggg
tattaaggat 600caaatgaagt ttaccgaact ggtgaaagaa atcctgcgtc tgaccggcgg
ttttgatgtc 660gctgacatct tccctagcaa gaagttgctg caccacctga gcggcaagcg
tgcaaaactg 720accaatatcc ataacaagct ggataatctg atcaataaca tcatcgcaga
gcacccgggc 780aaccgtacct cgtcctccca ggaaacgctg ctggacgttc tgctgcgcct
gaaagagtct 840gcggagtttc cgctgaccgc cgacaacgtt aaagcagtga tcctggatat
gttcggcgct 900ggtacggata ccagcagcgc gacgatcgag tgggcgatta gcgagctgat
tcgctgccct 960cgcgcgatgg agaaagtgca gacggaattg cgtcaggcac tgaatggcaa
agagcgtatt 1020caggaagagg atttgcagga gctgaattat ctgaagctgg tgattaaaga
aaccctgcgc 1080ctgcatccgc cgttgccgct ggtgatgccg cgtgagtgcc gtgaaccgtg
tgttttgggc 1140ggttacgaca ttccgagcaa aacgaagctg atcgttaatg ttttcgcgat
taaccgtgac 1200ccggaatact ggaaagacgc ggaaacgttt atgccggagc gttttgagaa
tagcccgatt 1260accgttatgg gttccgagta cgaatacctg ccatttggtg ctggtcgtcg
tatgtgtcct 1320ggtgcagcgc tgggtctggc caacgtggaa ctgccgctgg cgcacattct
gtactatttc 1380aactggaaac tgccgaacgg caagaccttc gaagatttgg acatgaccga
gagctttggt 1440gccactgtgc agcgcaaaac cgagctgctg ctggttccga ccgactttca
aacgctgact 1500gcgagcacct aatgagtcga cagaggaaga tataccatgg cactggacaa
actggacctg 1560tacgtaatca tcaccttagt cgtcgccgtg gccgcgtatt ttgcgaaaaa
tcgccgctcg 1620tctagcgcag ccaagaaagc cgcggagagc ccggttattg tcgtcccgaa
gaaggttacg 1680gaggacgaag tggacgacgg tcgtaaaaag gtcacggtgt tcttcggcac
gcagactggt 1740accgctgaag gtttcgcgaa ggcgctggtt gaagaagcaa aggcgcgcta
tgaaaaggca 1800gtgttcaagg ttatcgatct ggacgattac gccgcagagg acgacgaata
cgaggagaag 1860ttgaaaaagg agtccctcgc cttcttcttc ctggcgacgt acggcgatgg
tgagccgacc 1920gataacgcag ctcgtttcta caagtggttc accgagggtg aggagaaggg
tgagtggctg 1980gataaactgc aatatgcggt ctttggtctg ggcaaccgcc aatatgagca
cttcaataag 2040atcgcaaagg ttgtggatga gaaactggtc gagcagggtg ccaagcgcct
ggtgccggtt 2100ggcatgggtg atgacgatca gtgcatcgag gatgacttca ccgcctggaa
ggagctggtg 2160tggccggagc tggaccaact gttgcgcgac gaagatgaca ccagcgttgc
gacgccgtat 2220accgcggcag ttggcgaata tcgtgttgtt tttcatgata agccggaaac
ctacgatcag 2280gatcaactga ccaatggtca tgctgtgcat gacgcgcagc acccgtgcag
aagcaatgtt 2340gctgttaaga aagaattgca ctctccgctg tccgatcgca gctgcaccca
cctggaattt 2400gacatcagca ataccggttt gagctacgaa acgggcgatc acgtcggtgt
gtatgtggaa 2460aatctgagcg aagttgtcga tgaggctgag aagctgatcg gtttaccacc
gcacacctac 2520ttcagcgtgc atactgacaa tgaggatggc accccactgg gcggtgctag
cctgccaccg 2580cctttcccgc cttgcaccct gcgcaaagcc ctcgctagct acgctgatgt
gctgagcagc 2640ccgaagaaga gcgcactgct ggcactggca gcacacgcta ccgattccac
cgaagccgat 2700cgcctgaagt ttttcgctag cccggcaggc aaggacgagt atgcgcagtg
gattgtcgcg 2760agccaccgta gcctgctgga agtgatggag gcgttcccga gcgcgaagcc
tccgctcggc 2820gtctttttcg catcggttgc gcctcgcctg caaccgcgtt attactcaat
cagcagctct 2880ccgaaattcg cgccgaatcg tattcacgtt acttgcgcgc tggtttatga
gcaaactccg 2940agcggtcgtg ttcacaaggg cgtttgctct acctggatga aaaacgcggt
tcctatgacg 3000gagagccaag actgtagctg ggctccgatt tatgttcgca cgtctaactt
tcgcctgcct 3060agcgacccga aggtgccagt gattatgatt ggtccgggta ccggtctggc
accgttccgc 3120ggtttcctgc aagaacgtct ggcacagaaa gaagctggta cggaattggg
caccgcaatt 3180ctgttctttg gttgtcgtaa tcgtaaagtg gactttatct atgaggatga
actgaacaac 3240ttcgtggaaa ccggtgccct gagcgaattg gtgacggctt tttctcgtga
gggtgcgacc 3300aaagaatacg tgcagcacaa gatgacgcag aaagcaagcg acatttggaa
tctgctgtcc 3360gaaggtgcgt acctgtatgt ctgtggcgac gcgaagggca tggcaaaaga
cgttcaccgt 3420accctgcaca ccattgtgca ggagcaaggt agcctggact cttcgaaggc
ggaattgtac 3480gtcaaaaacc tgcaaatggc cggtcgttat ctgcgtgacg tttggtaaaa
gctt 3534143534DNAArtificial SequencepCWori-CYP71AV8-P2O-aaCPR
insert DNA sequence 14catatggcac tgttgctggc tgtcttttgg tctgctctga
ttattttggt ggttacctac 60accatctccc tgctgattaa ccagtggcgt aaaccgaaac
cacagggtaa attcccgccg 120ggtccgtggc gtctgccgat tatcggtcac atgcaccatt
tgatcggcac catgccgcat 180cgtggtgtta tggaactggc ccgtaagcat ggcagcctga
tgcacctgca actgggtgaa 240gtctctacga ttgttgtcag cagcccgcgt tgggcgaaag
aggtcttgac cacctatgat 300atcaccttcg ccaatcgccc ggaaaccctg actggcgaga
tcgtcgcata ccacaacacg 360gatatcgtcc tggcgccgta tggtgagtat tggcgtcaac
tgcgtaaact gtgcacgctg 420gagctgctga gcaacaagaa agtgaagagc ttccagagcc
tgcgcgaaga agagtgttgg 480aacctggtca aggacatccg cagcaccggc caaggtagcc
caatcaatct gtcggagaac 540attttcaaga tgattgcgac gattctgagc cgtgctgcgt
tcggtaaggg tattaaggat 600caaatgaagt ttaccgaact ggtgaaagaa atcctgcgtc
tgaccggcgg ttttgatgtc 660gctgacatct tccctagcaa gaagttgctg caccacctga
gcggcaagcg tgcaaaactg 720accaatatcc ataacaagct ggataatctg atcaataaca
tcatcgcaga gcacccgggc 780aaccgtacct cgtcctccca ggaaacgctg ctggacgttc
tgctgcgcct gaaagagtct 840gcggagtttc cgctgaccgc cgacaacgtt aaagcagtga
tcctggatat gttcggcgct 900ggtacggata ccagcagcgc gacgatcgag tgggcgatta
gcgagctgat tcgctgccct 960cgcgcgatgg agaaagtgca gacggaattg cgtcaggcac
tgaatggcaa agagcgtatt 1020caggaagagg atttgcagga gctgaattat ctgaagctgg
tgattaaaga aaccctgcgc 1080ctgcatccgc cgttgccgct ggtgatgccg cgtgagtgcc
gtgaaccgtg tgttttgggc 1140ggttacgaca ttccgagcaa aacgaagctg atcgttaatg
ttttcgcgat taaccgtgac 1200ccggaatact ggaaagacgc ggaaacgttt atgccggagc
gttttgagaa tagcccgatt 1260accgttatgg gttccgagta cgaatacctg ccatttggtg
ctggtcgtcg tatgtgtcct 1320ggtgcagcgc tgggtctggc caacgtggaa ctgccgctgg
cgcacattct gtactatttc 1380aactggaaac tgccgaacgg caagaccttc gaagatttgg
acatgaccga gagctttggt 1440gccactgtgc agcgcaaaac cgagctgctg ctggttccga
ccgactttca aacgctgact 1500gcgagcacct aatgagtcga cagaggaaga tataccatgg
cactggacaa actggacctg 1560tacgtaatca tcaccttagt cgtcgccgtg gccgcgtatt
ttgcgaaaaa tcgccgctcg 1620tctagcgcag ccaagaaagc cgcggagagc ccggttattg
tcgtcccgaa gaaggttacg 1680gaggacgaag tggacgacgg tcgtaaaaag gtcacggtgt
tcttcggcac gcagactggt 1740accgctgaag gtttcgcgaa ggcgctggtt gaagaagcaa
aggcgcgcta tgaaaaggca 1800gtgttcaagg ttatcgatct ggacgattac gccgcagagg
acgacgaata cgaggagaag 1860ttgaaaaagg agtccctcgc cttcttcttc ctggcgacgt
acggcgatgg tgagccgacc 1920gataacgcag ctcgtttcta caagtggttc accgagggtg
aggagaaggg tgagtggctg 1980gataaactgc aatatgcggt ctttggtctg ggcaaccgcc
aatatgagca cttcaataag 2040atcgcaaagg ttgtggatga gaaactggtc gagcagggtg
ccaagcgcct ggtgccggtt 2100ggcatgggtg atgacgatca gtgcatcgag gatgacttca
ccgcctggaa ggagctggtg 2160tggccggagc tggaccaact gttgcgcgac gaagatgaca
ccagcgttgc gacgccgtat 2220accgcggcag ttggcgaata tcgtgttgtt tttcatgata
agccggaaac ctacgatcag 2280gatcaactga ccaatggtca tgctgtgcat gacgcgcagc
acccgtgcag aagcaatgtt 2340gctgttaaga aagaattgca ctctccgctg tccgatcgca
gctgcaccca cctggaattt 2400gacatcagca ataccggttt gagctacgaa acgggcgatc
acgtcggtgt gtatgtggaa 2460aatctgagcg aagttgtcga tgaggctgag aagctgatcg
gtttaccacc gcacacctac 2520ttcagcgtgc atactgacaa tgaggatggc accccactgg
gcggtgctag cctgccaccg 2580cctttcccgc cttgcaccct gcgcaaagcc ctcgctagct
acgctgatgt gctgagcagc 2640ccgaagaaga gcgcactgct ggcactggca gcacacgcta
ccgattccac cgaagccgat 2700cgcctgaagt ttttcgctag cccggcaggc aaggacgagt
atgcgcagtg gattgtcgcg 2760agccaccgta gcctgctgga agtgatggag gcgttcccga
gcgcgaagcc tccgctcggc 2820gtctttttcg catcggttgc gcctcgcctg caaccgcgtt
attactcaat cagcagctct 2880ccgaaattcg cgccgaatcg tattcacgtt acttgcgcgc
tggtttatga gcaaactccg 2940agcggtcgtg ttcacaaggg cgtttgctct acctggatga
aaaacgcggt tcctatgacg 3000gagagccaag actgtagctg ggctccgatt tatgttcgca
cgtctaactt tcgcctgcct 3060agcgacccga aggtgccagt gattatgatt ggtccgggta
ccggtctggc accgttccgc 3120ggtttcctgc aagaacgtct ggcacagaaa gaagctggta
cggaattggg caccgcaatt 3180ctgttctttg gttgtcgtaa tcgtaaagtg gactttatct
atgaggatga actgaacaac 3240ttcgtggaaa ccggtgccct gagcgaattg gtgacggctt
tttctcgtga gggtgcgacc 3300aaagaatacg tgcagcacaa gatgacgcag aaagcaagcg
acatttggaa tctgctgtcc 3360gaaggtgcgt acctgtatgt ctgtggcgac gcgaagggca
tggcaaaaga cgttcaccgt 3420accctgcaca ccattgtgca ggagcaaggt agcctggact
cttcgaaggc ggaattgtac 3480gtcaaaaacc tgcaaatggc cggtcgttat ctgcgtgacg
tttggtaaaa gctt 3534153684DNAArtificial
SequencepCWori-CYP71AV8-P2-CPRm insert DNA sequence 15catatggctc
tgttattagc agttttttgg tcggcgctta taatcctcgt agtaacctac 60accatatccc
tcctaatcaa ccaatggcga aaaccgaaac cccaagggaa gttccccccg 120ggcccatggc
gtctgccgat tatcggtcac atgcaccatt tgatcggcac catgccgcat 180cgtggtgtta
tggaactggc ccgtaagcat ggcagcctga tgcacctgca actgggtgaa 240gtctctacga
ttgttgtcag cagcccgcgt tgggcgaaag aggtcttgac cacctatgat 300atcaccttcg
ccaatcgccc ggaaaccctg actggcgaga tcgtcgcata ccacaacacg 360gatatcgtcc
tggcgccgta tggtgagtat tggcgtcaac tgcgtaaact gtgcacgctg 420gagctgctga
gcaacaagaa agtgaagagc ttccagagcc tgcgcgaaga agagtgttgg 480aacctggtca
aggacatccg cagcaccggc caaggtagcc caatcaatct gtcggagaac 540attttcaaga
tgattgcgac gattctgagc cgtgctgcgt tcggtaaggg tattaaggat 600caaatgaagt
ttaccgaact ggtgaaagaa atcctgcgtc tgaccggcgg ttttgatgtc 660gctgacatct
tccctagcaa gaagttgctg caccacctga gcggcaagcg tgcaaaactg 720accaatatcc
ataacaagct ggataatctg atcaataaca tcatcgcaga gcacccgggc 780aaccgtacct
cgtcctccca ggaaacgctg ctggacgttc tgctgcgcct gaaagagtct 840gcggagtttc
cgctgaccgc cgacaacgtt aaagcagtga tcctggatat gttcggcgct 900ggtacggata
ccagcagcgc gacgatcgag tgggcgatta gcgagctgat tcgctgccct 960cgcgcgatgg
agaaagtgca gacggaattg cgtcaggcac tgaatggcaa agagcgtatt 1020caggaagagg
atttgcagga gctgaattat ctgaagctgg tgattaaaga aaccctgcgc 1080ctgcatccgc
cgttgccgct ggtgatgccg cgtgagtgcc gtgaaccgtg tgttttgggc 1140ggttacgaca
ttccgagcaa aacgaagctg atcgttaatg ttttcgcgat taaccgtgac 1200ccggaatact
ggaaagacgc ggaaacgttt atgccggagc gttttgagaa tagcccgatt 1260accgttatgg
gttccgagta cgaatacctg ccatttggtg ctggtcgtcg tatgtgtcct 1320ggtgcagcgc
tgggtctggc caacgtggaa ctgccgctgg cgcacattct gtactatttc 1380aactggaaac
tgccgaacgg caagaccttc gaagatttgg acatgaccga gagctttggt 1440gccactgtgc
agcgcaaaac cgagctgctg ctggttccga ccgactttca aaccctgact 1500gcgagcacct
aatgagtcga ctaactttaa gaaggagata tatccatgga acctagctct 1560cagaaactgt
ctccgttgga atttgttgct gctatcctga agggcgacta cagcagcggt 1620caggttgaag
gtggtccacc gccaggtctg gcagctatgt tgatggaaaa taaggatttg 1680gtgatggttc
tgacgacgtc cgtggcagtc ctgatcggct gtgtcgtggt cctggcatgg 1740cgtcgtgcgg
caggtagcgg taagtacaag caacctgaac tgcctaaact ggtggtcccg 1800aaagcagccg
aaccggagga ggcagaggat gataaaacca agatcagcgt gtttttcggc 1860acccaaaccg
gtacggcaga aggtttcgcg aaggcttttg ttgaagaggc caaggcgcgt 1920tatcagcagg
cccgtttcaa agttatcgac ctggacgact atgcggcaga cgatgacgag 1980tacgaagaga
aactgaagaa ggaaaacttg gcattcttct tcttggcgtc ctacggtgac 2040ggcgagccga
cggacaacgc ggcacgcttt tacaaatggt ttacggaggg taaggaccgt 2100ggtgaatggc
tgaacaatct gcagtacggc gtttttggtc tgggtaaccg tcaatatgag 2160catttcaata
agatcgccat tgtcgtcgat gatctgatct tcgagcaagg tggcaagaag 2220ctggttccgg
tgggtctggg tgacgatgac cagtgcattg aggatgattt tgcggcgtgg 2280cgtgaactgg
tctggccgga actggataaa ctgctgcgta acgaagacga cgctaccgtg 2340gcaaccccgt
acagcgccgc tgtgctgcaa taccgcgtgg ttttccacga tcacattgac 2400ggcctgatta
gcgaaaacgg tagcccgaac ggtcatgcta atggcaatac cgtgtacgat 2460gcgcaacacc
cgtgccgtag caacgtcgcg gtcaagaagg aattgcatac tccggcgagc 2520gatcgcagct
gcacccacct ggaatttaac attagcggta ccggcctgat gtacgagacg 2580ggtgaccacg
tcggtgtgta ttgcgagaac ctgttggaaa ccgtggagga ggccgagaag 2640ttgttgaacc
tgagcccgca gacgtacttc tccgttcaca ccgacaacga ggacggtacg 2700ccgttgagcg
gcagcagcct gccgccaccg tttccgccgt gcaccttgcg cacggcattg 2760accaaatacg
cagacttgac ttctgcaccg aaaaagtcgg tgctggtggc gctggccgag 2820tacgcatctg
accagggtga agcggatcgt ttgcgtttct tggcgagccc gagcggcaaa 2880gaggaatatg
cacagtacat cttggcaagc cagcgcacgc tgctggaggt catggcggag 2940ttcccgtcgg
cgaaaccgcc gctgggtgtc tttttcgcgg gtgtcgctcc gcgcctgcag 3000ccgcgtttct
attccattag ctctagcccg aagatcgcac cgttccgtat tcacgtgacc 3060tgcgccctgg
tttatgacaa atcccctacc ggtcgcgttc ataagggcat ctgtagcacg 3120tggatgaaaa
atgcggtccc gctggaagaa agcaacgatt gttcctgggc tccgatcttc 3180gtccgcaaca
gcaacttcaa gctgccgacc gacccgaagg ttccgattat catgattggt 3240ccgggtaccg
gtctggcccc ttttcgtggc tttttgcaag agcgcttggc gttgaaagag 3300agcggtgctg
aattgggtcc ggcgatcttg ttctttggtt gccgtaaccg taaaatggac 3360tttatttacg
aggatgaact gaatgatttc gtcaaagcgg gcgttgtcag cgagctgatc 3420gtcgctttta
gccgcgaagg cccgatgaaa gaatacgtgc aacacaaaat gagccaacgt 3480gcctccgatg
tgtggaacat cattagcgac ggtggttatg tttatgtttg cggtgacgcg 3540aagggtatgg
ctcgtgatgt tcaccgtacc ctgcatacca tcgcacagga gcaaggtagc 3600atgtccagct
cggaggccga aggtatggtc aaaaacctgc aaaccaccgg tcgttacctg 3660cgtgatgtgt
ggtaataaaa gctt
3684163684DNAArtificial SequencepCWori-CYP71AV8-P2O-CPRm insert DNA
sequence 16catatggcac tgttgctggc tgtcttttgg tctgctctga ttattttggt
ggttacctac 60accatctccc tgctgattaa ccagtggcgt aaaccgaaac cacagggtaa
attcccgccg 120ggtccgtggc gtctgccgat tatcggtcac atgcaccatt tgatcggcac
catgccgcat 180cgtggtgtta tggaactggc ccgtaagcat ggcagcctga tgcacctgca
actgggtgaa 240gtctctacga ttgttgtcag cagcccgcgt tgggcgaaag aggtcttgac
cacctatgat 300atcaccttcg ccaatcgccc ggaaaccctg actggcgaga tcgtcgcata
ccacaacacg 360gatatcgtcc tggcgccgta tggtgagtat tggcgtcaac tgcgtaaact
gtgcacgctg 420gagctgctga gcaacaagaa agtgaagagc ttccagagcc tgcgcgaaga
agagtgttgg 480aacctggtca aggacatccg cagcaccggc caaggtagcc caatcaatct
gtcggagaac 540attttcaaga tgattgcgac gattctgagc cgtgctgcgt tcggtaaggg
tattaaggat 600caaatgaagt ttaccgaact ggtgaaagaa atcctgcgtc tgaccggcgg
ttttgatgtc 660gctgacatct tccctagcaa gaagttgctg caccacctga gcggcaagcg
tgcaaaactg 720accaatatcc ataacaagct ggataatctg atcaataaca tcatcgcaga
gcacccgggc 780aaccgtacct cgtcctccca ggaaacgctg ctggacgttc tgctgcgcct
gaaagagtct 840gcggagtttc cgctgaccgc cgacaacgtt aaagcagtga tcctggatat
gttcggcgct 900ggtacggata ccagcagcgc gacgatcgag tgggcgatta gcgagctgat
tcgctgccct 960cgcgcgatgg agaaagtgca gacggaattg cgtcaggcac tgaatggcaa
agagcgtatt 1020caggaagagg atttgcagga gctgaattat ctgaagctgg tgattaaaga
aaccctgcgc 1080ctgcatccgc cgttgccgct ggtgatgccg cgtgagtgcc gtgaaccgtg
tgttttgggc 1140ggttacgaca ttccgagcaa aacgaagctg atcgttaatg ttttcgcgat
taaccgtgac 1200ccggaatact ggaaagacgc ggaaacgttt atgccggagc gttttgagaa
tagcccgatt 1260accgttatgg gttccgagta cgaatacctg ccatttggtg ctggtcgtcg
tatgtgtcct 1320ggtgcagcgc tgggtctggc caacgtggaa ctgccgctgg cgcacattct
gtactatttc 1380aactggaaac tgccgaacgg caagaccttc gaagatttgg acatgaccga
gagctttggt 1440gccactgtgc agcgcaaaac cgagctgctg ctggttccga ccgactttca
aacgctgact 1500gcgagcacct aatgagtcga ctaactttaa gaaggagata tatccatgga
acctagctct 1560cagaaactgt ctccgttgga atttgttgct gctatcctga agggcgacta
cagcagcggt 1620caggttgaag gtggtccacc gccaggtctg gcagctatgt tgatggaaaa
taaggatttg 1680gtgatggttc tgacgacgtc cgtggcagtc ctgatcggct gtgtcgtggt
cctggcatgg 1740cgtcgtgcgg caggtagcgg taagtacaag caacctgaac tgcctaaact
ggtggtcccg 1800aaagcagccg aaccggagga ggcagaggat gataaaacca agatcagcgt
gtttttcggc 1860acccaaaccg gtacggcaga aggtttcgcg aaggcttttg ttgaagaggc
caaggcgcgt 1920tatcagcagg cccgtttcaa agttatcgac ctggacgact atgcggcaga
cgatgacgag 1980tacgaagaga aactgaagaa ggaaaacttg gcattcttct tcttggcgtc
ctacggtgac 2040ggcgagccga cggacaacgc ggcacgcttt tacaaatggt ttacggaggg
taaggaccgt 2100ggtgaatggc tgaacaatct gcagtacggc gtttttggtc tgggtaaccg
tcaatatgag 2160catttcaata agatcgccat tgtcgtcgat gatctgatct tcgagcaagg
tggcaagaag 2220ctggttccgg tgggtctggg tgacgatgac cagtgcattg aggatgattt
tgcggcgtgg 2280cgtgaactgg tctggccgga actggataaa ctgctgcgta acgaagacga
cgctaccgtg 2340gcaaccccgt acagcgccgc tgtgctgcaa taccgcgtgg ttttccacga
tcacattgac 2400ggcctgatta gcgaaaacgg tagcccgaac ggtcatgcta atggcaatac
cgtgtacgat 2460gcgcaacacc cgtgccgtag caacgtcgcg gtcaagaagg aattgcatac
tccggcgagc 2520gatcgcagct gcacccacct ggaatttaac attagcggta ccggcctgat
gtacgagacg 2580ggtgaccacg tcggtgtgta ttgcgagaac ctgttggaaa ccgtggagga
ggccgagaag 2640ttgttgaacc tgagcccgca gacgtacttc tccgttcaca ccgacaacga
ggacggtacg 2700ccgttgagcg gcagcagcct gccgccaccg tttccgccgt gcaccttgcg
cacggcattg 2760accaaatacg cagacttgac ttctgcaccg aaaaagtcgg tgctggtggc
gctggccgag 2820tacgcatctg accagggtga agcggatcgt ttgcgtttct tggcgagccc
gagcggcaaa 2880gaggaatatg cacagtacat cttggcaagc cagcgcacgc tgctggaggt
catggcggag 2940ttcccgtcgg cgaaaccgcc gctgggtgtc tttttcgcgg gtgtcgctcc
gcgcctgcag 3000ccgcgtttct attccattag ctctagcccg aagatcgcac cgttccgtat
tcacgtgacc 3060tgcgccctgg tttatgacaa atcccctacc ggtcgcgttc ataagggcat
ctgtagcacg 3120tggatgaaaa atgcggtccc gctggaagaa agcaacgatt gttcctgggc
tccgatcttc 3180gtccgcaaca gcaacttcaa gctgccgacc gacccgaagg ttccgattat
catgattggt 3240ccgggtaccg gtctggcccc ttttcgtggc tttttgcaag agcgcttggc
gttgaaagag 3300agcggtgctg aattgggtcc ggcgatcttg ttctttggtt gccgtaaccg
taaaatggac 3360tttatttacg aggatgaact gaatgatttc gtcaaagcgg gcgttgtcag
cgagctgatc 3420gtcgctttta gccgcgaagg cccgatgaaa gaatacgtgc aacacaaaat
gagccaacgt 3480gcctccgatg tgtggaacat cattagcgac ggtggttatg tttatgtttg
cggtgacgcg 3540aagggtatgg ctcgtgatgt tcaccgtacc ctgcatacca tcgcacagga
gcaaggtagc 3600atgtccagct cggaggccga aggtatggtc aaaaacctgc aaaccaccgg
tcgttacctg 3660cgtgatgtgt ggtaataaaa gctt
3684173498DNAArtificial SequencepCWori-CYP71AV8-65188-aaCPR
insert DNA sequence 17catatggcac tcttactggc agtattctgg tccgccctga
tcattcttgt aacccgcacg 60actagcaaaa agaatctgtt gccggagcca tggcgtctgc
cgattatcgg tcacatgcac 120catttgatcg gcaccatgcc gcatcgtggt gttatggaac
tggcccgtaa gcatggcagc 180ctgatgcacc tgcaactggg tgaagtctct acgattgttg
tcagcagccc gcgttgggcg 240aaagaggtct tgaccaccta tgatatcacc ttcgccaatc
gcccggaaac cctgactggc 300gagatcgtcg cataccacaa cacggatatc gtcctggcgc
cgtatggtga gtattggcgt 360caactgcgta aactgtgcac gctggagctg ctgagcaaca
agaaagtgaa gagcttccag 420agcctgcgcg aagaagagtg ttggaacctg gtcaaggaca
tccgcagcac cggccaaggt 480agcccaatca atctgtcgga gaacattttc aagatgattg
cgacgattct gagccgtgct 540gcgttcggta agggtattaa ggatcaaatg aagtttaccg
aactggtgaa agaaatcctg 600cgtctgaccg gcggttttga tgtcgctgac atcttcccta
gcaagaagtt gctgcaccac 660ctgagcggca agcgtgcaaa actgaccaat atccataaca
agctggataa tctgatcaat 720aacatcatcg cagagcaccc gggcaaccgt acctcgtcct
cccaggaaac gctgctggac 780gttctgctgc gcctgaaaga gtctgcggag tttccgctga
ccgccgacaa cgttaaagca 840gtgatcctgg atatgttcgg cgctggtacg gataccagca
gcgcgacgat cgagtgggcg 900attagcgagc tgattcgctg ccctcgcgcg atggagaaag
tgcagacgga attgcgtcag 960gcactgaatg gcaaagagcg tattcaggaa gaggatttgc
aggagctgaa ttatctgaag 1020ctggtgatta aagaaaccct gcgcctgcat ccgccgttgc
cgctggtgat gccgcgtgag 1080tgccgtgaac cgtgtgtttt gggcggttac gacattccga
gcaaaacgaa gctgatcgtt 1140aatgttttcg cgattaaccg tgacccggaa tactggaaag
acgcggaaac gtttatgccg 1200gagcgttttg agaatagccc gattaccgtt atgggttccg
agtacgaata cctgccattt 1260ggtgctggtc gtcgtatgtg tcctggtgca gcgctgggtc
tggccaacgt ggaactgccg 1320ctggcgcaca ttctgtacta tttcaactgg aaactgccga
acggcaagac cttcgaagat 1380ttggacatga ccgagagctt tggtgccact gtgcagcgca
aaaccgagct gctgctggtt 1440ccgaccgact ttcaaacgct gactgcgagc acctaatgag
tcgacagagg aagatatacc 1500atggcactgg acaaactgga cctgtacgta atcatcacct
tagtcgtcgc cgtggccgcg 1560tattttgcga aaaatcgccg ctcgtctagc gcagccaaga
aagccgcgga gagcccggtt 1620attgtcgtcc cgaagaaggt tacggaggac gaagtggacg
acggtcgtaa aaaggtcacg 1680gtgttcttcg gcacgcagac tggtaccgct gaaggtttcg
cgaaggcgct ggttgaagaa 1740gcaaaggcgc gctatgaaaa ggcagtgttc aaggttatcg
atctggacga ttacgccgca 1800gaggacgacg aatacgagga gaagttgaaa aaggagtccc
tcgccttctt cttcctggcg 1860acgtacggcg atggtgagcc gaccgataac gcagctcgtt
tctacaagtg gttcaccgag 1920ggtgaggaga agggtgagtg gctggataaa ctgcaatatg
cggtctttgg tctgggcaac 1980cgccaatatg agcacttcaa taagatcgca aaggttgtgg
atgagaaact ggtcgagcag 2040ggtgccaagc gcctggtgcc ggttggcatg ggtgatgacg
atcagtgcat cgaggatgac 2100ttcaccgcct ggaaggagct ggtgtggccg gagctggacc
aactgttgcg cgacgaagat 2160gacaccagcg ttgcgacgcc gtataccgcg gcagttggcg
aatatcgtgt tgtttttcat 2220gataagccgg aaacctacga tcaggatcaa ctgaccaatg
gtcatgctgt gcatgacgcg 2280cagcacccgt gcagaagcaa tgttgctgtt aagaaagaat
tgcactctcc gctgtccgat 2340cgcagctgca cccacctgga atttgacatc agcaataccg
gtttgagcta cgaaacgggc 2400gatcacgtcg gtgtgtatgt ggaaaatctg agcgaagttg
tcgatgaggc tgagaagctg 2460atcggtttac caccgcacac ctacttcagc gtgcatactg
acaatgagga tggcacccca 2520ctgggcggtg ctagcctgcc accgcctttc ccgccttgca
ccctgcgcaa agccctcgct 2580agctacgctg atgtgctgag cagcccgaag aagagcgcac
tgctggcact ggcagcacac 2640gctaccgatt ccaccgaagc cgatcgcctg aagtttttcg
ctagcccggc aggcaaggac 2700gagtatgcgc agtggattgt cgcgagccac cgtagcctgc
tggaagtgat ggaggcgttc 2760ccgagcgcga agcctccgct cggcgtcttt ttcgcatcgg
ttgcgcctcg cctgcaaccg 2820cgttattact caatcagcag ctctccgaaa ttcgcgccga
atcgtattca cgttacttgc 2880gcgctggttt atgagcaaac tccgagcggt cgtgttcaca
agggcgtttg ctctacctgg 2940atgaaaaacg cggttcctat gacggagagc caagactgta
gctgggctcc gatttatgtt 3000cgcacgtcta actttcgcct gcctagcgac ccgaaggtgc
cagtgattat gattggtccg 3060ggtaccggtc tggcaccgtt ccgcggtttc ctgcaagaac
gtctggcaca gaaagaagct 3120ggtacggaat tgggcaccgc aattctgttc tttggttgtc
gtaatcgtaa agtggacttt 3180atctatgagg atgaactgaa caacttcgtg gaaaccggtg
ccctgagcga attggtgacg 3240gctttttctc gtgagggtgc gaccaaagaa tacgtgcagc
acaagatgac gcagaaagca 3300agcgacattt ggaatctgct gtccgaaggt gcgtacctgt
atgtctgtgg cgacgcgaag 3360ggcatggcaa aagacgttca ccgtaccctg cacaccattg
tgcaggagca aggtagcctg 3420gactcttcga aggcggaatt gtacgtcaaa aacctgcaaa
tggccggtcg ttatctgcgt 3480gacgtttggt aaaagctt
3498183648DNAArtificial
SequencepCWori-CYP71AV8-65188-CPRm insert DNA sequence 18catatggcac
tcttactggc agtattctgg tccgccctga tcattcttgt aacccgcacg 60actagcaaaa
agaatctgtt gccggagcca tggcgtctgc cgattatcgg tcacatgcac 120catttgatcg
gcaccatgcc gcatcgtggt gttatggaac tggcccgtaa gcatggcagc 180ctgatgcacc
tgcaactggg tgaagtctct acgattgttg tcagcagccc gcgttgggcg 240aaagaggtct
tgaccaccta tgatatcacc ttcgccaatc gcccggaaac cctgactggc 300gagatcgtcg
cataccacaa cacggatatc gtcctggcgc cgtatggtga gtattggcgt 360caactgcgta
aactgtgcac gctggagctg ctgagcaaca agaaagtgaa gagcttccag 420agcctgcgcg
aagaagagtg ttggaacctg gtcaaggaca tccgcagcac cggccaaggt 480agcccaatca
atctgtcgga gaacattttc aagatgattg cgacgattct gagccgtgct 540gcgttcggta
agggtattaa ggatcaaatg aagtttaccg aactggtgaa agaaatcctg 600cgtctgaccg
gcggttttga tgtcgctgac atcttcccta gcaagaagtt gctgcaccac 660ctgagcggca
agcgtgcaaa actgaccaat atccataaca agctggataa tctgatcaat 720aacatcatcg
cagagcaccc gggcaaccgt acctcgtcct cccaggaaac gctgctggac 780gttctgctgc
gcctgaaaga gtctgcggag tttccgctga ccgccgacaa cgttaaagca 840gtgatcctgg
atatgttcgg cgctggtacg gataccagca gcgcgacgat cgagtgggcg 900attagcgagc
tgattcgctg ccctcgcgcg atggagaaag tgcagacgga attgcgtcag 960gcactgaatg
gcaaagagcg tattcaggaa gaggatttgc aggagctgaa ttatctgaag 1020ctggtgatta
aagaaaccct gcgcctgcat ccgccgttgc cgctggtgat gccgcgtgag 1080tgccgtgaac
cgtgtgtttt gggcggttac gacattccga gcaaaacgaa gctgatcgtt 1140aatgttttcg
cgattaaccg tgacccggaa tactggaaag acgcggaaac gtttatgccg 1200gagcgttttg
agaatagccc gattaccgtt atgggttccg agtacgaata cctgccattt 1260ggtgctggtc
gtcgtatgtg tcctggtgca gcgctgggtc tggccaacgt ggaactgccg 1320ctggcgcaca
ttctgtacta tttcaactgg aaactgccga acggcaagac cttcgaagat 1380ttggacatga
ccgagagctt tggtgccact gtgcagcgca aaaccgagct gctgctggtt 1440ccgaccgact
ttcaaacgct gactgcgagc acctaatgag tcgactaact ttaagaagga 1500gatatatcca
tggaacctag ctctcagaaa ctgtctccgt tggaatttgt tgctgctatc 1560ctgaagggcg
actacagcag cggtcaggtt gaaggtggtc caccgccagg tctggcagct 1620atgttgatgg
aaaataagga tttggtgatg gttctgacga cgtccgtggc agtcctgatc 1680ggctgtgtcg
tggtcctggc atggcgtcgt gcggcaggta gcggtaagta caagcaacct 1740gaactgccta
aactggtggt cccgaaagca gccgaaccgg aggaggcaga ggatgataaa 1800accaagatca
gcgtgttttt cggcacccaa accggtacgg cagaaggttt cgcgaaggct 1860tttgttgaag
aggccaaggc gcgttatcag caggcccgtt tcaaagttat cgacctggac 1920gactatgcgg
cagacgatga cgagtacgaa gagaaactga agaaggaaaa cttggcattc 1980ttcttcttgg
cgtcctacgg tgacggcgag ccgacggaca acgcggcacg cttttacaaa 2040tggtttacgg
agggtaagga ccgtggtgaa tggctgaaca atctgcagta cggcgttttt 2100ggtctgggta
accgtcaata tgagcatttc aataagatcg ccattgtcgt cgatgatctg 2160atcttcgagc
aaggtggcaa gaagctggtt ccggtgggtc tgggtgacga tgaccagtgc 2220attgaggatg
attttgcggc gtggcgtgaa ctggtctggc cggaactgga taaactgctg 2280cgtaacgaag
acgacgctac cgtggcaacc ccgtacagcg ccgctgtgct gcaataccgc 2340gtggttttcc
acgatcacat tgacggcctg attagcgaaa acggtagccc gaacggtcat 2400gctaatggca
ataccgtgta cgatgcgcaa cacccgtgcc gtagcaacgt cgcggtcaag 2460aaggaattgc
atactccggc gagcgatcgc agctgcaccc acctggaatt taacattagc 2520ggtaccggcc
tgatgtacga gacgggtgac cacgtcggtg tgtattgcga gaacctgttg 2580gaaaccgtgg
aggaggccga gaagttgttg aacctgagcc cgcagacgta cttctccgtt 2640cacaccgaca
acgaggacgg tacgccgttg agcggcagca gcctgccgcc accgtttccg 2700ccgtgcacct
tgcgcacggc attgaccaaa tacgcagact tgacttctgc accgaaaaag 2760tcggtgctgg
tggcgctggc cgagtacgca tctgaccagg gtgaagcgga tcgtttgcgt 2820ttcttggcga
gcccgagcgg caaagaggaa tatgcacagt acatcttggc aagccagcgc 2880acgctgctgg
aggtcatggc ggagttcccg tcggcgaaac cgccgctggg tgtctttttc 2940gcgggtgtcg
ctccgcgcct gcagccgcgt ttctattcca ttagctctag cccgaagatc 3000gcaccgttcc
gtattcacgt gacctgcgcc ctggtttatg acaaatcccc taccggtcgc 3060gttcataagg
gcatctgtag cacgtggatg aaaaatgcgg tcccgctgga agaaagcaac 3120gattgttcct
gggctccgat cttcgtccgc aacagcaact tcaagctgcc gaccgacccg 3180aaggttccga
ttatcatgat tggtccgggt accggtctgg ccccttttcg tggctttttg 3240caagagcgct
tggcgttgaa agagagcggt gctgaattgg gtccggcgat cttgttcttt 3300ggttgccgta
accgtaaaat ggactttatt tacgaggatg aactgaatga tttcgtcaaa 3360gcgggcgttg
tcagcgagct gatcgtcgct tttagccgcg aaggcccgat gaaagaatac 3420gtgcaacaca
aaatgagcca acgtgcctcc gatgtgtgga acatcattag cgacggtggt 3480tatgtttatg
tttgcggtga cgcgaagggt atggctcgtg atgttcaccg taccctgcat 3540accatcgcac
aggagcaagg tagcatgtcc agctcggagg ccgaaggtat ggtcaaaaac 3600ctgcaaacca
ccggtcgtta cctgcgtgat gtgtggtaat aaaagctt
3648191665DNAArtificial Sequencealpha-santalene synthase optimized cDNA
sequence 19atggaccaca tgtctaccca gcaggttagc tccgagaata tcgttcgcaa
cgcggcgaac 60ttccacccga atatctgggg taatcatttc ttgacgtgtc caagccagac
gatcgattct 120tggacgcaac aacaccataa agagctgaaa gaagaggtcc gcaagatgat
ggtgagcgac 180gcaaacaaac cggcacaacg tctgcgtctg attgacaccg ttcaacgttt
gggcgtggcg 240tatcatttcg aaaaagaaat cgatgacgct ctggaaaaga tcggtcacga
tccgtttgac 300gataaggatg acctgtatat cgttagcctg tgttttcgcc tgctgcgtca
gcatggcatc 360aagattagct gcgatgtttt tgagaagttc aaagacgacg atggcaagtt
taaggcttcc 420ctgatgaatg atgtccaagg tatgctgtcg ttgtatgaag cggcccacct
ggcaattcat 480ggcgaggaca tcctggatga ggctattgtc tttacgacca cccacctgaa
gagcaccgtt 540tctaactccc cggtcaattc cacctttgcg gaacagattc gccacagcct
gcgtgtgccg 600ctgcgtaagg cagtcccgcg tttggagagc cgctacttcc tggatatcta
tagccgtgac 660gacctgcacg acaagactct gctgaacttt gccaaactgg acttcaacat
cctgcaggcg 720atgcaccaga aagaggcaag cgagatgacc cgttggtggc gtgatttcga
tttcctgaag 780aagctgccgt acattcgtga tcgcgtggtt gaactgtact tttggatttt
ggtcggtgtg 840agctaccaac cgaaattcag cacgggtcgt atctttttga gcaagattat
ctgtctggaa 900accctggtgg acgacacgtt tgatgcgtac ggtactttcg acgaactggc
cattttcacc 960gaggccgtta cgcgttggga cctgggtcat cgcgacgcgc tgcctgagta
catgaaattc 1020attttcaaga ccctgattga tgtgtacagc gaggcggaac aagagctggc
aaaagagggc 1080cgctcctata gcattcacta tgcgatccgt agcttccagg agttggtcat
gaagtacttt 1140tgcgaggcga aatggctgaa taagggttat gttccgagcc tggatgacta
caagagcgtc 1200agcctgcgca gcatcggctt cctgccgatc gccgtggctt cttttgtttt
catgggcgac 1260attgctacga aagaggtttt tgagtgggaa atgaataacc cgaaaatcat
catcgcagcc 1320gaaaccattt tccgctttct ggatgacatt gcaggtcatc gcttcgaaca
aaaacgtgag 1380cacagcccga gcgcaatcga gtgctacaaa aaccaacatg gtgtctcgga
agaagaggca 1440gtgaaagcgc tgagcttgga ggtcgccaat tcgtggaaag acattaacga
agagctgctg 1500ctgaacccta tggcaattcc actgccgttg ctgcaggtga tcctggattt
gagccgtagc 1560gcggacttca tgtacggtaa tgcgcaggac cgtttcacgc actccaccat
gatgaaagat 1620caagttgacc tggttctgaa agatccggtg aaactggacg attaa
166520554PRTArtificial Sequencealpha-santalene synthase amino
acid sequence 20Met Asp His Met Ser Thr Gln Gln Val Ser Ser Glu Asn Ile
Val Arg1 5 10 15Asn Ala
Ala Asn Phe His Pro Asn Ile Trp Gly Asn His Phe Leu Thr 20
25 30Cys Pro Ser Gln Thr Ile Asp Ser Trp
Thr Gln Gln His His Lys Glu 35 40
45Leu Lys Glu Glu Val Arg Lys Met Met Val Ser Asp Ala Asn Lys Pro 50
55 60Ala Gln Arg Leu Arg Leu Ile Asp Thr
Val Gln Arg Leu Gly Val Ala65 70 75
80Tyr His Phe Glu Lys Glu Ile Asp Asp Ala Leu Glu Lys Ile
Gly His 85 90 95Asp Pro
Phe Asp Asp Lys Asp Asp Leu Tyr Ile Val Ser Leu Cys Phe 100
105 110Arg Leu Leu Arg Gln His Gly Ile Lys
Ile Ser Cys Asp Val Phe Glu 115 120
125Lys Phe Lys Asp Asp Asp Gly Lys Phe Lys Ala Ser Leu Met Asn Asp
130 135 140Val Gln Gly Met Leu Ser Leu
Tyr Glu Ala Ala His Leu Ala Ile His145 150
155 160Gly Glu Asp Ile Leu Asp Glu Ala Ile Val Phe Thr
Thr Thr His Leu 165 170
175Lys Ser Thr Val Ser Asn Ser Pro Val Asn Ser Thr Phe Ala Glu Gln
180 185 190Ile Arg His Ser Leu Arg
Val Pro Leu Arg Lys Ala Val Pro Arg Leu 195 200
205Glu Ser Arg Tyr Phe Leu Asp Ile Tyr Ser Arg Asp Asp Leu
His Asp 210 215 220Lys Thr Leu Leu Asn
Phe Ala Lys Leu Asp Phe Asn Ile Leu Gln Ala225 230
235 240Met His Gln Lys Glu Ala Ser Glu Met Thr
Arg Trp Trp Arg Asp Phe 245 250
255Asp Phe Leu Lys Lys Leu Pro Tyr Ile Arg Asp Arg Val Val Glu Leu
260 265 270Tyr Phe Trp Ile Leu
Val Gly Val Ser Tyr Gln Pro Lys Phe Ser Thr 275
280 285Gly Arg Ile Phe Leu Ser Lys Ile Ile Cys Leu Glu
Thr Leu Val Asp 290 295 300Asp Thr Phe
Asp Ala Tyr Gly Thr Phe Asp Glu Leu Ala Ile Phe Thr305
310 315 320Glu Ala Val Thr Arg Trp Asp
Leu Gly His Arg Asp Ala Leu Pro Glu 325
330 335Tyr Met Lys Phe Ile Phe Lys Thr Leu Ile Asp Val
Tyr Ser Glu Ala 340 345 350Glu
Gln Glu Leu Ala Lys Glu Gly Arg Ser Tyr Ser Ile His Tyr Ala 355
360 365Ile Arg Ser Phe Gln Glu Leu Val Met
Lys Tyr Phe Cys Glu Ala Lys 370 375
380Trp Leu Asn Lys Gly Tyr Val Pro Ser Leu Asp Asp Tyr Lys Ser Val385
390 395 400Ser Leu Arg Ser
Ile Gly Phe Leu Pro Ile Ala Val Ala Ser Phe Val 405
410 415Phe Met Gly Asp Ile Ala Thr Lys Glu Val
Phe Glu Trp Glu Met Asn 420 425
430Asn Pro Lys Ile Ile Ile Ala Ala Glu Thr Ile Phe Arg Phe Leu Asp
435 440 445Asp Ile Ala Gly His Arg Phe
Glu Gln Lys Arg Glu His Ser Pro Ser 450 455
460Ala Ile Glu Cys Tyr Lys Asn Gln His Gly Val Ser Glu Glu Glu
Ala465 470 475 480Val Lys
Ala Leu Ser Leu Glu Val Ala Asn Ser Trp Lys Asp Ile Asn
485 490 495Glu Glu Leu Leu Leu Asn Pro
Met Ala Ile Pro Leu Pro Leu Leu Gln 500 505
510Val Ile Leu Asp Leu Ser Arg Ser Ala Asp Phe Met Tyr Gly
Asn Ala 515 520 525Gln Asp Arg Phe
Thr His Ser Thr Met Met Lys Asp Gln Val Asp Leu 530
535 540Val Leu Lys Asp Pro Val Lys Leu Asp Asp545
550211728DNAArtificial SequenceSaTps8201-1-FL_optEc
(alpha/santalene synthase optimized full-length cDNA) including RBS
region and restriction sites 21aggaggtaaa acatatggac agcagcaccg
ccaccgcaat gaccgcacca ttcatcgacc 60cgacggatca tgtgaatctg aaaaccgaca
cggatgcgag cgaaaatcgt cgtatgggta 120actacaagcc gagcatttgg aactacgatt
ttctgcagtc cctggcgacg caccacaaca 180ttgttgaaga gcgtcacctg aagctggcag
agaaactgaa aggtcaagtg aaattcatgt 240tcggtgcgcc gatggagcca ttggctaagt
tggagctggt tgatgtggtg caacgcttgg 300gtctgaacca cctgttcgag actgaaatca
aagaagctct gttcagcatc tacaaagatg 360gcagcaatgg ctggtggttt ggccatctgc
atgctacctc tttgcgcttc cgtctgttgc 420gccaatgtgg cctgtttatc ccgcaggacg
ttttcaaaac ctttcaaaac aagaccggtg 480agtttgacat gaagctgtgg gacaacgtta
agggcctgct gagcctgtac gaggcgagct 540acctgggctg gaagggcgag aacatcttgg
atgaagcaaa ggcgttcacg accaagtgcc 600tgaagagcgc atgggagaac attagcgaga
agtggctggc gaagcgtgtt aaacatgcgt 660tggcgctgcc gctgcactgg cgtgttccgc
gtattgaagc acgctggttt atcgaggtgt 720acgaacaaga ggccaatatg aatccgacgc
tgctgaaact ggcgaaactg gacttcaaca 780tggtccaaag cattcaccag aaagaaatcg
gtgaactggc ccgctggtgg gttactaccg 840gcctggacaa gctggatttc gcacgcaaca
atctgttgca gtcttatatg tggagctgcg 900ccatcgcgtc cgacccgaaa ttcaaactgg
cgcgtgaaac cattgtcgag atcggttccg 960tgttgacggt tgtcgacgac ggctatgatg
tgtacggttc tatggatgag ctggacctgt 1020acaccagctc ggtggagcgt tggtcctgtg
tcaaaattga caagctgcct aatacgctga 1080agctgatctt tatgtctatg ttcaacaaaa
ccaacgaggt gggtctgcgt gttcaacacg 1140agcgtggtta caatagcatc ccgaccttca
ttaaggcgtg ggtggaacag tgtaagagct 1200atcaaaaaga ggcgcgttgg tttcatggtg
gtcacacgcc tccgctggaa gaatacagcc 1260tgaacggtct ggtcagcatt ggttttccgc
tgttgctgat caccggctat gttgcgattg 1320ctgagaatga agcagccctg gataaagtcc
acccgctgcc ggacctgctg cattattcca 1380gcttgctgag ccgtctgatt aatgatatcg
gcactagccc ggatgaaatg gcgcgtggtg 1440acaatctgaa gagcattcac tgctatatga
atgaaaccgg tgccagcgaa gaggtcgcac 1500gcgagcacat caaaggcgtc atcgaagaga
attggaaaat tctgaaccag tgttgctttg 1560accagtccca gttccaggag ccgttcatca
cgtttaacct gaacagcgtg cgcggctcgc 1620atttcttcta tgaatttggt gatggttttg
gtgttaccga cagctggacc aaggtggata 1680tgaaaagcgt cctgattgat ccgattccgc
tgggtgaaga gtaagctt 172822569PRTArtificial
SequenceSaTps8201-1-FL (alpha/beta santalene synthase full-length)
amino acid sequence 22Met Asp Ser Ser Thr Ala Thr Ala Met Thr Ala Pro Phe
Ile Asp Pro1 5 10 15Thr
Asp His Val Asn Leu Lys Thr Asp Thr Asp Ala Ser Glu Asn Arg 20
25 30Arg Met Gly Asn Tyr Lys Pro Ser
Ile Trp Asn Tyr Asp Phe Leu Gln 35 40
45Ser Leu Ala Thr His His Asn Ile Val Glu Glu Arg His Leu Lys Leu
50 55 60Ala Glu Lys Leu Lys Gly Gln Val
Lys Phe Met Phe Gly Ala Pro Met65 70 75
80Glu Pro Leu Ala Lys Leu Glu Leu Val Asp Val Val Gln
Arg Leu Gly 85 90 95Leu
Asn His Leu Phe Glu Thr Glu Ile Lys Glu Ala Leu Phe Ser Ile
100 105 110Tyr Lys Asp Gly Ser Asn Gly
Trp Trp Phe Gly His Leu His Ala Thr 115 120
125Ser Leu Arg Phe Arg Leu Leu Arg Gln Cys Gly Leu Phe Ile Pro
Gln 130 135 140Asp Val Phe Lys Thr Phe
Gln Asn Lys Thr Gly Glu Phe Asp Met Lys145 150
155 160Leu Trp Asp Asn Val Lys Gly Leu Leu Ser Leu
Tyr Glu Ala Ser Tyr 165 170
175Leu Gly Trp Lys Gly Glu Asn Ile Leu Asp Glu Ala Lys Ala Phe Thr
180 185 190Thr Lys Cys Leu Lys Ser
Ala Trp Glu Asn Ile Ser Glu Lys Trp Leu 195 200
205Ala Lys Arg Val Lys His Ala Leu Ala Leu Pro Leu His Trp
Arg Val 210 215 220Pro Arg Ile Glu Ala
Arg Trp Phe Ile Glu Val Tyr Glu Gln Glu Ala225 230
235 240Asn Met Asn Pro Thr Leu Leu Lys Leu Ala
Lys Leu Asp Phe Asn Met 245 250
255Val Gln Ser Ile His Gln Lys Glu Ile Gly Glu Leu Ala Arg Trp Trp
260 265 270Val Thr Thr Gly Leu
Asp Lys Leu Asp Phe Ala Arg Asn Asn Leu Leu 275
280 285Gln Ser Tyr Met Trp Ser Cys Ala Ile Ala Ser Asp
Pro Lys Phe Lys 290 295 300Leu Ala Arg
Glu Thr Ile Val Glu Ile Gly Ser Val Leu Thr Val Val305
310 315 320Asp Asp Gly Tyr Asp Val Tyr
Gly Ser Met Asp Glu Leu Asp Leu Tyr 325
330 335Thr Ser Ser Val Glu Arg Trp Ser Cys Val Lys Ile
Asp Lys Leu Pro 340 345 350Asn
Thr Leu Lys Leu Ile Phe Met Ser Met Phe Asn Lys Thr Asn Glu 355
360 365Val Gly Leu Arg Val Gln His Glu Arg
Gly Tyr Asn Ser Ile Pro Thr 370 375
380Phe Ile Lys Ala Trp Val Glu Gln Cys Lys Ser Tyr Gln Lys Glu Ala385
390 395 400Arg Trp Phe His
Gly Gly His Thr Pro Pro Leu Glu Glu Tyr Ser Leu 405
410 415Asn Gly Leu Val Ser Ile Gly Phe Pro Leu
Leu Leu Ile Thr Gly Tyr 420 425
430Val Ala Ile Ala Glu Asn Glu Ala Ala Leu Asp Lys Val His Pro Leu
435 440 445Pro Asp Leu Leu His Tyr Ser
Ser Leu Leu Ser Arg Leu Ile Asn Asp 450 455
460Ile Gly Thr Ser Pro Asp Glu Met Ala Arg Gly Asp Asn Leu Lys
Ser465 470 475 480Ile His
Cys Tyr Met Asn Glu Thr Gly Ala Ser Glu Glu Val Ala Arg
485 490 495Glu His Ile Lys Gly Val Ile
Glu Glu Asn Trp Lys Ile Leu Asn Gln 500 505
510Cys Cys Phe Asp Gln Ser Gln Phe Gln Glu Pro Phe Ile Thr
Phe Asn 515 520 525Leu Asn Ser Val
Arg Gly Ser His Phe Phe Tyr Glu Phe Gly Asp Gly 530
535 540Phe Gly Val Thr Asp Ser Trp Thr Lys Val Asp Met
Lys Ser Val Leu545 550 555
560Ile Asp Pro Ile Pro Leu Gly Glu Glu
565235361DNAArtificial SequenceDNA sequence of the synthetic operon
containing CYP71AV-P2, CPRm, and ClASS including the NdeI and
HindIII restriction sites in 3' and 5' ends 23catatggctc tgttattagc
agttttttgg tcggcgctta taatcctcgt agtaacctac 60accatatccc tcctaatcaa
ccaatggcga aaaccgaaac cccaagggaa gttccccccg 120ggcccatggc gtctgccgat
tatcggtcac atgcaccatt tgatcggcac catgccgcat 180cgtggtgtta tggaactggc
ccgtaagcat ggcagcctga tgcacctgca actgggtgaa 240gtctctacga ttgttgtcag
cagcccgcgt tgggcgaaag aggtcttgac cacctatgat 300atcaccttcg ccaatcgccc
ggaaaccctg actggcgaga tcgtcgcata ccacaacacg 360gatatcgtcc tggcgccgta
tggtgagtat tggcgtcaac tgcgtaaact gtgcacgctg 420gagctgctga gcaacaagaa
agtgaagagc ttccagagcc tgcgcgaaga agagtgttgg 480aacctggtca aggacatccg
cagcaccggc caaggtagcc caatcaatct gtcggagaac 540attttcaaga tgattgcgac
gattctgagc cgtgctgcgt tcggtaaggg tattaaggat 600caaatgaagt ttaccgaact
ggtgaaagaa atcctgcgtc tgaccggcgg ttttgatgtc 660gctgacatct tccctagcaa
gaagttgctg caccacctga gcggcaagcg tgcaaaactg 720accaatatcc ataacaagct
ggataatctg atcaataaca tcatcgcaga gcacccgggc 780aaccgtacct cgtcctccca
ggaaacgctg ctggacgttc tgctgcgcct gaaagagtct 840gcggagtttc cgctgaccgc
cgacaacgtt aaagcagtga tcctggatat gttcggcgct 900ggtacggata ccagcagcgc
gacgatcgag tgggcgatta gcgagctgat tcgctgccct 960cgcgcgatgg agaaagtgca
gacggaattg cgtcaggcac tgaatggcaa agagcgtatt 1020caggaagagg atttgcagga
gctgaattat ctgaagctgg tgattaaaga aaccctgcgc 1080ctgcatccgc cgttgccgct
ggtgatgccg cgtgagtgcc gtgaaccgtg tgttttgggc 1140ggttacgaca ttccgagcaa
aacgaagctg atcgttaatg ttttcgcgat taaccgtgac 1200ccggaatact ggaaagacgc
ggaaacgttt atgccggagc gttttgagaa tagcccgatt 1260accgttatgg gttccgagta
cgaatacctg ccatttggtg ctggtcgtcg tatgtgtcct 1320ggtgcagcgc tgggtctggc
caacgtggaa ctgccgctgg cgcacattct gtactatttc 1380aactggaaac tgccgaacgg
caagaccttc gaagatttgg acatgaccga gagctttggt 1440gccactgtgc agcgcaaaac
cgagctgctg ctggttccga ccgactttca aacgctgact 1500gcgagcacct aatgagtcga
ctaactttaa gaaggagata tatccatgga acctagctct 1560cagaaactgt ctccgttgga
atttgttgct gctatcctga agggcgacta cagcagcggt 1620caggttgaag gtggtccacc
gccaggtctg gcagctatgt tgatggaaaa taaggatttg 1680gtgatggttc tgacgacgtc
cgtggcagtc ctgatcggct gtgtcgtggt cctggcatgg 1740cgtcgtgcgg caggtagcgg
taagtacaag caacctgaac tgcctaaact ggtggtcccg 1800aaagcagccg aaccggagga
ggcagaggat gataaaacca agatcagcgt gtttttcggc 1860acccaaaccg gtacggcaga
aggtttcgcg aaggcttttg ttgaagaggc caaggcgcgt 1920tatcagcagg cccgtttcaa
agttatcgac ctggacgact atgcggcaga cgatgacgag 1980tacgaagaga aactgaagaa
ggaaaacttg gcattcttct tcttggcgtc ctacggtgac 2040ggcgagccga cggacaacgc
ggcacgcttt tacaaatggt ttacggaggg taaggaccgt 2100ggtgaatggc tgaacaatct
gcagtacggc gtttttggtc tgggtaaccg tcaatatgag 2160catttcaata agatcgccat
tgtcgtcgat gatctgatct tcgagcaagg tggcaagaag 2220ctggttccgg tgggtctggg
tgacgatgac cagtgcattg aggatgattt tgcggcgtgg 2280cgtgaactgg tctggccgga
actggataaa ctgctgcgta acgaagacga cgctaccgtg 2340gcaaccccgt acagcgccgc
tgtgctgcaa taccgcgtgg ttttccacga tcacattgac 2400ggcctgatta gcgaaaacgg
tagcccgaac ggtcatgcta atggcaatac cgtgtacgat 2460gcgcaacacc cgtgccgtag
caacgtcgcg gtcaagaagg aattgcatac tccggcgagc 2520gatcgcagct gcacccacct
ggaatttaac attagcggta ccggcctgat gtacgagacg 2580ggtgaccacg tcggtgtgta
ttgcgagaac ctgttggaaa ccgtggagga ggccgagaag 2640ttgttgaacc tgagcccgca
gacgtacttc tccgttcaca ccgacaacga ggacggtacg 2700ccgttgagcg gcagcagcct
gccgccaccg tttccgccgt gcaccttgcg cacggcattg 2760accaaatacg cagacttgac
ttctgcaccg aaaaagtcgg tgctggtggc gctggccgag 2820tacgcatctg accagggtga
agcggatcgt ttgcgtttct tggcgagccc gagcggcaaa 2880gaggaatatg cacagtacat
cttggcaagc cagcgcacgc tgctggaggt catggcggag 2940ttcccgtcgg cgaaaccgcc
gctgggtgtc tttttcgcgg gtgtcgctcc gcgcctgcag 3000ccgcgtttct attccattag
ctctagcccg aagatcgcac cgttccgtat tcacgtgacc 3060tgcgccctgg tttatgacaa
atcccctacc ggtcgcgttc ataagggcat ctgtagcacg 3120tggatgaaaa atgcggtccc
gctggaagaa agcaacgatt gttcctgggc tccgatcttc 3180gtccgcaaca gcaacttcaa
gctgccgacc gacccgaagg ttccgattat catgattggt 3240ccgggtaccg gtctggcccc
ttttcgtggc tttttgcaag agcgcttggc gttgaaagag 3300agcggtgctg aattgggtcc
ggcgatcttg ttctttggtt gccgtaaccg taaaatggac 3360tttatttacg aggatgaact
gaatgatttc gtcaaagcgg gcgttgtcag cgagctgatc 3420gtcgctttta gccgcgaagg
cccgatgaaa gaatacgtgc aacacaaaat gagccaacgt 3480gcctccgatg tgtggaacat
cattagcgac ggtggttatg tttatgtttg cggtgacgcg 3540aagggtatgg ctcgtgatgt
tcaccgtacc ctgcatacca tcgcacagga gcaaggtagc 3600atgtccagct cggaggccga
aggtatggtc aaaaacctgc aaaccaccgg tcgttacctg 3660cgtgatgtgt ggtaataaaa
gcttgaagga gatatactaa tgtctaccca gcaggttagc 3720tccgagaata tcgttcgcaa
cgcggcgaac ttccacccga atatctgggg taatcatttc 3780ttgacgtgtc caagccagac
gatcgattct tggacgcaac aacaccataa agagctgaaa 3840gaagaggtcc gcaagatgat
ggtgagcgac gcaaacaaac cggcacaacg tctgcgtctg 3900attgacaccg ttcaacgttt
gggcgtggcg tatcatttcg aaaaagaaat cgatgacgct 3960ctggaaaaga tcggtcacga
tccgtttgac gataaggatg acctgtatat cgttagcctg 4020tgttttcgcc tgctgcgtca
gcatggcatc aagattagct gcgatgtttt tgagaagttc 4080aaagacgacg atggcaagtt
taaggcttcc ctgatgaatg atgtccaagg tatgctgtcg 4140ttgtatgaag cggcccacct
ggcaattcat ggcgaggaca tcctggatga ggctattgtc 4200tttacgacca cccacctgaa
gagcaccgtt tctaactccc cggtcaattc cacctttgcg 4260gaacagattc gccacagcct
gcgtgtgccg ctgcgtaagg cagtcccgcg tttggagagc 4320cgctacttcc tggatatcta
tagccgtgac gacctgcacg acaagactct gctgaacttt 4380gccaaactgg acttcaacat
cctgcaggcg atgcaccaga aagaggcaag cgagatgacc 4440cgttggtggc gtgatttcga
tttcctgaag aagctgccgt acattcgtga tcgcgtggtt 4500gaactgtact tttggatttt
ggtcggtgtg agctaccaac cgaaattcag cacgggtcgt 4560atctttttga gcaagattat
ctgtctggaa accctggtgg acgacacgtt tgatgcgtac 4620ggtactttcg acgaactggc
cattttcacc gaggccgtta cgcgttggga cctgggtcat 4680cgcgacgcgc tgcctgagta
catgaaattc attttcaaga ccctgattga tgtgtacagc 4740gaggcggaac aagagctggc
aaaagagggc cgctcctata gcattcacta tgcgatccgt 4800agcttccagg agttggtcat
gaagtacttt tgcgaggcga aatggctgaa taagggttat 4860gttccgagcc tggatgacta
caagagcgtc agcctgcgca gcatcggctt cctgccgatc 4920gccgtggctt cttttgtttt
catgggcgac attgctacga aagaggtttt tgagtgggaa 4980atgaataacc cgaaaatcat
catcgcagcc gaaaccattt tccgctttct ggatgacatt 5040gcaggtcatc gcttcgaaca
aaaacgtgag cacagcccga gcgcaatcga gtgctacaaa 5100aaccaacatg gtgtctcgga
agaagaggca gtgaaagcgc tgagcttgga ggtcgccaat 5160tcgtggaaag acattaacga
agagctgctg ctgaacccta tggcaattcc actgccgttg 5220ctgcaggtga tcctggattt
gagccgtagc gcggacttca tgtacggtaa tgcgcaggac 5280cgtttcacgc actccaccat
gatgaaagat caagttgacc tggttctgaa agatccggtg 5340aaactggacg attaagaatt c
5361245414DNAArtificial
SequenceDNA sequence of the synthetic operon containing CYP71AV-P2,
CPRm, and SaSAS including the NdeI and HindIII restriction sites in
3' and 5' ends 24catatggctc tgttattagc agttttttgg tcggcgctta taatcctcgt
agtaacctac 60accatatccc tcctaatcaa ccaatggcga aaaccgaaac cccaagggaa
gttccccccg 120ggcccatggc gtctgccgat tatcggtcac atgcaccatt tgatcggcac
catgccgcat 180cgtggtgtta tggaactggc ccgtaagcat ggcagcctga tgcacctgca
actgggtgaa 240gtctctacga ttgttgtcag cagcccgcgt tgggcgaaag aggtcttgac
cacctatgat 300atcaccttcg ccaatcgccc ggaaaccctg actggcgaga tcgtcgcata
ccacaacacg 360gatatcgtcc tggcgccgta tggtgagtat tggcgtcaac tgcgtaaact
gtgcacgctg 420gagctgctga gcaacaagaa agtgaagagc ttccagagcc tgcgcgaaga
agagtgttgg 480aacctggtca aggacatccg cagcaccggc caaggtagcc caatcaatct
gtcggagaac 540attttcaaga tgattgcgac gattctgagc cgtgctgcgt tcggtaaggg
tattaaggat 600caaatgaagt ttaccgaact ggtgaaagaa atcctgcgtc tgaccggcgg
ttttgatgtc 660gctgacatct tccctagcaa gaagttgctg caccacctga gcggcaagcg
tgcaaaactg 720accaatatcc ataacaagct ggataatctg atcaataaca tcatcgcaga
gcacccgggc 780aaccgtacct cgtcctccca ggaaacgctg ctggacgttc tgctgcgcct
gaaagagtct 840gcggagtttc cgctgaccgc cgacaacgtt aaagcagtga tcctggatat
gttcggcgct 900ggtacggata ccagcagcgc gacgatcgag tgggcgatta gcgagctgat
tcgctgccct 960cgcgcgatgg agaaagtgca gacggaattg cgtcaggcac tgaatggcaa
agagcgtatt 1020caggaagagg atttgcagga gctgaattat ctgaagctgg tgattaaaga
aaccctgcgc 1080ctgcatccgc cgttgccgct ggtgatgccg cgtgagtgcc gtgaaccgtg
tgttttgggc 1140ggttacgaca ttccgagcaa aacgaagctg atcgttaatg ttttcgcgat
taaccgtgac 1200ccggaatact ggaaagacgc ggaaacgttt atgccggagc gttttgagaa
tagcccgatt 1260accgttatgg gttccgagta cgaatacctg ccatttggtg ctggtcgtcg
tatgtgtcct 1320ggtgcagcgc tgggtctggc caacgtggaa ctgccgctgg cgcacattct
gtactatttc 1380aactggaaac tgccgaacgg caagaccttc gaagatttgg acatgaccga
gagctttggt 1440gccactgtgc agcgcaaaac cgagctgctg ctggttccga ccgactttca
aaccctgact 1500gcaagcacct aatgagtcga ctaactttaa gaaggagata tatccatgga
acctagctct 1560cagaaactgt ctccgttgga atttgttgct gctatcctga agggcgacta
cagcagcggt 1620caggttgaag gtggtccacc gccaggtctg gcagctatgt tgatggaaaa
taaggatttg 1680gtgatggttc tgacgacgtc cgtggcagtc ctgatcggct gtgtcgtggt
cctggcatgg 1740cgtcgtgcgg caggtagcgg taagtacaag caacctgaac tgcctaaact
ggtggtcccg 1800aaagcagccg aaccggagga ggcagaggat gataaaacca agatcagcgt
gtttttcggc 1860acccaaaccg gtacggcaga aggtttcgcg aaggcttttg ttgaagaggc
caaggcgcgt 1920tatcagcagg cccgtttcaa agttatcgac ctggacgact atgcggcaga
cgatgacgag 1980tacgaagaga aactgaagaa ggaaaacttg gcattcttct tcttggcgtc
ctacggtgac 2040ggcgagccga cggacaacgc ggcacgcttt tacaaatggt ttacggaggg
taaggaccgt 2100ggtgaatggc tgaacaatct gcagtacggc gtttttggtc tgggtaaccg
tcaatatgag 2160catttcaata agatcgccat tgtcgtcgat gatctgatct tcgagcaagg
tggcaagaag 2220ctggttccgg tgggtctggg tgacgatgac cagtgcattg aggatgattt
tgcggcgtgg 2280cgtgaactgg tctggccgga actggataaa ctgctgcgta acgaagacga
cgctaccgtg 2340gcaaccccgt acagcgccgc tgtgctgcaa taccgcgtgg ttttccacga
tcacattgac 2400ggcctgatta gcgaaaacgg tagcccgaac ggtcatgcta atggcaatac
cgtgtacgat 2460gcgcaacacc cgtgccgtag caacgtcgcg gtcaagaagg aattgcatac
tccggcgagc 2520gatcgcagct gcacccacct ggaatttaac attagcggta ccggcctgat
gtacgagacg 2580ggtgaccacg tcggtgtgta ttgcgagaac ctgttggaaa ccgtggagga
ggccgagaag 2640ttgttgaacc tgagcccgca gacgtacttc tccgttcaca ccgacaacga
ggacggtacg 2700ccgttgagcg gcagcagcct gccgccaccg tttccgccgt gcaccttgcg
cacggcattg 2760accaaatacg cagacttgac ttctgcaccg aaaaagtcgg tgctggtggc
gctggccgag 2820tacgcatctg accagggtga agcggatcgt ttgcgtttct tggcgagccc
gagcggcaaa 2880gaggaatatg cacagtacat cttggcaagc cagcgcacgc tgctggaggt
catggcggag 2940ttcccgtcgg cgaaaccgcc gctgggtgtc tttttcgcgg gtgtcgctcc
gcgcctgcag 3000ccgcgtttct attccattag ctctagcccg aagatcgcac cgttccgtat
tcacgtgacc 3060tgcgccctgg tttatgacaa atcccctacc ggtcgcgttc ataagggcat
ctgtagcacg 3120tggatgaaaa atgcggtccc gctggaagaa agcaacgatt gttcctgggc
tccgatcttc 3180gtccgcaaca gcaacttcaa gctgccgacc gacccgaagg ttccgattat
catgattggt 3240ccgggtaccg gtctggcccc ttttcgtggc tttttgcaag agcgcttggc
gttgaaagag 3300agcggtgctg aattgggtcc ggcgatcttg ttctttggtt gccgtaaccg
taaaatggac 3360tttatttacg aggatgaact gaatgatttc gtcaaagcgg gcgttgtcag
cgagctgatc 3420gtcgctttta gccgcgaagg cccgatgaaa gaatacgtgc aacacaaaat
gagccaacgt 3480gcctccgatg tgtggaacat cattagcgac ggtggttatg tttatgtttg
cggtgacgcg 3540aagggtatgg ctcgtgatgt tcaccgtacc ctgcatacca tcgcacagga
gcaaggtagc 3600atgtccagct cggaggccga aggtatggtc aaaaacctgc aaaccaccgg
tcgttacctg 3660cgtgatgtgt ggtaataaaa gcttaggagg taaaacatat ggacagcagc
accgccaccg 3720caatgaccgc accattcatc gacccgacgg atcatgtgaa tctgaaaacc
gacacggatg 3780cgagcgaaaa tcgtcgtatg ggtaactaca agccgagcat ttggaactac
gattttctgc 3840agtccctggc gacgcaccac aacattgttg aagagcgtca cctgaagctg
gcagagaaac 3900tgaaaggtca agtgaaattc atgttcggtg cgccgatgga gccattggct
aagttggagc 3960tggttgatgt ggtgcaacgc ttgggtctga accacctgtt cgagactgaa
atcaaagaag 4020ctctgttcag catctacaaa gatggcagca atggctggtg gtttggccat
ctgcatgcta 4080cctctttgcg cttccgtctg ttgcgccaat gtggcctgtt tatcccgcag
gacgttttca 4140aaacctttca aaacaagacc ggtgagtttg acatgaagct gtgggacaac
gttaagggcc 4200tgctgagcct gtacgaggcg agctacctgg gctggaaggg cgagaacatc
ttggatgaag 4260caaaggcgtt cacgaccaag tgcctgaaga gcgcatggga gaacattagc
gagaagtggc 4320tggcgaagcg tgttaaacat gcgttggcgc tgccgctgca ctggcgtgtt
ccgcgtattg 4380aagcacgctg gtttatcgag gtgtacgaac aagaggccaa tatgaatccg
acgctgctga 4440aactggcgaa actggacttc aacatggtcc aaagcattca ccagaaagaa
atcggtgaac 4500tggcccgctg gtgggttact accggcctgg acaagctgga tttcgcacgc
aacaatctgt 4560tgcagtctta tatgtggagc tgcgccatcg cgtccgaccc gaaattcaaa
ctggcgcgtg 4620aaaccattgt cgagatcggt tccgtgttga cggttgtcga cgacggctat
gatgtgtacg 4680gttctatgga tgagctggac ctgtacacca gctcggtgga gcgttggtcc
tgtgtcaaaa 4740ttgacaagct gcctaatacg ctgaagctga tctttatgtc tatgttcaac
aaaaccaacg 4800aggtgggtct gcgtgttcaa cacgagcgtg gttacaatag catcccgacc
ttcattaagg 4860cgtgggtgga acagtgtaag agctatcaaa aagaggcgcg ttggtttcat
ggtggtcaca 4920cgcctccgct ggaagaatac agcctgaacg gtctggtcag cattggtttt
ccgctgttgc 4980tgatcaccgg ctatgttgcg attgctgaga atgaagcagc cctggataaa
gtccacccgc 5040tgccggacct gctgcattat tccagcttgc tgagccgtct gattaatgat
atcggcacta 5100gcccggatga aatggcgcgt ggtgacaatc tgaagagcat tcactgctat
atgaatgaaa 5160ccggtgccag cgaagaggtc gcacgcgagc acatcaaagg cgtcatcgaa
gagaattgga 5220aaattctgaa ccagtgttgc tttgaccagt cccagttcca ggagccgttc
atcacgttta 5280acctgaacag cgtgcgcggc tcgcatttct tctatgaatt tggtgatggt
tttggtgtta 5340ccgacagctg gaccaaggtg gatatgaaaa gcgtcctgat tgatccgatt
ccgctgggtg 5400aagagtaagc ttgc
5414255361DNAArtificial SequenceDNA sequence of the synthetic
operon containing CYP71AV-P2O, CPRm, and ClASS including the NdeI
and HindIII restriction sites in 3' and 5' ends 25catatggcac
tgttgctggc tgtcttttgg tctgctctga ttattttggt ggttacctac 60accatctccc
tgctgattaa ccagtggcgt aaaccgaaac cacagggtaa attcccgccg 120ggtccgtggc
gtctgccgat tatcggtcac atgcaccatt tgatcggcac catgccgcat 180cgtggtgtta
tggaactggc ccgtaagcat ggcagcctga tgcacctgca actgggtgaa 240gtctctacga
ttgttgtcag cagcccgcgt tgggcgaaag aggtcttgac cacctatgat 300atcaccttcg
ccaatcgccc ggaaaccctg actggcgaga tcgtcgcata ccacaacacg 360gatatcgtcc
tggcgccgta tggtgagtat tggcgtcaac tgcgtaaact gtgcacgctg 420gagctgctga
gcaacaagaa agtgaagagc ttccagagcc tgcgcgaaga agagtgttgg 480aacctggtca
aggacatccg cagcaccggc caaggtagcc caatcaatct gtcggagaac 540attttcaaga
tgattgcgac gattctgagc cgtgctgcgt tcggtaaggg tattaaggat 600caaatgaagt
ttaccgaact ggtgaaagaa atcctgcgtc tgaccggcgg ttttgatgtc 660gctgacatct
tccctagcaa gaagttgctg caccacctga gcggcaagcg tgcaaaactg 720accaatatcc
ataacaagct ggataatctg atcaataaca tcatcgcaga gcacccgggc 780aaccgtacct
cgtcctccca ggaaacgctg ctggacgttc tgctgcgcct gaaagagtct 840gcggagtttc
cgctgaccgc cgacaacgtt aaagcagtga tcctggatat gttcggcgct 900ggtacggata
ccagcagcgc gacgatcgag tgggcgatta gcgagctgat tcgctgccct 960cgcgcgatgg
agaaagtgca gacggaattg cgtcaggcac tgaatggcaa agagcgtatt 1020caggaagagg
atttgcagga gctgaattat ctgaagctgg tgattaaaga aaccctgcgc 1080ctgcatccgc
cgttgccgct ggtgatgccg cgtgagtgcc gtgaaccgtg tgttttgggc 1140ggttacgaca
ttccgagcaa aacgaagctg atcgttaatg ttttcgcgat taaccgtgac 1200ccggaatact
ggaaagacgc ggaaacgttt atgccggagc gttttgagaa tagcccgatt 1260accgttatgg
gttccgagta cgaatacctg ccatttggtg ctggtcgtcg tatgtgtcct 1320ggtgcagcgc
tgggtctggc caacgtggaa ctgccgctgg cgcacattct gtactatttc 1380aactggaaac
tgccgaacgg caagaccttc gaagatttgg acatgaccga gagctttggt 1440gccactgtgc
agcgcaaaac cgagctgctg ctggttccga ccgactttca aacgctgact 1500gcgagcacct
aatgagtcga ctaactttaa gaaggagata tatccatgga acctagctct 1560cagaaactgt
ctccgttgga atttgttgct gctatcctga agggcgacta cagcagcggt 1620caggttgaag
gtggtccacc gccaggtctg gcagctatgt tgatggaaaa taaggatttg 1680gtgatggttc
tgacgacgtc cgtggcagtc ctgatcggct gtgtcgtggt cctggcatgg 1740cgtcgtgcgg
caggtagcgg taagtacaag caacctgaac tgcctaaact ggtggtcccg 1800aaagcagccg
aaccggagga ggcagaggat gataaaacca agatcagcgt gtttttcggc 1860acccaaaccg
gtacggcaga aggtttcgcg aaggcttttg ttgaagaggc caaggcgcgt 1920tatcagcagg
cccgtttcaa agttatcgac ctggacgact atgcggcaga cgatgacgag 1980tacgaagaga
aactgaagaa ggaaaacttg gcattcttct tcttggcgtc ctacggtgac 2040ggcgagccga
cggacaacgc ggcacgcttt tacaaatggt ttacggaggg taaggaccgt 2100ggtgaatggc
tgaacaatct gcagtacggc gtttttggtc tgggtaaccg tcaatatgag 2160catttcaata
agatcgccat tgtcgtcgat gatctgatct tcgagcaagg tggcaagaag 2220ctggttccgg
tgggtctggg tgacgatgac cagtgcattg aggatgattt tgcggcgtgg 2280cgtgaactgg
tctggccgga actggataaa ctgctgcgta acgaagacga cgctaccgtg 2340gcaaccccgt
acagcgccgc tgtgctgcaa taccgcgtgg ttttccacga tcacattgac 2400ggcctgatta
gcgaaaacgg tagcccgaac ggtcatgcta atggcaatac cgtgtacgat 2460gcgcaacacc
cgtgccgtag caacgtcgcg gtcaagaagg aattgcatac tccggcgagc 2520gatcgcagct
gcacccacct ggaatttaac attagcggta ccggcctgat gtacgagacg 2580ggtgaccacg
tcggtgtgta ttgcgagaac ctgttggaaa ccgtggagga ggccgagaag 2640ttgttgaacc
tgagcccgca gacgtacttc tccgttcaca ccgacaacga ggacggtacg 2700ccgttgagcg
gcagcagcct gccgccaccg tttccgccgt gcaccttgcg cacggcattg 2760accaaatacg
cagacttgac ttctgcaccg aaaaagtcgg tgctggtggc gctggccgag 2820tacgcatctg
accagggtga agcggatcgt ttgcgtttct tggcgagccc gagcggcaaa 2880gaggaatatg
cacagtacat cttggcaagc cagcgcacgc tgctggaggt catggcggag 2940ttcccgtcgg
cgaaaccgcc gctgggtgtc tttttcgcgg gtgtcgctcc gcgcctgcag 3000ccgcgtttct
attccattag ctctagcccg aagatcgcac cgttccgtat tcacgtgacc 3060tgcgccctgg
tttatgacaa atcccctacc ggtcgcgttc ataagggcat ctgtagcacg 3120tggatgaaaa
atgcggtccc gctggaagaa agcaacgatt gttcctgggc tccgatcttc 3180gtccgcaaca
gcaacttcaa gctgccgacc gacccgaagg ttccgattat catgattggt 3240ccgggtaccg
gtctggcccc ttttcgtggc tttttgcaag agcgcttggc gttgaaagag 3300agcggtgctg
aattgggtcc ggcgatcttg ttctttggtt gccgtaaccg taaaatggac 3360tttatttacg
aggatgaact gaatgatttc gtcaaagcgg gcgttgtcag cgagctgatc 3420gtcgctttta
gccgcgaagg cccgatgaaa gaatacgtgc aacacaaaat gagccaacgt 3480gcctccgatg
tgtggaacat cattagcgac ggtggttatg tttatgtttg cggtgacgcg 3540aagggtatgg
ctcgtgatgt tcaccgtacc ctgcatacca tcgcacagga gcaaggtagc 3600atgtccagct
cggaggccga aggtatggtc aaaaacctgc aaaccaccgg tcgttacctg 3660cgtgatgtgt
ggtaataaaa gcttgaagga gatatactaa tgtctaccca gcaggttagc 3720tccgagaata
tcgttcgcaa cgcggcgaac ttccacccga atatctgggg taatcatttc 3780ttgacgtgtc
caagccagac gatcgattct tggacgcaac aacaccataa agagctgaaa 3840gaagaggtcc
gcaagatgat ggtgagcgac gcaaacaaac cggcacaacg tctgcgtctg 3900attgacaccg
ttcaacgttt gggcgtggcg tatcatttcg aaaaagaaat cgatgacgct 3960ctggaaaaga
tcggtcacga tccgtttgac gataaggatg acctgtatat cgttagcctg 4020tgttttcgcc
tgctgcgtca gcatggcatc aagattagct gcgatgtttt tgagaagttc 4080aaagacgacg
atggcaagtt taaggcttcc ctgatgaatg atgtccaagg tatgctgtcg 4140ttgtatgaag
cggcccacct ggcaattcat ggcgaggaca tcctggatga ggctattgtc 4200tttacgacca
cccacctgaa gagcaccgtt tctaactccc cggtcaattc cacctttgcg 4260gaacagattc
gccacagcct gcgtgtgccg ctgcgtaagg cagtcccgcg tttggagagc 4320cgctacttcc
tggatatcta tagccgtgac gacctgcacg acaagactct gctgaacttt 4380gccaaactgg
acttcaacat cctgcaggcg atgcaccaga aagaggcaag cgagatgacc 4440cgttggtggc
gtgatttcga tttcctgaag aagctgccgt acattcgtga tcgcgtggtt 4500gaactgtact
tttggatttt ggtcggtgtg agctaccaac cgaaattcag cacgggtcgt 4560atctttttga
gcaagattat ctgtctggaa accctggtgg acgacacgtt tgatgcgtac 4620ggtactttcg
acgaactggc cattttcacc gaggccgtta cgcgttggga cctgggtcat 4680cgcgacgcgc
tgcctgagta catgaaattc attttcaaga ccctgattga tgtgtacagc 4740gaggcggaac
aagagctggc aaaagagggc cgctcctata gcattcacta tgcgatccgt 4800agcttccagg
agttggtcat gaagtacttt tgcgaggcga aatggctgaa taagggttat 4860gttccgagcc
tggatgacta caagagcgtc agcctgcgca gcatcggctt cctgccgatc 4920gccgtggctt
cttttgtttt catgggcgac attgctacga aagaggtttt tgagtgggaa 4980atgaataacc
cgaaaatcat catcgcagcc gaaaccattt tccgctttct ggatgacatt 5040gcaggtcatc
gcttcgaaca aaaacgtgag cacagcccga gcgcaatcga gtgctacaaa 5100aaccaacatg
gtgtctcgga agaagaggca gtgaaagcgc tgagcttgga ggtcgccaat 5160tcgtggaaag
acattaacga agagctgctg ctgaacccta tggcaattcc actgccgttg 5220ctgcaggtga
tcctggattt gagccgtagc gcggacttca tgtacggtaa tgcgcaggac 5280cgtttcacgc
actccaccat gatgaaagat caagttgacc tggttctgaa agatccggtg 5340aaactggacg
attaagaatt c
5361265414DNAArtificial SequenceDNA sequence of the synthetic operon
containing CYP71AV-P2O, CPRm, and SaSAS including the NdeI and
HindIII restriction sites in 3' and 5' ends 26catatggcac tgttgctggc
tgtcttttgg tctgctctga ttattttggt ggttacctac 60accatctccc tgctgattaa
ccagtggcgt aaaccgaaac cacagggtaa attcccgccg 120ggtccgtggc gtctgccgat
tatcggtcac atgcaccatt tgatcggcac catgccgcat 180cgtggtgtta tggaactggc
ccgtaagcat ggcagcctga tgcacctgca actgggtgaa 240gtctctacga ttgttgtcag
cagcccgcgt tgggcgaaag aggtcttgac cacctatgat 300atcaccttcg ccaatcgccc
ggaaaccctg actggcgaga tcgtcgcata ccacaacacg 360gatatcgtcc tggcgccgta
tggtgagtat tggcgtcaac tgcgtaaact gtgcacgctg 420gagctgctga gcaacaagaa
agtgaagagc ttccagagcc tgcgcgaaga agagtgttgg 480aacctggtca aggacatccg
cagcaccggc caaggtagcc caatcaatct gtcggagaac 540attttcaaga tgattgcgac
gattctgagc cgtgctgcgt tcggtaaggg tattaaggat 600caaatgaagt ttaccgaact
ggtgaaagaa atcctgcgtc tgaccggcgg ttttgatgtc 660gctgacatct tccctagcaa
gaagttgctg caccacctga gcggcaagcg tgcaaaactg 720accaatatcc ataacaagct
ggataatctg atcaataaca tcatcgcaga gcacccgggc 780aaccgtacct cgtcctccca
ggaaacgctg ctggacgttc tgctgcgcct gaaagagtct 840gcggagtttc cgctgaccgc
cgacaacgtt aaagcagtga tcctggatat gttcggcgct 900ggtacggata ccagcagcgc
gacgatcgag tgggcgatta gcgagctgat tcgctgccct 960cgcgcgatgg agaaagtgca
gacggaattg cgtcaggcac tgaatggcaa agagcgtatt 1020caggaagagg atttgcagga
gctgaattat ctgaagctgg tgattaaaga aaccctgcgc 1080ctgcatccgc cgttgccgct
ggtgatgccg cgtgagtgcc gtgaaccgtg tgttttgggc 1140ggttacgaca ttccgagcaa
aacgaagctg atcgttaatg ttttcgcgat taaccgtgac 1200ccggaatact ggaaagacgc
ggaaacgttt atgccggagc gttttgagaa tagcccgatt 1260accgttatgg gttccgagta
cgaatacctg ccatttggtg ctggtcgtcg tatgtgtcct 1320ggtgcagcgc tgggtctggc
caacgtggaa ctgccgctgg cgcacattct gtactatttc 1380aactggaaac tgccgaacgg
caagaccttc gaagatttgg acatgaccga gagctttggt 1440gccactgtgc agcgcaaaac
cgagctgctg ctggttccga ccgactttca aacgctgact 1500gcgagcacct aatgagtcga
ctaactttaa gaaggagata tatccatgga acctagctct 1560cagaaactgt ctccgttgga
atttgttgct gctatcctga agggcgacta cagcagcggt 1620caggttgaag gtggtccacc
gccaggtctg gcagctatgt tgatggaaaa taaggatttg 1680gtgatggttc tgacgacgtc
cgtggcagtc ctgatcggct gtgtcgtggt cctggcatgg 1740cgtcgtgcgg caggtagcgg
taagtacaag caacctgaac tgcctaaact ggtggtcccg 1800aaagcagccg aaccggagga
ggcagaggat gataaaacca agatcagcgt gtttttcggc 1860acccaaaccg gtacggcaga
aggtttcgcg aaggcttttg ttgaagaggc caaggcgcgt 1920tatcagcagg cccgtttcaa
agttatcgac ctggacgact atgcggcaga cgatgacgag 1980tacgaagaga aactgaagaa
ggaaaacttg gcattcttct tcttggcgtc ctacggtgac 2040ggcgagccga cggacaacgc
ggcacgcttt tacaaatggt ttacggaggg taaggaccgt 2100ggtgaatggc tgaacaatct
gcagtacggc gtttttggtc tgggtaaccg tcaatatgag 2160catttcaata agatcgccat
tgtcgtcgat gatctgatct tcgagcaagg tggcaagaag 2220ctggttccgg tgggtctggg
tgacgatgac cagtgcattg aggatgattt tgcggcgtgg 2280cgtgaactgg tctggccgga
actggataaa ctgctgcgta acgaagacga cgctaccgtg 2340gcaaccccgt acagcgccgc
tgtgctgcaa taccgcgtgg ttttccacga tcacattgac 2400ggcctgatta gcgaaaacgg
tagcccgaac ggtcatgcta atggcaatac cgtgtacgat 2460gcgcaacacc cgtgccgtag
caacgtcgcg gtcaagaagg aattgcatac tccggcgagc 2520gatcgcagct gcacccacct
ggaatttaac attagcggta ccggcctgat gtacgagacg 2580ggtgaccacg tcggtgtgta
ttgcgagaac ctgttggaaa ccgtggagga ggccgagaag 2640ttgttgaacc tgagcccgca
gacgtacttc tccgttcaca ccgacaacga ggacggtacg 2700ccgttgagcg gcagcagcct
gccgccaccg tttccgccgt gcaccttgcg cacggcattg 2760accaaatacg cagacttgac
ttctgcaccg aaaaagtcgg tgctggtggc gctggccgag 2820tacgcatctg accagggtga
agcggatcgt ttgcgtttct tggcgagccc gagcggcaaa 2880gaggaatatg cacagtacat
cttggcaagc cagcgcacgc tgctggaggt catggcggag 2940ttcccgtcgg cgaaaccgcc
gctgggtgtc tttttcgcgg gtgtcgctcc gcgcctgcag 3000ccgcgtttct attccattag
ctctagcccg aagatcgcac cgttccgtat tcacgtgacc 3060tgcgccctgg tttatgacaa
atcccctacc ggtcgcgttc ataagggcat ctgtagcacg 3120tggatgaaaa atgcggtccc
gctggaagaa agcaacgatt gttcctgggc tccgatcttc 3180gtccgcaaca gcaacttcaa
gctgccgacc gacccgaagg ttccgattat catgattggt 3240ccgggtaccg gtctggcccc
ttttcgtggc tttttgcaag agcgcttggc gttgaaagag 3300agcggtgctg aattgggtcc
ggcgatcttg ttctttggtt gccgtaaccg taaaatggac 3360tttatttacg aggatgaact
gaatgatttc gtcaaagcgg gcgttgtcag cgagctgatc 3420gtcgctttta gccgcgaagg
cccgatgaaa gaatacgtgc aacacaaaat gagccaacgt 3480gcctccgatg tgtggaacat
cattagcgac ggtggttatg tttatgtttg cggtgacgcg 3540aagggtatgg ctcgtgatgt
tcaccgtacc ctgcatacca tcgcacagga gcaaggtagc 3600atgtccagct cggaggccga
aggtatggtc aaaaacctgc aaaccaccgg tcgttacctg 3660cgtgatgtgt ggtaataaaa
gcttaggagg taaaacatat ggacagcagc accgccaccg 3720caatgaccgc accattcatc
gacccgacgg atcatgtgaa tctgaaaacc gacacggatg 3780cgagcgaaaa tcgtcgtatg
ggtaactaca agccgagcat ttggaactac gattttctgc 3840agtccctggc gacgcaccac
aacattgttg aagagcgtca cctgaagctg gcagagaaac 3900tgaaaggtca agtgaaattc
atgttcggtg cgccgatgga gccattggct aagttggagc 3960tggttgatgt ggtgcaacgc
ttgggtctga accacctgtt cgagactgaa atcaaagaag 4020ctctgttcag catctacaaa
gatggcagca atggctggtg gtttggccat ctgcatgcta 4080cctctttgcg cttccgtctg
ttgcgccaat gtggcctgtt tatcccgcag gacgttttca 4140aaacctttca aaacaagacc
ggtgagtttg acatgaagct gtgggacaac gttaagggcc 4200tgctgagcct gtacgaggcg
agctacctgg gctggaaggg cgagaacatc ttggatgaag 4260caaaggcgtt cacgaccaag
tgcctgaaga gcgcatggga gaacattagc gagaagtggc 4320tggcgaagcg tgttaaacat
gcgttggcgc tgccgctgca ctggcgtgtt ccgcgtattg 4380aagcacgctg gtttatcgag
gtgtacgaac aagaggccaa tatgaatccg acgctgctga 4440aactggcgaa actggacttc
aacatggtcc aaagcattca ccagaaagaa atcggtgaac 4500tggcccgctg gtgggttact
accggcctgg acaagctgga tttcgcacgc aacaatctgt 4560tgcagtctta tatgtggagc
tgcgccatcg cgtccgaccc gaaattcaaa ctggcgcgtg 4620aaaccattgt cgagatcggt
tccgtgttga cggttgtcga cgacggctat gatgtgtacg 4680gttctatgga tgagctggac
ctgtacacca gctcggtgga gcgttggtcc tgtgtcaaaa 4740ttgacaagct gcctaatacg
ctgaagctga tctttatgtc tatgttcaac aaaaccaacg 4800aggtgggtct gcgtgttcaa
cacgagcgtg gttacaatag catcccgacc ttcattaagg 4860cgtgggtgga acagtgtaag
agctatcaaa aagaggcgcg ttggtttcat ggtggtcaca 4920cgcctccgct ggaagaatac
agcctgaacg gtctggtcag cattggtttt ccgctgttgc 4980tgatcaccgg ctatgttgcg
attgctgaga atgaagcagc cctggataaa gtccacccgc 5040tgccggacct gctgcattat
tccagcttgc tgagccgtct gattaatgat atcggcacta 5100gcccggatga aatggcgcgt
ggtgacaatc tgaagagcat tcactgctat atgaatgaaa 5160ccggtgccag cgaagaggtc
gcacgcgagc acatcaaagg cgtcatcgaa gagaattgga 5220aaattctgaa ccagtgttgc
tttgaccagt cccagttcca ggagccgttc atcacgttta 5280acctgaacag cgtgcgcggc
tcgcatttct tctatgaatt tggtgatggt tttggtgtta 5340ccgacagctg gaccaaggtg
gatatgaaaa gcgtcctgat tgatccgatt ccgctgggtg 5400aagagtaagc ttgc
5414271512DNAArtificial
SequenceCYP71AV8-L358A DNA sequence 27atggctctgt tattagcagt tttttggtcg
gcgcttataa tcctcgtagt aacctacacc 60atatccctcc taatcaacca atggcgaaaa
ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc tgccgattat cggtcacatg
caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg aactggcccg taagcatggc
agcctgatgc acctgcaact gggtgaagtc 240tctacgattg ttgtcagcag cccgcgttgg
gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca atcgcccgga aaccctgact
ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg cgccgtatgg tgagtattgg
cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca acaagaaagt gaagagcttc
cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg acatccgcag caccggccaa
ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga ttgcgacgat tctgagccgt
gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta ccgaactggt gaaagaaatc
ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc ctagcaagaa gttgctgcac
cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata acaagctgga taatctgatc
aataacatca tcgcagagca cccgggcaac 780cgtacctcgt cctcccagga aacgctgctg
gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc tgaccgccga caacgttaaa
gcagtgatcc tggatatgtt cggcgctggt 900acggatacca gcagcgcgac gatcgagtgg
gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga aagtgcagac ggaattgcgt
caggcactga atggcaaaga gcgtattcag 1020gaagaggatt tgcaggagct gaattatctg
aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgg ctccgctggt gatgccgcgt
gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc cgagcaaaac gaagctgatc
gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga aagacgcgga aacgtttatg
ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt ccgagtacga atacctgcca
tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg gtctggccaa cgtggaactg
ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc cgaacggcaa gaccttcgaa
gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc gcaaaaccga gctgctgctg
gttccgaccg actttcaaac cctgactgcg 1500agcacctaat ga
151228502PRTArtificial
SequenceCYP71AV8-L358A amino acid sequence 28Met Ala Leu Leu Leu Ala Val
Phe Trp Ser Ala Leu Ile Ile Leu Val1 5 10
15Val Thr Tyr Thr Ile Ser Leu Leu Ile Asn Gln Trp Arg
Lys Pro Lys 20 25 30Pro Gln
Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile Ile Gly 35
40 45His Met His His Leu Ile Gly Thr Met Pro
His Arg Gly Val Met Glu 50 55 60Leu
Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu Gly Glu Val65
70 75 80Ser Thr Ile Val Val Ser
Ser Pro Arg Trp Ala Lys Glu Val Leu Thr 85
90 95Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro Glu Thr
Leu Thr Gly Glu 100 105 110Ile
Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala Pro Tyr Gly Glu 115
120 125Tyr Trp Arg Gln Leu Arg Lys Leu Cys
Thr Leu Glu Leu Leu Ser Asn 130 135
140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu Glu Glu Cys Trp Asn145
150 155 160Leu Val Lys Asp
Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu 165
170 175Ser Glu Asn Ile Phe Lys Met Ile Ala Thr
Ile Leu Ser Arg Ala Ala 180 185
190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe Thr Glu Leu Val Lys
195 200 205Glu Ile Leu Arg Leu Thr Gly
Gly Phe Asp Val Ala Asp Ile Phe Pro 210 215
220Ser Lys Lys Leu Leu His His Leu Ser Gly Lys Arg Ala Lys Leu
Thr225 230 235 240Asn Ile
His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala Glu
245 250 255His Pro Gly Asn Arg Thr Ser
Ser Ser Gln Glu Thr Leu Leu Asp Val 260 265
270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe Pro Leu Thr Ala
Asp Asn 275 280 285Val Lys Ala Val
Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile Ser Glu Leu Ile
Arg Cys Pro Arg305 310 315
320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala Leu Asn Gly Lys
325 330 335Glu Arg Ile Gln Glu
Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu 340
345 350Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro Ala
Pro Leu Val Met 355 360 365Pro Arg
Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp Ile Pro 370
375 380Ser Lys Thr Lys Leu Ile Val Asn Val Phe Ala
Ile Asn Arg Asp Pro385 390 395
400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met Pro Glu Arg Phe Glu Asn
405 410 415Ser Pro Ile Thr
Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly 420
425 430Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu
Gly Leu Ala Asn Val 435 440 445Glu
Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn Trp Lys Leu Pro 450
455 460Asn Gly Lys Thr Phe Glu Asp Leu Asp Met
Thr Glu Ser Phe Gly Ala465 470 475
480Thr Val Gln Arg Lys Thr Glu Leu Leu Leu Val Pro Thr Asp Phe
Gln 485 490 495Thr Leu Thr
Ala Ser Thr 500291512DNAArtificial SequenceCYP71AV8-L358F DNA
sequence 29atggctctgt tattagcagt tttttggtcg gcgcttataa tcctcgtagt
aacctacacc 60atatccctcc taatcaacca atggcgaaaa ccgaaacccc aagggaagtt
ccccccgggc 120ccatggcgtc tgccgattat cggtcacatg caccatttga tcggcaccat
gccgcatcgt 180ggtgttatgg aactggcccg taagcatggc agcctgatgc acctgcaact
gggtgaagtc 240tctacgattg ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac
ctatgatatc 300accttcgcca atcgcccgga aaccctgact ggcgagatcg tcgcatacca
caacacggat 360atcgtcctgg cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg
cacgctggag 420ctgctgagca acaagaaagt gaagagcttc cagagcctgc gcgaagaaga
gtgttggaac 480ctggtcaagg acatccgcag caccggccaa ggtagcccaa tcaatctgtc
ggagaacatt 540ttcaagatga ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat
taaggatcaa 600atgaagttta ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt
tgatgtcgct 660gacatcttcc ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc
aaaactgacc 720aatatccata acaagctgga taatctgatc aataacatca tcgcagagca
cccgggcaac 780cgtacctcgt cctcccagga aacgctgctg gacgttctgc tgcgcctgaa
agagtctgcg 840gagtttccgc tgaccgccga caacgttaaa gcagtgatcc tggatatgtt
cggcgctggt 900acggatacca gcagcgcgac gatcgagtgg gcgattagcg agctgattcg
ctgccctcgc 960gcgatggaga aagtgcagac ggaattgcgt caggcactga atggcaaaga
gcgtattcag 1020gaagaggatt tgcaggagct gaattatctg aagctggtga ttaaagaaac
cctgcgcctg 1080catccgccgt ttccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt
tttgggcggt 1140tacgacattc cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa
ccgtgacccg 1200gaatactgga aagacgcgga aacgtttatg ccggagcgtt ttgagaatag
cccgattacc 1260gttatgggtt ccgagtacga atacctgcca tttggtgctg gtcgtcgtat
gtgtcctggt 1320gcagcgctgg gtctggccaa cgtggaactg ccgctggcgc acattctgta
ctatttcaac 1380tggaaactgc cgaacggcaa gaccttcgaa gatttggaca tgaccgagag
ctttggtgcc 1440actgtgcagc gcaaaaccga gctgctgctg gttccgaccg actttcaaac
gctgactgcg 1500agcacctaat ga
151230502PRTArtificial SequenceCYP71AV8-L358F amino acid
sequence 30Met Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu
Val1 5 10 15Val Thr Tyr
Thr Ile Ser Leu Leu Ile Asn Gln Trp Arg Lys Pro Lys 20
25 30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp
Arg Leu Pro Ile Ile Gly 35 40
45His Met His His Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50
55 60Leu Ala Arg Lys His Gly Ser Leu Met
His Leu Gln Leu Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val
Leu Thr 85 90 95Thr Tyr
Asp Ile Thr Phe Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile
Val Leu Ala Pro Tyr Gly Glu 115 120
125Tyr Trp Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn
130 135 140Lys Lys Val Lys Ser Phe Gln
Ser Leu Arg Glu Glu Glu Cys Trp Asn145 150
155 160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser
Pro Ile Asn Leu 165 170
175Ser Glu Asn Ile Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala
180 185 190Phe Gly Lys Gly Ile Lys
Asp Gln Met Lys Phe Thr Glu Leu Val Lys 195 200
205Glu Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile
Phe Pro 210 215 220Ser Lys Lys Leu Leu
His His Leu Ser Gly Lys Arg Ala Lys Leu Thr225 230
235 240Asn Ile His Asn Lys Leu Asp Asn Leu Ile
Asn Asn Ile Ile Ala Glu 245 250
255His Pro Gly Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val
260 265 270Leu Leu Arg Leu Lys
Glu Ser Ala Glu Phe Pro Leu Thr Ala Asp Asn 275
280 285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly
Thr Asp Thr Ser 290 295 300Ser Ala Thr
Ile Glu Trp Ala Ile Ser Glu Leu Ile Arg Cys Pro Arg305
310 315 320Ala Met Glu Lys Val Gln Thr
Glu Leu Arg Gln Ala Leu Asn Gly Lys 325
330 335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn
Tyr Leu Lys Leu 340 345 350Val
Ile Lys Glu Thr Leu Arg Leu His Pro Pro Phe Pro Leu Val Met 355
360 365Pro Arg Glu Cys Arg Glu Pro Cys Val
Leu Gly Gly Tyr Asp Ile Pro 370 375
380Ser Lys Thr Lys Leu Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385
390 395 400Glu Tyr Trp Lys
Asp Ala Glu Thr Phe Met Pro Glu Arg Phe Glu Asn 405
410 415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr
Glu Tyr Leu Pro Phe Gly 420 425
430Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val
435 440 445Glu Leu Pro Leu Ala His Ile
Leu Tyr Tyr Phe Asn Trp Lys Leu Pro 450 455
460Asn Gly Lys Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly
Ala465 470 475 480Thr Val
Gln Arg Lys Thr Glu Leu Leu Leu Val Pro Thr Asp Phe Gln
485 490 495Thr Leu Thr Ala Ser Thr
500311512DNAArtificial SequenceCYP71AV8-L358T DNA Sequence
31atggctctgt tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc
60atatccctcc taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc
120ccatggcgtc tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt
180ggtgttatgg aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc
240tctacgattg ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc
300accttcgcca atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat
360atcgtcctgg cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag
420ctgctgagca acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac
480ctggtcaagg acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt
540ttcaagatga ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa
600atgaagttta ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct
660gacatcttcc ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc
720aatatccata acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac
780cgtacctcgt cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg
840gagtttccgc tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt
900acggatacca gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc
960gcgatggaga aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag
1020gaagaggatt tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg
1080catccgccga ctccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt
1140tacgacattc cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg
1200gaatactgga aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc
1260gttatgggtt ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt
1320gcagcgctgg gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac
1380tggaaactgc cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc
1440actgtgcagc gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg
1500agcacctaat ga
151232502PRTArtificial SequenceCYP71AV8-L358T amino acid sequence 32Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Thr Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500331512DNAArtificial SequenceCYP71AV8-L358S DNA sequence 33atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgt
ctccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151234502PRTArtificial SequenceCYP71AV8-L358S amino acid sequence 34Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Ser Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500351512DNAArtificial SequenceCYP71AV8-L358V DNA sequence 35atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgg
ttccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151236502PRTArtificial SequenceCYP71AV8-L358V amino acid sequence 36Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Val Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500371512DNAArtificial SequenceCYP71AV8-L358G DNA sequence 37atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgg
ggccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151238502PRTArtificial SequenceCYP71AV8-L358G amino acid sequence 38Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Gly Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500391512DNAArtificial SequenceCYP71AV8-L358I DNA sequence 39atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccga
ttccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151240502PRTArtificial SequenceCYP71AV8-L358I amino acid sequence 40Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Ile Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500411512DNAArtificial SequenceCYP71AV8-L358M DNA sequence 41atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccga
tgccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151242502PRTArtificial SequenceCYP71AV8-L358M amino acid sequence 42Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Met Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500431512DNAArtificial SequenceCYP71AV8-L358P DNA sequence 43atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgc
ctccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151244502PRTArtificial SequenceCYP71AV8-L358P amino acid sequence 44Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Pro Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500451512DNAArtificial SequenceCYP71AV8-L358Y DNA sequence 45atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgt
atccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151246502PRTArtificial SequenceCYP71AV8-L358Y amino acid sequence 46Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Tyr Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500471512DNAArtificial SequenceCYP71AV8-L358W DNA sequence 47atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgt
ggccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151248502PRTArtificial SequenceCYP71AV8-L358W amino acid sequence 48Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Trp Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500491512DNAArtificial SequenceCYP71AV8-L358R DNA sequence 49atggctctgt
tattagcagt tttttggtcg gcgcttataa tcctcgtagt aacctacacc 60atatccctcc
taatcaacca atggcgaaaa ccgaaacccc aagggaagtt ccccccgggc 120ccatggcgtc
tgccgattat cggtcacatg caccatttga tcggcaccat gccgcatcgt 180ggtgttatgg
aactggcccg taagcatggc agcctgatgc acctgcaact gggtgaagtc 240tctacgattg
ttgtcagcag cccgcgttgg gcgaaagagg tcttgaccac ctatgatatc 300accttcgcca
atcgcccgga aaccctgact ggcgagatcg tcgcatacca caacacggat 360atcgtcctgg
cgccgtatgg tgagtattgg cgtcaactgc gtaaactgtg cacgctggag 420ctgctgagca
acaagaaagt gaagagcttc cagagcctgc gcgaagaaga gtgttggaac 480ctggtcaagg
acatccgcag caccggccaa ggtagcccaa tcaatctgtc ggagaacatt 540ttcaagatga
ttgcgacgat tctgagccgt gctgcgttcg gtaagggtat taaggatcaa 600atgaagttta
ccgaactggt gaaagaaatc ctgcgtctga ccggcggttt tgatgtcgct 660gacatcttcc
ctagcaagaa gttgctgcac cacctgagcg gcaagcgtgc aaaactgacc 720aatatccata
acaagctgga taatctgatc aataacatca tcgcagagca cccgggcaac 780cgtacctcgt
cctcccagga aacgctgctg gacgttctgc tgcgcctgaa agagtctgcg 840gagtttccgc
tgaccgccga caacgttaaa gcagtgatcc tggatatgtt cggcgctggt 900acggatacca
gcagcgcgac gatcgagtgg gcgattagcg agctgattcg ctgccctcgc 960gcgatggaga
aagtgcagac ggaattgcgt caggcactga atggcaaaga gcgtattcag 1020gaagaggatt
tgcaggagct gaattatctg aagctggtga ttaaagaaac cctgcgcctg 1080catccgccgc
gtccgctggt gatgccgcgt gagtgccgtg aaccgtgtgt tttgggcggt 1140tacgacattc
cgagcaaaac gaagctgatc gttaatgttt tcgcgattaa ccgtgacccg 1200gaatactgga
aagacgcgga aacgtttatg ccggagcgtt ttgagaatag cccgattacc 1260gttatgggtt
ccgagtacga atacctgcca tttggtgctg gtcgtcgtat gtgtcctggt 1320gcagcgctgg
gtctggccaa cgtggaactg ccgctggcgc acattctgta ctatttcaac 1380tggaaactgc
cgaacggcaa gaccttcgaa gatttggaca tgaccgagag ctttggtgcc 1440actgtgcagc
gcaaaaccga gctgctgctg gttccgaccg actttcaaac cctgactgcg 1500agcacctaat
ga
151250502PRTArtificial SequenceCYP71AV8-L358R amino acid sequence 50Met
Ala Leu Leu Leu Ala Val Phe Trp Ser Ala Leu Ile Ile Leu Val1
5 10 15Val Thr Tyr Thr Ile Ser Leu
Leu Ile Asn Gln Trp Arg Lys Pro Lys 20 25
30Pro Gln Gly Lys Phe Pro Pro Gly Pro Trp Arg Leu Pro Ile
Ile Gly 35 40 45His Met His His
Leu Ile Gly Thr Met Pro His Arg Gly Val Met Glu 50 55
60Leu Ala Arg Lys His Gly Ser Leu Met His Leu Gln Leu
Gly Glu Val65 70 75
80Ser Thr Ile Val Val Ser Ser Pro Arg Trp Ala Lys Glu Val Leu Thr
85 90 95Thr Tyr Asp Ile Thr Phe
Ala Asn Arg Pro Glu Thr Leu Thr Gly Glu 100
105 110Ile Val Ala Tyr His Asn Thr Asp Ile Val Leu Ala
Pro Tyr Gly Glu 115 120 125Tyr Trp
Arg Gln Leu Arg Lys Leu Cys Thr Leu Glu Leu Leu Ser Asn 130
135 140Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu
Glu Glu Cys Trp Asn145 150 155
160Leu Val Lys Asp Ile Arg Ser Thr Gly Gln Gly Ser Pro Ile Asn Leu
165 170 175Ser Glu Asn Ile
Phe Lys Met Ile Ala Thr Ile Leu Ser Arg Ala Ala 180
185 190Phe Gly Lys Gly Ile Lys Asp Gln Met Lys Phe
Thr Glu Leu Val Lys 195 200 205Glu
Ile Leu Arg Leu Thr Gly Gly Phe Asp Val Ala Asp Ile Phe Pro 210
215 220Ser Lys Lys Leu Leu His His Leu Ser Gly
Lys Arg Ala Lys Leu Thr225 230 235
240Asn Ile His Asn Lys Leu Asp Asn Leu Ile Asn Asn Ile Ile Ala
Glu 245 250 255His Pro Gly
Asn Arg Thr Ser Ser Ser Gln Glu Thr Leu Leu Asp Val 260
265 270Leu Leu Arg Leu Lys Glu Ser Ala Glu Phe
Pro Leu Thr Ala Asp Asn 275 280
285Val Lys Ala Val Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr Ser 290
295 300Ser Ala Thr Ile Glu Trp Ala Ile
Ser Glu Leu Ile Arg Cys Pro Arg305 310
315 320Ala Met Glu Lys Val Gln Thr Glu Leu Arg Gln Ala
Leu Asn Gly Lys 325 330
335Glu Arg Ile Gln Glu Glu Asp Leu Gln Glu Leu Asn Tyr Leu Lys Leu
340 345 350Val Ile Lys Glu Thr Leu
Arg Leu His Pro Pro Arg Pro Leu Val Met 355 360
365Pro Arg Glu Cys Arg Glu Pro Cys Val Leu Gly Gly Tyr Asp
Ile Pro 370 375 380Ser Lys Thr Lys Leu
Ile Val Asn Val Phe Ala Ile Asn Arg Asp Pro385 390
395 400Glu Tyr Trp Lys Asp Ala Glu Thr Phe Met
Pro Glu Arg Phe Glu Asn 405 410
415Ser Pro Ile Thr Val Met Gly Ser Glu Tyr Glu Tyr Leu Pro Phe Gly
420 425 430Ala Gly Arg Arg Met
Cys Pro Gly Ala Ala Leu Gly Leu Ala Asn Val 435
440 445Glu Leu Pro Leu Ala His Ile Leu Tyr Tyr Phe Asn
Trp Lys Leu Pro 450 455 460Asn Gly Lys
Thr Phe Glu Asp Leu Asp Met Thr Glu Ser Phe Gly Ala465
470 475 480Thr Val Gln Arg Lys Thr Glu
Leu Leu Leu Val Pro Thr Asp Phe Gln 485
490 495Thr Leu Thr Ala Ser Thr
500511488DNAArtemisia annua 51atgaagagta tactaaaagc aatggcactc tcactgacca
cttccattgc tcttgcaacg 60atccttttgt tcgtttacaa gttcgctact cgttccaaat
ccaccaaaaa aagccttcct 120gagccatggc ggcttcccat tattggtcac atgcatcact
tgattggtac aacgccacat 180cgtggggtta gggatttagc cagaaagtat ggatctttga
tgcatttaca gcttggtgaa 240gttccaacaa tcgtggtgtc atctccgaaa tgggctaaag
agattttgac aacgtacgac 300attacctttg ctaacaggcc cgagacttta actggtgaga
ttgttttata tcacaatacg 360gatgttgttc ttgcacctta tggtgaatac tggaggcaat
tacgtaaaat ttgcacattg 420gagcttttga gtgttaagaa agtaaagtca tttcagtcac
ttcgtgaaga ggagtgttgg 480aatttggttc aagagattaa agcttcaggt tcagggagac
cggttaacct ttcagagaat 540gttttcaagt tgattgcaac gatacttagt agagccgcat
ttgggaaagg gatcaaggac 600cagaaagagt taacggagat tgtgaaagag atactgaggc
aaactggtgg ttttgatgtg 660gcagatatct ttccttcaaa gaaatttctt catcatcttt
cgggcaagag agctcggtta 720actagccttc gcaaaaagat cgataattta atcgataacc
ttgtagctga gcatactgtt 780aacacctcca gtaaaactaa cgagacactc ctcgatgttc
ttttaaggct caaagacagt 840gctgaattcc cattaacatc tgataacatt aaagccatca
ttttggatat gtttggagca 900ggcacagaca cttcctcatc cacaatcgaa tgggcgattt
cggaactcat aaagtgtccg 960aaagcaatgg agaaagtaca agcggaattg aggaaagcat
tgaacggaaa agaaaagatc 1020catgaggaag acattcaaga actaagctac ttgaacatgg
taatcaaaga aacattgagg 1080ttgcaccctc cactaccctt ggttctgcca agagagtgcc
gccaaccagt caatttggct 1140ggatacaaca tacccaataa gaccaaactt attgtcaacg
tctttgcgat aaatagggac 1200cctgaatatt ggaaagacgc tgaagctttc atccctgaac
gatttgaaaa tagttctgca 1260actgtcatgg gtgcagaata cgagtatctt ccgtttggag
ctgggagaag gatgtgtcct 1320ggagccgcac ttggtttagc taacgtgcag ctcccgctcg
ctaatatact atatcatttc 1380aactggaaac tccccaatgg tgtgagctat gaccagatcg
acatgaccga gagctctgga 1440gccacgatgc aaagaaagac tgagttgtta ctcgttccaa
gtttctag 148852495PRTArtemisia annua 52Met Lys Ser Ile Leu
Lys Ala Met Ala Leu Ser Leu Thr Thr Ser Ile1 5
10 15Ala Leu Ala Thr Ile Leu Leu Phe Val Tyr Lys
Phe Ala Thr Arg Ser 20 25
30Lys Ser Thr Lys Lys Ser Leu Pro Glu Pro Trp Arg Leu Pro Ile Ile
35 40 45Gly His Met His His Leu Ile Gly
Thr Thr Pro His Arg Gly Val Arg 50 55
60Asp Leu Ala Arg Lys Tyr Gly Ser Leu Met His Leu Gln Leu Gly Glu65
70 75 80Val Pro Thr Ile Val
Val Ser Ser Pro Lys Trp Ala Lys Glu Ile Leu 85
90 95Thr Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro
Glu Thr Leu Thr Gly 100 105
110Glu Ile Val Leu Tyr His Asn Thr Asp Val Val Leu Ala Pro Tyr Gly
115 120 125Glu Tyr Trp Arg Gln Leu Arg
Lys Ile Cys Thr Leu Glu Leu Leu Ser 130 135
140Val Lys Lys Val Lys Ser Phe Gln Ser Leu Arg Glu Glu Glu Cys
Trp145 150 155 160Asn Leu
Val Gln Glu Ile Lys Ala Ser Gly Ser Gly Arg Pro Val Asn
165 170 175Leu Ser Glu Asn Val Phe Lys
Leu Ile Ala Thr Ile Leu Ser Arg Ala 180 185
190Ala Phe Gly Lys Gly Ile Lys Asp Gln Lys Glu Leu Thr Glu
Ile Val 195 200 205Lys Glu Ile Leu
Arg Gln Thr Gly Gly Phe Asp Val Ala Asp Ile Phe 210
215 220Pro Ser Lys Lys Phe Leu His His Leu Ser Gly Lys
Arg Ala Arg Leu225 230 235
240Thr Ser Leu Arg Lys Lys Ile Asp Asn Leu Ile Asp Asn Leu Val Ala
245 250 255Glu His Thr Val Asn
Thr Ser Ser Lys Thr Asn Glu Thr Leu Leu Asp 260
265 270Val Leu Leu Arg Leu Lys Asp Ser Ala Glu Phe Pro
Leu Thr Ser Asp 275 280 285Asn Ile
Lys Ala Ile Ile Leu Asp Met Phe Gly Ala Gly Thr Asp Thr 290
295 300Ser Ser Ser Thr Ile Glu Trp Ala Ile Ser Glu
Leu Ile Lys Cys Pro305 310 315
320Lys Ala Met Glu Lys Val Gln Ala Glu Leu Arg Lys Ala Leu Asn Gly
325 330 335Lys Glu Lys Ile
His Glu Glu Asp Ile Gln Glu Leu Ser Tyr Leu Asn 340
345 350Met Val Ile Lys Glu Thr Leu Arg Leu His Pro
Pro Leu Pro Leu Val 355 360 365Leu
Pro Arg Glu Cys Arg Gln Pro Val Asn Leu Ala Gly Tyr Asn Ile 370
375 380Pro Asn Lys Thr Lys Leu Ile Val Asn Val
Phe Ala Ile Asn Arg Asp385 390 395
400Pro Glu Tyr Trp Lys Asp Ala Glu Ala Phe Ile Pro Glu Arg Phe
Glu 405 410 415Asn Ser Ser
Ala Thr Val Met Gly Ala Glu Tyr Glu Tyr Leu Pro Phe 420
425 430Gly Ala Gly Arg Arg Met Cys Pro Gly Ala
Ala Leu Gly Leu Ala Asn 435 440
445Val Gln Leu Pro Leu Ala Asn Ile Leu Tyr His Phe Asn Trp Lys Leu 450
455 460Pro Asn Gly Val Ser Tyr Asp Gln
Ile Asp Met Thr Glu Ser Ser Gly465 470
475 480Ala Thr Met Gln Arg Lys Thr Glu Leu Leu Leu Val
Pro Ser Phe 485 490
495531500DNAArtificial SequenceCYP71AV1 codon optimized DNA sequence
53atgaccgtac acgacatcat cgcaacgtac ttcactaaat ggtacgtaat tgtgccgctg
60gcactgattg cgtatcgcgt gctggattat ttctacgcga cccgttctaa aagcactaag
120aaatctctgc cggaaccgtg gcgtctgcca atcatcggtc acatgcacca cctgatcggc
180accaccccgc accgtggcgt acgcgacctg gcgcgtaagt acggctctct gatgcatctg
240cagctgggcg aggtacctac tatcgtcgtt tcctccccga agtgggccaa agaaatcctg
300actacctatg acatcacttt cgccaaccgc ccggaaacgc tgaccggcga aattgtcctg
360taccataaca cggatgtggt tctggccccg tacggtgagt actggcgcca gctgcgcaaa
420atttgtactc tggaactgct gagcgttaaa aaggttaaat ccttccagag cctgcgtgaa
480gaggaatgct ggaacctggt gcaggagatt aaagcgtctg gcagcggtcg tccagttaac
540ctgtctgaga atgtttttaa actgatcgct actatcctgt ctcgcgcggc attcggtaaa
600ggtatcaaag atcagaaaga actgaccgaa atcgttaagg aaatcctgcg ccagactggt
660ggcttcgacg ttgcggacat cttcccgtcc aaaaagttcc tgcaccatct gtctggcaaa
720cgcgctcgtc tgacctccct gcgtaagaaa attgataacc tgattgacaa cctggtcgct
780gagcacactg tgaacacctc ttctaaaacc aacgaaaccc tgctggacgt actgctgcgc
840ctgaaggact ctgccgaatt tccactgact agcgacaata tcaaagcaat catcctggac
900atgttcggcg ccggtaccga tacgtcctct tccacgattg agtgggctat ttccgaactg
960atcaaatgcc cgaaggcgat ggaaaaagtg caggcggaac tgcgtaaagc gctgaacggt
1020aaagagaaaa ttcatgaaga ggacatccag gaactgtcct acctgaatat ggtaatcaaa
1080gaaactctgc gtctgcatcc gccgctgcca ctggttctgc cgcgtgaatg ccgtcagccg
1140gttaacctgg ccggctacaa cattccgaac aaaacgaagc tgatcgtcaa cgttttcgcg
1200atcaaccgcg atcctgaata ctggaaagac gcggaagcgt tcattccgga acgctttgag
1260aactcctctg ccaccgttat gggcgctgaa tacgagtacc tgccgttcgg tgcgggtcgc
1320cgtatgtgcc cgggtgctgc actgggcctg gcgaacgttc aactgccact ggcgaacatc
1380ctgtaccact tcaactggaa actgcctaac ggcgtatctt atgatcaaat cgacatgacc
1440gaaagctccg gcgcgaccat gcagcgtaaa accgaactgc tgctggttcc gtccttttaa
150054499PRTArtificial SequenceCYP71AV1 codon optimized amino acid
sequence 54Met Thr Val His Asp Ile Ile Ala Thr Tyr Phe Thr Lys Trp Tyr
Val1 5 10 15Ile Val Pro
Leu Ala Leu Ile Ala Tyr Arg Val Leu Asp Tyr Phe Tyr 20
25 30Ala Thr Arg Ser Lys Ser Thr Lys Lys Ser
Leu Pro Glu Pro Trp Arg 35 40
45Leu Pro Ile Ile Gly His Met His His Leu Ile Gly Thr Thr Pro His 50
55 60Arg Gly Val Arg Asp Leu Ala Arg Lys
Tyr Gly Ser Leu Met His Leu65 70 75
80Gln Leu Gly Glu Val Pro Thr Ile Val Val Ser Ser Pro Lys
Trp Ala 85 90 95Lys Glu
Ile Leu Thr Thr Tyr Asp Ile Thr Phe Ala Asn Arg Pro Glu 100
105 110Thr Leu Thr Gly Glu Ile Val Leu Tyr
His Asn Thr Asp Val Val Leu 115 120
125Ala Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Arg Lys Ile Cys Thr Leu
130 135 140Glu Leu Leu Ser Val Lys Lys
Val Lys Ser Phe Gln Ser Leu Arg Glu145 150
155 160Glu Glu Cys Trp Asn Leu Val Gln Glu Ile Lys Ala
Ser Gly Ser Gly 165 170
175Arg Pro Val Asn Leu Ser Glu Asn Val Phe Lys Leu Ile Ala Thr Ile
180 185 190Leu Ser Arg Ala Ala Phe
Gly Lys Gly Ile Lys Asp Gln Lys Glu Leu 195 200
205Thr Glu Ile Val Lys Glu Ile Leu Arg Gln Thr Gly Gly Phe
Asp Val 210 215 220Ala Asp Ile Phe Pro
Ser Lys Lys Phe Leu His His Leu Ser Gly Lys225 230
235 240Arg Ala Arg Leu Thr Ser Leu Arg Lys Lys
Ile Asp Asn Leu Ile Asp 245 250
255Asn Leu Val Ala Glu His Thr Val Asn Thr Ser Ser Lys Thr Asn Glu
260 265 270Thr Leu Leu Asp Val
Leu Leu Arg Leu Lys Asp Ser Ala Glu Phe Pro 275
280 285Leu Thr Ser Asp Asn Ile Lys Ala Ile Ile Leu Asp
Met Phe Gly Ala 290 295 300Gly Thr Asp
Thr Ser Ser Ser Thr Ile Glu Trp Ala Ile Ser Glu Leu305
310 315 320Ile Lys Cys Pro Lys Ala Met
Glu Lys Val Gln Ala Glu Leu Arg Lys 325
330 335Ala Leu Asn Gly Lys Glu Lys Ile His Glu Glu Asp
Ile Gln Glu Leu 340 345 350Ser
Tyr Leu Asn Met Val Ile Lys Glu Thr Leu Arg Leu His Pro Pro 355
360 365Leu Pro Leu Val Leu Pro Arg Glu Cys
Arg Gln Pro Val Asn Leu Ala 370 375
380Gly Tyr Asn Ile Pro Asn Lys Thr Lys Leu Ile Val Asn Val Phe Ala385
390 395 400Ile Asn Arg Asp
Pro Glu Tyr Trp Lys Asp Ala Glu Ala Phe Ile Pro 405
410 415Glu Arg Phe Glu Asn Ser Ser Ala Thr Val
Met Gly Ala Glu Tyr Glu 420 425
430Tyr Leu Pro Phe Gly Ala Gly Arg Arg Met Cys Pro Gly Ala Ala Leu
435 440 445Gly Leu Ala Asn Val Gln Leu
Pro Leu Ala Asn Ile Leu Tyr His Phe 450 455
460Asn Trp Lys Leu Pro Asn Gly Val Ser Tyr Asp Gln Ile Asp Met
Thr465 470 475 480Glu Ser
Ser Gly Ala Thr Met Gln Arg Lys Thr Glu Leu Leu Leu Val
485 490 495Pro Ser Phe553150DNABacillus
megaterium 55atgacaatta aagaaatgcc tcagccaaaa acgtttggag agcttaaaaa
tttaccgtta 60ttaaacacag ataaaccggt tcaagctttg atgaaaattg cggatgaatt
aggagaaatc 120tttaaattcg aggcgcctgg tcgtgtaacg cgctacttat caagtcagcg
tctaattaaa 180gaagcatgcg atgaatcacg ctttgataaa aacttaagtc aagcgcttaa
atttgtacgt 240gattttgcag gagacgggtt atttacaagc tggacgcatg aaaaaaattg
gaaaaaagcg 300cataatatct tacttccaag cttcagtcag caggcaatga aaggctatca
tgcgatgatg 360gtcgatatcg ccgtgcagct tgttcaaaag tgggagcgtc taaatgcaga
tgagcatatt 420gaagtaccgg aagacatgac acgtttaacg cttgatacaa ttggtctttg
cggctttaac 480tatcgcttta acagctttta ccgagatcag cctcatccat ttattacaag
tatggtccgt 540gcactggatg aagcaatgaa caagctgcag cgagcaaatc cagacgaccc
agcttatgat 600gaaaacaagc gccagtttca agaagatatc aaggtgatga acgacctagt
agataaaatt 660attgcagatc gcaaagcaag cggtgaacaa agcgatgatt tattaacgca
catgctaaac 720ggaaaagatc cagaaacggg tgagccgctt gatgacgaga acattcgcta
tcaaattatt 780acattcttaa ttgcgggaca cgaaacaaca agtggtcttt tatcatttgc
gctgtatttc 840ttagtgaaaa atccacatgt attacaaaaa gcagcagaag aagcagcacg
agttctagta 900gatcctgttc caagctacaa acaagtcaaa cagcttaaat atgtcggcat
ggtcttaaac 960gaagcgctgc gcttatggcc aactgctcct gcgttttccc tatatgcaaa
agaagatacg 1020gtgcttggag gagaatatcc tttagaaaaa ggcgacgaac taatggttct
gattcctcag 1080cttcaccgtg ataaaacaat ttggggagac gatgtggaag agttccgtcc
agagcgtttt 1140gaaaatccaa gtgcgattcc gcagcatgcg tttaaaccgt ttggaaacgg
tcagcgtgcg 1200tgtatcggtc agcagttcgc tcttcatgaa gcaacgctgg tacttggtat
gatgctaaaa 1260cactttgact ttgaagatca tacaaactac gagctggata ttaaagaaac
tttaacgtta 1320aaacctgaag gctttgtggt aaaagcaaaa tcgaaaaaaa ttccgcttgg
cggtattcct 1380tcacctagca ctgaacagtc tgctaaaaaa gtacgcaaaa aggcagaaaa
cgctcataat 1440acgccgctgc ttgtgctata cggttcaaat atgggaacag ctgaaggaac
ggcgcgtgat 1500ttagcagata ttgcaatgag caaaggattt gcaccgcagg tcgcaacgct
tgattcacac 1560gccggaaatc ttccgcgcga aggagctgta ttaattgtaa cggcgtctta
taacggtcat 1620ccgcctgata acgcaaagca atttgtcgac tggttagacc aagcgtctgc
tgatgaagta 1680aaaggcgttc gctactccgt atttggatgc ggcgataaaa actgggctac
tacgtatcaa 1740aaagtgcctg cttttatcga tgaaacgctt gccgctaaag gggcagaaaa
catcgctgac 1800cgcggtgaag cagatgcaag cgacgacttt gaaggcacct atgaagaatg
gcgtgaacac 1860atgtggagtg acgtagcagc ctactttaac ctcgacattg aaaacagtga
agataataaa 1920tctactcttt cacttcaatt tgtcgacagc gccgcggata tgccgcttgc
gaaaatgcac 1980ggtgcgtttt caacgaacgt cgtagcaagc aaagaacttc aacagccagg
cagtgcacga 2040agcacgcgac atcttgaaat tgaacttcca aaagaagctt cttatcaaga
aggagatcat 2100ttaggtgtta ttcctcgcaa ctatgaagga atagtaaacc gtgtaacagc
aaggttcggc 2160ctagatgcat cacagcaaat ccgtctggaa gcagaagaag aaaaattagc
tcatttgcca 2220ctcgctaaaa cagtatccgt agaagagctt ctgcaatacg tggagcttca
agatcctgtt 2280acgcgcacgc agcttcgcgc aatggctgct aaaacggtct gcccgccgca
taaagtagag 2340cttgaagcct tgcttgaaaa gcaagcctac aaagaacaag tgctggcaaa
acgtttaaca 2400atgcttgaac tgcttgaaaa atacccggcg tgtgaaatga aattcagcga
atttatcgcc 2460cttctgccaa gcatacgccc gcgctattac tcgatttctt catcacctcg
tgtcgatgaa 2520aaacaagcaa gcatcacggt cagcgttgtc tcaggagaag cgtggagcgg
atatggagaa 2580tataaaggaa ttgcgtcgaa ctatcttgcc gagctgcaag aaggagatac
gattacgtgc 2640tttatttcca caccgcagtc agaatttacg ctgccaaaag accctgaaac
gccgcttatc 2700atggtcggac cgggaacagg cgtcgcgccg tttagaggct ttgtgcaggc
gcgcaaacag 2760ctaaaagaac aaggacagtc acttggagaa gcacatttat acttcggctg
ccgttcacct 2820catgaagact atctgtatca agaagagctt gaaaacgccc aaagcgaagg
catcattacg 2880cttcataccg ctttttctcg catgccaaat cagccgaaaa catacgttca
gcacgtaatg 2940gaacaagacg gcaagaaatt gattgaactt cttgatcaag gagcgcactt
ctatatttgc 3000ggagacggaa gccaaatggc acctgccgtt gaagcaacgc ttatgaaaag
ctatgctgac 3060gttcaccaag tgagtgaagc agacgctcgc ttatggctgc agcagctaga
agaaaaaggc 3120cgatacgcaa aagacgtgtg ggctgggtaa
3150561049PRTBacillus megaterium 56Met Thr Ile Lys Glu Met Pro
Gln Pro Lys Thr Phe Gly Glu Leu Lys1 5 10
15Asn Leu Pro Leu Leu Asn Thr Asp Lys Pro Val Gln Ala
Leu Met Lys 20 25 30Ile Ala
Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala Pro Gly Arg 35
40 45Val Thr Arg Tyr Leu Ser Ser Gln Arg Leu
Ile Lys Glu Ala Cys Asp 50 55 60Glu
Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu Lys Phe Val Arg65
70 75 80Asp Phe Ala Gly Asp Gly
Leu Phe Thr Ser Trp Thr His Glu Lys Asn 85
90 95Trp Lys Lys Ala His Asn Ile Leu Leu Pro Ser Phe
Ser Gln Gln Ala 100 105 110Met
Lys Gly Tyr His Ala Met Met Val Asp Ile Ala Val Gln Leu Val 115
120 125Gln Lys Trp Glu Arg Leu Asn Ala Asp
Glu His Ile Glu Val Pro Glu 130 135
140Asp Met Thr Arg Leu Thr Leu Asp Thr Ile Gly Leu Cys Gly Phe Asn145
150 155 160Tyr Arg Phe Asn
Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr 165
170 175Ser Met Val Arg Ala Leu Asp Glu Ala Met
Asn Lys Leu Gln Arg Ala 180 185
190Asn Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys Arg Gln Phe Gln Glu
195 200 205Asp Ile Lys Val Met Asn Asp
Leu Val Asp Lys Ile Ile Ala Asp Arg 210 215
220Lys Ala Ser Gly Glu Gln Ser Asp Asp Leu Leu Thr His Met Leu
Asn225 230 235 240Gly Lys
Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile Arg
245 250 255Tyr Gln Ile Ile Thr Phe Leu
Ile Ala Gly His Glu Thr Thr Ser Gly 260 265
270Leu Leu Ser Phe Ala Leu Tyr Phe Leu Val Lys Asn Pro His
Val Leu 275 280 285Gln Lys Ala Ala
Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro 290
295 300Ser Tyr Lys Gln Val Lys Gln Leu Lys Tyr Val Gly
Met Val Leu Asn305 310 315
320Glu Ala Leu Arg Leu Trp Pro Thr Ala Pro Ala Phe Ser Leu Tyr Ala
325 330 335Lys Glu Asp Thr Val
Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp 340
345 350Glu Leu Met Val Leu Ile Pro Gln Leu His Arg Asp
Lys Thr Ile Trp 355 360 365Gly Asp
Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn Pro Ser 370
375 380Ala Ile Pro Gln His Ala Phe Lys Pro Phe Gly
Asn Gly Gln Arg Ala385 390 395
400Cys Ile Gly Gln Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu Gly
405 410 415Met Met Leu Lys
His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu 420
425 430Asp Ile Lys Glu Thr Leu Thr Leu Lys Pro Glu
Gly Phe Val Val Lys 435 440 445Ala
Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro Ser Pro Ser Thr 450
455 460Glu Gln Ser Ala Lys Lys Val Arg Lys Lys
Ala Glu Asn Ala His Asn465 470 475
480Thr Pro Leu Leu Val Leu Tyr Gly Ser Asn Met Gly Thr Ala Glu
Gly 485 490 495Thr Ala Arg
Asp Leu Ala Asp Ile Ala Met Ser Lys Gly Phe Ala Pro 500
505 510Gln Val Ala Thr Leu Asp Ser His Ala Gly
Asn Leu Pro Arg Glu Gly 515 520
525Ala Val Leu Ile Val Thr Ala Ser Tyr Asn Gly His Pro Pro Asp Asn 530
535 540Ala Lys Gln Phe Val Asp Trp Leu
Asp Gln Ala Ser Ala Asp Glu Val545 550
555 560Lys Gly Val Arg Tyr Ser Val Phe Gly Cys Gly Asp
Lys Asn Trp Ala 565 570
575Thr Thr Tyr Gln Lys Val Pro Ala Phe Ile Asp Glu Thr Leu Ala Ala
580 585 590Lys Gly Ala Glu Asn Ile
Ala Asp Arg Gly Glu Ala Asp Ala Ser Asp 595 600
605Asp Phe Glu Gly Thr Tyr Glu Glu Trp Arg Glu His Met Trp
Ser Asp 610 615 620Val Ala Ala Tyr Phe
Asn Leu Asp Ile Glu Asn Ser Glu Asp Asn Lys625 630
635 640Ser Thr Leu Ser Leu Gln Phe Val Asp Ser
Ala Ala Asp Met Pro Leu 645 650
655Ala Lys Met His Gly Ala Phe Ser Thr Asn Val Val Ala Ser Lys Glu
660 665 670Leu Gln Gln Pro Gly
Ser Ala Arg Ser Thr Arg His Leu Glu Ile Glu 675
680 685Leu Pro Lys Glu Ala Ser Tyr Gln Glu Gly Asp His
Leu Gly Val Ile 690 695 700Pro Arg Asn
Tyr Glu Gly Ile Val Asn Arg Val Thr Ala Arg Phe Gly705
710 715 720Leu Asp Ala Ser Gln Gln Ile
Arg Leu Glu Ala Glu Glu Glu Lys Leu 725
730 735Ala His Leu Pro Leu Ala Lys Thr Val Ser Val Glu
Glu Leu Leu Gln 740 745 750Tyr
Val Glu Leu Gln Asp Pro Val Thr Arg Thr Gln Leu Arg Ala Met 755
760 765Ala Ala Lys Thr Val Cys Pro Pro His
Lys Val Glu Leu Glu Ala Leu 770 775
780Leu Glu Lys Gln Ala Tyr Lys Glu Gln Val Leu Ala Lys Arg Leu Thr785
790 795 800Met Leu Glu Leu
Leu Glu Lys Tyr Pro Ala Cys Glu Met Lys Phe Ser 805
810 815Glu Phe Ile Ala Leu Leu Pro Ser Ile Arg
Pro Arg Tyr Tyr Ser Ile 820 825
830Ser Ser Ser Pro Arg Val Asp Glu Lys Gln Ala Ser Ile Thr Val Ser
835 840 845Val Val Ser Gly Glu Ala Trp
Ser Gly Tyr Gly Glu Tyr Lys Gly Ile 850 855
860Ala Ser Asn Tyr Leu Ala Glu Leu Gln Glu Gly Asp Thr Ile Thr
Cys865 870 875 880Phe Ile
Ser Thr Pro Gln Ser Glu Phe Thr Leu Pro Lys Asp Pro Glu
885 890 895Thr Pro Leu Ile Met Val Gly
Pro Gly Thr Gly Val Ala Pro Phe Arg 900 905
910Gly Phe Val Gln Ala Arg Lys Gln Leu Lys Glu Gln Gly Gln
Ser Leu 915 920 925Gly Glu Ala His
Leu Tyr Phe Gly Cys Arg Ser Pro His Glu Asp Tyr 930
935 940Leu Tyr Gln Glu Glu Leu Glu Asn Ala Gln Ser Glu
Gly Ile Ile Thr945 950 955
960Leu His Thr Ala Phe Ser Arg Met Pro Asn Gln Pro Lys Thr Tyr Val
965 970 975Gln His Val Met Glu
Gln Asp Gly Lys Lys Leu Ile Glu Leu Leu Asp 980
985 990Gln Gly Ala His Phe Tyr Ile Cys Gly Asp Gly Ser
Gln Met Ala Pro 995 1000 1005Ala
Val Glu Ala Thr Leu Met Lys Ser Tyr Ala Asp Val His Gln 1010
1015 1020Val Ser Glu Ala Asp Ala Arg Leu Trp
Leu Gln Gln Leu Glu Glu 1025 1030
1035Lys Gly Arg Tyr Ala Lys Asp Val Trp Ala Gly 1040
1045573150DNAArtificial SequenceP450-BM3 Variant 7 DNA sequence
57atgacaatta aagaaatgcc tcagccaaaa acgtttggag agcttaaaaa tttaccgtta
60ttaaacacag ataaaccggt tcaagctttg atgaaaattg cggatgaatt aggagaaatc
120tttaaattcg aggcgcctgg tcgtgtaacg cgctacttat caagtcagcg tctaattaaa
180gaagcatgcg atgaatcacg ctttgataaa aacttaagtc aagcgcttaa atttgtacgt
240gattttgcag gagacgggtt aatcacaagc tggacgcatg aaaaaaattg gaaaaaagcg
300cataatatct tacttccaag cttcagtcag caggcaatga aaggctatca tgcgatgatg
360gtcgatatcg ccgtgcagct tgttcaaaag tgggagcgtc taaatgcaga tgagcatatt
420gaagtaccgg aagacatgac acgtttaacg cttgatacaa ttggtctttg cggctttaac
480tatcgcttta acagctttta ccgagatcag cctcatccat ttattacaag tatggtccgt
540gcactggatg aagcaatgaa caagctgcag cgagcaaatc cagacgaccc agcttatgat
600gaaaacaagc gccagtttca agaagatatc aaggtgatga acgacctagt agataaaatt
660attgcagatc gcaaagcaag cggtgaacaa agcgatgatt tattaacgca catgctaaac
720ggaaaagatc cagaaacggg tgagccgctt gatgacgaga acattcgcta tcaaattatt
780acattcttaa ttgcgggaca cgaaacaaca agtggtcttt tatcatttgc gctgtatttc
840ttagtgaaaa atccacatgt attacaaaaa gcagcagaag aagcagcacg agttctagta
900gatcctgttc caagctacaa acaagtcaaa cagcttaaat atgtcggcat ggtcttaaac
960gaagcgctgc gcttatggcc aactatccct gcgttttccc tatatgcaaa agaagatacg
1020gtgcttggag gagaatatcc tttagaaaaa ggcgacgaac taatggttct gattcctcag
1080cttcaccgtg ataaaacaat ttggggagac gatgtggaag agttccgtcc agagcgtttt
1140gaaaatccaa gtgcgattcc gcagcatgcg tttaaaccgt ttggaaacgg tcagcgtgcg
1200tgtatcggtc agcagttcgc tcttcatgaa gcaacgctgg tacttggtat gatgctaaaa
1260cactttgact ttgaagatca tacaaactac gagctggata ttaaagaaac tttaacgtta
1320aaacctgaag gctttgtggt aaaagcaaaa tcgaaaaaaa ttccgcttgg cggtattcct
1380tcacctagca ctgaacagtc tgctaaaaaa gtacgcaaaa aggcagaaaa cgctcataat
1440acgccgctgc ttgtgctata cggttcaaat atgggaacag ctgaaggaac ggcgcgtgat
1500ttagcagata ttgcaatgag caaaggattt gcaccgcagg tcgcaacgct tgattcacac
1560gccggaaatc ttccgcgcga aggagctgta ttaattgtaa cggcgtctta taacggtcat
1620ccgcctgata acgcaaagca atttgtcgac tggttagacc aagcgtctgc tgatgaagta
1680aaaggcgttc gctactccgt atttggatgc ggcgataaaa actgggctac tacgtatcaa
1740aaagtgcctg cttttatcga tgaaacgctt gccgctaaag gggcagaaaa catcgctgac
1800cgcggtgaag cagatgcaag cgacgacttt gaaggcacct atgaagaatg gcgtgaacac
1860atgtggagtg acgtagcagc ctactttaac ctcgacattg aaaacagtga agataataaa
1920tctactcttt cacttcaatt tgtcgacagc gccgcggata tgccgcttgc gaaaatgcac
1980ggtgcgtttt caacgaacgt cgtagcaagc aaagaacttc aacagccagg cagtgcacga
2040agcacgcgac atcttgaaat tgaacttcca aaagaagctt cttatcaaga aggagatcat
2100ttaggtgtta ttcctcgcaa ctatgaagga atagtaaacc gtgtaacagc aaggttcggc
2160ctagatgcat cacagcaaat ccgtctggaa gcagaagaag aaaaattagc tcatttgcca
2220ctcgctaaaa cagtatccgt agaagagctt ctgcaatacg tggagcttca agatcctgtt
2280acgcgcacgc agcttcgcgc aatggctgct aaaacggtct gcccgccgca taaagtagag
2340cttgaagcct tgcttgaaaa gcaagcctac aaagaacaag tgctggcaaa acgtttaaca
2400atgcttgaac tgcttgaaaa atacccggcg tgtgaaatga aattcagcga atttatcgcc
2460cttctgccaa gcatacgccc gcgctattac tcgatttctt catcacctcg tgtcgatgaa
2520aaacaagcaa gcatcacggt cagcgttgtc tcaggagaag cgtggagcgg atatggagaa
2580tataaaggaa ttgcgtcgaa ctatcttgcc gagctgcaag aaggagatac gattacgtgc
2640tttatttcca caccgcagtc agaatttacg ctgccaaaag accctgaaac gccgcttatc
2700atggtcggac cgggaacagg cgtcgcgccg tttagaggct ttgtgcaggc gcgcaaacag
2760ctaaaagaac aaggacagtc acttggagaa gcacatttat acttcggctg ccgttcacct
2820catgaagact atctgtatca agaagagctt gaaaacgccc aaagcgaagg catcattacg
2880cttcataccg ctttttctcg catgccaaat cagccgaaaa catacgttca gcacgtaatg
2940gaacaagacg gcaagaaatt gattgaactt cttgatcaag gagcgcactt ctatatttgc
3000ggagacggaa gccaaatggc acctgccgtt gaagcaacgc ttatgaaaag ctatgctgac
3060gttcaccaag tgagtgaagc agacgctcgc ttatggctgc agcagctaga agaaaaaggc
3120cgatacgcaa aagacgtgtg ggctgggtaa
3150581049PRTArtificial SequenceP450-BM3 Variant 7 amino acid sequence
58Met Thr Ile Lys Glu Met Pro Gln Pro Lys Thr Phe Gly Glu Leu Lys1
5 10 15Asn Leu Pro Leu Leu Asn
Thr Asp Lys Pro Val Gln Ala Leu Met Lys 20 25
30Ile Ala Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala
Pro Gly Arg 35 40 45Val Thr Arg
Tyr Leu Ser Ser Gln Arg Leu Ile Lys Glu Ala Cys Asp 50
55 60Glu Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu
Lys Phe Val Arg65 70 75
80Asp Phe Ala Gly Asp Gly Leu Ile Thr Ser Trp Thr His Glu Lys Asn
85 90 95Trp Lys Lys Ala His Asn
Ile Leu Leu Pro Ser Phe Ser Gln Gln Ala 100
105 110Met Lys Gly Tyr His Ala Met Met Val Asp Ile Ala
Val Gln Leu Val 115 120 125Gln Lys
Trp Glu Arg Leu Asn Ala Asp Glu His Ile Glu Val Pro Glu 130
135 140Asp Met Thr Arg Leu Thr Leu Asp Thr Ile Gly
Leu Cys Gly Phe Asn145 150 155
160Tyr Arg Phe Asn Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr
165 170 175Ser Met Val Arg
Ala Leu Asp Glu Ala Met Asn Lys Leu Gln Arg Ala 180
185 190Asn Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys
Arg Gln Phe Gln Glu 195 200 205Asp
Ile Lys Val Met Asn Asp Leu Val Asp Lys Ile Ile Ala Asp Arg 210
215 220Lys Ala Ser Gly Glu Gln Ser Asp Asp Leu
Leu Thr His Met Leu Asn225 230 235
240Gly Lys Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile
Arg 245 250 255Tyr Gln Ile
Ile Thr Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly 260
265 270Leu Leu Ser Phe Ala Leu Tyr Phe Leu Val
Lys Asn Pro His Val Leu 275 280
285Gln Lys Ala Ala Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro 290
295 300Ser Tyr Lys Gln Val Lys Gln Leu
Lys Tyr Val Gly Met Val Leu Asn305 310
315 320Glu Ala Leu Arg Leu Trp Pro Thr Ile Pro Ala Phe
Ser Leu Tyr Ala 325 330
335Lys Glu Asp Thr Val Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp
340 345 350Glu Leu Met Val Leu Ile
Pro Gln Leu His Arg Asp Lys Thr Ile Trp 355 360
365Gly Asp Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn
Pro Ser 370 375 380Ala Ile Pro Gln His
Ala Phe Lys Pro Phe Gly Asn Gly Gln Arg Ala385 390
395 400Cys Ile Gly Gln Gln Phe Ala Leu His Glu
Ala Thr Leu Val Leu Gly 405 410
415Met Met Leu Lys His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu
420 425 430Asp Ile Lys Glu Thr
Leu Thr Leu Lys Pro Glu Gly Phe Val Val Lys 435
440 445Ala Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro
Ser Pro Ser Thr 450 455 460Glu Gln Ser
Ala Lys Lys Val Arg Lys Lys Ala Glu Asn Ala His Asn465
470 475 480Thr Pro Leu Leu Val Leu Tyr
Gly Ser Asn Met Gly Thr Ala Glu Gly 485
490 495Thr Ala Arg Asp Leu Ala Asp Ile Ala Met Ser Lys
Gly Phe Ala Pro 500 505 510Gln
Val Ala Thr Leu Asp Ser His Ala Gly Asn Leu Pro Arg Glu Gly 515
520 525Ala Val Leu Ile Val Thr Ala Ser Tyr
Asn Gly His Pro Pro Asp Asn 530 535
540Ala Lys Gln Phe Val Asp Trp Leu Asp Gln Ala Ser Ala Asp Glu Val545
550 555 560Lys Gly Val Arg
Tyr Ser Val Phe Gly Cys Gly Asp Lys Asn Trp Ala 565
570 575Thr Thr Tyr Gln Lys Val Pro Ala Phe Ile
Asp Glu Thr Leu Ala Ala 580 585
590Lys Gly Ala Glu Asn Ile Ala Asp Arg Gly Glu Ala Asp Ala Ser Asp
595 600 605Asp Phe Glu Gly Thr Tyr Glu
Glu Trp Arg Glu His Met Trp Ser Asp 610 615
620Val Ala Ala Tyr Phe Asn Leu Asp Ile Glu Asn Ser Glu Asp Asn
Lys625 630 635 640Ser Thr
Leu Ser Leu Gln Phe Val Asp Ser Ala Ala Asp Met Pro Leu
645 650 655Ala Lys Met His Gly Ala Phe
Ser Thr Asn Val Val Ala Ser Lys Glu 660 665
670Leu Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg His Leu Glu
Ile Glu 675 680 685Leu Pro Lys Glu
Ala Ser Tyr Gln Glu Gly Asp His Leu Gly Val Ile 690
695 700Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg Val Thr
Ala Arg Phe Gly705 710 715
720Leu Asp Ala Ser Gln Gln Ile Arg Leu Glu Ala Glu Glu Glu Lys Leu
725 730 735Ala His Leu Pro Leu
Ala Lys Thr Val Ser Val Glu Glu Leu Leu Gln 740
745 750Tyr Val Glu Leu Gln Asp Pro Val Thr Arg Thr Gln
Leu Arg Ala Met 755 760 765Ala Ala
Lys Thr Val Cys Pro Pro His Lys Val Glu Leu Glu Ala Leu 770
775 780Leu Glu Lys Gln Ala Tyr Lys Glu Gln Val Leu
Ala Lys Arg Leu Thr785 790 795
800Met Leu Glu Leu Leu Glu Lys Tyr Pro Ala Cys Glu Met Lys Phe Ser
805 810 815Glu Phe Ile Ala
Leu Leu Pro Ser Ile Arg Pro Arg Tyr Tyr Ser Ile 820
825 830Ser Ser Ser Pro Arg Val Asp Glu Lys Gln Ala
Ser Ile Thr Val Ser 835 840 845Val
Val Ser Gly Glu Ala Trp Ser Gly Tyr Gly Glu Tyr Lys Gly Ile 850
855 860Ala Ser Asn Tyr Leu Ala Glu Leu Gln Glu
Gly Asp Thr Ile Thr Cys865 870 875
880Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr Leu Pro Lys Asp Pro
Glu 885 890 895Thr Pro Leu
Ile Met Val Gly Pro Gly Thr Gly Val Ala Pro Phe Arg 900
905 910Gly Phe Val Gln Ala Arg Lys Gln Leu Lys
Glu Gln Gly Gln Ser Leu 915 920
925Gly Glu Ala His Leu Tyr Phe Gly Cys Arg Ser Pro His Glu Asp Tyr 930
935 940Leu Tyr Gln Glu Glu Leu Glu Asn
Ala Gln Ser Glu Gly Ile Ile Thr945 950
955 960Leu His Thr Ala Phe Ser Arg Met Pro Asn Gln Pro
Lys Thr Tyr Val 965 970
975Gln His Val Met Glu Gln Asp Gly Lys Lys Leu Ile Glu Leu Leu Asp
980 985 990Gln Gly Ala His Phe Tyr
Ile Cys Gly Asp Gly Ser Gln Met Ala Pro 995 1000
1005Ala Val Glu Ala Thr Leu Met Lys Ser Tyr Ala Asp
Val His Gln 1010 1015 1020Val Ser Glu
Ala Asp Ala Arg Leu Trp Leu Gln Gln Leu Glu Glu 1025
1030 1035Lys Gly Arg Tyr Ala Lys Asp Val Trp Ala Gly
1040 1045593150DNAArtificial SequenceP450-BM3 Variant 17
DNA sequence 59atgacaatta aagaaatgcc tcagccaaaa acgtttggag agcttaaaaa
tttaccgtta 60ttaaacacag ataaaccggt tcaagctttg atgaaaattg cggatgaatt
aggagaaatc 120tttaaattcg aggcgcctgg tcgtgtaacg cgctacttat caagtcagcg
tctaattaaa 180gaagcatgcg atgaatcacg ctttgataaa aacttaagtc aagcgcttaa
atttgtacgt 240gattttgcag gagacgggtt agttacaagc tggacgcatg aaaaaaattg
gaaaaaagcg 300cataatatct tacttccaag cttcagtcag caggcaatga aaggctatca
tgcgatgatg 360gtcgatatcg ccgtgcagct tgttcaaaag tgggagcgtc taaatgcaga
tgagcatatt 420gaagtaccgg aagacatgac acgtttaacg cttgatacaa ttggtctttg
cggctttaac 480tatcgcttta acagctttta ccgagatcag cctcatccat ttattacaag
tatggtccgt 540gcactggatg aagcaatgaa caagctgcag cgagcaaatc cagacgaccc
agcttatgat 600gaaaacaagc gccagtttca agaagatatc aaggtgatga acgacctagt
agataaaatt 660attgcagatc gcaaagcaag cggtgaacaa agcgatgatt tattaacgca
catgctaaac 720ggaaaagatc cagaaacggg tgagccgctt gatgacgaga acattcgcta
tcaaattatt 780acattcttaa ttgcgggaca cgaaacaaca agtggtcttt tatcatttgc
gctgtatttc 840ttagtgaaaa atccacatgt attacaaaaa gcagcagaag aagcagcacg
agttctagta 900gatcctgttc caagctacaa acaagtcaaa cagcttaaat atgtcggcat
ggtcttaaac 960gaagcgctgc gcttatggcc aactatccct gcgttttccc tatatgcaaa
agaagatacg 1020gtgcttggag gagaatatcc tttagaaaaa ggcgacgaac taatggttct
gattcctcag 1080cttcaccgtg ataaaacaat ttggggagac gatgtggaag agttccgtcc
agagcgtttt 1140gaaaatccaa gtgcgattcc gcagcatgcg tttaaaccgt ttggaaacgg
tcagcgtgcg 1200tgtatcggtc agcagttcgc tcttcatgaa gcaacgctgg tacttggtat
gatgctaaaa 1260cactttgact ttgaagatca tacaaactac gagctggata ttaaagaaac
tttaacgtta 1320aaacctgaag gctttgtggt aaaagcaaaa tcgaaaaaaa ttccgcttgg
cggtattcct 1380tcacctagca ctgaacagtc tgctaaaaaa gtacgcaaaa aggcagaaaa
cgctcataat 1440acgccgctgc ttgtgctata cggttcaaat atgggaacag ctgaaggaac
ggcgcgtgat 1500ttagcagata ttgcaatgag caaaggattt gcaccgcagg tcgcaacgct
tgattcacac 1560gccggaaatc ttccgcgcga aggagctgta ttaattgtaa cggcgtctta
taacggtcat 1620ccgcctgata acgcaaagca atttgtcgac tggttagacc aagcgtctgc
tgatgaagta 1680aaaggcgttc gctactccgt atttggatgc ggcgataaaa actgggctac
tacgtatcaa 1740aaagtgcctg cttttatcga tgaaacgctt gccgctaaag gggcagaaaa
catcgctgac 1800cgcggtgaag cagatgcaag cgacgacttt gaaggcacct atgaagaatg
gcgtgaacac 1860atgtggagtg acgtagcagc ctactttaac ctcgacattg aaaacagtga
agataataaa 1920tctactcttt cacttcaatt tgtcgacagc gccgcggata tgccgcttgc
gaaaatgcac 1980ggtgcgtttt caacgaacgt cgtagcaagc aaagaacttc aacagccagg
cagtgcacga 2040agcacgcgac atcttgaaat tgaacttcca aaagaagctt cttatcaaga
aggagatcat 2100ttaggtgtta ttcctcgcaa ctatgaagga atagtaaacc gtgtaacagc
aaggttcggc 2160ctagatgcat cacagcaaat ccgtctggaa gcagaagaag aaaaattagc
tcatttgcca 2220ctcgctaaaa cagtatccgt agaagagctt ctgcaatacg tggagcttca
agatcctgtt 2280acgcgcacgc agcttcgcgc aatggctgct aaaacggtct gcccgccgca
taaagtagag 2340cttgaagcct tgcttgaaaa gcaagcctac aaagaacaag tgctggcaaa
acgtttaaca 2400atgcttgaac tgcttgaaaa atacccggcg tgtgaaatga aattcagcga
atttatcgcc 2460cttctgccaa gcatacgccc gcgctattac tcgatttctt catcacctcg
tgtcgatgaa 2520aaacaagcaa gcatcacggt cagcgttgtc tcaggagaag cgtggagcgg
atatggagaa 2580tataaaggaa ttgcgtcgaa ctatcttgcc gagctgcaag aaggagatac
gattacgtgc 2640tttatttcca caccgcagtc agaatttacg ctgccaaaag accctgaaac
gccgcttatc 2700atggtcggac cgggaacagg cgtcgcgccg tttagaggct ttgtgcaggc
gcgcaaacag 2760ctaaaagaac aaggacagtc acttggagaa gcacatttat acttcggctg
ccgttcacct 2820catgaagact atctgtatca agaagagctt gaaaacgccc aaagcgaagg
catcattacg 2880cttcataccg ctttttctcg catgccaaat cagccgaaaa catacgttca
gcacgtaatg 2940gaacaagacg gcaagaaatt gattgaactt cttgatcaag gagcgcactt
ctatatttgc 3000ggagacggaa gccaaatggc acctgccgtt gaagcaacgc ttatgaaaag
ctatgctgac 3060gttcaccaag tgagtgaagc agacgctcgc ttatggctgc agcagctaga
agaaaaaggc 3120cgatacgcaa aagacgtgtg ggctgggtaa
3150601049PRTArtificial SequenceP450-BM3 Variant 17 amino acid
sequence 60Met Thr Ile Lys Glu Met Pro Gln Pro Lys Thr Phe Gly Glu Leu
Lys1 5 10 15Asn Leu Pro
Leu Leu Asn Thr Asp Lys Pro Val Gln Ala Leu Met Lys 20
25 30Ile Ala Asp Glu Leu Gly Glu Ile Phe Lys
Phe Glu Ala Pro Gly Arg 35 40
45Val Thr Arg Tyr Leu Ser Ser Gln Arg Leu Ile Lys Glu Ala Cys Asp 50
55 60Glu Ser Arg Phe Asp Lys Asn Leu Ser
Gln Ala Leu Lys Phe Val Arg65 70 75
80Asp Phe Ala Gly Asp Gly Leu Val Thr Ser Trp Thr His Glu
Lys Asn 85 90 95Trp Lys
Lys Ala His Asn Ile Leu Leu Pro Ser Phe Ser Gln Gln Ala 100
105 110Met Lys Gly Tyr His Ala Met Met Val
Asp Ile Ala Val Gln Leu Val 115 120
125Gln Lys Trp Glu Arg Leu Asn Ala Asp Glu His Ile Glu Val Pro Glu
130 135 140Asp Met Thr Arg Leu Thr Leu
Asp Thr Ile Gly Leu Cys Gly Phe Asn145 150
155 160Tyr Arg Phe Asn Ser Phe Tyr Arg Asp Gln Pro His
Pro Phe Ile Thr 165 170
175Ser Met Val Arg Ala Leu Asp Glu Ala Met Asn Lys Leu Gln Arg Ala
180 185 190Asn Pro Asp Asp Pro Ala
Tyr Asp Glu Asn Lys Arg Gln Phe Gln Glu 195 200
205Asp Ile Lys Val Met Asn Asp Leu Val Asp Lys Ile Ile Ala
Asp Arg 210 215 220Lys Ala Ser Gly Glu
Gln Ser Asp Asp Leu Leu Thr His Met Leu Asn225 230
235 240Gly Lys Asp Pro Glu Thr Gly Glu Pro Leu
Asp Asp Glu Asn Ile Arg 245 250
255Tyr Gln Ile Ile Thr Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly
260 265 270Leu Leu Ser Phe Ala
Leu Tyr Phe Leu Val Lys Asn Pro His Val Leu 275
280 285Gln Lys Ala Ala Glu Glu Ala Ala Arg Val Leu Val
Asp Pro Val Pro 290 295 300Ser Tyr Lys
Gln Val Lys Gln Leu Lys Tyr Val Gly Met Val Leu Asn305
310 315 320Glu Ala Leu Arg Leu Trp Pro
Thr Ile Pro Ala Phe Ser Leu Tyr Ala 325
330 335Lys Glu Asp Thr Val Leu Gly Gly Glu Tyr Pro Leu
Glu Lys Gly Asp 340 345 350Glu
Leu Met Val Leu Ile Pro Gln Leu His Arg Asp Lys Thr Ile Trp 355
360 365Gly Asp Asp Val Glu Glu Phe Arg Pro
Glu Arg Phe Glu Asn Pro Ser 370 375
380Ala Ile Pro Gln His Ala Phe Lys Pro Phe Gly Asn Gly Gln Arg Ala385
390 395 400Cys Ile Gly Gln
Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu Gly 405
410 415Met Met Leu Lys His Phe Asp Phe Glu Asp
His Thr Asn Tyr Glu Leu 420 425
430Asp Ile Lys Glu Thr Leu Thr Leu Lys Pro Glu Gly Phe Val Val Lys
435 440 445Ala Lys Ser Lys Lys Ile Pro
Leu Gly Gly Ile Pro Ser Pro Ser Thr 450 455
460Glu Gln Ser Ala Lys Lys Val Arg Lys Lys Ala Glu Asn Ala His
Asn465 470 475 480Thr Pro
Leu Leu Val Leu Tyr Gly Ser Asn Met Gly Thr Ala Glu Gly
485 490 495Thr Ala Arg Asp Leu Ala Asp
Ile Ala Met Ser Lys Gly Phe Ala Pro 500 505
510Gln Val Ala Thr Leu Asp Ser His Ala Gly Asn Leu Pro Arg
Glu Gly 515 520 525Ala Val Leu Ile
Val Thr Ala Ser Tyr Asn Gly His Pro Pro Asp Asn 530
535 540Ala Lys Gln Phe Val Asp Trp Leu Asp Gln Ala Ser
Ala Asp Glu Val545 550 555
560Lys Gly Val Arg Tyr Ser Val Phe Gly Cys Gly Asp Lys Asn Trp Ala
565 570 575Thr Thr Tyr Gln Lys
Val Pro Ala Phe Ile Asp Glu Thr Leu Ala Ala 580
585 590Lys Gly Ala Glu Asn Ile Ala Asp Arg Gly Glu Ala
Asp Ala Ser Asp 595 600 605Asp Phe
Glu Gly Thr Tyr Glu Glu Trp Arg Glu His Met Trp Ser Asp 610
615 620Val Ala Ala Tyr Phe Asn Leu Asp Ile Glu Asn
Ser Glu Asp Asn Lys625 630 635
640Ser Thr Leu Ser Leu Gln Phe Val Asp Ser Ala Ala Asp Met Pro Leu
645 650 655Ala Lys Met His
Gly Ala Phe Ser Thr Asn Val Val Ala Ser Lys Glu 660
665 670Leu Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg
His Leu Glu Ile Glu 675 680 685Leu
Pro Lys Glu Ala Ser Tyr Gln Glu Gly Asp His Leu Gly Val Ile 690
695 700Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg
Val Thr Ala Arg Phe Gly705 710 715
720Leu Asp Ala Ser Gln Gln Ile Arg Leu Glu Ala Glu Glu Glu Lys
Leu 725 730 735Ala His Leu
Pro Leu Ala Lys Thr Val Ser Val Glu Glu Leu Leu Gln 740
745 750Tyr Val Glu Leu Gln Asp Pro Val Thr Arg
Thr Gln Leu Arg Ala Met 755 760
765Ala Ala Lys Thr Val Cys Pro Pro His Lys Val Glu Leu Glu Ala Leu 770
775 780Leu Glu Lys Gln Ala Tyr Lys Glu
Gln Val Leu Ala Lys Arg Leu Thr785 790
795 800Met Leu Glu Leu Leu Glu Lys Tyr Pro Ala Cys Glu
Met Lys Phe Ser 805 810
815Glu Phe Ile Ala Leu Leu Pro Ser Ile Arg Pro Arg Tyr Tyr Ser Ile
820 825 830Ser Ser Ser Pro Arg Val
Asp Glu Lys Gln Ala Ser Ile Thr Val Ser 835 840
845Val Val Ser Gly Glu Ala Trp Ser Gly Tyr Gly Glu Tyr Lys
Gly Ile 850 855 860Ala Ser Asn Tyr Leu
Ala Glu Leu Gln Glu Gly Asp Thr Ile Thr Cys865 870
875 880Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr
Leu Pro Lys Asp Pro Glu 885 890
895Thr Pro Leu Ile Met Val Gly Pro Gly Thr Gly Val Ala Pro Phe Arg
900 905 910Gly Phe Val Gln Ala
Arg Lys Gln Leu Lys Glu Gln Gly Gln Ser Leu 915
920 925Gly Glu Ala His Leu Tyr Phe Gly Cys Arg Ser Pro
His Glu Asp Tyr 930 935 940Leu Tyr Gln
Glu Glu Leu Glu Asn Ala Gln Ser Glu Gly Ile Ile Thr945
950 955 960Leu His Thr Ala Phe Ser Arg
Met Pro Asn Gln Pro Lys Thr Tyr Val 965
970 975Gln His Val Met Glu Gln Asp Gly Lys Lys Leu Ile
Glu Leu Leu Asp 980 985 990Gln
Gly Ala His Phe Tyr Ile Cys Gly Asp Gly Ser Gln Met Ala Pro 995
1000 1005Ala Val Glu Ala Thr Leu Met Lys
Ser Tyr Ala Asp Val His Gln 1010 1015
1020Val Ser Glu Ala Asp Ala Arg Leu Trp Leu Gln Gln Leu Glu Glu
1025 1030 1035Lys Gly Arg Tyr Ala Lys
Asp Val Trp Ala Gly 1040 1045613150DNAArtificial
SequenceP450-BM3 Variant 18 DNA sequence 61atgacaatta aagaaatgcc
tcagccaaaa acgtttggag agcttaaaaa tttaccgtta 60ttaaacacag ataaaccggt
tcaagctttg atgaaaattg cggatgaatt aggagaaatc 120tttaaattcg aggcgcctgg
tcgtgtaacg cgctacttat caagtcagcg tctaattaaa 180gaagcatgcg atgaatcacg
ctttgataaa aacttaagtc aagcgcttaa atttgtacgt 240gattttgcag gagacgggtt
agttacaagc tggacgcatg aaaaaaattg gaaaaaagcg 300cataatatct tacttccaag
cttcagtcag caggcaatga aaggctatca tgcgatgatg 360gtcgatatcg ccgtgcagct
tgttcaaaag tgggagcgtc taaatgcaga tgagcatatt 420gaagtaccgg aagacatgac
acgtttaacg cttgatacaa ttggtctttg cggctttaac 480tatcgcttta acagctttta
ccgagatcag cctcatccat ttattacaag tatggtccgt 540gcactggatg aagcaatgaa
caagctgcag cgagcaaatc cagacgaccc agcttatgat 600gaaaacaagc gccagtttca
agaagatatc aaggtgatga acgacctagt agataaaatt 660attgcagatc gcaaagcaag
cggtgaacaa agcgatgatt tattaacgca catgctaaac 720ggaaaagatc cagaaacggg
tgagccgctt gatgacgaga acattcgcta tcaaattatt 780acattcttaa ttgcgggaca
cgaaacaaca agtggtcttt tatcatttgc gctgtatttc 840ttagtgaaaa atccacatgt
attacaaaaa gcagcagaag aagcagcacg agttctagta 900gatcctgttc caagctacaa
acaagtcaaa cagcttaaat atgtcggcat ggtcttaaac 960gaagcgctgc gcttatggcc
aactctgcct gcgttttccc tatatgcaaa agaagatacg 1020gtgcttggag gagaatatcc
tttagaaaaa ggcgacgaac taatggttct gattcctcag 1080cttcaccgtg ataaaacaat
ttggggagac gatgtggaag agttccgtcc agagcgtttt 1140gaaaatccaa gtgcgattcc
gcagcatgcg tttaaaccgt ttggaaacgg tcagcgtgcg 1200tgtatcggtc agcagttcgc
tcttcatgaa gcaacgctgg tacttggtat gatgctaaaa 1260cactttgact ttgaagatca
tacaaactac gagctggata ttaaagaaac tttaacgtta 1320aaacctgaag gctttgtggt
aaaagcaaaa tcgaaaaaaa ttccgcttgg cggtattcct 1380tcacctagca ctgaacagtc
tgctaaaaaa gtacgcaaaa aggcagaaaa cgctcataat 1440acgccgctgc ttgtgctata
cggttcaaat atgggaacag ctgaaggaac ggcgcgtgat 1500ttagcagata ttgcaatgag
caaaggattt gcaccgcagg tcgcaacgct tgattcacac 1560gccggaaatc ttccgcgcga
aggagctgta ttaattgtaa cggcgtctta taacggtcat 1620ccgcctgata acgcaaagca
atttgtcgac tggttagacc aagcgtctgc tgatgaagta 1680aaaggcgttc gctactccgt
atttggatgc ggcgataaaa actgggctac tacgtatcaa 1740aaagtgcctg cttttatcga
tgaaacgctt gccgctaaag gggcagaaaa catcgctgac 1800cgcggtgaag cagatgcaag
cgacgacttt gaaggcacct atgaagaatg gcgtgaacac 1860atgtggagtg acgtagcagc
ctactttaac ctcgacattg aaaacagtga agataataaa 1920tctactcttt cacttcaatt
tgtcgacagc gccgcggata tgccgcttgc gaaaatgcac 1980ggtgcgtttt caacgaacgt
cgtagcaagc aaagaacttc aacagccagg cagtgcacga 2040agcacgcgac atcttgaaat
tgaacttcca aaagaagctt cttatcaaga aggagatcat 2100ttaggtgtta ttcctcgcaa
ctatgaagga atagtaaacc gtgtaacagc aaggttcggc 2160ctagatgcat cacagcaaat
ccgtctggaa gcagaagaag aaaaattagc tcatttgcca 2220ctcgctaaaa cagtatccgt
agaagagctt ctgcaatacg tggagcttca agatcctgtt 2280acgcgcacgc agcttcgcgc
aatggctgct aaaacggtct gcccgccgca taaagtagag 2340cttgaagcct tgcttgaaaa
gcaagcctac aaagaacaag tgctggcaaa acgtttaaca 2400atgcttgaac tgcttgaaaa
atacccggcg tgtgaaatga aattcagcga atttatcgcc 2460cttctgccaa gcatacgccc
gcgctattac tcgatttctt catcacctcg tgtcgatgaa 2520aaacaagcaa gcatcacggt
cagcgttgtc tcaggagaag cgtggagcgg atatggagaa 2580tataaaggaa ttgcgtcgaa
ctatcttgcc gagctgcaag aaggagatac gattacgtgc 2640tttatttcca caccgcagtc
agaatttacg ctgccaaaag accctgaaac gccgcttatc 2700atggtcggac cgggaacagg
cgtcgcgccg tttagaggct ttgtgcaggc gcgcaaacag 2760ctaaaagaac aaggacagtc
acttggagaa gcacatttat acttcggctg ccgttcacct 2820catgaagact atctgtatca
agaagagctt gaaaacgccc aaagcgaagg catcattacg 2880cttcataccg ctttttctcg
catgccaaat cagccgaaaa catacgttca gcacgtaatg 2940gaacaagacg gcaagaaatt
gattgaactt cttgatcaag gagcgcactt ctatatttgc 3000ggagacggaa gccaaatggc
acctgccgtt gaagcaacgc ttatgaaaag ctatgctgac 3060gttcaccaag tgagtgaagc
agacgctcgc ttatggctgc agcagctaga agaaaaaggc 3120cgatacgcaa aagacgtgtg
ggctgggtaa 3150621049PRTArtificial
SequenceP450-BM3 Variant 18 amino acid sequence 62Met Thr Ile Lys Glu Met
Pro Gln Pro Lys Thr Phe Gly Glu Leu Lys1 5
10 15Asn Leu Pro Leu Leu Asn Thr Asp Lys Pro Val Gln
Ala Leu Met Lys 20 25 30Ile
Ala Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala Pro Gly Arg 35
40 45Val Thr Arg Tyr Leu Ser Ser Gln Arg
Leu Ile Lys Glu Ala Cys Asp 50 55
60Glu Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu Lys Phe Val Arg65
70 75 80Asp Phe Ala Gly Asp
Gly Leu Val Thr Ser Trp Thr His Glu Lys Asn 85
90 95Trp Lys Lys Ala His Asn Ile Leu Leu Pro Ser
Phe Ser Gln Gln Ala 100 105
110Met Lys Gly Tyr His Ala Met Met Val Asp Ile Ala Val Gln Leu Val
115 120 125Gln Lys Trp Glu Arg Leu Asn
Ala Asp Glu His Ile Glu Val Pro Glu 130 135
140Asp Met Thr Arg Leu Thr Leu Asp Thr Ile Gly Leu Cys Gly Phe
Asn145 150 155 160Tyr Arg
Phe Asn Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr
165 170 175Ser Met Val Arg Ala Leu Asp
Glu Ala Met Asn Lys Leu Gln Arg Ala 180 185
190Asn Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys Arg Gln Phe
Gln Glu 195 200 205Asp Ile Lys Val
Met Asn Asp Leu Val Asp Lys Ile Ile Ala Asp Arg 210
215 220Lys Ala Ser Gly Glu Gln Ser Asp Asp Leu Leu Thr
His Met Leu Asn225 230 235
240Gly Lys Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile Arg
245 250 255Tyr Gln Ile Ile Thr
Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly 260
265 270Leu Leu Ser Phe Ala Leu Tyr Phe Leu Val Lys Asn
Pro His Val Leu 275 280 285Gln Lys
Ala Ala Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro 290
295 300Ser Tyr Lys Gln Val Lys Gln Leu Lys Tyr Val
Gly Met Val Leu Asn305 310 315
320Glu Ala Leu Arg Leu Trp Pro Thr Leu Pro Ala Phe Ser Leu Tyr Ala
325 330 335Lys Glu Asp Thr
Val Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp 340
345 350Glu Leu Met Val Leu Ile Pro Gln Leu His Arg
Asp Lys Thr Ile Trp 355 360 365Gly
Asp Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn Pro Ser 370
375 380Ala Ile Pro Gln His Ala Phe Lys Pro Phe
Gly Asn Gly Gln Arg Ala385 390 395
400Cys Ile Gly Gln Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu
Gly 405 410 415Met Met Leu
Lys His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu 420
425 430Asp Ile Lys Glu Thr Leu Thr Leu Lys Pro
Glu Gly Phe Val Val Lys 435 440
445Ala Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro Ser Pro Ser Thr 450
455 460Glu Gln Ser Ala Lys Lys Val Arg
Lys Lys Ala Glu Asn Ala His Asn465 470
475 480Thr Pro Leu Leu Val Leu Tyr Gly Ser Asn Met Gly
Thr Ala Glu Gly 485 490
495Thr Ala Arg Asp Leu Ala Asp Ile Ala Met Ser Lys Gly Phe Ala Pro
500 505 510Gln Val Ala Thr Leu Asp
Ser His Ala Gly Asn Leu Pro Arg Glu Gly 515 520
525Ala Val Leu Ile Val Thr Ala Ser Tyr Asn Gly His Pro Pro
Asp Asn 530 535 540Ala Lys Gln Phe Val
Asp Trp Leu Asp Gln Ala Ser Ala Asp Glu Val545 550
555 560Lys Gly Val Arg Tyr Ser Val Phe Gly Cys
Gly Asp Lys Asn Trp Ala 565 570
575Thr Thr Tyr Gln Lys Val Pro Ala Phe Ile Asp Glu Thr Leu Ala Ala
580 585 590Lys Gly Ala Glu Asn
Ile Ala Asp Arg Gly Glu Ala Asp Ala Ser Asp 595
600 605Asp Phe Glu Gly Thr Tyr Glu Glu Trp Arg Glu His
Met Trp Ser Asp 610 615 620Val Ala Ala
Tyr Phe Asn Leu Asp Ile Glu Asn Ser Glu Asp Asn Lys625
630 635 640Ser Thr Leu Ser Leu Gln Phe
Val Asp Ser Ala Ala Asp Met Pro Leu 645
650 655Ala Lys Met His Gly Ala Phe Ser Thr Asn Val Val
Ala Ser Lys Glu 660 665 670Leu
Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg His Leu Glu Ile Glu 675
680 685Leu Pro Lys Glu Ala Ser Tyr Gln Glu
Gly Asp His Leu Gly Val Ile 690 695
700Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg Val Thr Ala Arg Phe Gly705
710 715 720Leu Asp Ala Ser
Gln Gln Ile Arg Leu Glu Ala Glu Glu Glu Lys Leu 725
730 735Ala His Leu Pro Leu Ala Lys Thr Val Ser
Val Glu Glu Leu Leu Gln 740 745
750Tyr Val Glu Leu Gln Asp Pro Val Thr Arg Thr Gln Leu Arg Ala Met
755 760 765Ala Ala Lys Thr Val Cys Pro
Pro His Lys Val Glu Leu Glu Ala Leu 770 775
780Leu Glu Lys Gln Ala Tyr Lys Glu Gln Val Leu Ala Lys Arg Leu
Thr785 790 795 800Met Leu
Glu Leu Leu Glu Lys Tyr Pro Ala Cys Glu Met Lys Phe Ser
805 810 815Glu Phe Ile Ala Leu Leu Pro
Ser Ile Arg Pro Arg Tyr Tyr Ser Ile 820 825
830Ser Ser Ser Pro Arg Val Asp Glu Lys Gln Ala Ser Ile Thr
Val Ser 835 840 845Val Val Ser Gly
Glu Ala Trp Ser Gly Tyr Gly Glu Tyr Lys Gly Ile 850
855 860Ala Ser Asn Tyr Leu Ala Glu Leu Gln Glu Gly Asp
Thr Ile Thr Cys865 870 875
880Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr Leu Pro Lys Asp Pro Glu
885 890 895Thr Pro Leu Ile Met
Val Gly Pro Gly Thr Gly Val Ala Pro Phe Arg 900
905 910Gly Phe Val Gln Ala Arg Lys Gln Leu Lys Glu Gln
Gly Gln Ser Leu 915 920 925Gly Glu
Ala His Leu Tyr Phe Gly Cys Arg Ser Pro His Glu Asp Tyr 930
935 940Leu Tyr Gln Glu Glu Leu Glu Asn Ala Gln Ser
Glu Gly Ile Ile Thr945 950 955
960Leu His Thr Ala Phe Ser Arg Met Pro Asn Gln Pro Lys Thr Tyr Val
965 970 975Gln His Val Met
Glu Gln Asp Gly Lys Lys Leu Ile Glu Leu Leu Asp 980
985 990Gln Gly Ala His Phe Tyr Ile Cys Gly Asp Gly
Ser Gln Met Ala Pro 995 1000
1005Ala Val Glu Ala Thr Leu Met Lys Ser Tyr Ala Asp Val His Gln
1010 1015 1020Val Ser Glu Ala Asp Ala
Arg Leu Trp Leu Gln Gln Leu Glu Glu 1025 1030
1035Lys Gly Arg Tyr Ala Lys Asp Val Trp Ala Gly 1040
1045633150DNAArtificial SequenceP450-BM3 Variant 19 DNA sequence
63atgacaatta aagaaatgcc tcagccaaaa acgtttggag agcttaaaaa tttaccgtta
60ttaaacacag ataaaccggt tcaagctttg atgaaaattg cggatgaatt aggagaaatc
120tttaaattcg aggcgcctgg tcgtgtaacg cgctacttat caagtcagcg tctaattaaa
180gaagcatgcg atgaatcacg ctttgataaa aacttaagtc aagcgcttaa atttgtacgt
240gattttgcag gagacgggtt agttacaagc tggacgcatg aaaaaaattg gaaaaaagcg
300cataatatct tacttccaag cttcagtcag caggcaatga aaggctatca tgcgatgatg
360gtcgatatcg ccgtgcagct tgttcaaaag tgggagcgtc taaatgcaga tgagcatatt
420gaagtaccgg aagacatgac acgtttaacg cttgatacaa ttggtctttg cggctttaac
480tatcgcttta acagctttta ccgagatcag cctcatccat ttattacaag tatggtccgt
540gcactggatg aagcaatgaa caagctgcag cgagcaaatc cagacgaccc agcttatgat
600gaaaacaagc gccagtttca agaagatatc aaggtgatga acgacctagt agataaaatt
660attgcagatc gcaaagcaag cggtgaacaa agcgatgatt tattaacgca catgctaaac
720ggaaaagatc cagaaacggg tgagccgctt gatgacgaga acattcgcta tcaaattatt
780acattcttaa ttgcgggaca cgaaacaaca agtggtcttt tatcatttgc gctgtatttc
840ttagtgaaaa atccacatgt attacaaaaa gcagcagaag aagcagcacg agttctagta
900gatcctgttc caagctacaa acaagtcaaa cagcttaaat atgtcggcat ggtcttaaac
960gaagcgctgc gcttatggcc aactgttcct gcgttttccc tatatgcaaa agaagatacg
1020gtgcttggag gagaatatcc tttagaaaaa ggcgacgaac taatggttct gattcctcag
1080cttcaccgtg ataaaacaat ttggggagac gatgtggaag agttccgtcc agagcgtttt
1140gaaaatccaa gtgcgattcc gcagcatgcg tttaaaccgt ttggaaacgg tcagcgtgcg
1200tgtatcggtc agcagttcgc tcttcatgaa gcaacgctgg tacttggtat gatgctaaaa
1260cactttgact ttgaagatca tacaaactac gagctggata ttaaagaaac tttaacgtta
1320aaacctgaag gctttgtggt aaaagcaaaa tcgaaaaaaa ttccgcttgg cggtattcct
1380tcacctagca ctgaacagtc tgctaaaaaa gtacgcaaaa aggcagaaaa cgctcataat
1440acgccgctgc ttgtgctata cggttcaaat atgggaacag ctgaaggaac ggcgcgtgat
1500ttagcagata ttgcaatgag caaaggattt gcaccgcagg tcgcaacgct tgattcacac
1560gccggaaatc ttccgcgcga aggagctgta ttaattgtaa cggcgtctta taacggtcat
1620ccgcctgata acgcaaagca atttgtcgac tggttagacc aagcgtctgc tgatgaagta
1680aaaggcgttc gctactccgt atttggatgc ggcgataaaa actgggctac tacgtatcaa
1740aaagtgcctg cttttatcga tgaaacgctt gccgctaaag gggcagaaaa catcgctgac
1800cgcggtgaag cagatgcaag cgacgacttt gaaggcacct atgaagaatg gcgtgaacac
1860atgtggagtg acgtagcagc ctactttaac ctcgacattg aaaacagtga agataataaa
1920tctactcttt cacttcaatt tgtcgacagc gccgcggata tgccgcttgc gaaaatgcac
1980ggtgcgtttt caacgaacgt cgtagcaagc aaagaacttc aacagccagg cagtgcacga
2040agcacgcgac atcttgaaat tgaacttcca aaagaagctt cttatcaaga aggagatcat
2100ttaggtgtta ttcctcgcaa ctatgaagga atagtaaacc gtgtaacagc aaggttcggc
2160ctagatgcat cacagcaaat ccgtctggaa gcagaagaag aaaaattagc tcatttgcca
2220ctcgctaaaa cagtatccgt agaagagctt ctgcaatacg tggagcttca agatcctgtt
2280acgcgcacgc agcttcgcgc aatggctgct aaaacggtct gcccgccgca taaagtagag
2340cttgaagcct tgcttgaaaa gcaagcctac aaagaacaag tgctggcaaa acgtttaaca
2400atgcttgaac tgcttgaaaa atacccggcg tgtgaaatga aattcagcga atttatcgcc
2460cttctgccaa gcatacgccc gcgctattac tcgatttctt catcacctcg tgtcgatgaa
2520aaacaagcaa gcatcacggt cagcgttgtc tcaggagaag cgtggagcgg atatggagaa
2580tataaaggaa ttgcgtcgaa ctatcttgcc gagctgcaag aaggagatac gattacgtgc
2640tttatttcca caccgcagtc agaatttacg ctgccaaaag accctgaaac gccgcttatc
2700atggtcggac cgggaacagg cgtcgcgccg tttagaggct ttgtgcaggc gcgcaaacag
2760ctaaaagaac aaggacagtc acttggagaa gcacatttat acttcggctg ccgttcacct
2820catgaagact atctgtatca agaagagctt gaaaacgccc aaagcgaagg catcattacg
2880cttcataccg ctttttctcg catgccaaat cagccgaaaa catacgttca gcacgtaatg
2940gaacaagacg gcaagaaatt gattgaactt cttgatcaag gagcgcactt ctatatttgc
3000ggagacggaa gccaaatggc acctgccgtt gaagcaacgc ttatgaaaag ctatgctgac
3060gttcaccaag tgagtgaagc agacgctcgc ttatggctgc agcagctaga agaaaaaggc
3120cgatacgcaa aagacgtgtg ggctgggtaa
3150641049PRTArtificial SequenceP450-BM3 Variant 19 amino acid sequence
64Met Thr Ile Lys Glu Met Pro Gln Pro Lys Thr Phe Gly Glu Leu Lys1
5 10 15Asn Leu Pro Leu Leu Asn
Thr Asp Lys Pro Val Gln Ala Leu Met Lys 20 25
30Ile Ala Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala
Pro Gly Arg 35 40 45Val Thr Arg
Tyr Leu Ser Ser Gln Arg Leu Ile Lys Glu Ala Cys Asp 50
55 60Glu Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu
Lys Phe Val Arg65 70 75
80Asp Phe Ala Gly Asp Gly Leu Val Thr Ser Trp Thr His Glu Lys Asn
85 90 95Trp Lys Lys Ala His Asn
Ile Leu Leu Pro Ser Phe Ser Gln Gln Ala 100
105 110Met Lys Gly Tyr His Ala Met Met Val Asp Ile Ala
Val Gln Leu Val 115 120 125Gln Lys
Trp Glu Arg Leu Asn Ala Asp Glu His Ile Glu Val Pro Glu 130
135 140Asp Met Thr Arg Leu Thr Leu Asp Thr Ile Gly
Leu Cys Gly Phe Asn145 150 155
160Tyr Arg Phe Asn Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr
165 170 175Ser Met Val Arg
Ala Leu Asp Glu Ala Met Asn Lys Leu Gln Arg Ala 180
185 190Asn Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys
Arg Gln Phe Gln Glu 195 200 205Asp
Ile Lys Val Met Asn Asp Leu Val Asp Lys Ile Ile Ala Asp Arg 210
215 220Lys Ala Ser Gly Glu Gln Ser Asp Asp Leu
Leu Thr His Met Leu Asn225 230 235
240Gly Lys Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile
Arg 245 250 255Tyr Gln Ile
Ile Thr Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly 260
265 270Leu Leu Ser Phe Ala Leu Tyr Phe Leu Val
Lys Asn Pro His Val Leu 275 280
285Gln Lys Ala Ala Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro 290
295 300Ser Tyr Lys Gln Val Lys Gln Leu
Lys Tyr Val Gly Met Val Leu Asn305 310
315 320Glu Ala Leu Arg Leu Trp Pro Thr Val Pro Ala Phe
Ser Leu Tyr Ala 325 330
335Lys Glu Asp Thr Val Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp
340 345 350Glu Leu Met Val Leu Ile
Pro Gln Leu His Arg Asp Lys Thr Ile Trp 355 360
365Gly Asp Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn
Pro Ser 370 375 380Ala Ile Pro Gln His
Ala Phe Lys Pro Phe Gly Asn Gly Gln Arg Ala385 390
395 400Cys Ile Gly Gln Gln Phe Ala Leu His Glu
Ala Thr Leu Val Leu Gly 405 410
415Met Met Leu Lys His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu
420 425 430Asp Ile Lys Glu Thr
Leu Thr Leu Lys Pro Glu Gly Phe Val Val Lys 435
440 445Ala Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro
Ser Pro Ser Thr 450 455 460Glu Gln Ser
Ala Lys Lys Val Arg Lys Lys Ala Glu Asn Ala His Asn465
470 475 480Thr Pro Leu Leu Val Leu Tyr
Gly Ser Asn Met Gly Thr Ala Glu Gly 485
490 495Thr Ala Arg Asp Leu Ala Asp Ile Ala Met Ser Lys
Gly Phe Ala Pro 500 505 510Gln
Val Ala Thr Leu Asp Ser His Ala Gly Asn Leu Pro Arg Glu Gly 515
520 525Ala Val Leu Ile Val Thr Ala Ser Tyr
Asn Gly His Pro Pro Asp Asn 530 535
540Ala Lys Gln Phe Val Asp Trp Leu Asp Gln Ala Ser Ala Asp Glu Val545
550 555 560Lys Gly Val Arg
Tyr Ser Val Phe Gly Cys Gly Asp Lys Asn Trp Ala 565
570 575Thr Thr Tyr Gln Lys Val Pro Ala Phe Ile
Asp Glu Thr Leu Ala Ala 580 585
590Lys Gly Ala Glu Asn Ile Ala Asp Arg Gly Glu Ala Asp Ala Ser Asp
595 600 605Asp Phe Glu Gly Thr Tyr Glu
Glu Trp Arg Glu His Met Trp Ser Asp 610 615
620Val Ala Ala Tyr Phe Asn Leu Asp Ile Glu Asn Ser Glu Asp Asn
Lys625 630 635 640Ser Thr
Leu Ser Leu Gln Phe Val Asp Ser Ala Ala Asp Met Pro Leu
645 650 655Ala Lys Met His Gly Ala Phe
Ser Thr Asn Val Val Ala Ser Lys Glu 660 665
670Leu Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg His Leu Glu
Ile Glu 675 680 685Leu Pro Lys Glu
Ala Ser Tyr Gln Glu Gly Asp His Leu Gly Val Ile 690
695 700Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg Val Thr
Ala Arg Phe Gly705 710 715
720Leu Asp Ala Ser Gln Gln Ile Arg Leu Glu Ala Glu Glu Glu Lys Leu
725 730 735Ala His Leu Pro Leu
Ala Lys Thr Val Ser Val Glu Glu Leu Leu Gln 740
745 750Tyr Val Glu Leu Gln Asp Pro Val Thr Arg Thr Gln
Leu Arg Ala Met 755 760 765Ala Ala
Lys Thr Val Cys Pro Pro His Lys Val Glu Leu Glu Ala Leu 770
775 780Leu Glu Lys Gln Ala Tyr Lys Glu Gln Val Leu
Ala Lys Arg Leu Thr785 790 795
800Met Leu Glu Leu Leu Glu Lys Tyr Pro Ala Cys Glu Met Lys Phe Ser
805 810 815Glu Phe Ile Ala
Leu Leu Pro Ser Ile Arg Pro Arg Tyr Tyr Ser Ile 820
825 830Ser Ser Ser Pro Arg Val Asp Glu Lys Gln Ala
Ser Ile Thr Val Ser 835 840 845Val
Val Ser Gly Glu Ala Trp Ser Gly Tyr Gly Glu Tyr Lys Gly Ile 850
855 860Ala Ser Asn Tyr Leu Ala Glu Leu Gln Glu
Gly Asp Thr Ile Thr Cys865 870 875
880Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr Leu Pro Lys Asp Pro
Glu 885 890 895Thr Pro Leu
Ile Met Val Gly Pro Gly Thr Gly Val Ala Pro Phe Arg 900
905 910Gly Phe Val Gln Ala Arg Lys Gln Leu Lys
Glu Gln Gly Gln Ser Leu 915 920
925Gly Glu Ala His Leu Tyr Phe Gly Cys Arg Ser Pro His Glu Asp Tyr 930
935 940Leu Tyr Gln Glu Glu Leu Glu Asn
Ala Gln Ser Glu Gly Ile Ile Thr945 950
955 960Leu His Thr Ala Phe Ser Arg Met Pro Asn Gln Pro
Lys Thr Tyr Val 965 970
975Gln His Val Met Glu Gln Asp Gly Lys Lys Leu Ile Glu Leu Leu Asp
980 985 990Gln Gly Ala His Phe Tyr
Ile Cys Gly Asp Gly Ser Gln Met Ala Pro 995 1000
1005Ala Val Glu Ala Thr Leu Met Lys Ser Tyr Ala Asp
Val His Gln 1010 1015 1020Val Ser Glu
Ala Asp Ala Arg Leu Trp Leu Gln Gln Leu Glu Glu 1025
1030 1035Lys Gly Arg Tyr Ala Lys Asp Val Trp Ala Gly
1040 1045653150DNAArtificial SequenceP450-BM3 Variant 20
DNA sequence 65atgacaatta aagaaatgcc tcagccaaaa acgtttggag agcttaaaaa
tttaccgtta 60ttaaacacag ataaaccggt tcaagctttg atgaaaattg cggatgaatt
aggagaaatc 120tttaaattcg aggcgcctgg tcgtgtaacg cgctacttat caagtcagcg
tctaattaaa 180gaagcatgcg atgaatcacg ctttgataaa aacttaagtc aagcgcttaa
atttgtacgt 240gattttgcag gagacgggtt agttacaagc tggacgcatg aaaaaaattg
gaaaaaagcg 300cataatatct tacttccaag cttcagtcag caggcaatga aaggctatca
tgcgatgatg 360gtcgatatcg ccgtgcagct tgttcaaaag tgggagcgtc taaatgcaga
tgagcatatt 420gaagtaccgg aagacatgac acgtttaacg cttgatacaa ttggtctttg
cggctttaac 480tatcgcttta acagctttta ccgagatcag cctcatccat ttattacaag
tatggtccgt 540gcactggatg aagcaatgaa caagctgcag cgagcaaatc cagacgaccc
agcttatgat 600gaaaacaagc gccagtttca agaagatatc aaggtgatga acgacctagt
agataaaatt 660attgcagatc gcaaagcaag cggtgaacaa agcgatgatt tattaacgca
catgctaaac 720ggaaaagatc cagaaacggg tgagccgctt gatgacgaga acattcgcta
tcaaattatt 780acattcttaa ttgcgggaca cgaaacaaca agtggtcttt tatcatttgc
gctgtatttc 840ttagtgaaaa atccacatgt attacaaaaa gcagcagaag aagcagcacg
agttctagta 900gatcctgttc caagctacaa acaagtcaaa cagcttaaat atgtcggcat
ggtcttaaac 960gaagcgctgc gcttatggcc aacttttcct gcgttttccc tatatgcaaa
agaagatacg 1020gtgcttggag gagaatatcc tttagaaaaa ggcgacgaac taatggttct
gattcctcag 1080cttcaccgtg ataaaacaat ttggggagac gatgtggaag agttccgtcc
agagcgtttt 1140gaaaatccaa gtgcgattcc gcagcatgcg tttaaaccgt ttggaaacgg
tcagcgtgcg 1200tgtatcggtc agcagttcgc tcttcatgaa gcaacgctgg tacttggtat
gatgctaaaa 1260cactttgact ttgaagatca tacaaactac gagctggata ttaaagaaac
tttaacgtta 1320aaacctgaag gctttgtggt aaaagcaaaa tcgaaaaaaa ttccgcttgg
cggtattcct 1380tcacctagca ctgaacagtc tgctaaaaaa gtacgcaaaa aggcagaaaa
cgctcataat 1440acgccgctgc ttgtgctata cggttcaaat atgggaacag ctgaaggaac
ggcgcgtgat 1500ttagcagata ttgcaatgag caaaggattt gcaccgcagg tcgcaacgct
tgattcacac 1560gccggaaatc ttccgcgcga aggagctgta ttaattgtaa cggcgtctta
taacggtcat 1620ccgcctgata acgcaaagca atttgtcgac tggttagacc aagcgtctgc
tgatgaagta 1680aaaggcgttc gctactccgt atttggatgc ggcgataaaa actgggctac
tacgtatcaa 1740aaagtgcctg cttttatcga tgaaacgctt gccgctaaag gggcagaaaa
catcgctgac 1800cgcggtgaag cagatgcaag cgacgacttt gaaggcacct atgaagaatg
gcgtgaacac 1860atgtggagtg acgtagcagc ctactttaac ctcgacattg aaaacagtga
agataataaa 1920tctactcttt cacttcaatt tgtcgacagc gccgcggata tgccgcttgc
gaaaatgcac 1980ggtgcgtttt caacgaacgt cgtagcaagc aaagaacttc aacagccagg
cagtgcacga 2040agcacgcgac atcttgaaat tgaacttcca aaagaagctt cttatcaaga
aggagatcat 2100ttaggtgtta ttcctcgcaa ctatgaagga atagtaaacc gtgtaacagc
aaggttcggc 2160ctagatgcat cacagcaaat ccgtctggaa gcagaagaag aaaaattagc
tcatttgcca 2220ctcgctaaaa cagtatccgt agaagagctt ctgcaatacg tggagcttca
agatcctgtt 2280acgcgcacgc agcttcgcgc aatggctgct aaaacggtct gcccgccgca
taaagtagag 2340cttgaagcct tgcttgaaaa gcaagcctac aaagaacaag tgctggcaaa
acgtttaaca 2400atgcttgaac tgcttgaaaa atacccggcg tgtgaaatga aattcagcga
atttatcgcc 2460cttctgccaa gcatacgccc gcgctattac tcgatttctt catcacctcg
tgtcgatgaa 2520aaacaagcaa gcatcacggt cagcgttgtc tcaggagaag cgtggagcgg
atatggagaa 2580tataaaggaa ttgcgtcgaa ctatcttgcc gagctgcaag aaggagatac
gattacgtgc 2640tttatttcca caccgcagtc agaatttacg ctgccaaaag accctgaaac
gccgcttatc 2700atggtcggac cgggaacagg cgtcgcgccg tttagaggct ttgtgcaggc
gcgcaaacag 2760ctaaaagaac aaggacagtc acttggagaa gcacatttat acttcggctg
ccgttcacct 2820catgaagact atctgtatca agaagagctt gaaaacgccc aaagcgaagg
catcattacg 2880cttcataccg ctttttctcg catgccaaat cagccgaaaa catacgttca
gcacgtaatg 2940gaacaagacg gcaagaaatt gattgaactt cttgatcaag gagcgcactt
ctatatttgc 3000ggagacggaa gccaaatggc acctgccgtt gaagcaacgc ttatgaaaag
ctatgctgac 3060gttcaccaag tgagtgaagc agacgctcgc ttatggctgc agcagctaga
agaaaaaggc 3120cgatacgcaa aagacgtgtg ggctgggtaa
3150661049PRTArtificial SequenceP450-BM3 Variant 20 amino acid
sequence 66Met Thr Ile Lys Glu Met Pro Gln Pro Lys Thr Phe Gly Glu Leu
Lys1 5 10 15Asn Leu Pro
Leu Leu Asn Thr Asp Lys Pro Val Gln Ala Leu Met Lys 20
25 30Ile Ala Asp Glu Leu Gly Glu Ile Phe Lys
Phe Glu Ala Pro Gly Arg 35 40
45Val Thr Arg Tyr Leu Ser Ser Gln Arg Leu Ile Lys Glu Ala Cys Asp 50
55 60Glu Ser Arg Phe Asp Lys Asn Leu Ser
Gln Ala Leu Lys Phe Val Arg65 70 75
80Asp Phe Ala Gly Asp Gly Leu Val Thr Ser Trp Thr His Glu
Lys Asn 85 90 95Trp Lys
Lys Ala His Asn Ile Leu Leu Pro Ser Phe Ser Gln Gln Ala 100
105 110Met Lys Gly Tyr His Ala Met Met Val
Asp Ile Ala Val Gln Leu Val 115 120
125Gln Lys Trp Glu Arg Leu Asn Ala Asp Glu His Ile Glu Val Pro Glu
130 135 140Asp Met Thr Arg Leu Thr Leu
Asp Thr Ile Gly Leu Cys Gly Phe Asn145 150
155 160Tyr Arg Phe Asn Ser Phe Tyr Arg Asp Gln Pro His
Pro Phe Ile Thr 165 170
175Ser Met Val Arg Ala Leu Asp Glu Ala Met Asn Lys Leu Gln Arg Ala
180 185 190Asn Pro Asp Asp Pro Ala
Tyr Asp Glu Asn Lys Arg Gln Phe Gln Glu 195 200
205Asp Ile Lys Val Met Asn Asp Leu Val Asp Lys Ile Ile Ala
Asp Arg 210 215 220Lys Ala Ser Gly Glu
Gln Ser Asp Asp Leu Leu Thr His Met Leu Asn225 230
235 240Gly Lys Asp Pro Glu Thr Gly Glu Pro Leu
Asp Asp Glu Asn Ile Arg 245 250
255Tyr Gln Ile Ile Thr Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly
260 265 270Leu Leu Ser Phe Ala
Leu Tyr Phe Leu Val Lys Asn Pro His Val Leu 275
280 285Gln Lys Ala Ala Glu Glu Ala Ala Arg Val Leu Val
Asp Pro Val Pro 290 295 300Ser Tyr Lys
Gln Val Lys Gln Leu Lys Tyr Val Gly Met Val Leu Asn305
310 315 320Glu Ala Leu Arg Leu Trp Pro
Thr Phe Pro Ala Phe Ser Leu Tyr Ala 325
330 335Lys Glu Asp Thr Val Leu Gly Gly Glu Tyr Pro Leu
Glu Lys Gly Asp 340 345 350Glu
Leu Met Val Leu Ile Pro Gln Leu His Arg Asp Lys Thr Ile Trp 355
360 365Gly Asp Asp Val Glu Glu Phe Arg Pro
Glu Arg Phe Glu Asn Pro Ser 370 375
380Ala Ile Pro Gln His Ala Phe Lys Pro Phe Gly Asn Gly Gln Arg Ala385
390 395 400Cys Ile Gly Gln
Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu Gly 405
410 415Met Met Leu Lys His Phe Asp Phe Glu Asp
His Thr Asn Tyr Glu Leu 420 425
430Asp Ile Lys Glu Thr Leu Thr Leu Lys Pro Glu Gly Phe Val Val Lys
435 440 445Ala Lys Ser Lys Lys Ile Pro
Leu Gly Gly Ile Pro Ser Pro Ser Thr 450 455
460Glu Gln Ser Ala Lys Lys Val Arg Lys Lys Ala Glu Asn Ala His
Asn465 470 475 480Thr Pro
Leu Leu Val Leu Tyr Gly Ser Asn Met Gly Thr Ala Glu Gly
485 490 495Thr Ala Arg Asp Leu Ala Asp
Ile Ala Met Ser Lys Gly Phe Ala Pro 500 505
510Gln Val Ala Thr Leu Asp Ser His Ala Gly Asn Leu Pro Arg
Glu Gly 515 520 525Ala Val Leu Ile
Val Thr Ala Ser Tyr Asn Gly His Pro Pro Asp Asn 530
535 540Ala Lys Gln Phe Val Asp Trp Leu Asp Gln Ala Ser
Ala Asp Glu Val545 550 555
560Lys Gly Val Arg Tyr Ser Val Phe Gly Cys Gly Asp Lys Asn Trp Ala
565 570 575Thr Thr Tyr Gln Lys
Val Pro Ala Phe Ile Asp Glu Thr Leu Ala Ala 580
585 590Lys Gly Ala Glu Asn Ile Ala Asp Arg Gly Glu Ala
Asp Ala Ser Asp 595 600 605Asp Phe
Glu Gly Thr Tyr Glu Glu Trp Arg Glu His Met Trp Ser Asp 610
615 620Val Ala Ala Tyr Phe Asn Leu Asp Ile Glu Asn
Ser Glu Asp Asn Lys625 630 635
640Ser Thr Leu Ser Leu Gln Phe Val Asp Ser Ala Ala Asp Met Pro Leu
645 650 655Ala Lys Met His
Gly Ala Phe Ser Thr Asn Val Val Ala Ser Lys Glu 660
665 670Leu Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg
His Leu Glu Ile Glu 675 680 685Leu
Pro Lys Glu Ala Ser Tyr Gln Glu Gly Asp His Leu Gly Val Ile 690
695 700Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg
Val Thr Ala Arg Phe Gly705 710 715
720Leu Asp Ala Ser Gln Gln Ile Arg Leu Glu Ala Glu Glu Glu Lys
Leu 725 730 735Ala His Leu
Pro Leu Ala Lys Thr Val Ser Val Glu Glu Leu Leu Gln 740
745 750Tyr Val Glu Leu Gln Asp Pro Val Thr Arg
Thr Gln Leu Arg Ala Met 755 760
765Ala Ala Lys Thr Val Cys Pro Pro His Lys Val Glu Leu Glu Ala Leu 770
775 780Leu Glu Lys Gln Ala Tyr Lys Glu
Gln Val Leu Ala Lys Arg Leu Thr785 790
795 800Met Leu Glu Leu Leu Glu Lys Tyr Pro Ala Cys Glu
Met Lys Phe Ser 805 810
815Glu Phe Ile Ala Leu Leu Pro Ser Ile Arg Pro Arg Tyr Tyr Ser Ile
820 825 830Ser Ser Ser Pro Arg Val
Asp Glu Lys Gln Ala Ser Ile Thr Val Ser 835 840
845Val Val Ser Gly Glu Ala Trp Ser Gly Tyr Gly Glu Tyr Lys
Gly Ile 850 855 860Ala Ser Asn Tyr Leu
Ala Glu Leu Gln Glu Gly Asp Thr Ile Thr Cys865 870
875 880Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr
Leu Pro Lys Asp Pro Glu 885 890
895Thr Pro Leu Ile Met Val Gly Pro Gly Thr Gly Val Ala Pro Phe Arg
900 905 910Gly Phe Val Gln Ala
Arg Lys Gln Leu Lys Glu Gln Gly Gln Ser Leu 915
920 925Gly Glu Ala His Leu Tyr Phe Gly Cys Arg Ser Pro
His Glu Asp Tyr 930 935 940Leu Tyr Gln
Glu Glu Leu Glu Asn Ala Gln Ser Glu Gly Ile Ile Thr945
950 955 960Leu His Thr Ala Phe Ser Arg
Met Pro Asn Gln Pro Lys Thr Tyr Val 965
970 975Gln His Val Met Glu Gln Asp Gly Lys Lys Leu Ile
Glu Leu Leu Asp 980 985 990Gln
Gly Ala His Phe Tyr Ile Cys Gly Asp Gly Ser Gln Met Ala Pro 995
1000 1005Ala Val Glu Ala Thr Leu Met Lys
Ser Tyr Ala Asp Val His Gln 1010 1015
1020Val Ser Glu Ala Asp Ala Arg Leu Trp Leu Gln Gln Leu Glu Glu
1025 1030 1035Lys Gly Arg Tyr Ala Lys
Asp Val Trp Ala Gly 1040 1045673150DNAArtificial
SequenceP450-BM3 Variant 23 DNA sequence 67atgacaatta aagaaatgcc
tcagccaaaa acgtttggag agcttaaaaa tttaccgtta 60ttaaacacag ataaaccggt
tcaagctttg atgaaaattg cggatgaatt aggagaaatc 120tttaaattcg aggcgcctgg
tcgtgtaacg cgctacttat caagtcagcg tctaattaaa 180gaagcatgcg atgaatcacg
ctttgataaa aacttaagtc aagcgcttaa atttgtacgt 240gattttgcag gagacgggtt
atttacaagc tggacgcatg aaaaaaattg gaaaaaagcg 300cataatatct tacttccaag
cttcagtcag caggcaatga aaggctatca tgcgatgatg 360gtcgatatcg ccgtgcagct
tgttcaaaag tgggagcgtc taaatgcaga tgagcatatt 420gaagtaccgg aagacatgac
acgtttaacg cttgatacaa ttggtctttg cggctttaac 480tatcgcttta acagctttta
ccgagatcag cctcatccat ttattacaag tatggtccgt 540gcactggatg aagcaatgaa
caagctgcag cgagcaaatc cagacgaccc agcttatgat 600gaaaacaagc gccagtttca
agaagatatc aaggtgatga acgacctagt agataaaatt 660attgcagatc gcaaagcaag
cggtgaacaa agcgatgatt tattaacgca catgctaaac 720ggaaaagatc cagaaacggg
tgagccgctt gatgacgaga acattcgcta tcaaattatt 780acattcttaa ttgcgggaca
cgaaacaaca agtggtcttt tatcatttgc gctgtatttc 840ttagtgaaaa atccacatgt
attacaaaaa gcagcagaag aagcagcacg agttctagta 900gatcctgttc caagctacaa
acaagtcaaa cagcttaaat atgtcggcat ggtcttaaac 960gaagcgctgc gcttatggcc
aactgttcct gcgttttccc tatatgcaaa agaagatacg 1020gtgcttggag gagaatatcc
tttagaaaaa ggcgacgaac taatggttct gattcctcag 1080cttcaccgtg ataaaacaat
ttggggagac gatgtggaag agttccgtcc agagcgtttt 1140gaaaatccaa gtgcgattcc
gcagcatgcg tttaaaccgt ttggaaacgg tcagcgtgcg 1200tgtatcggtc agcagttcgc
tcttcatgaa gcaacgctgg tacttggtat gatgctaaaa 1260cactttgact ttgaagatca
tacaaactac gagctggata ttaaagaaac tttaacgtta 1320aaacctgaag gctttgtggt
aaaagcaaaa tcgaaaaaaa ttccgcttgg cggtattcct 1380tcacctagca ctgaacagtc
tgctaaaaaa gtacgcaaaa aggcagaaaa cgctcataat 1440acgccgctgc ttgtgctata
cggttcaaat atgggaacag ctgaaggaac ggcgcgtgat 1500ttagcagata ttgcaatgag
caaaggattt gcaccgcagg tcgcaacgct tgattcacac 1560gccggaaatc ttccgcgcga
aggagctgta ttaattgtaa cggcgtctta taacggtcat 1620ccgcctgata acgcaaagca
atttgtcgac tggttagacc aagcgtctgc tgatgaagta 1680aaaggcgttc gctactccgt
atttggatgc ggcgataaaa actgggctac tacgtatcaa 1740aaagtgcctg cttttatcga
tgaaacgctt gccgctaaag gggcagaaaa catcgctgac 1800cgcggtgaag cagatgcaag
cgacgacttt gaaggcacct atgaagaatg gcgtgaacac 1860atgtggagtg acgtagcagc
ctactttaac ctcgacattg aaaacagtga agataataaa 1920tctactcttt cacttcaatt
tgtcgacagc gccgcggata tgccgcttgc gaaaatgcac 1980ggtgcgtttt caacgaacgt
cgtagcaagc aaagaacttc aacagccagg cagtgcacga 2040agcacgcgac atcttgaaat
tgaacttcca aaagaagctt cttatcaaga aggagatcat 2100ttaggtgtta ttcctcgcaa
ctatgaagga atagtaaacc gtgtaacagc aaggttcggc 2160ctagatgcat cacagcaaat
ccgtctggaa gcagaagaag aaaaattagc tcatttgcca 2220ctcgctaaaa cagtatccgt
agaagagctt ctgcaatacg tggagcttca agatcctgtt 2280acgcgcacgc agcttcgcgc
aatggctgct aaaacggtct gcccgccgca taaagtagag 2340cttgaagcct tgcttgaaaa
gcaagcctac aaagaacaag tgctggcaaa acgtttaaca 2400atgcttgaac tgcttgaaaa
atacccggcg tgtgaaatga aattcagcga atttatcgcc 2460cttctgccaa gcatacgccc
gcgctattac tcgatttctt catcacctcg tgtcgatgaa 2520aaacaagcaa gcatcacggt
cagcgttgtc tcaggagaag cgtggagcgg atatggagaa 2580tataaaggaa ttgcgtcgaa
ctatcttgcc gagctgcaag aaggagatac gattacgtgc 2640tttatttcca caccgcagtc
agaatttacg ctgccaaaag accctgaaac gccgcttatc 2700atggtcggac cgggaacagg
cgtcgcgccg tttagaggct ttgtgcaggc gcgcaaacag 2760ctaaaagaac aaggacagtc
acttggagaa gcacatttat acttcggctg ccgttcacct 2820catgaagact atctgtatca
agaagagctt gaaaacgccc aaagcgaagg catcattacg 2880cttcataccg ctttttctcg
catgccaaat cagccgaaaa catacgttca gcacgtaatg 2940gaacaagacg gcaagaaatt
gattgaactt cttgatcaag gagcgcactt ctatatttgc 3000ggagacggaa gccaaatggc
acctgccgtt gaagcaacgc ttatgaaaag ctatgctgac 3060gttcaccaag tgagtgaagc
agacgctcgc ttatggctgc agcagctaga agaaaaaggc 3120cgatacgcaa aagacgtgtg
ggctgggtaa 3150681049PRTArtificial
SequenceP450-BM3 Variant 23 amino acid sequence 68Met Thr Ile Lys Glu Met
Pro Gln Pro Lys Thr Phe Gly Glu Leu Lys1 5
10 15Asn Leu Pro Leu Leu Asn Thr Asp Lys Pro Val Gln
Ala Leu Met Lys 20 25 30Ile
Ala Asp Glu Leu Gly Glu Ile Phe Lys Phe Glu Ala Pro Gly Arg 35
40 45Val Thr Arg Tyr Leu Ser Ser Gln Arg
Leu Ile Lys Glu Ala Cys Asp 50 55
60Glu Ser Arg Phe Asp Lys Asn Leu Ser Gln Ala Leu Lys Phe Val Arg65
70 75 80Asp Phe Ala Gly Asp
Gly Leu Phe Thr Ser Trp Thr His Glu Lys Asn 85
90 95Trp Lys Lys Ala His Asn Ile Leu Leu Pro Ser
Phe Ser Gln Gln Ala 100 105
110Met Lys Gly Tyr His Ala Met Met Val Asp Ile Ala Val Gln Leu Val
115 120 125Gln Lys Trp Glu Arg Leu Asn
Ala Asp Glu His Ile Glu Val Pro Glu 130 135
140Asp Met Thr Arg Leu Thr Leu Asp Thr Ile Gly Leu Cys Gly Phe
Asn145 150 155 160Tyr Arg
Phe Asn Ser Phe Tyr Arg Asp Gln Pro His Pro Phe Ile Thr
165 170 175Ser Met Val Arg Ala Leu Asp
Glu Ala Met Asn Lys Leu Gln Arg Ala 180 185
190Asn Pro Asp Asp Pro Ala Tyr Asp Glu Asn Lys Arg Gln Phe
Gln Glu 195 200 205Asp Ile Lys Val
Met Asn Asp Leu Val Asp Lys Ile Ile Ala Asp Arg 210
215 220Lys Ala Ser Gly Glu Gln Ser Asp Asp Leu Leu Thr
His Met Leu Asn225 230 235
240Gly Lys Asp Pro Glu Thr Gly Glu Pro Leu Asp Asp Glu Asn Ile Arg
245 250 255Tyr Gln Ile Ile Thr
Phe Leu Ile Ala Gly His Glu Thr Thr Ser Gly 260
265 270Leu Leu Ser Phe Ala Leu Tyr Phe Leu Val Lys Asn
Pro His Val Leu 275 280 285Gln Lys
Ala Ala Glu Glu Ala Ala Arg Val Leu Val Asp Pro Val Pro 290
295 300Ser Tyr Lys Gln Val Lys Gln Leu Lys Tyr Val
Gly Met Val Leu Asn305 310 315
320Glu Ala Leu Arg Leu Trp Pro Thr Val Pro Ala Phe Ser Leu Tyr Ala
325 330 335Lys Glu Asp Thr
Val Leu Gly Gly Glu Tyr Pro Leu Glu Lys Gly Asp 340
345 350Glu Leu Met Val Leu Ile Pro Gln Leu His Arg
Asp Lys Thr Ile Trp 355 360 365Gly
Asp Asp Val Glu Glu Phe Arg Pro Glu Arg Phe Glu Asn Pro Ser 370
375 380Ala Ile Pro Gln His Ala Phe Lys Pro Phe
Gly Asn Gly Gln Arg Ala385 390 395
400Cys Ile Gly Gln Gln Phe Ala Leu His Glu Ala Thr Leu Val Leu
Gly 405 410 415Met Met Leu
Lys His Phe Asp Phe Glu Asp His Thr Asn Tyr Glu Leu 420
425 430Asp Ile Lys Glu Thr Leu Thr Leu Lys Pro
Glu Gly Phe Val Val Lys 435 440
445Ala Lys Ser Lys Lys Ile Pro Leu Gly Gly Ile Pro Ser Pro Ser Thr 450
455 460Glu Gln Ser Ala Lys Lys Val Arg
Lys Lys Ala Glu Asn Ala His Asn465 470
475 480Thr Pro Leu Leu Val Leu Tyr Gly Ser Asn Met Gly
Thr Ala Glu Gly 485 490
495Thr Ala Arg Asp Leu Ala Asp Ile Ala Met Ser Lys Gly Phe Ala Pro
500 505 510Gln Val Ala Thr Leu Asp
Ser His Ala Gly Asn Leu Pro Arg Glu Gly 515 520
525Ala Val Leu Ile Val Thr Ala Ser Tyr Asn Gly His Pro Pro
Asp Asn 530 535 540Ala Lys Gln Phe Val
Asp Trp Leu Asp Gln Ala Ser Ala Asp Glu Val545 550
555 560Lys Gly Val Arg Tyr Ser Val Phe Gly Cys
Gly Asp Lys Asn Trp Ala 565 570
575Thr Thr Tyr Gln Lys Val Pro Ala Phe Ile Asp Glu Thr Leu Ala Ala
580 585 590Lys Gly Ala Glu Asn
Ile Ala Asp Arg Gly Glu Ala Asp Ala Ser Asp 595
600 605Asp Phe Glu Gly Thr Tyr Glu Glu Trp Arg Glu His
Met Trp Ser Asp 610 615 620Val Ala Ala
Tyr Phe Asn Leu Asp Ile Glu Asn Ser Glu Asp Asn Lys625
630 635 640Ser Thr Leu Ser Leu Gln Phe
Val Asp Ser Ala Ala Asp Met Pro Leu 645
650 655Ala Lys Met His Gly Ala Phe Ser Thr Asn Val Val
Ala Ser Lys Glu 660 665 670Leu
Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg His Leu Glu Ile Glu 675
680 685Leu Pro Lys Glu Ala Ser Tyr Gln Glu
Gly Asp His Leu Gly Val Ile 690 695
700Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg Val Thr Ala Arg Phe Gly705
710 715 720Leu Asp Ala Ser
Gln Gln Ile Arg Leu Glu Ala Glu Glu Glu Lys Leu 725
730 735Ala His Leu Pro Leu Ala Lys Thr Val Ser
Val Glu Glu Leu Leu Gln 740 745
750Tyr Val Glu Leu Gln Asp Pro Val Thr Arg Thr Gln Leu Arg Ala Met
755 760 765Ala Ala Lys Thr Val Cys Pro
Pro His Lys Val Glu Leu Glu Ala Leu 770 775
780Leu Glu Lys Gln Ala Tyr Lys Glu Gln Val Leu Ala Lys Arg Leu
Thr785 790 795 800Met Leu
Glu Leu Leu Glu Lys Tyr Pro Ala Cys Glu Met Lys Phe Ser
805 810 815Glu Phe Ile Ala Leu Leu Pro
Ser Ile Arg Pro Arg Tyr Tyr Ser Ile 820 825
830Ser Ser Ser Pro Arg Val Asp Glu Lys Gln Ala Ser Ile Thr
Val Ser 835 840 845Val Val Ser Gly
Glu Ala Trp Ser Gly Tyr Gly Glu Tyr Lys Gly Ile 850
855 860Ala Ser Asn Tyr Leu Ala Glu Leu Gln Glu Gly Asp
Thr Ile Thr Cys865 870 875
880Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr Leu Pro Lys Asp Pro Glu
885 890 895Thr Pro Leu Ile Met
Val Gly Pro Gly Thr Gly Val Ala Pro Phe Arg 900
905 910Gly Phe Val Gln Ala Arg Lys Gln Leu Lys Glu Gln
Gly Gln Ser Leu 915 920 925Gly Glu
Ala His Leu Tyr Phe Gly Cys Arg Ser Pro His Glu Asp Tyr 930
935 940Leu Tyr Gln Glu Glu Leu Glu Asn Ala Gln Ser
Glu Gly Ile Ile Thr945 950 955
960Leu His Thr Ala Phe Ser Arg Met Pro Asn Gln Pro Lys Thr Tyr Val
965 970 975Gln His Val Met
Glu Gln Asp Gly Lys Lys Leu Ile Glu Leu Leu Asp 980
985 990Gln Gly Ala His Phe Tyr Ile Cys Gly Asp Gly
Ser Gln Met Ala Pro 995 1000
1005Ala Val Glu Ala Thr Leu Met Lys Ser Tyr Ala Asp Val His Gln
1010 1015 1020Val Ser Glu Ala Asp Ala
Arg Leu Trp Leu Gln Gln Leu Glu Glu 1025 1030
1035Lys Gly Arg Tyr Ala Lys Asp Val Trp Ala Gly 1040
1045692051DNASantalum album 69atgtacgtat ccatcagcaa tgatcgacct
tataaaggag ccgagacact ctcaccttca 60atccactcat ccctacattc ttttgctaac
tcctttgttg ccagcaagta tatctcttac 120gttaaacgtt ttacttcctc aacatgtctc
cggcaacagc cgttatcctc actctcctcg 180tggccctagg gctatccatc cttttgcggc
ggcgccaaaa aagaaataat ctacctcccg 240gtccacccgc tttaccgatc atcggaaaca
tccacatatt ggggaccctt cctcaccaga 300gcctctacaa cttggccaag aagtatggtc
ccatcatgtc aatgaggctg gggctcgtgc 360cggctgttgt gatatcctct ccggaggccg
ccgagctcgt cctcaagacc cacgatatcg 420ttttcgccag ccggcccaga ctccaagttg
cggactactt ccattacggg acaaagggcg 480tcatcctgac ggagtatggt acatattggc
gcaacatgcg aaggctgtgc accgtgaagc 540ttctcaacac ggtgaaaatc gattctttcg
cagggacaag gaagaaggag gtggcatcgt 600tcgtgcagtc ccttaaggag gcttcggtgg
cacacaaaat ggtgaatttg agcgcgaggg 660tggcgaacgt cattgaaaac atggtgtgcc
ttatggtgat cgggcgaagt agcgatgaga 720ggtttaagct aaaggaggtc atccaggagg
cagcgcagtt ggcgggagct ttcaatatag 780gggattatgt tccattcctt atgccccttg
acctacaggg attaactcgg cgcataaagt 840caggaagtaa agctttcgac gacatcttgg
aagtcataat cgacgagcac gtgcaagaca 900ttaaggacca tgatgatgaa caacatggag
acttcattga tgtgttgctg gcaatgatga 960acaagcccat ggattcgcgg gagggtctta
gtatcattga ccgaacaaac atcaaagcga 1020tcctagtgga catgattgga gctgcaatgg
acacttcaac aagtggcgtc gagtgggcga 1080tttcagagct catcaagcat ccgcgggtaa
tgaaaaagct ccaagacgag gtcaaaactg 1140tcatcggaat gaataggatg gtcgaggagg
ccgacttgcc taagctacca tacctcgaca 1200tggtagtgaa agagaccatg aggttacacc
ctcctggacc attgctcgtg ccccgagagt 1260ccatggaaga catcacaatc aacggatact
acatacctaa gaaatcgcga atcattgtca 1320acgcctgggc aattgggcgt gatacaaacg
cctggtctaa taacgcgcac gagttcttcc 1380cagagaggtt tatgagtagc aatgtggact
tacagggaca agatttccaa cttatcccat 1440tcgggtcagg tcggagaggg tgccccggga
tgcgcctagg cctcacaacc gttcgattag 1500tgttagcgca gctcattcat tgtttcgact
tggagcttcc taagggaacc gtggcgaccg 1560acttggacat gagtgagaaa ttcgggttgg
caatgcccag agcccagcac ttgcttgcat 1620ttccaaccta tcgcttggag tcctaaacca
ttgaggaaga tgcgtttata tttcatattg 1680cagtgttaca ataagtagca gtcgttttca
tggtgaagag gcaattcccc ctacactacc 1740tgtcttatgc tatgcccctc cccaactttc
accgtatgtg tcttgtcatc atgtatcatg 1800tccacatcaa taagatatta tatagaaatt
gtcggtacgc caagatcgga ctcaatatgt 1860atcagctttg agctctgtac acaaaatttg
atacacgaac agagaaggtc gcgaattttg 1920ggccactcgt ctcagatata tacccttcaa
gtggctaatg gggagatccc tctcctttgc 1980atttaaagcc tctgcttccc gaaccctagc
ccacaaaatt ttggccgaaa ccggataggc 2040atacacgaca g
2051701503DNASantalum album 70atgtctccgg
caacagccgt tatcctcact ctcctcgtgg ccctagggct atccatcctt 60ttgcggcggc
gccaaaaaag aaataatcta cctcccggtc cacccgcttt accgatcatc 120ggaaacatcc
acatattggg gacccttcct caccagagcc tctacaactt ggccaagaag 180tatggtccca
tcatgtcaat gaggctgggg ctcgtgccgg ctgttgtgat atcctctccg 240gaggccgccg
agctcgtcct caagacccac gatatcgttt tcgccagccg gcccagactc 300caagttgcgg
actacttcca ttacgggaca aagggcgtca tcctgacgga gtatggtaca 360tattggcgca
acatgcgaag gctgtgcacc gtgaagcttc tcaacacggt gaaaatcgat 420tctttcgcag
ggacaaggaa gaaggaggtg gcatcgttcg tgcagtccct taaggaggct 480tcggtggcac
acaaaatggt gaatttgagc gcgagggtgg cgaacgtcat tgaaaacatg 540gtgtgcctta
tggtgatcgg gcgaagtagc gatgagaggt ttaagctaaa ggaggtcatc 600caggaggcag
cgcagttggc gggagctttc aatatagggg attatgttcc attccttatg 660ccccttgacc
tacagggatt aactcggcgc ataaagtcag gaagtaaagc tttcgacgac 720atcttggaag
tcataatcga cgagcacgtg caagacatta aggaccatga tgatgaacaa 780catggagact
tcattgatgt gttgctggca atgatgaaca agcccatgga ttcgcgggag 840ggtcttagta
tcattgaccg aacaaacatc aaagcgatcc tagtggacat gattggagct 900gcaatggaca
cttcaacaag tggcgtcgag tgggcgattt cagagctcat caagcatccg 960cgggtaatga
aaaagctcca agacgaggtc aaaactgtca tcggaatgaa taggatggtc 1020gaggaggccg
acttgcctaa gctaccatac ctcgacatgg tagtgaaaga gaccatgagg 1080ttacaccctc
ctggaccatt gctcgtgccc cgagagtcca tggaagacat cacaatcaac 1140ggatactaca
tacctaagaa atcgcgaatc attgtcaacg cctgggcaat tgggcgtgat 1200acaaacgcct
ggtctaataa cgcgcacgag ttcttcccag agaggtttat gagtagcaat 1260gtggacttac
agggacaaga tttccaactt atcccattcg ggtcaggtcg gagagggtgc 1320cccgggatgc
gcctaggcct cacaaccgtt cgattagtgt tagcgcagct cattcattgt 1380ttcgacttgg
agcttcctaa gggaaccgtg gcgaccgact tggacatgag tgagaaattc 1440gggttggcaa
tgcccagagc ccagcacttg cttgcatttc caacctatcg cttggagtcc 1500taa
150371500PRTSantalum album 71Met Ser Pro Ala Thr Ala Val Ile Leu Thr Leu
Leu Val Ala Leu Gly1 5 10
15Leu Ser Ile Leu Leu Arg Arg Arg Gln Lys Arg Asn Asn Leu Pro Pro
20 25 30Gly Pro Pro Ala Leu Pro Ile
Ile Gly Asn Ile His Ile Leu Gly Thr 35 40
45Leu Pro His Gln Ser Leu Tyr Asn Leu Ala Lys Lys Tyr Gly Pro
Ile 50 55 60Met Ser Met Arg Leu Gly
Leu Val Pro Ala Val Val Ile Ser Ser Pro65 70
75 80Glu Ala Ala Glu Leu Val Leu Lys Thr His Asp
Ile Val Phe Ala Ser 85 90
95Arg Pro Arg Leu Gln Val Ala Asp Tyr Phe His Tyr Gly Thr Lys Gly
100 105 110Val Ile Leu Thr Glu Tyr
Gly Thr Tyr Trp Arg Asn Met Arg Arg Leu 115 120
125Cys Thr Val Lys Leu Leu Asn Thr Val Lys Ile Asp Ser Phe
Ala Gly 130 135 140Thr Arg Lys Lys Glu
Val Ala Ser Phe Val Gln Ser Leu Lys Glu Ala145 150
155 160Ser Val Ala His Lys Met Val Asn Leu Ser
Ala Arg Val Ala Asn Val 165 170
175Ile Glu Asn Met Val Cys Leu Met Val Ile Gly Arg Ser Ser Asp Glu
180 185 190Arg Phe Lys Leu Lys
Glu Val Ile Gln Glu Ala Ala Gln Leu Ala Gly 195
200 205Ala Phe Asn Ile Gly Asp Tyr Val Pro Phe Leu Met
Pro Leu Asp Leu 210 215 220Gln Gly Leu
Thr Arg Arg Ile Lys Ser Gly Ser Lys Ala Phe Asp Asp225
230 235 240Ile Leu Glu Val Ile Ile Asp
Glu His Val Gln Asp Ile Lys Asp His 245
250 255Asp Asp Glu Gln His Gly Asp Phe Ile Asp Val Leu
Leu Ala Met Met 260 265 270Asn
Lys Pro Met Asp Ser Arg Glu Gly Leu Ser Ile Ile Asp Arg Thr 275
280 285Asn Ile Lys Ala Ile Leu Val Asp Met
Ile Gly Ala Ala Met Asp Thr 290 295
300Ser Thr Ser Gly Val Glu Trp Ala Ile Ser Glu Leu Ile Lys His Pro305
310 315 320Arg Val Met Lys
Lys Leu Gln Asp Glu Val Lys Thr Val Ile Gly Met 325
330 335Asn Arg Met Val Glu Glu Ala Asp Leu Pro
Lys Leu Pro Tyr Leu Asp 340 345
350Met Val Val Lys Glu Thr Met Arg Leu His Pro Pro Gly Pro Leu Leu
355 360 365Val Pro Arg Glu Ser Met Glu
Asp Ile Thr Ile Asn Gly Tyr Tyr Ile 370 375
380Pro Lys Lys Ser Arg Ile Ile Val Asn Ala Trp Ala Ile Gly Arg
Asp385 390 395 400Thr Asn
Ala Trp Ser Asn Asn Ala His Glu Phe Phe Pro Glu Arg Phe
405 410 415Met Ser Ser Asn Val Asp Leu
Gln Gly Gln Asp Phe Gln Leu Ile Pro 420 425
430Phe Gly Ser Gly Arg Arg Gly Cys Pro Gly Met Arg Leu Gly
Leu Thr 435 440 445Thr Val Arg Leu
Val Leu Ala Gln Leu Ile His Cys Phe Asp Leu Glu 450
455 460Leu Pro Lys Gly Thr Val Ala Thr Asp Leu Asp Met
Ser Glu Lys Phe465 470 475
480Gly Leu Ala Met Pro Arg Ala Gln His Leu Leu Ala Phe Pro Thr Tyr
485 490 495Arg Leu Glu Ser
500721534DNAArtificial SequenceSaCP120293, optimized DNA sequence
for SaCP816 72aggaggtaaa acatatggca ctgttgttgg cggttttctg gagcgctttg
attattctgg 60ttagcatctt attgcgtcgt cgtcaaaaac gcaacaattt gccaccgggc
ccaccggccc 120tgccgatcat cggtaacatt cacattctgg gcaccctgcc gcaccagagc
ctgtacaatc 180tggcgaagaa gtacggtccg atcatgtcca tgcgtttggg cttggttccg
gcggtggtca 240tcagcagccc ggaagcggcc gagctggtcc tgaaaaccca cgacatcgtt
tttgcttctc 300gccctcgtct gcaagttgca gattactttc actatggcac caaaggcgtg
attctgaccg 360aatatggtac ctactggcgt aacatgcgtc gcctgtgcac ggtcaaactg
ctgaacaccg 420ttaagattga tagctttgca ggcacccgca agaaagaagt cgctagcttc
gttcagagcc 480tgaaagaagc aagcgtggcg cacaaaatgg ttaacctgtc cgcacgcgtc
gctaatgtta 540ttgagaatat ggtttgtctg atggttattg gtagatcgtc tgacgagcgt
ttcaagctga 600aagaagtgat ccaagaagcg gcacagctgg cgggtgcctt caatattggt
gactatgtcc 660cgtttctgat gccgctggat ctgcagggcc tgactcgccg tatcaagagc
ggtagcaagg 720cattcgatga catcctcgag gtcattatcg acgagcatgt gcaagacatt
aaagatcatg 780acgatgagca gcatggtgac ttcatcgacg tgctgctggc gatgatgaat
aagccgatgg 840attctcgtga gggtctgtcc atcattgatc gcacgaacat taaagcgatc
ctggtggata 900tgatcggtgc cgcgatggac acgagcacca gcggtgtgga gtgggcgatt
tcggagctga 960ttaagcatcc tcgtgtcatg aagaaactgc aagacgaagt gaaaaccgta
atcggtatga 1020accgcatggt ggaagaagcg gatctgccga aactgccgta cctggacatg
gttgtcaagg 1080aaacgatgcg tctgcatccg ccaggcccgc tgctggtgcc gcgtgaaagc
atggaagata 1140ttacgatcaa cggttactat atcccgaaga aatcccgcat tattgtgaat
gcatgggcga 1200tcggccgtga caccaacgcc tggagcaata atgcgcacga gtttttccct
gagcgtttta 1260tgagctctaa cgttgatctg caaggccagg acttccagct gatcccgttc
ggtagcggtc 1320gtcgcggttg tccgggcatg cgtctgggtc tgacgacggt ccgcttggtg
ctggcccaac 1380tgattcactg cttcgacctg gagcttccga agggcaccgt cgcgactgac
ctggatatga 1440gcgagaagtt tggtctggca atgccgcgtg cgcagcactt actggccttt
ccgacctacc 1500gtctggagag ctaagtcgac accatggaaa gctt
153473499PRTArtificial SequenceSaCP120293 amino acid sequence,
N-terminal modified SaCP816 73Met Ala Leu Leu Leu Ala Val Phe Trp
Ser Ala Leu Ile Ile Leu Val1 5 10
15Ser Ile Leu Leu Arg Arg Arg Gln Lys Arg Asn Asn Leu Pro Pro
Gly 20 25 30Pro Pro Ala Leu
Pro Ile Ile Gly Asn Ile His Ile Leu Gly Thr Leu 35
40 45Pro His Gln Ser Leu Tyr Asn Leu Ala Lys Lys Tyr
Gly Pro Ile Met 50 55 60Ser Met Arg
Leu Gly Leu Val Pro Ala Val Val Ile Ser Ser Pro Glu65 70
75 80Ala Ala Glu Leu Val Leu Lys Thr
His Asp Ile Val Phe Ala Ser Arg 85 90
95Pro Arg Leu Gln Val Ala Asp Tyr Phe His Tyr Gly Thr Lys
Gly Val 100 105 110Ile Leu Thr
Glu Tyr Gly Thr Tyr Trp Arg Asn Met Arg Arg Leu Cys 115
120 125Thr Val Lys Leu Leu Asn Thr Val Lys Ile Asp
Ser Phe Ala Gly Thr 130 135 140Arg Lys
Lys Glu Val Ala Ser Phe Val Gln Ser Leu Lys Glu Ala Ser145
150 155 160Val Ala His Lys Met Val Asn
Leu Ser Ala Arg Val Ala Asn Val Ile 165
170 175Glu Asn Met Val Cys Leu Met Val Ile Gly Arg Ser
Ser Asp Glu Arg 180 185 190Phe
Lys Leu Lys Glu Val Ile Gln Glu Ala Ala Gln Leu Ala Gly Ala 195
200 205Phe Asn Ile Gly Asp Tyr Val Pro Phe
Leu Met Pro Leu Asp Leu Gln 210 215
220Gly Leu Thr Arg Arg Ile Lys Ser Gly Ser Lys Ala Phe Asp Asp Ile225
230 235 240Leu Glu Val Ile
Ile Asp Glu His Val Gln Asp Ile Lys Asp His Asp 245
250 255Asp Glu Gln His Gly Asp Phe Ile Asp Val
Leu Leu Ala Met Met Asn 260 265
270Lys Pro Met Asp Ser Arg Glu Gly Leu Ser Ile Ile Asp Arg Thr Asn
275 280 285Ile Lys Ala Ile Leu Val Asp
Met Ile Gly Ala Ala Met Asp Thr Ser 290 295
300Thr Ser Gly Val Glu Trp Ala Ile Ser Glu Leu Ile Lys His Pro
Arg305 310 315 320Val Met
Lys Lys Leu Gln Asp Glu Val Lys Thr Val Ile Gly Met Asn
325 330 335Arg Met Val Glu Glu Ala Asp
Leu Pro Lys Leu Pro Tyr Leu Asp Met 340 345
350Val Val Lys Glu Thr Met Arg Leu His Pro Pro Gly Pro Leu
Leu Val 355 360 365Pro Arg Glu Ser
Met Glu Asp Ile Thr Ile Asn Gly Tyr Tyr Ile Pro 370
375 380Lys Lys Ser Arg Ile Ile Val Asn Ala Trp Ala Ile
Gly Arg Asp Thr385 390 395
400Asn Ala Trp Ser Asn Asn Ala His Glu Phe Phe Pro Glu Arg Phe Met
405 410 415Ser Ser Asn Val Asp
Leu Gln Gly Gln Asp Phe Gln Leu Ile Pro Phe 420
425 430Gly Ser Gly Arg Arg Gly Cys Pro Gly Met Arg Leu
Gly Leu Thr Thr 435 440 445Val Arg
Leu Val Leu Ala Gln Leu Ile His Cys Phe Asp Leu Glu Leu 450
455 460Pro Lys Gly Thr Val Ala Thr Asp Leu Asp Met
Ser Glu Lys Phe Gly465 470 475
480Leu Ala Met Pro Arg Ala Gln His Leu Leu Ala Phe Pro Thr Tyr Arg
485 490 495Leu Glu
Ser743672DNAArtificial Sequencesynthetic operon encoding for SaCP816 and
CPRm 74catatggcac tgttgttggc ggttttctgg agcgctttga ttattctggt tagcatctta
60ttgcgtcgtc gtcaaaaacg caacaatttg ccaccgggcc caccggccct gccgatcatc
120ggtaacattc acattctggg caccctgccg caccagagcc tgtacaatct ggcgaagaag
180tacggtccga tcatgtccat gcgtttgggc ttggttccgg cggtggtcat cagcagcccg
240gaagcggccg agctggtcct gaaaacccac gacatcgttt ttgcttctcg ccctcgtctg
300caagttgcag attactttca ctatggcacc aaaggcgtga ttctgaccga atatggtacc
360tactggcgta acatgcgtcg cctgtgcacg gtcaaactgc tgaacaccgt taagattgat
420agctttgcag gcacccgcaa gaaagaagtc gctagcttcg ttcagagcct gaaagaagca
480agcgtggcgc acaaaatggt taacctgtcc gcacgcgtcg ctaatgttat tgagaatatg
540gtttgtctga tggttattgg tagatcgtct gacgagcgtt tcaagctgaa agaagtgatc
600caagaagcgg cacagctggc gggtgccttc aatattggtg actatgtccc gtttctgatg
660ccgctggatc tgcagggcct gactcgccgt atcaagagcg gtagcaaggc attcgatgac
720atcctcgagg tcattatcga cgagcatgtg caagacatta aagatcatga cgatgagcag
780catggtgact tcatcgacgt gctgctggcg atgatgaata agccgatgga ttctcgtgag
840ggtctgtcca tcattgatcg cacgaacatt aaagcgatcc tggtggatat gatcggtgcc
900gcgatggaca cgagcaccag cggtgtggag tgggcgattt cggagctgat taagcatcct
960cgtgtcatga agaaactgca agacgaagtg aaaaccgtaa tcggtatgaa ccgcatggtg
1020gaagaagcgg atctgccgaa actgccgtac ctggacatgg ttgtcaagga aacgatgcgt
1080ctgcatccgc caggcccgct gctggtgccg cgtgaaagca tggaagatat tacgatcaac
1140ggttactata tcccgaagaa atcccgcatt attgtgaatg catgggcgat cggccgtgac
1200accaacgcct ggagcaataa tgcgcacgag tttttccctg agcgttttat gagctctaac
1260gttgatctgc aaggccagga cttccagctg atcccgttcg gtagcggtcg tcgcggttgt
1320ccgggcatgc gtctgggtct gacgacggtc cgcttggtgc tggcccaact gattcactgc
1380ttcgacctgg agcttccgaa gggcaccgtc gcgactgacc tggatatgag cgagaagttt
1440ggtctggcaa tgccgcgtgc gcagcactta ctggcctttc cgacctaccg tctggagagc
1500taagtcgact aactttaaga aggagatata tccatggaac ctagctctca gaaactgtct
1560ccgttggaat ttgttgctgc tatcctgaag ggcgactaca gcagcggtca ggttgaaggt
1620ggtccaccgc caggtctggc agctatgttg atggaaaata aggatttggt gatggttctg
1680acgacgtccg tggcagtcct gatcggctgt gtcgtggtcc tggcatggcg tcgtgcggca
1740ggtagcggta agtacaagca acctgaactg cctaaactgg tggtcccgaa agcagccgaa
1800ccggaggagg cagaggatga taaaaccaag atcagcgtgt ttttcggcac ccaaaccggt
1860acggcagaag gtttcgcgaa ggcttttgtt gaagaggcca aggcgcgtta tcagcaggcc
1920cgtttcaaag ttatcgacct ggacgactat gcggcagacg atgacgagta cgaagagaaa
1980ctgaagaagg aaaacttggc attcttcttc ttggcgtcct acggtgacgg cgagccgacg
2040gacaacgcgg cacgctttta caaatggttt acggagggta aggaccgtgg tgaatggctg
2100aacaatctgc agtacggcgt ttttggtctg ggtaaccgtc aatatgagca tttcaataag
2160atcgccattg tcgtcgatga tctgatcttc gagcaaggtg gcaagaagct ggttccggtg
2220ggtctgggtg acgatgacca gtgcattgag gatgattttg cggcgtggcg tgaactggtc
2280tggccggaac tggataaact gctgcgtaac gaagacgacg ctaccgtggc aaccccgtac
2340agcgccgctg tgctgcaata ccgcgtggtt ttccacgatc acattgacgg cctgattagc
2400gaaaacggta gcccgaacgg tcatgctaat ggcaataccg tgtacgatgc gcaacacccg
2460tgccgtagca acgtcgcggt caagaaggaa ttgcatactc cggcgagcga tcgcagctgc
2520acccacctgg aatttaacat tagcggtacc ggcctgatgt acgagacggg tgaccacgtc
2580ggtgtgtatt gcgagaacct gttggaaacc gtggaggagg ccgagaagtt gttgaacctg
2640agcccgcaga cgtacttctc cgttcacacc gacaacgagg acggtacgcc gttgagcggc
2700agcagcctgc cgccaccgtt tccgccgtgc accttgcgca cggcattgac caaatacgca
2760gacttgactt ctgcaccgaa aaagtcggtg ctggtggcgc tggccgagta cgcatctgac
2820cagggtgaag cggatcgttt gcgtttcttg gcgagcccga gcggcaaaga ggaatatgca
2880cagtacatct tggcaagcca gcgcacgctg ctggaggtca tggcggagtt cccgtcggcg
2940aaaccgccgc tgggtgtctt tttcgcgggt gtcgctccgc gcctgcagcc gcgtttctat
3000tccattagct ctagcccgaa gatcgcaccg ttccgtattc acgtgacctg cgccctggtt
3060tatgacaaat cccctaccgg tcgcgttcat aagggcatct gtagcacgtg gatgaaaaat
3120gcggtcccgc tggaagaaag caacgattgt tcctgggctc cgatcttcgt ccgcaacagc
3180aacttcaagc tgccgaccga cccgaaggtt ccgattatca tgattggtcc gggtaccggt
3240ctggcccctt ttcgtggctt tttgcaagag cgcttggcgt tgaaagagag cggtgctgaa
3300ttgggtccgg cgatcttgtt ctttggttgc cgtaaccgta aaatggactt tatttacgag
3360gatgaactga atgatttcgt caaagcgggc gttgtcagcg agctgatcgt cgcttttagc
3420cgcgaaggcc cgatgaaaga atacgtgcaa cacaaaatga gccaacgtgc ctccgatgtg
3480tggaacatca ttagcgacgg tggttatgtt tatgtttgcg gtgacgcgaa gggtatggct
3540cgtgatgttc accgtaccct gcataccatc gcacaggagc aaggtagcat gtccagctcg
3600gaggccgaag gtatggtcaa aaacctgcaa accaccggtc gttacctgcg tgatgtgtgg
3660taataaaagc tt
3672755349DNAArtificial SequenceSynthetic operon encoding for SaCP816,
CPRm and ClASS 75catatggcac tgttgttggc ggttttctgg agcgctttga
ttattctggt tagcatctta 60ttgcgtcgtc gtcaaaaacg caacaatttg ccaccgggcc
caccggccct gccgatcatc 120ggtaacattc acattctggg caccctgccg caccagagcc
tgtacaatct ggcgaagaag 180tacggtccga tcatgtccat gcgtttgggc ttggttccgg
cggtggtcat cagcagcccg 240gaagcggccg agctggtcct gaaaacccac gacatcgttt
ttgcttctcg ccctcgtctg 300caagttgcag attactttca ctatggcacc aaaggcgtga
ttctgaccga atatggtacc 360tactggcgta acatgcgtcg cctgtgcacg gtcaaactgc
tgaacaccgt taagattgat 420agctttgcag gcacccgcaa gaaagaagtc gctagcttcg
ttcagagcct gaaagaagca 480agcgtggcgc acaaaatggt taacctgtcc gcacgcgtcg
ctaatgttat tgagaatatg 540gtttgtctga tggttattgg tagatcgtct gacgagcgtt
tcaagctgaa agaagtgatc 600caagaagcgg cacagctggc gggtgccttc aatattggtg
actatgtccc gtttctgatg 660ccgctggatc tgcagggcct gactcgccgt atcaagagcg
gtagcaaggc attcgatgac 720atcctcgagg tcattatcga cgagcatgtg caagacatta
aagatcatga cgatgagcag 780catggtgact tcatcgacgt gctgctggcg atgatgaata
agccgatgga ttctcgtgag 840ggtctgtcca tcattgatcg cacgaacatt aaagcgatcc
tggtggatat gatcggtgcc 900gcgatggaca cgagcaccag cggtgtggag tgggcgattt
cggagctgat taagcatcct 960cgtgtcatga agaaactgca agacgaagtg aaaaccgtaa
tcggtatgaa ccgcatggtg 1020gaagaagcgg atctgccgaa actgccgtac ctggacatgg
ttgtcaagga aacgatgcgt 1080ctgcatccgc caggcccgct gctggtgccg cgtgaaagca
tggaagatat tacgatcaac 1140ggttactata tcccgaagaa atcccgcatt attgtgaatg
catgggcgat cggccgtgac 1200accaacgcct ggagcaataa tgcgcacgag tttttccctg
agcgttttat gagctctaac 1260gttgatctgc aaggccagga cttccagctg atcccgttcg
gtagcggtcg tcgcggttgt 1320ccgggcatgc gtctgggtct gacgacggtc cgcttggtgc
tggcccaact gattcactgc 1380ttcgacctgg agcttccgaa gggcaccgtc gcgactgacc
tggatatgag cgagaagttt 1440ggtctggcaa tgccgcgtgc gcagcactta ctggcctttc
cgacctaccg tctggagagc 1500taagtcgact aactttaaga aggagatata tccatggaac
ctagctctca gaaactgtct 1560ccgttggaat ttgttgctgc tatcctgaag ggcgactaca
gcagcggtca ggttgaaggt 1620ggtccaccgc caggtctggc agctatgttg atggaaaata
aggatttggt gatggttctg 1680acgacgtccg tggcagtcct gatcggctgt gtcgtggtcc
tggcatggcg tcgtgcggca 1740ggtagcggta agtacaagca acctgaactg cctaaactgg
tggtcccgaa agcagccgaa 1800ccggaggagg cagaggatga taaaaccaag atcagcgtgt
ttttcggcac ccaaaccggt 1860acggcagaag gtttcgcgaa ggcttttgtt gaagaggcca
aggcgcgtta tcagcaggcc 1920cgtttcaaag ttatcgacct ggacgactat gcggcagacg
atgacgagta cgaagagaaa 1980ctgaagaagg aaaacttggc attcttcttc ttggcgtcct
acggtgacgg cgagccgacg 2040gacaacgcgg cacgctttta caaatggttt acggagggta
aggaccgtgg tgaatggctg 2100aacaatctgc agtacggcgt ttttggtctg ggtaaccgtc
aatatgagca tttcaataag 2160atcgccattg tcgtcgatga tctgatcttc gagcaaggtg
gcaagaagct ggttccggtg 2220ggtctgggtg acgatgacca gtgcattgag gatgattttg
cggcgtggcg tgaactggtc 2280tggccggaac tggataaact gctgcgtaac gaagacgacg
ctaccgtggc aaccccgtac 2340agcgccgctg tgctgcaata ccgcgtggtt ttccacgatc
acattgacgg cctgattagc 2400gaaaacggta gcccgaacgg tcatgctaat ggcaataccg
tgtacgatgc gcaacacccg 2460tgccgtagca acgtcgcggt caagaaggaa ttgcatactc
cggcgagcga tcgcagctgc 2520acccacctgg aatttaacat tagcggtacc ggcctgatgt
acgagacggg tgaccacgtc 2580ggtgtgtatt gcgagaacct gttggaaacc gtggaggagg
ccgagaagtt gttgaacctg 2640agcccgcaga cgtacttctc cgttcacacc gacaacgagg
acggtacgcc gttgagcggc 2700agcagcctgc cgccaccgtt tccgccgtgc accttgcgca
cggcattgac caaatacgca 2760gacttgactt ctgcaccgaa aaagtcggtg ctggtggcgc
tggccgagta cgcatctgac 2820cagggtgaag cggatcgttt gcgtttcttg gcgagcccga
gcggcaaaga ggaatatgca 2880cagtacatct tggcaagcca gcgcacgctg ctggaggtca
tggcggagtt cccgtcggcg 2940aaaccgccgc tgggtgtctt tttcgcgggt gtcgctccgc
gcctgcagcc gcgtttctat 3000tccattagct ctagcccgaa gatcgcaccg ttccgtattc
acgtgacctg cgccctggtt 3060tatgacaaat cccctaccgg tcgcgttcat aagggcatct
gtagcacgtg gatgaaaaat 3120gcggtcccgc tggaagaaag caacgattgt tcctgggctc
cgatcttcgt ccgcaacagc 3180aacttcaagc tgccgaccga cccgaaggtt ccgattatca
tgattggtcc gggtaccggt 3240ctggcccctt ttcgtggctt tttgcaagag cgcttggcgt
tgaaagagag cggtgctgaa 3300ttgggtccgg cgatcttgtt ctttggttgc cgtaaccgta
aaatggactt tatttacgag 3360gatgaactga atgatttcgt caaagcgggc gttgtcagcg
agctgatcgt cgcttttagc 3420cgcgaaggcc cgatgaaaga atacgtgcaa cacaaaatga
gccaacgtgc ctccgatgtg 3480tggaacatca ttagcgacgg tggttatgtt tatgtttgcg
gtgacgcgaa gggtatggct 3540cgtgatgttc accgtaccct gcataccatc gcacaggagc
aaggtagcat gtccagctcg 3600gaggccgaag gtatggtcaa aaacctgcaa accaccggtc
gttacctgcg tgatgtgtgg 3660taataaaagc ttgaaggaga tatactaatg tctacccagc
aggttagctc cgagaatatc 3720gttcgcaacg cggcgaactt ccacccgaat atctggggta
atcatttctt gacgtgtcca 3780agccagacga tcgattcttg gacgcaacaa caccataaag
agctgaaaga agaggtccgc 3840aagatgatgg tgagcgacgc aaacaaaccg gcacaacgtc
tgcgtctgat tgacaccgtt 3900caacgtttgg gcgtggcgta tcatttcgaa aaagaaatcg
atgacgctct ggaaaagatc 3960ggtcacgatc cgtttgacga taaggatgac ctgtatatcg
ttagcctgtg ttttcgcctg 4020ctgcgtcagc atggcatcaa gattagctgc gatgtttttg
agaagttcaa agacgacgat 4080ggcaagttta aggcttccct gatgaatgat gtccaaggta
tgctgtcgtt gtatgaagcg 4140gcccacctgg caattcatgg cgaggacatc ctggatgagg
ctattgtctt tacgaccacc 4200cacctgaaga gcaccgtttc taactccccg gtcaattcca
cctttgcgga acagattcgc 4260cacagcctgc gtgtgccgct gcgtaaggca gtcccgcgtt
tggagagccg ctacttcctg 4320gatatctata gccgtgacga cctgcacgac aagactctgc
tgaactttgc caaactggac 4380ttcaacatcc tgcaggcgat gcaccagaaa gaggcaagcg
agatgacccg ttggtggcgt 4440gatttcgatt tcctgaagaa gctgccgtac attcgtgatc
gcgtggttga actgtacttt 4500tggattttgg tcggtgtgag ctaccaaccg aaattcagca
cgggtcgtat ctttttgagc 4560aagattatct gtctggaaac cctggtggac gacacgtttg
atgcgtacgg tactttcgac 4620gaactggcca ttttcaccga ggccgttacg cgttgggacc
tgggtcatcg cgacgcgctg 4680cctgagtaca tgaaattcat tttcaagacc ctgattgatg
tgtacagcga ggcggaacaa 4740gagctggcaa aagagggccg ctcctatagc attcactatg
cgatccgtag cttccaggag 4800ttggtcatga agtacttttg cgaggcgaaa tggctgaata
agggttatgt tccgagcctg 4860gatgactaca agagcgtcag cctgcgcagc atcggcttcc
tgccgatcgc cgtggcttct 4920tttgttttca tgggcgacat tgctacgaaa gaggtttttg
agtgggaaat gaataacccg 4980aaaatcatca tcgcagccga aaccattttc cgctttctgg
atgacattgc aggtcatcgc 5040ttcgaacaaa aacgtgagca cagcccgagc gcaatcgagt
gctacaaaaa ccaacatggt 5100gtctcggaag aagaggcagt gaaagcgctg agcttggagg
tcgccaattc gtggaaagac 5160attaacgaag agctgctgct gaaccctatg gcaattccac
tgccgttgct gcaggtgatc 5220ctggatttga gccgtagcgc ggacttcatg tacggtaatg
cgcaggaccg tttcacgcac 5280tccaccatga tgaaagatca agttgacctg gttctgaaag
atccggtgaa actggacgat 5340taagaattc
5349765402DNAArtificial Sequencesynthetic operon
encoding for SaCP816, CPRm and SaSAS 76catatggcac tgttgttggc
ggttttctgg agcgctttga ttattctggt tagcatctta 60ttgcgtcgtc gtcaaaaacg
caacaatttg ccaccgggcc caccggccct gccgatcatc 120ggtaacattc acattctggg
caccctgccg caccagagcc tgtacaatct ggcgaagaag 180tacggtccga tcatgtccat
gcgtttgggc ttggttccgg cggtggtcat cagcagcccg 240gaagcggccg agctggtcct
gaaaacccac gacatcgttt ttgcttctcg ccctcgtctg 300caagttgcag attactttca
ctatggcacc aaaggcgtga ttctgaccga atatggtacc 360tactggcgta acatgcgtcg
cctgtgcacg gtcaaactgc tgaacaccgt taagattgat 420agctttgcag gcacccgcaa
gaaagaagtc gctagcttcg ttcagagcct gaaagaagca 480agcgtggcgc acaaaatggt
taacctgtcc gcacgcgtcg ctaatgttat tgagaatatg 540gtttgtctga tggttattgg
tagatcgtct gacgagcgtt tcaagctgaa agaagtgatc 600caagaagcgg cacagctggc
gggtgccttc aatattggtg actatgtccc gtttctgatg 660ccgctggatc tgcagggcct
gactcgccgt atcaagagcg gtagcaaggc attcgatgac 720atcctcgagg tcattatcga
cgagcatgtg caagacatta aagatcatga cgatgagcag 780catggtgact tcatcgacgt
gctgctggcg atgatgaata agccgatgga ttctcgtgag 840ggtctgtcca tcattgatcg
cacgaacatt aaagcgatcc tggtggatat gatcggtgcc 900gcgatggaca cgagcaccag
cggtgtggag tgggcgattt cggagctgat taagcatcct 960cgtgtcatga agaaactgca
agacgaagtg aaaaccgtaa tcggtatgaa ccgcatggtg 1020gaagaagcgg atctgccgaa
actgccgtac ctggacatgg ttgtcaagga aacgatgcgt 1080ctgcatccgc caggcccgct
gctggtgccg cgtgaaagca tggaagatat tacgatcaac 1140ggttactata tcccgaagaa
atcccgcatt attgtgaatg catgggcgat cggccgtgac 1200accaacgcct ggagcaataa
tgcgcacgag tttttccctg agcgttttat gagctctaac 1260gttgatctgc aaggccagga
cttccagctg atcccgttcg gtagcggtcg tcgcggttgt 1320ccgggcatgc gtctgggtct
gacgacggtc cgcttggtgc tggcccaact gattcactgc 1380ttcgacctgg agcttccgaa
gggcaccgtc gcgactgacc tggatatgag cgagaagttt 1440ggtctggcaa tgccgcgtgc
gcagcactta ctggcctttc cgacctaccg tctggagagc 1500taagtcgact aactttaaga
aggagatata tccatggaac ctagctctca gaaactgtct 1560ccgttggaat ttgttgctgc
tatcctgaag ggcgactaca gcagcggtca ggttgaaggt 1620ggtccaccgc caggtctggc
agctatgttg atggaaaata aggatttggt gatggttctg 1680acgacgtccg tggcagtcct
gatcggctgt gtcgtggtcc tggcatggcg tcgtgcggca 1740ggtagcggta agtacaagca
acctgaactg cctaaactgg tggtcccgaa agcagccgaa 1800ccggaggagg cagaggatga
taaaaccaag atcagcgtgt ttttcggcac ccaaaccggt 1860acggcagaag gtttcgcgaa
ggcttttgtt gaagaggcca aggcgcgtta tcagcaggcc 1920cgtttcaaag ttatcgacct
ggacgactat gcggcagacg atgacgagta cgaagagaaa 1980ctgaagaagg aaaacttggc
attcttcttc ttggcgtcct acggtgacgg cgagccgacg 2040gacaacgcgg cacgctttta
caaatggttt acggagggta aggaccgtgg tgaatggctg 2100aacaatctgc agtacggcgt
ttttggtctg ggtaaccgtc aatatgagca tttcaataag 2160atcgccattg tcgtcgatga
tctgatcttc gagcaaggtg gcaagaagct ggttccggtg 2220ggtctgggtg acgatgacca
gtgcattgag gatgattttg cggcgtggcg tgaactggtc 2280tggccggaac tggataaact
gctgcgtaac gaagacgacg ctaccgtggc aaccccgtac 2340agcgccgctg tgctgcaata
ccgcgtggtt ttccacgatc acattgacgg cctgattagc 2400gaaaacggta gcccgaacgg
tcatgctaat ggcaataccg tgtacgatgc gcaacacccg 2460tgccgtagca acgtcgcggt
caagaaggaa ttgcatactc cggcgagcga tcgcagctgc 2520acccacctgg aatttaacat
tagcggtacc ggcctgatgt acgagacggg tgaccacgtc 2580ggtgtgtatt gcgagaacct
gttggaaacc gtggaggagg ccgagaagtt gttgaacctg 2640agcccgcaga cgtacttctc
cgttcacacc gacaacgagg acggtacgcc gttgagcggc 2700agcagcctgc cgccaccgtt
tccgccgtgc accttgcgca cggcattgac caaatacgca 2760gacttgactt ctgcaccgaa
aaagtcggtg ctggtggcgc tggccgagta cgcatctgac 2820cagggtgaag cggatcgttt
gcgtttcttg gcgagcccga gcggcaaaga ggaatatgca 2880cagtacatct tggcaagcca
gcgcacgctg ctggaggtca tggcggagtt cccgtcggcg 2940aaaccgccgc tgggtgtctt
tttcgcgggt gtcgctccgc gcctgcagcc gcgtttctat 3000tccattagct ctagcccgaa
gatcgcaccg ttccgtattc acgtgacctg cgccctggtt 3060tatgacaaat cccctaccgg
tcgcgttcat aagggcatct gtagcacgtg gatgaaaaat 3120gcggtcccgc tggaagaaag
caacgattgt tcctgggctc cgatcttcgt ccgcaacagc 3180aacttcaagc tgccgaccga
cccgaaggtt ccgattatca tgattggtcc gggtaccggt 3240ctggcccctt ttcgtggctt
tttgcaagag cgcttggcgt tgaaagagag cggtgctgaa 3300ttgggtccgg cgatcttgtt
ctttggttgc cgtaaccgta aaatggactt tatttacgag 3360gatgaactga atgatttcgt
caaagcgggc gttgtcagcg agctgatcgt cgcttttagc 3420cgcgaaggcc cgatgaaaga
atacgtgcaa cacaaaatga gccaacgtgc ctccgatgtg 3480tggaacatca ttagcgacgg
tggttatgtt tatgtttgcg gtgacgcgaa gggtatggct 3540cgtgatgttc accgtaccct
gcataccatc gcacaggagc aaggtagcat gtccagctcg 3600gaggccgaag gtatggtcaa
aaacctgcaa accaccggtc gttacctgcg tgatgtgtgg 3660taataaaagc ttaggaggta
aaacatatgg acagcagcac cgccaccgca atgaccgcac 3720cattcatcga cccgacggat
catgtgaatc tgaaaaccga cacggatgcg agcgaaaatc 3780gtcgtatggg taactacaag
ccgagcattt ggaactacga ttttctgcag tccctggcga 3840cgcaccacaa cattgttgaa
gagcgtcacc tgaagctggc agagaaactg aaaggtcaag 3900tgaaattcat gttcggtgcg
ccgatggagc cattggctaa gttggagctg gttgatgtgg 3960tgcaacgctt gggtctgaac
cacctgttcg agactgaaat caaagaagct ctgttcagca 4020tctacaaaga tggcagcaat
ggctggtggt ttggccatct gcatgctacc tctttgcgct 4080tccgtctgtt gcgccaatgt
ggcctgttta tcccgcagga cgttttcaaa acctttcaaa 4140acaagaccgg tgagtttgac
atgaagctgt gggacaacgt taagggcctg ctgagcctgt 4200acgaggcgag ctacctgggc
tggaagggcg agaacatctt ggatgaagca aaggcgttca 4260cgaccaagtg cctgaagagc
gcatgggaga acattagcga gaagtggctg gcgaagcgtg 4320ttaaacatgc gttggcgctg
ccgctgcact ggcgtgttcc gcgtattgaa gcacgctggt 4380ttatcgaggt gtacgaacaa
gaggccaata tgaatccgac gctgctgaaa ctggcgaaac 4440tggacttcaa catggtccaa
agcattcacc agaaagaaat cggtgaactg gcccgctggt 4500gggttactac cggcctggac
aagctggatt tcgcacgcaa caatctgttg cagtcttata 4560tgtggagctg cgccatcgcg
tccgacccga aattcaaact ggcgcgtgaa accattgtcg 4620agatcggttc cgtgttgacg
gttgtcgacg acggctatga tgtgtacggt tctatggatg 4680agctggacct gtacaccagc
tcggtggagc gttggtcctg tgtcaaaatt gacaagctgc 4740ctaatacgct gaagctgatc
tttatgtcta tgttcaacaa aaccaacgag gtgggtctgc 4800gtgttcaaca cgagcgtggt
tacaatagca tcccgacctt cattaaggcg tgggtggaac 4860agtgtaagag ctatcaaaaa
gaggcgcgtt ggtttcatgg tggtcacacg cctccgctgg 4920aagaatacag cctgaacggt
ctggtcagca ttggttttcc gctgttgctg atcaccggct 4980atgttgcgat tgctgagaat
gaagcagccc tggataaagt ccacccgctg ccggacctgc 5040tgcattattc cagcttgctg
agccgtctga ttaatgatat cggcactagc ccggatgaaa 5100tggcgcgtgg tgacaatctg
aagagcattc actgctatat gaatgaaacc ggtgccagcg 5160aagaggtcgc acgcgagcac
atcaaaggcg tcatcgaaga gaattggaaa attctgaacc 5220agtgttgctt tgaccagtcc
cagttccagg agccgttcat cacgtttaac ctgaacagcg 5280tgcgcggctc gcatttcttc
tatgaatttg gtgatggttt tggtgttacc gacagctgga 5340ccaaggtgga tatgaaaagc
gtcctgattg atccgattcc gctgggtgaa gagtaagctt 5400gc
5402771880DNASantalum album
77atataaaagc aatagagaaa cgcactttcc cacaccatcc caccagtaag tcactttgcc
60caagtcccta atacggtgga aagggcaaaa aaaaataacg gaaagggtaa aatatcccgc
120aaatgtctcc gaccactgtc gccgtcgccg tcgccatcat cggagcactc tggctcctca
180cgcgaaagcg ccggaagggg ccgggcctcc cgccaggccc acgggcctac ccgatcatcg
240ggaacctcca catgatgggc cagctcccgc accacaacct ccgcgagctg gcccgggagt
300acggccccat catgtcgatg cggctcggcc tcgtccccgc catcgtggtc tcctccccgg
360aggcggcgca gctcttcctg aagacgcatg atacggtgtt cgcgagccgg ccgaagacgg
420agacggcgaa gtacttccac tacgggatca agggtctcat cctgaccgag tacgggccgt
480actggcgcaa catccggcgg ctgagcacgg tcaagctgct gaacgcggcg aagatcgatt
540cgttcgcggc gatgaggcgg agcgaggtgg agaggctggt ggcgtcggtg agggggtcgg
600cggtgcggcg ggaggtggtg gacgtgagct cgaaggtggc ggaggcaatg gagaacatgg
660tgtgtcagat ggtgattggg aggagtgggg acgataggtt taagctgaag gagacgtttc
720aggaggggac tcagttggcc ggagctttca attttgggga gttcgttccc tttctcctgc
780cacttgacct tcagggaata acacggcgca taaaagaagt aagcacgagg ttcaacaaaa
840tcttggattt aatcgtcgac gagcacatca gagacgccgc tggaaccaaa aattccggcg
900gtcgagacag cgacaacttc ctcgacgtcc tcctttccct aatgaacacc tccatcagcg
960actccaacga caccggcgac aacaaccgca acaacgtcat tgaacgagac aacatcaaag
1020cgatcctcac cgatatgctc ggcgccgcca tggacacctc cgccagcacc gtcgagtgga
1080ccatctccga gctcttccgc cacccaaaaa caatgcaaaa gctccaggcc gagattcggg
1140gtgtcgtggg cccgacccgg aacgtgtctg aagacgacct cccaaagctc acttacctgg
1200acatggtggt gaaggagggg atgcggcttc acccggcggt gccgctgctc ctcccccacg
1260agtccctgga ggaggcgaca atcgatggtt attacattcc gaaggggtct cggatcctga
1320tcaatgtgtg ggccatcggg cgcgacccga aggcctggcc tgatcgcccg gaggagttca
1380tcccggagag gtttgagaaa agcaatgtgg atgtgctggg gagggatttc caactccttc
1440cgttcggctc gggccgtaga gggtgcgccg ggattcggtt agggttgatt ttcgtgcgat
1500tggtgctagc tcagctggtg cattgtttcg attgggagct cgcccgcaac atggcttcgt
1560caccggagaa gttggacatg gaagagaagt tcgggctagc tgtgcataga gttaaccatt
1620tgaaagcact gccgacttat cgcttggaat gctaaaagtt gctttctacc tatatatata
1680cactcgctag gaaataaatg atgttttcaa atggaataat tttctttttt aatgaaatag
1740cataagtatt gttggttgtt atttaccaaa aaaaaagaag tattgtcggt tgtttacgat
1800ggtggtatta atgtgttttg atgcatgggt atatccatca ttttatttta acttagctaa
1860tttttgagtt attgatgtat
1880781533DNASantalum album 78atgtctccga ccactgtcgc cgtcgccgtc gccatcatcg
gagcactctg gctcctcacg 60cgaaagcgcc ggaaggggcc gggcctcccg ccaggcccac
gggcctaccc gatcatcggg 120aacctccaca tgatgggcca gctcccgcac cacaacctcc
gcgagctggc ccgggagtac 180ggccccatca tgtcgatgcg gctcggcctc gtccccgcca
tcgtggtctc ctccccggag 240gcggcgcagc tcttcctgaa gacgcatgat acggtgttcg
cgagccggcc gaagacggag 300acggcgaagt acttccacta cgggatcaag ggtctcatcc
tgaccgagta cgggccgtac 360tggcgcaaca tccggcggct gagcacggtc aagctgctga
acgcggcgaa gatcgattcg 420ttcgcggcga tgaggcggag cgaggtggag aggctggtgg
cgtcggtgag ggggtcggcg 480gtgcggcggg aggtggtgga cgtgagctcg aaggtggcgg
aggcaatgga gaacatggtg 540tgtcagatgg tgattgggag gagtggggac gataggttta
agctgaagga gacgtttcag 600gaggggactc agttggccgg agctttcaat tttggggagt
tcgttccctt tctcctgcca 660cttgaccttc agggaataac acggcgcata aaagaagtaa
gcacgaggtt caacaaaatc 720ttggatttaa tcgtcgacga gcacatcaga gacgccgctg
gaaccaaaaa ttccggcggt 780cgagacagcg acaacttcct cgacgtcctc ctttccctaa
tgaacacctc catcagcgac 840tccaacgaca ccggcgacaa caaccgcaac aacgtcattg
aacgagacaa catcaaagcg 900atcctcaccg atatgctcgg cgccgccatg gacacctccg
ccagcaccgt cgagtggacc 960atctccgagc tcttccgcca cccaaaaaca atgcaaaagc
tccaggccga gattcggggt 1020gtcgtgggcc cgacccggaa cgtgtctgaa gacgacctcc
caaagctcac ttacctggac 1080atggtggtga aggaggggat gcggcttcac ccggcggtgc
cgctgctcct cccccacgag 1140tccctggagg aggcgacaat cgatggttat tacattccga
aggggtctcg gatcctgatc 1200aatgtgtggg ccatcgggcg cgacccgaag gcctggcctg
atcgcccgga ggagttcatc 1260ccggagaggt ttgagaaaag caatgtggat gtgctgggga
gggatttcca actccttccg 1320ttcggctcgg gccgtagagg gtgcgccggg attcggttag
ggttgatttt cgtgcgattg 1380gtgctagctc agctggtgca ttgtttcgat tgggagctcg
cccgcaacat ggcttcgtca 1440ccggagaagt tggacatgga agagaagttc gggctagctg
tgcatagagt taaccatttg 1500aaagcactgc cgacttatcg cttggaatgc taa
153379510PRTSantalum album 79Met Ser Pro Thr Thr
Val Ala Val Ala Val Ala Ile Ile Gly Ala Leu1 5
10 15Trp Leu Leu Thr Arg Lys Arg Arg Lys Gly Pro
Gly Leu Pro Pro Gly 20 25
30Pro Arg Ala Tyr Pro Ile Ile Gly Asn Leu His Met Met Gly Gln Leu
35 40 45Pro His His Asn Leu Arg Glu Leu
Ala Arg Glu Tyr Gly Pro Ile Met 50 55
60Ser Met Arg Leu Gly Leu Val Pro Ala Ile Val Val Ser Ser Pro Glu65
70 75 80Ala Ala Gln Leu Phe
Leu Lys Thr His Asp Thr Val Phe Ala Ser Arg 85
90 95Pro Lys Thr Glu Thr Ala Lys Tyr Phe His Tyr
Gly Ile Lys Gly Leu 100 105
110Ile Leu Thr Glu Tyr Gly Pro Tyr Trp Arg Asn Ile Arg Arg Leu Ser
115 120 125Thr Val Lys Leu Leu Asn Ala
Ala Lys Ile Asp Ser Phe Ala Ala Met 130 135
140Arg Arg Ser Glu Val Glu Arg Leu Val Ala Ser Val Arg Gly Ser
Ala145 150 155 160Val Arg
Arg Glu Val Val Asp Val Ser Ser Lys Val Ala Glu Ala Met
165 170 175Glu Asn Met Val Cys Gln Met
Val Ile Gly Arg Ser Gly Asp Asp Arg 180 185
190Phe Lys Leu Lys Glu Thr Phe Gln Glu Gly Thr Gln Leu Ala
Gly Ala 195 200 205Phe Asn Phe Gly
Glu Phe Val Pro Phe Leu Leu Pro Leu Asp Leu Gln 210
215 220Gly Ile Thr Arg Arg Ile Lys Glu Val Ser Thr Arg
Phe Asn Lys Ile225 230 235
240Leu Asp Leu Ile Val Asp Glu His Ile Arg Asp Ala Ala Gly Thr Lys
245 250 255Asn Ser Gly Gly Arg
Asp Ser Asp Asn Phe Leu Asp Val Leu Leu Ser 260
265 270Leu Met Asn Thr Ser Ile Ser Asp Ser Asn Asp Thr
Gly Asp Asn Asn 275 280 285Arg Asn
Asn Val Ile Glu Arg Asp Asn Ile Lys Ala Ile Leu Thr Asp 290
295 300Met Leu Gly Ala Ala Met Asp Thr Ser Ala Ser
Thr Val Glu Trp Thr305 310 315
320Ile Ser Glu Leu Phe Arg His Pro Lys Thr Met Gln Lys Leu Gln Ala
325 330 335Glu Ile Arg Gly
Val Val Gly Pro Thr Arg Asn Val Ser Glu Asp Asp 340
345 350Leu Pro Lys Leu Thr Tyr Leu Asp Met Val Val
Lys Glu Gly Met Arg 355 360 365Leu
His Pro Ala Val Pro Leu Leu Leu Pro His Glu Ser Leu Glu Glu 370
375 380Ala Thr Ile Asp Gly Tyr Tyr Ile Pro Lys
Gly Ser Arg Ile Leu Ile385 390 395
400Asn Val Trp Ala Ile Gly Arg Asp Pro Lys Ala Trp Pro Asp Arg
Pro 405 410 415Glu Glu Phe
Ile Pro Glu Arg Phe Glu Lys Ser Asn Val Asp Val Leu 420
425 430Gly Arg Asp Phe Gln Leu Leu Pro Phe Gly
Ser Gly Arg Arg Gly Cys 435 440
445Ala Gly Ile Arg Leu Gly Leu Ile Phe Val Arg Leu Val Leu Ala Gln 450
455 460Leu Val His Cys Phe Asp Trp Glu
Leu Ala Arg Asn Met Ala Ser Ser465 470
475 480Pro Glu Lys Leu Asp Met Glu Glu Lys Phe Gly Leu
Ala Val His Arg 485 490
495Val Asn His Leu Lys Ala Leu Pro Thr Tyr Arg Leu Glu Cys 500
505 510801555DNAArtificial
SequenceSaCP120292, optimized cDNA encoding for N-term modified
SaCP10374 80aggaggtaaa acatatggca ctgctgctgg ctgtcttttg gagcgcactg
attattctga 60cccgcaaacg ccgcaaaggt ccgggtctgc caccgggtcc gcgtgcgtac
ccgattattg 120gcaatctgca catgatgggc cagctgccac accacaattt gcgtgagctg
gcacgtgagt 180atggtccgat tatgagcatg cgcctgggtc tggtgccggc aatcgtggtt
agctctcctg 240aggctgcgca gctgttcctc aagacgcatg ataccgtttt cgcgagccgt
ccaaagaccg 300agactgccaa atacttccat tacggtatca aaggtctgat cctgaccgag
tatggcccgt 360actggcgcaa tattcgtcgt ttgagcaccg ttaagctgtt gaatgccgcg
aaaatcgata 420gcttcgcggc tatgcgtaga agcgaagttg aacgcctggt cgcgtccgtt
cgtggttcgg 480cggttcgtcg tgaggttgtg gacgtcagca gcaaagtggc ggaagctatg
gagaatatgg 540tctgccagat ggttatcggc cgttcaggtg acgatcgttt taagctgaaa
gaaacctttc 600aagagggcac ccaactggca ggcgcgttca attttggtga gtttgtgccg
tttctgctgc 660cgctggactt gcaaggtatt acccgtcgca tcaaagaagt cagcactcgt
ttcaataaga 720ttttggacct gatcgttgac gagcacattc gcgatgccgc tggtaccaaa
aacagcggcg 780gtcgtgatag cgacaatttt ctggatgttc tgctgtcctt gatgaacacc
tctattagcg 840atagcaatga cacgggtgac aacaaccgta acaacgtgat cgagcgtgat
aacattaaag 900cgatcctgac ggacatgctg ggtgcagcga tggacacgag cgcgagcacg
gtcgagtgga 960cgatctccga actgtttcgc cacccgaaaa ccatgcagaa gctgcaagca
gaaatccgtg 1020gtgtcgtggg cccgacccgc aatgtgagcg aagatgactt gccgaagctg
acctatctgg 1080acatggtcgt taaggaaggc atgcgtttgc atccggccgt gccgctgctt
ctgccgcatg 1140agtctctgga agaagccacg atcgatggct actacattcc gaagggttcc
cgcattctga 1200tcaacgtctg ggcgattggt cgcgacccga aggcctggcc ggatcgtcct
gaagagttca 1260tcccggagcg tttcgagaaa agcaacgtgg atgtgctggg ccgtgacttc
cagctgctgc 1320cgtttggttc gggtcgtcgc ggttgtgcag gcattcgcct gggcctgatc
ttcgtacgtc 1380tggttctggc acagttagtt cactgtttcg actgggaact ggcgcgcaac
atggcgagca 1440gcccggagaa gttggatatg gaagagaagt tcggcctggc ggtgcatcgt
gtcaaccacc 1500tgaaagccct gccgacgtat cgtctggagt gctaagtcga caccatggaa
agctt 155581506PRTArtificial SequenceSaCP10374opt, N-terminal
modified, amino acid sequence 81Met Ala Leu Leu Leu Ala Val Phe Trp
Ser Ala Leu Ile Ile Leu Thr1 5 10
15Arg Lys Arg Arg Lys Gly Pro Gly Leu Pro Pro Gly Pro Arg Ala
Tyr 20 25 30Pro Ile Ile Gly
Asn Leu His Met Met Gly Gln Leu Pro His His Asn 35
40 45Leu Arg Glu Leu Ala Arg Glu Tyr Gly Pro Ile Met
Ser Met Arg Leu 50 55 60Gly Leu Val
Pro Ala Ile Val Val Ser Ser Pro Glu Ala Ala Gln Leu65 70
75 80Phe Leu Lys Thr His Asp Thr Val
Phe Ala Ser Arg Pro Lys Thr Glu 85 90
95Thr Ala Lys Tyr Phe His Tyr Gly Ile Lys Gly Leu Ile Leu
Thr Glu 100 105 110Tyr Gly Pro
Tyr Trp Arg Asn Ile Arg Arg Leu Ser Thr Val Lys Leu 115
120 125Leu Asn Ala Ala Lys Ile Asp Ser Phe Ala Ala
Met Arg Arg Ser Glu 130 135 140Val Glu
Arg Leu Val Ala Ser Val Arg Gly Ser Ala Val Arg Arg Glu145
150 155 160Val Val Asp Val Ser Ser Lys
Val Ala Glu Ala Met Glu Asn Met Val 165
170 175Cys Gln Met Val Ile Gly Arg Ser Gly Asp Asp Arg
Phe Lys Leu Lys 180 185 190Glu
Thr Phe Gln Glu Gly Thr Gln Leu Ala Gly Ala Phe Asn Phe Gly 195
200 205Glu Phe Val Pro Phe Leu Leu Pro Leu
Asp Leu Gln Gly Ile Thr Arg 210 215
220Arg Ile Lys Glu Val Ser Thr Arg Phe Asn Lys Ile Leu Asp Leu Ile225
230 235 240Val Asp Glu His
Ile Arg Asp Ala Ala Gly Thr Lys Asn Ser Gly Gly 245
250 255Arg Asp Ser Asp Asn Phe Leu Asp Val Leu
Leu Ser Leu Met Asn Thr 260 265
270Ser Ile Ser Asp Ser Asn Asp Thr Gly Asp Asn Asn Arg Asn Asn Val
275 280 285Ile Glu Arg Asp Asn Ile Lys
Ala Ile Leu Thr Asp Met Leu Gly Ala 290 295
300Ala Met Asp Thr Ser Ala Ser Thr Val Glu Trp Thr Ile Ser Glu
Leu305 310 315 320Phe Arg
His Pro Lys Thr Met Gln Lys Leu Gln Ala Glu Ile Arg Gly
325 330 335Val Val Gly Pro Thr Arg Asn
Val Ser Glu Asp Asp Leu Pro Lys Leu 340 345
350Thr Tyr Leu Asp Met Val Val Lys Glu Gly Met Arg Leu His
Pro Ala 355 360 365Val Pro Leu Leu
Leu Pro His Glu Ser Leu Glu Glu Ala Thr Ile Asp 370
375 380Gly Tyr Tyr Ile Pro Lys Gly Ser Arg Ile Leu Ile
Asn Val Trp Ala385 390 395
400Ile Gly Arg Asp Pro Lys Ala Trp Pro Asp Arg Pro Glu Glu Phe Ile
405 410 415Pro Glu Arg Phe Glu
Lys Ser Asn Val Asp Val Leu Gly Arg Asp Phe 420
425 430Gln Leu Leu Pro Phe Gly Ser Gly Arg Arg Gly Cys
Ala Gly Ile Arg 435 440 445Leu Gly
Leu Ile Phe Val Arg Leu Val Leu Ala Gln Leu Val His Cys 450
455 460Phe Asp Trp Glu Leu Ala Arg Asn Met Ala Ser
Ser Pro Glu Lys Leu465 470 475
480Asp Met Glu Glu Lys Phe Gly Leu Ala Val His Arg Val Asn His Leu
485 490 495Lys Ala Leu Pro
Thr Tyr Arg Leu Glu Cys 500
505823693DNAArtificial SequenceSaCP10374-CPRm, synthetic operon encoding
for SaCP10374 and CPRm 82catatggcac tgctgctggc tgtcttttgg agcgcactga
ttattctgac ccgcaaacgc 60cgcaaaggtc cgggtctgcc accgggtccg cgtgcgtacc
cgattattgg caatctgcac 120atgatgggcc agctgccaca ccacaatttg cgtgagctgg
cacgtgagta tggtccgatt 180atgagcatgc gcctgggtct ggtgccggca atcgtggtta
gctctcctga ggctgcgcag 240ctgttcctca agacgcatga taccgttttc gcgagccgtc
caaagaccga gactgccaaa 300tacttccatt acggtatcaa aggtctgatc ctgaccgagt
atggcccgta ctggcgcaat 360attcgtcgtt tgagcaccgt taagctgttg aatgccgcga
aaatcgatag cttcgcggct 420atgcgtagaa gcgaagttga acgcctggtc gcgtccgttc
gtggttcggc ggttcgtcgt 480gaggttgtgg acgtcagcag caaagtggcg gaagctatgg
agaatatggt ctgccagatg 540gttatcggcc gttcaggtga cgatcgtttt aagctgaaag
aaacctttca agagggcacc 600caactggcag gcgcgttcaa ttttggtgag tttgtgccgt
ttctgctgcc gctggacttg 660caaggtatta cccgtcgcat caaagaagtc agcactcgtt
tcaataagat tttggacctg 720atcgttgacg agcacattcg cgatgccgct ggtaccaaaa
acagcggcgg tcgtgatagc 780gacaattttc tggatgttct gctgtccttg atgaacacct
ctattagcga tagcaatgac 840acgggtgaca acaaccgtaa caacgtgatc gagcgtgata
acattaaagc gatcctgacg 900gacatgctgg gtgcagcgat ggacacgagc gcgagcacgg
tcgagtggac gatctccgaa 960ctgtttcgcc acccgaaaac catgcagaag ctgcaagcag
aaatccgtgg tgtcgtgggc 1020ccgacccgca atgtgagcga agatgacttg ccgaagctga
cctatctgga catggtcgtt 1080aaggaaggca tgcgtttgca tccggccgtg ccgctgcttc
tgccgcatga gtctctggaa 1140gaagccacga tcgatggcta ctacattccg aagggttccc
gcattctgat caacgtctgg 1200gcgattggtc gcgacccgaa ggcctggccg gatcgtcctg
aagagttcat cccggagcgt 1260ttcgagaaaa gcaacgtgga tgtgctgggc cgtgacttcc
agctgctgcc gtttggttcg 1320ggtcgtcgcg gttgtgcagg cattcgcctg ggcctgatct
tcgtacgtct ggttctggca 1380cagttagttc actgtttcga ctgggaactg gcgcgcaaca
tggcgagcag cccggagaag 1440ttggatatgg aagagaagtt cggcctggcg gtgcatcgtg
tcaaccacct gaaagccctg 1500ccgacgtatc gtctggagtg ctaagtcgac taactttaag
aaggagatat atccatggaa 1560cctagctctc agaaactgtc tccgttggaa tttgttgctg
ctatcctgaa gggcgactac 1620agcagcggtc aggttgaagg tggtccaccg ccaggtctgg
cagctatgtt gatggaaaat 1680aaggatttgg tgatggttct gacgacgtcc gtggcagtcc
tgatcggctg tgtcgtggtc 1740ctggcatggc gtcgtgcggc aggtagcggt aagtacaagc
aacctgaact gcctaaactg 1800gtggtcccga aagcagccga accggaggag gcagaggatg
ataaaaccaa gatcagcgtg 1860tttttcggca cccaaaccgg tacggcagaa ggtttcgcga
aggcttttgt tgaagaggcc 1920aaggcgcgtt atcagcaggc ccgtttcaaa gttatcgacc
tggacgacta tgcggcagac 1980gatgacgagt acgaagagaa actgaagaag gaaaacttgg
cattcttctt cttggcgtcc 2040tacggtgacg gcgagccgac ggacaacgcg gcacgctttt
acaaatggtt tacggagggt 2100aaggaccgtg gtgaatggct gaacaatctg cagtacggcg
tttttggtct gggtaaccgt 2160caatatgagc atttcaataa gatcgccatt gtcgtcgatg
atctgatctt cgagcaaggt 2220ggcaagaagc tggttccggt gggtctgggt gacgatgacc
agtgcattga ggatgatttt 2280gcggcgtggc gtgaactggt ctggccggaa ctggataaac
tgctgcgtaa cgaagacgac 2340gctaccgtgg caaccccgta cagcgccgct gtgctgcaat
accgcgtggt tttccacgat 2400cacattgacg gcctgattag cgaaaacggt agcccgaacg
gtcatgctaa tggcaatacc 2460gtgtacgatg cgcaacaccc gtgccgtagc aacgtcgcgg
tcaagaagga attgcatact 2520ccggcgagcg atcgcagctg cacccacctg gaatttaaca
ttagcggtac cggcctgatg 2580tacgagacgg gtgaccacgt cggtgtgtat tgcgagaacc
tgttggaaac cgtggaggag 2640gccgagaagt tgttgaacct gagcccgcag acgtacttct
ccgttcacac cgacaacgag 2700gacggtacgc cgttgagcgg cagcagcctg ccgccaccgt
ttccgccgtg caccttgcgc 2760acggcattga ccaaatacgc agacttgact tctgcaccga
aaaagtcggt gctggtggcg 2820ctggccgagt acgcatctga ccagggtgaa gcggatcgtt
tgcgtttctt ggcgagcccg 2880agcggcaaag aggaatatgc acagtacatc ttggcaagcc
agcgcacgct gctggaggtc 2940atggcggagt tcccgtcggc gaaaccgccg ctgggtgtct
ttttcgcggg tgtcgctccg 3000cgcctgcagc cgcgtttcta ttccattagc tctagcccga
agatcgcacc gttccgtatt 3060cacgtgacct gcgccctggt ttatgacaaa tcccctaccg
gtcgcgttca taagggcatc 3120tgtagcacgt ggatgaaaaa tgcggtcccg ctggaagaaa
gcaacgattg ttcctgggct 3180ccgatcttcg tccgcaacag caacttcaag ctgccgaccg
acccgaaggt tccgattatc 3240atgattggtc cgggtaccgg tctggcccct tttcgtggct
ttttgcaaga gcgcttggcg 3300ttgaaagaga gcggtgctga attgggtccg gcgatcttgt
tctttggttg ccgtaaccgt 3360aaaatggact ttatttacga ggatgaactg aatgatttcg
tcaaagcggg cgttgtcagc 3420gagctgatcg tcgcttttag ccgcgaaggc ccgatgaaag
aatacgtgca acacaaaatg 3480agccaacgtg cctccgatgt gtggaacatc attagcgacg
gtggttatgt ttatgtttgc 3540ggtgacgcga agggtatggc tcgtgatgtt caccgtaccc
tgcataccat cgcacaggag 3600caaggtagca tgtccagctc ggaggccgaa ggtatggtca
aaaacctgca aaccaccggt 3660cgttacctgc gtgatgtgtg gtaataaaag ctt
3693835339DNAArtificial
SequenceSaCP816-CPRm-SaTPs647, synthetic operon encoding for
SaCP816, CPRm and a sesquisabiene B synthase 83catatggcac tgttgttggc
ggttttctgg agcgctttga ttattctggt tagcatctta 60ttgcgtcgtc gtcaaaaacg
caacaatttg ccaccgggcc caccggccct gccgatcatc 120ggtaacattc acattctggg
caccctgccg caccagagcc tgtacaatct ggcgaagaag 180tacggtccga tcatgtccat
gcgtttgggc ttggttccgg cggtggtcat cagcagcccg 240gaagcggccg agctggtcct
gaaaacccac gacatcgttt ttgcttctcg ccctcgtctg 300caagttgcag attactttca
ctatggcacc aaaggcgtga ttctgaccga atatggtacc 360tactggcgta acatgcgtcg
cctgtgcacg gtcaaactgc tgaacaccgt taagattgat 420agctttgcag gcacccgcaa
gaaagaagtc gctagcttcg ttcagagcct gaaagaagca 480agcgtggcgc acaaaatggt
taacctgtcc gcacgcgtcg ctaatgttat tgagaatatg 540gtttgtctga tggttattgg
tagatcgtct gacgagcgtt tcaagctgaa agaagtgatc 600caagaagcgg cacagctggc
gggtgccttc aatattggtg actatgtccc gtttctgatg 660ccgctggatc tgcagggcct
gactcgccgt atcaagagcg gtagcaaggc attcgatgac 720atcctcgagg tcattatcga
cgagcatgtg caagacatta aagatcatga cgatgagcag 780catggtgact tcatcgacgt
gctgctggcg atgatgaata agccgatgga ttctcgtgag 840ggtctgtcca tcattgatcg
cacgaacatt aaagcgatcc tggtggatat gatcggtgcc 900gcgatggaca cgagcaccag
cggtgtggag tgggcgattt cggagctgat taagcatcct 960cgtgtcatga agaaactgca
agacgaagtg aaaaccgtaa tcggtatgaa ccgcatggtg 1020gaagaagcgg atctgccgaa
actgccgtac ctggacatgg ttgtcaagga aacgatgcgt 1080ctgcatccgc caggcccgct
gctggtgccg cgtgaaagca tggaagatat tacgatcaac 1140ggttactata tcccgaagaa
atcccgcatt attgtgaatg catgggcgat cggccgtgac 1200accaacgcct ggagcaataa
tgcgcacgag tttttccctg agcgttttat gagctctaac 1260gttgatctgc aaggccagga
cttccagctg atcccgttcg gtagcggtcg tcgcggttgt 1320ccgggcatgc gtctgggtct
gacgacggtc cgcttggtgc tggcccaact gattcactgc 1380ttcgacctgg agcttccgaa
gggcaccgtc gcgactgacc tggatatgag cgagaagttt 1440ggtctggcaa tgccgcgtgc
gcagcactta ctggcctttc cgacctaccg tctggagagc 1500taagtcgact aactttaaga
aggagatata tccatggaac ctagctctca gaaactgtct 1560ccgttggaat ttgttgctgc
tatcctgaag ggcgactaca gcagcggtca ggttgaaggt 1620ggtccaccgc caggtctggc
agctatgttg atggaaaata aggatttggt gatggttctg 1680acgacgtccg tggcagtcct
gatcggctgt gtcgtggtcc tggcatggcg tcgtgcggca 1740ggtagcggta agtacaagca
acctgaactg cctaaactgg tggtcccgaa agcagccgaa 1800ccggaggagg cagaggatga
taaaaccaag atcagcgtgt ttttcggcac ccaaaccggt 1860acggcagaag gtttcgcgaa
ggcttttgtt gaagaggcca aggcgcgtta tcagcaggcc 1920cgtttcaaag ttatcgacct
ggacgactat gcggcagacg atgacgagta cgaagagaaa 1980ctgaagaagg aaaacttggc
attcttcttc ttggcgtcct acggtgacgg cgagccgacg 2040gacaacgcgg cacgctttta
caaatggttt acggagggta aggaccgtgg tgaatggctg 2100aacaatctgc agtacggcgt
ttttggtctg ggtaaccgtc aatatgagca tttcaataag 2160atcgccattg tcgtcgatga
tctgatcttc gagcaaggtg gcaagaagct ggttccggtg 2220ggtctgggtg acgatgacca
gtgcattgag gatgattttg cggcgtggcg tgaactggtc 2280tggccggaac tggataaact
gctgcgtaac gaagacgacg ctaccgtggc aaccccgtac 2340agcgccgctg tgctgcaata
ccgcgtggtt ttccacgatc acattgacgg cctgattagc 2400gaaaacggta gcccgaacgg
tcatgctaat ggcaataccg tgtacgatgc gcaacacccg 2460tgccgtagca acgtcgcggt
caagaaggaa ttgcatactc cggcgagcga tcgcagctgc 2520acccacctgg aatttaacat
tagcggtacc ggcctgatgt acgagacggg tgaccacgtc 2580ggtgtgtatt gcgagaacct
gttggaaacc gtggaggagg ccgagaagtt gttgaacctg 2640agcccgcaga cgtacttctc
cgttcacacc gacaacgagg acggtacgcc gttgagcggc 2700agcagcctgc cgccaccgtt
tccgccgtgc accttgcgca cggcattgac caaatacgca 2760gacttgactt ctgcaccgaa
aaagtcggtg ctggtggcgc tggccgagta cgcatctgac 2820cagggtgaag cggatcgttt
gcgtttcttg gcgagcccga gcggcaaaga ggaatatgca 2880cagtacatct tggcaagcca
gcgcacgctg ctggaggtca tggcggagtt cccgtcggcg 2940aaaccgccgc tgggtgtctt
tttcgcgggt gtcgctccgc gcctgcagcc gcgtttctat 3000tccattagct ctagcccgaa
gatcgcaccg ttccgtattc acgtgacctg cgccctggtt 3060tatgacaaat cccctaccgg
tcgcgttcat aagggcatct gtagcacgtg gatgaaaaat 3120gcggtcccgc tggaagaaag
caacgattgt tcctgggctc cgatcttcgt ccgcaacagc 3180aacttcaagc tgccgaccga
cccgaaggtt ccgattatca tgattggtcc gggtaccggt 3240ctggcccctt ttcgtggctt
tttgcaagag cgcttggcgt tgaaagagag cggtgctgaa 3300ttgggtccgg cgatcttgtt
ctttggttgc cgtaaccgta aaatggactt tatttacgag 3360gatgaactga atgatttcgt
caaagcgggc gttgtcagcg agctgatcgt cgcttttagc 3420cgcgaaggcc cgatgaaaga
atacgtgcaa cacaaaatga gccaacgtgc ctccgatgtg 3480tggaacatca ttagcgacgg
tggttatgtt tatgtttgcg gtgacgcgaa gggtatggct 3540cgtgatgttc accgtaccct
gcataccatc gcacaggagc aaggtagcat gtccagctcg 3600gaggccgaag gtatggtcaa
aaacctgcaa accaccggtc gttacctgcg tgatgtgtgg 3660taataaaagc ttaggaggta
aaaatggcga ccgttgtgga tgattctagc gtcgttcgtc 3720gttctgcaaa ctacccgccg
aatttgtggg actatgagtt cctgcaatcc ctgggtgacc 3780agtgtacggt cgaagaaaaa
cacctgaagc tggccgacaa gttgaaagaa gaagttaaat 3840ccctgattaa acagacgatg
gagccgctgg caaaactgga gttcatcgat accgtgcgtc 3900gtttgggttt gaaatatcag
tttgagaccg aggtgaagga ggccgttgtt atggttagca 3960aatatgagaa tgatgcgtgg
tggattgata atctgcacgc taccagcctg cgtttccgca 4020tcatgcgtga gaatggtatc
ttcgtgccgc aagatgtgtt tgaacgtttc aaagataccg 4080acggctttaa aaaccaactg
tgcgaagacg tgaagggtct gttgtctctg tatgaggcga 4140gctttctggg ttgggagggc
gaggatatct tggatgaggc acgcaccttt gcgaccagca 4200agctgaagag cattgaaggc
aaaattccga gcccgagcct ggctaagaaa gtgagccacg 4260cgctggactt gcctctgcac
tggcgtacca ttcgctacga agcgcgctgg ttcatcgaca 4320cctacggtga agaagaggac
gtgaatctga cgttgctgcg ttacgccaaa ctggacttca 4380acattgttca atctttttac
caaaaagaga tcggccgtct gtcccgctgg tgggtgggta 4440ctggcctgga taaaatgccg
tttgctcgta atggtctgat tcagagctat atgtacgcaa 4500ttggtatgct gttcgagcct
aacctgggcg aggtgcgtga gatggaggcg aaggtcggcg 4560ccttgattac cacgatcgac
gacgtgtatg acgtttacgg cacgatggag gagttggagc 4620tgttcaccga tattaccaat
cgttgggaca tcagcaaagc ggatcaactg ccgcgtaaca 4680tccgcatgcc gctgctgacg
atgttcaaca ccagcaatga tatcggttat tgggctctga 4740aagagcgtgg tttcaatggc
attccgtgta ccgcaaaagt ctggtccgac caactgaaga 4800gctacaccaa ggaggctaaa
tggttccacg aaggccataa accgactctg gaggagtatc 4860tggacaatgc gctggtcagc
atcggcttcc cgaacctgct ggtcacgtct tatctgttga 4920ccgttgagaa tccgaccaaa
gaaaagctgg actatgtgaa cagcctgccg ttgttcgttc 4980gcgcgagctg catcctgtgt
cgtatcatta acgatctggg tacgagcccg gatgaaatgg 5040agcgtggtga caatctgaaa
agcatccagt gctatatgaa cgaaaccggt gcgagccaag 5100aggttgcgcg tgagcacatc
gaaggcctgg ttcgtatgtg gtggaaacgt ctgaacaagt 5160gcctgtttga gccgagcccg
ttcactgagc cgttcctgag ctttacgatt aacgtggtcc 5220gtggtagcca ctttttctat
cagtacggcg atggctacgg caacgcagag agctggacca 5280agaaccaggg tatgtcggtg
ctgatccacc cgattaccct ggatgaagag taagaattc 5339845360DNAArtificial
SequenceSaCP10374-CPRm-saTPs647, synthetic operon encoding for
SaCP10374, CPRm and a sesquisabiene B synthase 84catatggcac tgctgctggc
tgtcttttgg agcgcactga ttattctgac ccgcaaacgc 60cgcaaaggtc cgggtctgcc
accgggtccg cgtgcgtacc cgattattgg caatctgcac 120atgatgggcc agctgccaca
ccacaatttg cgtgagctgg cacgtgagta tggtccgatt 180atgagcatgc gcctgggtct
ggtgccggca atcgtggtta gctctcctga ggctgcgcag 240ctgttcctca agacgcatga
taccgttttc gcgagccgtc caaagaccga gactgccaaa 300tacttccatt acggtatcaa
aggtctgatc ctgaccgagt atggcccgta ctggcgcaat 360attcgtcgtt tgagcaccgt
taagctgttg aatgccgcga aaatcgatag cttcgcggct 420atgcgtagaa gcgaagttga
acgcctggtc gcgtccgttc gtggttcggc ggttcgtcgt 480gaggttgtgg acgtcagcag
caaagtggcg gaagctatgg agaatatggt ctgccagatg 540gttatcggcc gttcaggtga
cgatcgtttt aagctgaaag aaacctttca agagggcacc 600caactggcag gcgcgttcaa
ttttggtgag tttgtgccgt ttctgctgcc gctggacttg 660caaggtatta cccgtcgcat
caaagaagtc agcactcgtt tcaataagat tttggacctg 720atcgttgacg agcacattcg
cgatgccgct ggtaccaaaa acagcggcgg tcgtgatagc 780gacaattttc tggatgttct
gctgtccttg atgaacacct ctattagcga tagcaatgac 840acgggtgaca acaaccgtaa
caacgtgatc gagcgtgata acattaaagc gatcctgacg 900gacatgctgg gtgcagcgat
ggacacgagc gcgagcacgg tcgagtggac gatctccgaa 960ctgtttcgcc acccgaaaac
catgcagaag ctgcaagcag aaatccgtgg tgtcgtgggc 1020ccgacccgca atgtgagcga
agatgacttg ccgaagctga cctatctgga catggtcgtt 1080aaggaaggca tgcgtttgca
tccggccgtg ccgctgcttc tgccgcatga gtctctggaa 1140gaagccacga tcgatggcta
ctacattccg aagggttccc gcattctgat caacgtctgg 1200gcgattggtc gcgacccgaa
ggcctggccg gatcgtcctg aagagttcat cccggagcgt 1260ttcgagaaaa gcaacgtgga
tgtgctgggc cgtgacttcc agctgctgcc gtttggttcg 1320ggtcgtcgcg gttgtgcagg
cattcgcctg ggcctgatct tcgtacgtct ggttctggca 1380cagttagttc actgtttcga
ctgggaactg gcgcgcaaca tggcgagcag cccggagaag 1440ttggatatgg aagagaagtt
cggcctggcg gtgcatcgtg tcaaccacct gaaagccctg 1500ccgacgtatc gtctggagag
ctaagtcgac taactttaag aaggagatat atccatggaa 1560cctagctctc agaaactgtc
tccgttggaa tttgttgctg ctatcctgaa gggcgactac 1620agcagcggtc aggttgaagg
tggtccaccg ccaggtctgg cagctatgtt gatggaaaat 1680aaggatttgg tgatggttct
gacgacgtcc gtggcagtcc tgatcggctg tgtcgtggtc 1740ctggcatggc gtcgtgcggc
aggtagcggt aagtacaagc aacctgaact gcctaaactg 1800gtggtcccga aagcagccga
accggaggag gcagaggatg ataaaaccaa gatcagcgtg 1860tttttcggca cccaaaccgg
tacggcagaa ggtttcgcga aggcttttgt tgaagaggcc 1920aaggcgcgtt atcagcaggc
ccgtttcaaa gttatcgacc tggacgacta tgcggcagac 1980gatgacgagt acgaagagaa
actgaagaag gaaaacttgg cattcttctt cttggcgtcc 2040tacggtgacg gcgagccgac
ggacaacgcg gcacgctttt acaaatggtt tacggagggt 2100aaggaccgtg gtgaatggct
gaacaatctg cagtacggcg tttttggtct gggtaaccgt 2160caatatgagc atttcaataa
gatcgccatt gtcgtcgatg atctgatctt cgagcaaggt 2220ggcaagaagc tggttccggt
gggtctgggt gacgatgacc agtgcattga ggatgatttt 2280gcggcgtggc gtgaactggt
ctggccggaa ctggataaac tgctgcgtaa cgaagacgac 2340gctaccgtgg caaccccgta
cagcgccgct gtgctgcaat accgcgtggt tttccacgat 2400cacattgacg gcctgattag
cgaaaacggt agcccgaacg gtcatgctaa tggcaatacc 2460gtgtacgatg cgcaacaccc
gtgccgtagc aacgtcgcgg tcaagaagga attgcatact 2520ccggcgagcg atcgcagctg
cacccacctg gaatttaaca ttagcggtac cggcctgatg 2580tacgagacgg gtgaccacgt
cggtgtgtat tgcgagaacc tgttggaaac cgtggaggag 2640gccgagaagt tgttgaacct
gagcccgcag acgtacttct ccgttcacac cgacaacgag 2700gacggtacgc cgttgagcgg
cagcagcctg ccgccaccgt ttccgccgtg caccttgcgc 2760acggcattga ccaaatacgc
agacttgact tctgcaccga aaaagtcggt gctggtggcg 2820ctggccgagt acgcatctga
ccagggtgaa gcggatcgtt tgcgtttctt ggcgagcccg 2880agcggcaaag aggaatatgc
acagtacatc ttggcaagcc agcgcacgct gctggaggtc 2940atggcggagt tcccgtcggc
gaaaccgccg ctgggtgtct ttttcgcggg tgtcgctccg 3000cgcctgcagc cgcgtttcta
ttccattagc tctagcccga agatcgcacc gttccgtatt 3060cacgtgacct gcgccctggt
ttatgacaaa tcccctaccg gtcgcgttca taagggcatc 3120tgtagcacgt ggatgaaaaa
tgcggtcccg ctggaagaaa gcaacgattg ttcctgggct 3180ccgatcttcg tccgcaacag
caacttcaag ctgccgaccg acccgaaggt tccgattatc 3240atgattggtc cgggtaccgg
tctggcccct tttcgtggct ttttgcaaga gcgcttggcg 3300ttgaaagaga gcggtgctga
attgggtccg gcgatcttgt tctttggttg ccgtaaccgt 3360aaaatggact ttatttacga
ggatgaactg aatgatttcg tcaaagcggg cgttgtcagc 3420gagctgatcg tcgcttttag
ccgcgaaggc ccgatgaaag aatacgtgca acacaaaatg 3480agccaacgtg cctccgatgt
gtggaacatc attagcgacg gtggttatgt ttatgtttgc 3540ggtgacgcga agggtatggc
tcgtgatgtt caccgtaccc tgcataccat cgcacaggag 3600caaggtagca tgtccagctc
ggaggccgaa ggtatggtca aaaacctgca aaccaccggt 3660cgttacctgc gtgatgtgtg
gtaataaaag cttaggaggt aaaaatggcg accgttgtgg 3720atgattctag cgtcgttcgt
cgttctgcaa actacccgcc gaatttgtgg gactatgagt 3780tcctgcaatc cctgggtgac
cagtgtacgg tcgaagaaaa acacctgaag ctggccgaca 3840agttgaaaga agaagttaaa
tccctgatta aacagacgat ggagccgctg gcaaaactgg 3900agttcatcga taccgtgcgt
cgtttgggtt tgaaatatca gtttgagacc gaggtgaagg 3960aggccgttgt tatggttagc
aaatatgaga atgatgcgtg gtggattgat aatctgcacg 4020ctaccagcct gcgtttccgc
atcatgcgtg agaatggtat cttcgtgccg caagatgtgt 4080ttgaacgttt caaagatacc
gacggcttta aaaaccaact gtgcgaagac gtgaagggtc 4140tgttgtctct gtatgaggcg
agctttctgg gttgggaggg cgaggatatc ttggatgagg 4200cacgcacctt tgcgaccagc
aagctgaaga gcattgaagg caaaattccg agcccgagcc 4260tggctaagaa agtgagccac
gcgctggact tgcctctgca ctggcgtacc attcgctacg 4320aagcgcgctg gttcatcgac
acctacggtg aagaagagga cgtgaatctg acgttgctgc 4380gttacgccaa actggacttc
aacattgttc aatcttttta ccaaaaagag atcggccgtc 4440tgtcccgctg gtgggtgggt
actggcctgg ataaaatgcc gtttgctcgt aatggtctga 4500ttcagagcta tatgtacgca
attggtatgc tgttcgagcc taacctgggc gaggtgcgtg 4560agatggaggc gaaggtcggc
gccttgatta ccacgatcga cgacgtgtat gacgtttacg 4620gcacgatgga ggagttggag
ctgttcaccg atattaccaa tcgttgggac atcagcaaag 4680cggatcaact gccgcgtaac
atccgcatgc cgctgctgac gatgttcaac accagcaatg 4740atatcggtta ttgggctctg
aaagagcgtg gtttcaatgg cattccgtgt accgcaaaag 4800tctggtccga ccaactgaag
agctacacca aggaggctaa atggttccac gaaggccata 4860aaccgactct ggaggagtat
ctggacaatg cgctggtcag catcggcttc ccgaacctgc 4920tggtcacgtc ttatctgttg
accgttgaga atccgaccaa agaaaagctg gactatgtga 4980acagcctgcc gttgttcgtt
cgcgcgagct gcatcctgtg tcgtatcatt aacgatctgg 5040gtacgagccc ggatgaaatg
gagcgtggtg acaatctgaa aagcatccag tgctatatga 5100acgaaaccgg tgcgagccaa
gaggttgcgc gtgagcacat cgaaggcctg gttcgtatgt 5160ggtggaaacg tctgaacaag
tgcctgtttg agccgagccc gttcactgag ccgttcctga 5220gctttacgat taacgtggtc
cgtggtagcc actttttcta tcagtacggc gatggctacg 5280gcaacgcaga gagctggacc
aagaaccagg gtatgtcggt gctgatccac ccgattaccc 5340tggatgaaga gtaagaattc
5360855420DNAArtificial
SequenceSaCP816-CPRm-SaTPs30, synthetic operon encoding for SaCP816,
CPRm and a Beta-bisabolene synthase 85catatggcac tgttgttggc ggttttctgg
agcgctttga ttattctggt tagcatctta 60ttgcgtcgtc gtcaaaaacg caacaatttg
ccaccgggcc caccggccct gccgatcatc 120ggtaacattc acattctggg caccctgccg
caccagagcc tgtacaatct ggcgaagaag 180tacggtccga tcatgtccat gcgtttgggc
ttggttccgg cggtggtcat cagcagcccg 240gaagcggccg agctggtcct gaaaacccac
gacatcgttt ttgcttctcg ccctcgtctg 300caagttgcag attactttca ctatggcacc
aaaggcgtga ttctgaccga atatggtacc 360tactggcgta acatgcgtcg cctgtgcacg
gtcaaactgc tgaacaccgt taagattgat 420agctttgcag gcacccgcaa gaaagaagtc
gctagcttcg ttcagagcct gaaagaagca 480agcgtggcgc acaaaatggt taacctgtcc
gcacgcgtcg ctaatgttat tgagaatatg 540gtttgtctga tggttattgg tagatcgtct
gacgagcgtt tcaagctgaa agaagtgatc 600caagaagcgg cacagctggc gggtgccttc
aatattggtg actatgtccc gtttctgatg 660ccgctggatc tgcagggcct gactcgccgt
atcaagagcg gtagcaaggc attcgatgac 720atcctcgagg tcattatcga cgagcatgtg
caagacatta aagatcatga cgatgagcag 780catggtgact tcatcgacgt gctgctggcg
atgatgaata agccgatgga ttctcgtgag 840ggtctgtcca tcattgatcg cacgaacatt
aaagcgatcc tggtggatat gatcggtgcc 900gcgatggaca cgagcaccag cggtgtggag
tgggcgattt cggagctgat taagcatcct 960cgtgtcatga agaaactgca agacgaagtg
aaaaccgtaa tcggtatgaa ccgcatggtg 1020gaagaagcgg atctgccgaa actgccgtac
ctggacatgg ttgtcaagga aacgatgcgt 1080ctgcatccgc caggcccgct gctggtgccg
cgtgaaagca tggaagatat tacgatcaac 1140ggttactata tcccgaagaa atcccgcatt
attgtgaatg catgggcgat cggccgtgac 1200accaacgcct ggagcaataa tgcgcacgag
tttttccctg agcgttttat gagctctaac 1260gttgatctgc aaggccagga cttccagctg
atcccgttcg gtagcggtcg tcgcggttgt 1320ccgggcatgc gtctgggtct gacgacggtc
cgcttggtgc tggcccaact gattcactgc 1380ttcgacctgg agcttccgaa gggcaccgtc
gcgactgacc tggatatgag cgagaagttt 1440ggtctggcaa tgccgcgtgc gcagcactta
ctggcctttc cgacctaccg tctggagagc 1500taagtcgact aactttaaga aggagatata
tccatggaac ctagctctca gaaactgtct 1560ccgttggaat ttgttgctgc tatcctgaag
ggcgactaca gcagcggtca ggttgaaggt 1620ggtccaccgc caggtctggc agctatgttg
atggaaaata aggatttggt gatggttctg 1680acgacgtccg tggcagtcct gatcggctgt
gtcgtggtcc tggcatggcg tcgtgcggca 1740ggtagcggta agtacaagca acctgaactg
cctaaactgg tggtcccgaa agcagccgaa 1800ccggaggagg cagaggatga taaaaccaag
atcagcgtgt ttttcggcac ccaaaccggt 1860acggcagaag gtttcgcgaa ggcttttgtt
gaagaggcca aggcgcgtta tcagcaggcc 1920cgtttcaaag ttatcgacct ggacgactat
gcggcagacg atgacgagta cgaagagaaa 1980ctgaagaagg aaaacttggc attcttcttc
ttggcgtcct acggtgacgg cgagccgacg 2040gacaacgcgg cacgctttta caaatggttt
acggagggta aggaccgtgg tgaatggctg 2100aacaatctgc agtacggcgt ttttggtctg
ggtaaccgtc aatatgagca tttcaataag 2160atcgccattg tcgtcgatga tctgatcttc
gagcaaggtg gcaagaagct ggttccggtg 2220ggtctgggtg acgatgacca gtgcattgag
gatgattttg cggcgtggcg tgaactggtc 2280tggccggaac tggataaact gctgcgtaac
gaagacgacg ctaccgtggc aaccccgtac 2340agcgccgctg tgctgcaata ccgcgtggtt
ttccacgatc acattgacgg cctgattagc 2400gaaaacggta gcccgaacgg tcatgctaat
ggcaataccg tgtacgatgc gcaacacccg 2460tgccgtagca acgtcgcggt caagaaggaa
ttgcatactc cggcgagcga tcgcagctgc 2520acccacctgg aatttaacat tagcggtacc
ggcctgatgt acgagacggg tgaccacgtc 2580ggtgtgtatt gcgagaacct gttggaaacc
gtggaggagg ccgagaagtt gttgaacctg 2640agcccgcaga cgtacttctc cgttcacacc
gacaacgagg acggtacgcc gttgagcggc 2700agcagcctgc cgccaccgtt tccgccgtgc
accttgcgca cggcattgac caaatacgca 2760gacttgactt ctgcaccgaa aaagtcggtg
ctggtggcgc tggccgagta cgcatctgac 2820cagggtgaag cggatcgttt gcgtttcttg
gcgagcccga gcggcaaaga ggaatatgca 2880cagtacatct tggcaagcca gcgcacgctg
ctggaggtca tggcggagtt cccgtcggcg 2940aaaccgccgc tgggtgtctt tttcgcgggt
gtcgctccgc gcctgcagcc gcgtttctat 3000tccattagct ctagcccgaa gatcgcaccg
ttccgtattc acgtgacctg cgccctggtt 3060tatgacaaat cccctaccgg tcgcgttcat
aagggcatct gtagcacgtg gatgaaaaat 3120gcggtcccgc tggaagaaag caacgattgt
tcctgggctc cgatcttcgt ccgcaacagc 3180aacttcaagc tgccgaccga cccgaaggtt
ccgattatca tgattggtcc gggtaccggt 3240ctggcccctt ttcgtggctt tttgcaagag
cgcttggcgt tgaaagagag cggtgctgaa 3300ttgggtccgg cgatcttgtt ctttggttgc
cgtaaccgta aaatggactt tatttacgag 3360gatgaactga atgatttcgt caaagcgggc
gttgtcagcg agctgatcgt cgcttttagc 3420cgcgaaggcc cgatgaaaga atacgtgcaa
cacaaaatga gccaacgtgc ctccgatgtg 3480tggaacatca ttagcgacgg tggttatgtt
tatgtttgcg gtgacgcgaa gggtatggct 3540cgtgatgttc accgtaccct gcataccatc
gcacaggagc aaggtagcat gtccagctcg 3600gaggccgaag gtatggtcaa aaacctgcaa
accaccggtc gttacctgcg tgatgtgtgg 3660taataaaagc ttaggaggta aaaatggacg
cattcgcaac gagcccgacc agcgcactga 3720ttaaggcggt taactgcatc gcgcacgtga
ccccgatggc aggtgaagat tcctccgaaa 3780accgccgtgc atcgaactac aaaccgagca
cctgggacta tgaatttctg caaagcctgg 3840ccacgagcca taacaccgtc caggaaaagc
acatgaagat ggctgagaaa ttgaaggaag 3900aggtgaagag catgatcaag ggtcagatgg
agccggtggc gaagttggaa ctgatcaaca 3960tcctgcagcg tctgggtttg aaatatcgct
ttgaatccga gatcaaggaa gagctgtttt 4020ccctgtacaa ggacggtact gatgcgtggt
gggttgataa tctgcatgca acggcgctgc 4080gttttagact gctgcgcgag aatggtattt
tcgtgccgca agaagtattc gaaactttaa 4140aggataagag cggtaagttt aagagccagc
tgtgcaagga cgttcgtggt ctgctgagct 4200tgtacgaggc gtcctacctg ggttgggagg
gtgaggactt gctggacgag gccaagaagt 4260tcagcaccac caacctgaac aatgtgaaag
aaagcatcag cagcaacact ctgggtcgct 4320tggtcaagca cgccctgaac ctgccgctgc
actggtctgc ggcacgttac gaggcgagat 4380ggtttattga cgagtacgaa aaagaagaaa
acgttaaccc gaacctgctg aagtacgcga 4440agtttgactt taacatcgtt cagagcattc
accaacgtga gctcggtaac ctcgcgcgtt 4500ggtgggtaga aaccggcctg gataaactga
gcttcgtgcg caatacgttg atgcagaatt 4560tcatgtgggg ctgtgcgatg gtgttcgaac
cgcagtacgg caaggttcgc gatgcggccg 4620tcaagcaggc cagcctgatt gcgatggtcg
acgacgtgta tgacgtttat ggcagcctgg 4680aagaactgga aatctttacc gatatcgtgg
accgttggga tatcaccggt atcgacaagc 4740tgccgcgtaa catctctatg attctgctga
cgatgttcaa taccgcgaat cagattggtt 4800acgacttgct gcgtgaccgc ggttttaacg
gcatcccgca cattgctcag gcgtgggcca 4860ccctgtgtaa gaaatatctg aaagaggcga
agtggtatca tagcggttac aagccaactc 4920tggaggagta cctggaaaac ggtcttgttt
ctattagctt tgtgctgagc cttgttaccg 4980catatctgca gaccgaaacc ctggagaatc
tgacgtatga gtccgctgcg tacgtgaata 5040gcgtaccgcc actggtccgc tacagcggcc
tgctgaatcg tctgtacaac gatctcggta 5100cgtcaagcgc agaaattgca cgtggtgaca
ccctgaaaag catccagtgt tatatgaccc 5160aaaccggtgc aaccgaggaa gcagcgcgcg
agcacattaa aggtctggtt cacgaagcgt 5220ggaagggcat gaacaaatgc ttgttcgagc
agacgccatt cgcggagccg tttgtcggtt 5280tcaacgtcaa taccgtccgc ggttcccaat
tcttctacca gcatggcgac ggctacgcgg 5340ttacggaaag ctggacgaag gacctgagcc
tgtcggtgct gattcacccg atcccgctga 5400atgaagagga ctaagaattc
5420865441DNAArtificial
SequenceSaCP10374-CPRm-SaTPs30, synthetic operon encoding for
SaCP10374, CPRm and a Beta-bisabolene synthase 86catatggcac tgctgctggc
tgtcttttgg agcgcactga ttattctgac ccgcaaacgc 60cgcaaaggtc cgggtctgcc
accgggtccg cgtgcgtacc cgattattgg caatctgcac 120atgatgggcc agctgccaca
ccacaatttg cgtgagctgg cacgtgagta tggtccgatt 180atgagcatgc gcctgggtct
ggtgccggca atcgtggtta gctctcctga ggctgcgcag 240ctgttcctca agacgcatga
taccgttttc gcgagccgtc caaagaccga gactgccaaa 300tacttccatt acggtatcaa
aggtctgatc ctgaccgagt atggcccgta ctggcgcaat 360attcgtcgtt tgagcaccgt
taagctgttg aatgccgcga aaatcgatag cttcgcggct 420atgcgtagaa gcgaagttga
acgcctggtc gcgtccgttc gtggttcggc ggttcgtcgt 480gaggttgtgg acgtcagcag
caaagtggcg gaagctatgg agaatatggt ctgccagatg 540gttatcggcc gttcaggtga
cgatcgtttt aagctgaaag aaacctttca agagggcacc 600caactggcag gcgcgttcaa
ttttggtgag tttgtgccgt ttctgctgcc gctggacttg 660caaggtatta cccgtcgcat
caaagaagtc agcactcgtt tcaataagat tttggacctg 720atcgttgacg agcacattcg
cgatgccgct ggtaccaaaa acagcggcgg tcgtgatagc 780gacaattttc tggatgttct
gctgtccttg atgaacacct ctattagcga tagcaatgac 840acgggtgaca acaaccgtaa
caacgtgatc gagcgtgata acattaaagc gatcctgacg 900gacatgctgg gtgcagcgat
ggacacgagc gcgagcacgg tcgagtggac gatctccgaa 960ctgtttcgcc acccgaaaac
catgcagaag ctgcaagcag aaatccgtgg tgtcgtgggc 1020ccgacccgca atgtgagcga
agatgacttg ccgaagctga cctatctgga catggtcgtt 1080aaggaaggca tgcgtttgca
tccggccgtg ccgctgcttc tgccgcatga gtctctggaa 1140gaagccacga tcgatggcta
ctacattccg aagggttccc gcattctgat caacgtctgg 1200gcgattggtc gcgacccgaa
ggcctggccg gatcgtcctg aagagttcat cccggagcgt 1260ttcgagaaaa gcaacgtgga
tgtgctgggc cgtgacttcc agctgctgcc gtttggttcg 1320ggtcgtcgcg gttgtgcagg
cattcgcctg ggcctgatct tcgtacgtct ggttctggca 1380cagttagttc actgtttcga
ctgggaactg gcgcgcaaca tggcgagcag cccggagaag 1440ttggatatgg aagagaagtt
cggcctggcg gtgcatcgtg tcaaccacct gaaagccctg 1500ccgacgtatc gtctggagag
ctaagtcgac taactttaag aaggagatat atccatggaa 1560cctagctctc agaaactgtc
tccgttggaa tttgttgctg ctatcctgaa gggcgactac 1620agcagcggtc aggttgaagg
tggtccaccg ccaggtctgg cagctatgtt gatggaaaat 1680aaggatttgg tgatggttct
gacgacgtcc gtggcagtcc tgatcggctg tgtcgtggtc 1740ctggcatggc gtcgtgcggc
aggtagcggt aagtacaagc aacctgaact gcctaaactg 1800gtggtcccga aagcagccga
accggaggag gcagaggatg ataaaaccaa gatcagcgtg 1860tttttcggca cccaaaccgg
tacggcagaa ggtttcgcga aggcttttgt tgaagaggcc 1920aaggcgcgtt atcagcaggc
ccgtttcaaa gttatcgacc tggacgacta tgcggcagac 1980gatgacgagt acgaagagaa
actgaagaag gaaaacttgg cattcttctt cttggcgtcc 2040tacggtgacg gcgagccgac
ggacaacgcg gcacgctttt acaaatggtt tacggagggt 2100aaggaccgtg gtgaatggct
gaacaatctg cagtacggcg tttttggtct gggtaaccgt 2160caatatgagc atttcaataa
gatcgccatt gtcgtcgatg atctgatctt cgagcaaggt 2220ggcaagaagc tggttccggt
gggtctgggt gacgatgacc agtgcattga ggatgatttt 2280gcggcgtggc gtgaactggt
ctggccggaa ctggataaac tgctgcgtaa cgaagacgac 2340gctaccgtgg caaccccgta
cagcgccgct gtgctgcaat accgcgtggt tttccacgat 2400cacattgacg gcctgattag
cgaaaacggt agcccgaacg gtcatgctaa tggcaatacc 2460gtgtacgatg cgcaacaccc
gtgccgtagc aacgtcgcgg tcaagaagga attgcatact 2520ccggcgagcg atcgcagctg
cacccacctg gaatttaaca ttagcggtac cggcctgatg 2580tacgagacgg gtgaccacgt
cggtgtgtat tgcgagaacc tgttggaaac cgtggaggag 2640gccgagaagt tgttgaacct
gagcccgcag acgtacttct ccgttcacac cgacaacgag 2700gacggtacgc cgttgagcgg
cagcagcctg ccgccaccgt ttccgccgtg caccttgcgc 2760acggcattga ccaaatacgc
agacttgact tctgcaccga aaaagtcggt gctggtggcg 2820ctggccgagt acgcatctga
ccagggtgaa gcggatcgtt tgcgtttctt ggcgagcccg 2880agcggcaaag aggaatatgc
acagtacatc ttggcaagcc agcgcacgct gctggaggtc 2940atggcggagt tcccgtcggc
gaaaccgccg ctgggtgtct ttttcgcggg tgtcgctccg 3000cgcctgcagc cgcgtttcta
ttccattagc tctagcccga agatcgcacc gttccgtatt 3060cacgtgacct gcgccctggt
ttatgacaaa tcccctaccg gtcgcgttca taagggcatc 3120tgtagcacgt ggatgaaaaa
tgcggtcccg ctggaagaaa gcaacgattg ttcctgggct 3180ccgatcttcg tccgcaacag
caacttcaag ctgccgaccg acccgaaggt tccgattatc 3240atgattggtc cgggtaccgg
tctggcccct tttcgtggct ttttgcaaga gcgcttggcg 3300ttgaaagaga gcggtgctga
attgggtccg gcgatcttgt tctttggttg ccgtaaccgt 3360aaaatggact ttatttacga
ggatgaactg aatgatttcg tcaaagcggg cgttgtcagc 3420gagctgatcg tcgcttttag
ccgcgaaggc ccgatgaaag aatacgtgca acacaaaatg 3480agccaacgtg cctccgatgt
gtggaacatc attagcgacg gtggttatgt ttatgtttgc 3540ggtgacgcga agggtatggc
tcgtgatgtt caccgtaccc tgcataccat cgcacaggag 3600caaggtagca tgtccagctc
ggaggccgaa ggtatggtca aaaacctgca aaccaccggt 3660cgttacctgc gtgatgtgtg
gtaataaaag cttaggaggt aaaaatggac gcattcgcaa 3720cgagcccgac cagcgcactg
attaaggcgg ttaactgcat cgcgcacgtg accccgatgg 3780caggtgaaga ttcctccgaa
aaccgccgtg catcgaacta caaaccgagc acctgggact 3840atgaatttct gcaaagcctg
gccacgagcc ataacaccgt ccaggaaaag cacatgaaga 3900tggctgagaa attgaaggaa
gaggtgaaga gcatgatcaa gggtcagatg gagccggtgg 3960cgaagttgga actgatcaac
atcctgcagc gtctgggttt gaaatatcgc tttgaatccg 4020agatcaagga agagctgttt
tccctgtaca aggacggtac tgatgcgtgg tgggttgata 4080atctgcatgc aacggcgctg
cgttttagac tgctgcgcga gaatggtatt ttcgtgccgc 4140aagaagtatt cgaaacttta
aaggataaga gcggtaagtt taagagccag ctgtgcaagg 4200acgttcgtgg tctgctgagc
ttgtacgagg cgtcctacct gggttgggag ggtgaggact 4260tgctggacga ggccaagaag
ttcagcacca ccaacctgaa caatgtgaaa gaaagcatca 4320gcagcaacac tctgggtcgc
ttggtcaagc acgccctgaa cctgccgctg cactggtctg 4380cggcacgtta cgaggcgaga
tggtttattg acgagtacga aaaagaagaa aacgttaacc 4440cgaacctgct gaagtacgcg
aagtttgact ttaacatcgt tcagagcatt caccaacgtg 4500agctcggtaa cctcgcgcgt
tggtgggtag aaaccggcct ggataaactg agcttcgtgc 4560gcaatacgtt gatgcagaat
ttcatgtggg gctgtgcgat ggtgttcgaa ccgcagtacg 4620gcaaggttcg cgatgcggcc
gtcaagcagg ccagcctgat tgcgatggtc gacgacgtgt 4680atgacgttta tggcagcctg
gaagaactgg aaatctttac cgatatcgtg gaccgttggg 4740atatcaccgg tatcgacaag
ctgccgcgta acatctctat gattctgctg acgatgttca 4800ataccgcgaa tcagattggt
tacgacttgc tgcgtgaccg cggttttaac ggcatcccgc 4860acattgctca ggcgtgggcc
accctgtgta agaaatatct gaaagaggcg aagtggtatc 4920atagcggtta caagccaact
ctggaggagt acctggaaaa cggtcttgtt tctattagct 4980ttgtgctgag ccttgttacc
gcatatctgc agaccgaaac cctggagaat ctgacgtatg 5040agtccgctgc gtacgtgaat
agcgtaccgc cactggtccg ctacagcggc ctgctgaatc 5100gtctgtacaa cgatctcggt
acgtcaagcg cagaaattgc acgtggtgac accctgaaaa 5160gcatccagtg ttatatgacc
caaaccggtg caaccgagga agcagcgcgc gagcacatta 5220aaggtctggt tcacgaagcg
tggaagggca tgaacaaatg cttgttcgag cagacgccat 5280tcgcggagcc gtttgtcggt
ttcaacgtca ataccgtccg cggttcccaa ttcttctacc 5340agcatggcga cggctacgcg
gttacggaaa gctggacgaa ggacctgagc ctgtcggtgc 5400tgattcaccc gatcccgctg
aatgaagagg actaagaatt c 5441875414DNAArtificial
SequenceSaCP816-CPRm-AaBFS, synthetic operon encoding for SaCP816,
CPRm and a Beta-farnesene synthase 87catatggcac tgttgttggc ggttttctgg
agcgctttga ttattctggt tagcatctta 60ttgcgtcgtc gtcaaaaacg caacaatttg
ccaccgggcc caccggccct gccgatcatc 120ggtaacattc acattctggg caccctgccg
caccagagcc tgtacaatct ggcgaagaag 180tacggtccga tcatgtccat gcgtttgggc
ttggttccgg cggtggtcat cagcagcccg 240gaagcggccg agctggtcct gaaaacccac
gacatcgttt ttgcttctcg ccctcgtctg 300caagttgcag attactttca ctatggcacc
aaaggcgtga ttctgaccga atatggtacc 360tactggcgta acatgcgtcg cctgtgcacg
gtcaaactgc tgaacaccgt taagattgat 420agctttgcag gcacccgcaa gaaagaagtc
gctagcttcg ttcagagcct gaaagaagca 480agcgtggcgc acaaaatggt taacctgtcc
gcacgcgtcg ctaatgttat tgagaatatg 540gtttgtctga tggttattgg tagatcgtct
gacgagcgtt tcaagctgaa agaagtgatc 600caagaagcgg cacagctggc gggtgccttc
aatattggtg actatgtccc gtttctgatg 660ccgctggatc tgcagggcct gactcgccgt
atcaagagcg gtagcaaggc attcgatgac 720atcctcgagg tcattatcga cgagcatgtg
caagacatta aagatcatga cgatgagcag 780catggtgact tcatcgacgt gctgctggcg
atgatgaata agccgatgga ttctcgtgag 840ggtctgtcca tcattgatcg cacgaacatt
aaagcgatcc tggtggatat gatcggtgcc 900gcgatggaca cgagcaccag cggtgtggag
tgggcgattt cggagctgat taagcatcct 960cgtgtcatga agaaactgca agacgaagtg
aaaaccgtaa tcggtatgaa ccgcatggtg 1020gaagaagcgg atctgccgaa actgccgtac
ctggacatgg ttgtcaagga aacgatgcgt 1080ctgcatccgc caggcccgct gctggtgccg
cgtgaaagca tggaagatat tacgatcaac 1140ggttactata tcccgaagaa atcccgcatt
attgtgaatg catgggcgat cggccgtgac 1200accaacgcct ggagcaataa tgcgcacgag
tttttccctg agcgttttat gagctctaac 1260gttgatctgc aaggccagga cttccagctg
atcccgttcg gtagcggtcg tcgcggttgt 1320ccgggcatgc gtctgggtct gacgacggtc
cgcttggtgc tggcccaact gattcactgc 1380ttcgacctgg agcttccgaa gggcaccgtc
gcgactgacc tggatatgag cgagaagttt 1440ggtctggcaa tgccgcgtgc gcagcactta
ctggcctttc cgacctaccg tctggagagc 1500taagtcgact aactttaaga aggagatata
tccatggaac ctagctctca gaaactgtct 1560ccgttggaat ttgttgctgc tatcctgaag
ggcgactaca gcagcggtca ggttgaaggt 1620ggtccaccgc caggtctggc agctatgttg
atggaaaata aggatttggt gatggttctg 1680acgacgtccg tggcagtcct gatcggctgt
gtcgtggtcc tggcatggcg tcgtgcggca 1740ggtagcggta agtacaagca acctgaactg
cctaaactgg tggtcccgaa agcagccgaa 1800ccggaggagg cagaggatga taaaaccaag
atcagcgtgt ttttcggcac ccaaaccggt 1860acggcagaag gtttcgcgaa ggcttttgtt
gaagaggcca aggcgcgtta tcagcaggcc 1920cgtttcaaag ttatcgacct ggacgactat
gcggcagacg atgacgagta cgaagagaaa 1980ctgaagaagg aaaacttggc attcttcttc
ttggcgtcct acggtgacgg cgagccgacg 2040gacaacgcgg cacgctttta caaatggttt
acggagggta aggaccgtgg tgaatggctg 2100aacaatctgc agtacggcgt ttttggtctg
ggtaaccgtc aatatgagca tttcaataag 2160atcgccattg tcgtcgatga tctgatcttc
gagcaaggtg gcaagaagct ggttccggtg 2220ggtctgggtg acgatgacca gtgcattgag
gatgattttg cggcgtggcg tgaactggtc 2280tggccggaac tggataaact gctgcgtaac
gaagacgacg ctaccgtggc aaccccgtac 2340agcgccgctg tgctgcaata ccgcgtggtt
ttccacgatc acattgacgg cctgattagc 2400gaaaacggta gcccgaacgg tcatgctaat
ggcaataccg tgtacgatgc gcaacacccg 2460tgccgtagca acgtcgcggt caagaaggaa
ttgcatactc cggcgagcga tcgcagctgc 2520acccacctgg aatttaacat tagcggtacc
ggcctgatgt acgagacggg tgaccacgtc 2580ggtgtgtatt gcgagaacct gttggaaacc
gtggaggagg ccgagaagtt gttgaacctg 2640agcccgcaga cgtacttctc cgttcacacc
gacaacgagg acggtacgcc gttgagcggc 2700agcagcctgc cgccaccgtt tccgccgtgc
accttgcgca cggcattgac caaatacgca 2760gacttgactt ctgcaccgaa aaagtcggtg
ctggtggcgc tggccgagta cgcatctgac 2820cagggtgaag cggatcgttt gcgtttcttg
gcgagcccga gcggcaaaga ggaatatgca 2880cagtacatct tggcaagcca gcgcacgctg
ctggaggtca tggcggagtt cccgtcggcg 2940aaaccgccgc tgggtgtctt tttcgcgggt
gtcgctccgc gcctgcagcc gcgtttctat 3000tccattagct ctagcccgaa gatcgcaccg
ttccgtattc acgtgacctg cgccctggtt 3060tatgacaaat cccctaccgg tcgcgttcat
aagggcatct gtagcacgtg gatgaaaaat 3120gcggtcccgc tggaagaaag caacgattgt
tcctgggctc cgatcttcgt ccgcaacagc 3180aacttcaagc tgccgaccga cccgaaggtt
ccgattatca tgattggtcc gggtaccggt 3240ctggcccctt ttcgtggctt tttgcaagag
cgcttggcgt tgaaagagag cggtgctgaa 3300ttgggtccgg cgatcttgtt ctttggttgc
cgtaaccgta aaatggactt tatttacgag 3360gatgaactga atgatttcgt caaagcgggc
gttgtcagcg agctgatcgt cgcttttagc 3420cgcgaaggcc cgatgaaaga atacgtgcaa
cacaaaatga gccaacgtgc ctccgatgtg 3480tggaacatca ttagcgacgg tggttatgtt
tatgtttgcg gtgacgcgaa gggtatggct 3540cgtgatgttc accgtaccct gcataccatc
gcacaggagc aaggtagcat gtccagctcg 3600gaggccgaag gtatggtcaa aaacctgcaa
accaccggtc gttacctgcg tgatgtgtgg 3660taataaaagc ttaggaggta aaaatgtcta
ccctgccaat ttcttctgtg tcctttagct 3720ccagcacttc gccactggtt gtcgatgaca
aggtgagcac gaaaccggat gtgatccgtc 3780acacgatgaa cttcaacgcg agcatttggg
gcgatcaatt cctgacctat gacgagccgg 3840aagatctggt aatgaagaaa caactggttg
aggaacttaa agaagaagtg aagaaagaat 3900tgatcaccat caagggtagc aacgagccga
tgcaacatgt caagctgatc gagttgatcg 3960acgcagttca acgcctgggc attgcctacc
actttgaaga agagattgaa gaggccctgc 4020agcacattca tgtcacctac ggtgagcagt
gggtggacaa agagaatttg caatccatca 4080gcctgtggtt tcgtctgctg cgtcaacagg
gcttcaacgt gagcagcggt gtgtttaaag 4140atttcatgga cgaaaagggt aagtttaaag
agtccctgtg caatgatgca cagggtattt 4200tggcgctgta tgaggccgca ttcatgcgcg
ttgaagatga aaccattctg gacaacgctc 4260tggagttcac caaggtgcat ctggacatca
tcgctaagga cccgagctgt gattctagcc 4320tgcgcacgca gattcaccag gctctgaagc
agccgctgcg ccgtcgcctg gcacgtattg 4380aggcgttaca ctatatgccg atctatcagc
aagagactag ccatgacgaa gttctgctga 4440aactggcaaa gctggacttt agcgttctgc
agagcatgca caagaaagaa ctcagccata 4500tttgcaagtg gtggaaagat ctggatctgc
agaataagct gccgtacgtt cgtgaccgtg 4560tcgttgaggg ctatttctgg atcttgagca
tttactacga gccgcaacat gcgcgtaccc 4620gtatgttcct gatgaaaacc tgtatgtggt
tggttgtgct ggacgacacg tttgataact 4680acggcacgta cgaagagttg gagattttca
cccaagcggt agaacgttgg agcatctcgt 4740gtctggacat gctgcctgag tatatgaagc
tgatctacca ggaactggtc aatttacacg 4800tcgagatgga agagagcctg gagaaagaag
gcaagaccta tcagattcac tatgtgaaag 4860aaatggcgaa agaactggtc cgcaactacc
tggttgaggc gcgctggctg aaagagggct 4920acatgccgac cctggaagag tatatgagcg
tgagcatggt cacgggtacg tacggtctga 4980tgatcgcccg cagctacgtc ggtcgtggcg
acatcgttac cgaagatacc ttcaaatggg 5040tttctagcta cccgccgatt atcaaggcaa
gctgcgttat cgtgcgtttg atggatgata 5100ttgttagcca caaagaagaa caagagcgtg
gtcatgttgc tagcagcatt gagtgctaca 5160gcaaagagtc cggtgcaagc gaagaagaag
cgtgcgagta tatcagccgt aaggtcgagg 5220acgcgtggaa agtcattaat cgcgagtccc
tgcgtccgac cgcggttccg tttccgctgc 5280tgatgcctgc gattaatctg gcgcgtatgt
gtgaggtcct gtacagcgtg aatgacggtt 5340ttacgcacgc cgagggtgat atgaaaagct
atatgaagtc attctttgtg cacccgatgg 5400ttgtgtaaga attc
5414885435DNAArtificial
SequenceSaCP10374-CPRm-AaBFS, synthetic operon encoding for
SaCP10374, CPRm and a Beta-farnesene synthase 88catatggcac tgctgctggc
tgtcttttgg agcgcactga ttattctgac ccgcaaacgc 60cgcaaaggtc cgggtctgcc
accgggtccg cgtgcgtacc cgattattgg caatctgcac 120atgatgggcc agctgccaca
ccacaatttg cgtgagctgg cacgtgagta tggtccgatt 180atgagcatgc gcctgggtct
ggtgccggca atcgtggtta gctctcctga ggctgcgcag 240ctgttcctca agacgcatga
taccgttttc gcgagccgtc caaagaccga gactgccaaa 300tacttccatt acggtatcaa
aggtctgatc ctgaccgagt atggcccgta ctggcgcaat 360attcgtcgtt tgagcaccgt
taagctgttg aatgccgcga aaatcgatag cttcgcggct 420atgcgtagaa gcgaagttga
acgcctggtc gcgtccgttc gtggttcggc ggttcgtcgt 480gaggttgtgg acgtcagcag
caaagtggcg gaagctatgg agaatatggt ctgccagatg 540gttatcggcc gttcaggtga
cgatcgtttt aagctgaaag aaacctttca agagggcacc 600caactggcag gcgcgttcaa
ttttggtgag tttgtgccgt ttctgctgcc gctggacttg 660caaggtatta cccgtcgcat
caaagaagtc agcactcgtt tcaataagat tttggacctg 720atcgttgacg agcacattcg
cgatgccgct ggtaccaaaa acagcggcgg tcgtgatagc 780gacaattttc tggatgttct
gctgtccttg atgaacacct ctattagcga tagcaatgac 840acgggtgaca acaaccgtaa
caacgtgatc gagcgtgata acattaaagc gatcctgacg 900gacatgctgg gtgcagcgat
ggacacgagc gcgagcacgg tcgagtggac gatctccgaa 960ctgtttcgcc acccgaaaac
catgcagaag ctgcaagcag aaatccgtgg tgtcgtgggc 1020ccgacccgca atgtgagcga
agatgacttg ccgaagctga cctatctgga catggtcgtt 1080aaggaaggca tgcgtttgca
tccggccgtg ccgctgcttc tgccgcatga gtctctggaa 1140gaagccacga tcgatggcta
ctacattccg aagggttccc gcattctgat caacgtctgg 1200gcgattggtc gcgacccgaa
ggcctggccg gatcgtcctg aagagttcat cccggagcgt 1260ttcgagaaaa gcaacgtgga
tgtgctgggc cgtgacttcc agctgctgcc gtttggttcg 1320ggtcgtcgcg gttgtgcagg
cattcgcctg ggcctgatct tcgtacgtct ggttctggca 1380cagttagttc actgtttcga
ctgggaactg gcgcgcaaca tggcgagcag cccggagaag 1440ttggatatgg aagagaagtt
cggcctggcg gtgcatcgtg tcaaccacct gaaagccctg 1500ccgacgtatc gtctggagag
ctaagtcgac taactttaag aaggagatat atccatggaa 1560cctagctctc agaaactgtc
tccgttggaa tttgttgctg ctatcctgaa gggcgactac 1620agcagcggtc aggttgaagg
tggtccaccg ccaggtctgg cagctatgtt gatggaaaat 1680aaggatttgg tgatggttct
gacgacgtcc gtggcagtcc tgatcggctg tgtcgtggtc 1740ctggcatggc gtcgtgcggc
aggtagcggt aagtacaagc aacctgaact gcctaaactg 1800gtggtcccga aagcagccga
accggaggag gcagaggatg ataaaaccaa gatcagcgtg 1860tttttcggca cccaaaccgg
tacggcagaa ggtttcgcga aggcttttgt tgaagaggcc 1920aaggcgcgtt atcagcaggc
ccgtttcaaa gttatcgacc tggacgacta tgcggcagac 1980gatgacgagt acgaagagaa
actgaagaag gaaaacttgg cattcttctt cttggcgtcc 2040tacggtgacg gcgagccgac
ggacaacgcg gcacgctttt acaaatggtt tacggagggt 2100aaggaccgtg gtgaatggct
gaacaatctg cagtacggcg tttttggtct gggtaaccgt 2160caatatgagc atttcaataa
gatcgccatt gtcgtcgatg atctgatctt cgagcaaggt 2220ggcaagaagc tggttccggt
gggtctgggt gacgatgacc agtgcattga ggatgatttt 2280gcggcgtggc gtgaactggt
ctggccggaa ctggataaac tgctgcgtaa cgaagacgac 2340gctaccgtgg caaccccgta
cagcgccgct gtgctgcaat accgcgtggt tttccacgat 2400cacattgacg gcctgattag
cgaaaacggt agcccgaacg gtcatgctaa tggcaatacc 2460gtgtacgatg cgcaacaccc
gtgccgtagc aacgtcgcgg tcaagaagga attgcatact 2520ccggcgagcg atcgcagctg
cacccacctg gaatttaaca ttagcggtac cggcctgatg 2580tacgagacgg gtgaccacgt
cggtgtgtat tgcgagaacc tgttggaaac cgtggaggag 2640gccgagaagt tgttgaacct
gagcccgcag acgtacttct ccgttcacac cgacaacgag 2700gacggtacgc cgttgagcgg
cagcagcctg ccgccaccgt ttccgccgtg caccttgcgc 2760acggcattga ccaaatacgc
agacttgact tctgcaccga aaaagtcggt gctggtggcg 2820ctggccgagt acgcatctga
ccagggtgaa gcggatcgtt tgcgtttctt ggcgagcccg 2880agcggcaaag aggaatatgc
acagtacatc ttggcaagcc agcgcacgct gctggaggtc 2940atggcggagt tcccgtcggc
gaaaccgccg ctgggtgtct ttttcgcggg tgtcgctccg 3000cgcctgcagc cgcgtttcta
ttccattagc tctagcccga agatcgcacc gttccgtatt 3060cacgtgacct gcgccctggt
ttatgacaaa tcccctaccg gtcgcgttca taagggcatc 3120tgtagcacgt ggatgaaaaa
tgcggtcccg ctggaagaaa gcaacgattg ttcctgggct 3180ccgatcttcg tccgcaacag
caacttcaag ctgccgaccg acccgaaggt tccgattatc 3240atgattggtc cgggtaccgg
tctggcccct tttcgtggct ttttgcaaga gcgcttggcg 3300ttgaaagaga gcggtgctga
attgggtccg gcgatcttgt tctttggttg ccgtaaccgt 3360aaaatggact ttatttacga
ggatgaactg aatgatttcg tcaaagcggg cgttgtcagc 3420gagctgatcg tcgcttttag
ccgcgaaggc ccgatgaaag aatacgtgca acacaaaatg 3480agccaacgtg cctccgatgt
gtggaacatc attagcgacg gtggttatgt ttatgtttgc 3540ggtgacgcga agggtatggc
tcgtgatgtt caccgtaccc tgcataccat cgcacaggag 3600caaggtagca tgtccagctc
ggaggccgaa ggtatggtca aaaacctgca aaccaccggt 3660cgttacctgc gtgatgtgtg
gtaataaaag cttaggaggt aaaaatgtct accctgccaa 3720tttcttctgt gtcctttagc
tccagcactt cgccactggt tgtcgatgac aaggtgagca 3780cgaaaccgga tgtgatccgt
cacacgatga acttcaacgc gagcatttgg ggcgatcaat 3840tcctgaccta tgacgagccg
gaagatctgg taatgaagaa acaactggtt gaggaactta 3900aagaagaagt gaagaaagaa
ttgatcacca tcaagggtag caacgagccg atgcaacatg 3960tcaagctgat cgagttgatc
gacgcagttc aacgcctggg cattgcctac cactttgaag 4020aagagattga agaggccctg
cagcacattc atgtcaccta cggtgagcag tgggtggaca 4080aagagaattt gcaatccatc
agcctgtggt ttcgtctgct gcgtcaacag ggcttcaacg 4140tgagcagcgg tgtgtttaaa
gatttcatgg acgaaaaggg taagtttaaa gagtccctgt 4200gcaatgatgc acagggtatt
ttggcgctgt atgaggccgc attcatgcgc gttgaagatg 4260aaaccattct ggacaacgct
ctggagttca ccaaggtgca tctggacatc atcgctaagg 4320acccgagctg tgattctagc
ctgcgcacgc agattcacca ggctctgaag cagccgctgc 4380gccgtcgcct ggcacgtatt
gaggcgttac actatatgcc gatctatcag caagagacta 4440gccatgacga agttctgctg
aaactggcaa agctggactt tagcgttctg cagagcatgc 4500acaagaaaga actcagccat
atttgcaagt ggtggaaaga tctggatctg cagaataagc 4560tgccgtacgt tcgtgaccgt
gtcgttgagg gctatttctg gatcttgagc atttactacg 4620agccgcaaca tgcgcgtacc
cgtatgttcc tgatgaaaac ctgtatgtgg ttggttgtgc 4680tggacgacac gtttgataac
tacggcacgt acgaagagtt ggagattttc acccaagcgg 4740tagaacgttg gagcatctcg
tgtctggaca tgctgcctga gtatatgaag ctgatctacc 4800aggaactggt caatttacac
gtcgagatgg aagagagcct ggagaaagaa ggcaagacct 4860atcagattca ctatgtgaaa
gaaatggcga aagaactggt ccgcaactac ctggttgagg 4920cgcgctggct gaaagagggc
tacatgccga ccctggaaga gtatatgagc gtgagcatgg 4980tcacgggtac gtacggtctg
atgatcgccc gcagctacgt cggtcgtggc gacatcgtta 5040ccgaagatac cttcaaatgg
gtttctagct acccgccgat tatcaaggca agctgcgtta 5100tcgtgcgttt gatggatgat
attgttagcc acaaagaaga acaagagcgt ggtcatgttg 5160ctagcagcat tgagtgctac
agcaaagagt ccggtgcaag cgaagaagaa gcgtgcgagt 5220atatcagccg taaggtcgag
gacgcgtgga aagtcattaa tcgcgagtcc ctgcgtccga 5280ccgcggttcc gtttccgctg
ctgatgcctg cgattaatct ggcgcgtatg tgtgaggtcc 5340tgtacagcgt gaatgacggt
tttacgcacg ccgagggtga tatgaaaagc tatatgaagt 5400cattctttgt gcacccgatg
gttgtgtaag aattc 5435895432DNAArtificial
SequenceSaCP816-CPRm-PaAFS, synthetic operon encoding for SaCP816,
CPRm and an alpha-farnesene synthase 89catatggcac tgttgttggc ggttttctgg
agcgctttga ttattctggt tagcatctta 60ttgcgtcgtc gtcaaaaacg caacaatttg
ccaccgggcc caccggccct gccgatcatc 120ggtaacattc acattctggg caccctgccg
caccagagcc tgtacaatct ggcgaagaag 180tacggtccga tcatgtccat gcgtttgggc
ttggttccgg cggtggtcat cagcagcccg 240gaagcggccg agctggtcct gaaaacccac
gacatcgttt ttgcttctcg ccctcgtctg 300caagttgcag attactttca ctatggcacc
aaaggcgtga ttctgaccga atatggtacc 360tactggcgta acatgcgtcg cctgtgcacg
gtcaaactgc tgaacaccgt taagattgat 420agctttgcag gcacccgcaa gaaagaagtc
gctagcttcg ttcagagcct gaaagaagca 480agcgtggcgc acaaaatggt taacctgtcc
gcacgcgtcg ctaatgttat tgagaatatg 540gtttgtctga tggttattgg tagatcgtct
gacgagcgtt tcaagctgaa agaagtgatc 600caagaagcgg cacagctggc gggtgccttc
aatattggtg actatgtccc gtttctgatg 660ccgctggatc tgcagggcct gactcgccgt
atcaagagcg gtagcaaggc attcgatgac 720atcctcgagg tcattatcga cgagcatgtg
caagacatta aagatcatga cgatgagcag 780catggtgact tcatcgacgt gctgctggcg
atgatgaata agccgatgga ttctcgtgag 840ggtctgtcca tcattgatcg cacgaacatt
aaagcgatcc tggtggatat gatcggtgcc 900gcgatggaca cgagcaccag cggtgtggag
tgggcgattt cggagctgat taagcatcct 960cgtgtcatga agaaactgca agacgaagtg
aaaaccgtaa tcggtatgaa ccgcatggtg 1020gaagaagcgg atctgccgaa actgccgtac
ctggacatgg ttgtcaagga aacgatgcgt 1080ctgcatccgc caggcccgct gctggtgccg
cgtgaaagca tggaagatat tacgatcaac 1140ggttactata tcccgaagaa atcccgcatt
attgtgaatg catgggcgat cggccgtgac 1200accaacgcct ggagcaataa tgcgcacgag
tttttccctg agcgttttat gagctctaac 1260gttgatctgc aaggccagga cttccagctg
atcccgttcg gtagcggtcg tcgcggttgt 1320ccgggcatgc gtctgggtct gacgacggtc
cgcttggtgc tggcccaact gattcactgc 1380ttcgacctgg agcttccgaa gggcaccgtc
gcgactgacc tggatatgag cgagaagttt 1440ggtctggcaa tgccgcgtgc gcagcactta
ctggcctttc cgacctaccg tctggagagc 1500taagtcgact aactttaaga aggagatata
tccatggaac ctagctctca gaaactgtct 1560ccgttggaat ttgttgctgc tatcctgaag
ggcgactaca gcagcggtca ggttgaaggt 1620ggtccaccgc caggtctggc agctatgttg
atggaaaata aggatttggt gatggttctg 1680acgacgtccg tggcagtcct gatcggctgt
gtcgtggtcc tggcatggcg tcgtgcggca 1740ggtagcggta agtacaagca acctgaactg
cctaaactgg tggtcccgaa agcagccgaa 1800ccggaggagg cagaggatga taaaaccaag
atcagcgtgt ttttcggcac ccaaaccggt 1860acggcagaag gtttcgcgaa ggcttttgtt
gaagaggcca aggcgcgtta tcagcaggcc 1920cgtttcaaag ttatcgacct ggacgactat
gcggcagacg atgacgagta cgaagagaaa 1980ctgaagaagg aaaacttggc attcttcttc
ttggcgtcct acggtgacgg cgagccgacg 2040gacaacgcgg cacgctttta caaatggttt
acggagggta aggaccgtgg tgaatggctg 2100aacaatctgc agtacggcgt ttttggtctg
ggtaaccgtc aatatgagca tttcaataag 2160atcgccattg tcgtcgatga tctgatcttc
gagcaaggtg gcaagaagct ggttccggtg 2220ggtctgggtg acgatgacca gtgcattgag
gatgattttg cggcgtggcg tgaactggtc 2280tggccggaac tggataaact gctgcgtaac
gaagacgacg ctaccgtggc aaccccgtac 2340agcgccgctg tgctgcaata ccgcgtggtt
ttccacgatc acattgacgg cctgattagc 2400gaaaacggta gcccgaacgg tcatgctaat
ggcaataccg tgtacgatgc gcaacacccg 2460tgccgtagca acgtcgcggt caagaaggaa
ttgcatactc cggcgagcga tcgcagctgc 2520acccacctgg aatttaacat tagcggtacc
ggcctgatgt acgagacggg tgaccacgtc 2580ggtgtgtatt gcgagaacct gttggaaacc
gtggaggagg ccgagaagtt gttgaacctg 2640agcccgcaga cgtacttctc cgttcacacc
gacaacgagg acggtacgcc gttgagcggc 2700agcagcctgc cgccaccgtt tccgccgtgc
accttgcgca cggcattgac caaatacgca 2760gacttgactt ctgcaccgaa aaagtcggtg
ctggtggcgc tggccgagta cgcatctgac 2820cagggtgaag cggatcgttt gcgtttcttg
gcgagcccga gcggcaaaga ggaatatgca 2880cagtacatct tggcaagcca gcgcacgctg
ctggaggtca tggcggagtt cccgtcggcg 2940aaaccgccgc tgggtgtctt tttcgcgggt
gtcgctccgc gcctgcagcc gcgtttctat 3000tccattagct ctagcccgaa gatcgcaccg
ttccgtattc acgtgacctg cgccctggtt 3060tatgacaaat cccctaccgg tcgcgttcat
aagggcatct gtagcacgtg gatgaaaaat 3120gcggtcccgc tggaagaaag caacgattgt
tcctgggctc cgatcttcgt ccgcaacagc 3180aacttcaagc tgccgaccga cccgaaggtt
ccgattatca tgattggtcc gggtaccggt 3240ctggcccctt ttcgtggctt tttgcaagag
cgcttggcgt tgaaagagag cggtgctgaa 3300ttgggtccgg cgatcttgtt ctttggttgc
cgtaaccgta aaatggactt tatttacgag 3360gatgaactga atgatttcgt caaagcgggc
gttgtcagcg agctgatcgt cgcttttagc 3420cgcgaaggcc cgatgaaaga atacgtgcaa
cacaaaatga gccaacgtgc ctccgatgtg 3480tggaacatca ttagcgacgg tggttatgtt
tatgtttgcg gtgacgcgaa gggtatggct 3540cgtgatgttc accgtaccct gcataccatc
gcacaggagc aaggtagcat gtccagctcg 3600gaggccgaag gtatggtcaa aaacctgcaa
accaccggtc gttacctgcg tgatgtgtgg 3660taataaaagc ttaggaggta aaaatggatc
tggcagtgga aatcgcaatg gacctggcag 3720tggatgatgt tgaacgccgt gtgggtgact
atcattccaa tctgtgggac gacgacttca 3780tccaaagcct gagcaccccg tatggcgcca
gctcttaccg cgagcgtgcg gagcgcttgg 3840tcggcgaggt caaagaaatg tttacgagca
tcagcatcga ggatggtgag ctgacctctg 3900acttgcttca acgcctgtgg atggttgaca
acgttgagcg cctgggcatt agccgtcact 3960tcgagaatga aatcaaggct gcaattgatt
acgtctacag ctattggtcc gacaagggta 4020ttgtccgtgg tagagatagc gccgtgccgg
atctgaacag cattgctctg ggtttccgta 4080cgttgcgtct gcatggttac accgttagca
gcgatgtttt caaggtcttt caagaccgca 4140aaggtgagtt tgcatgtagc gcgattccga
cggaaggtga catcaaaggc gtactgaatc 4200tgctgcgtgc aagctacatc gcgttccctg
gtgagaaagt gatggagaaa gcgcagacct 4260ttgccgcaac ttatctgaaa gaagcactgc
agaagatcca agtgtctagc ctgagccgcg 4320agatcgaata cgttctggag tatggctggc
tgaccaattt tccgcgcctg gaagcgcgta 4380actacatcga cgttttcggt gaggaaattt
gtccgtactt caagaaaccg tgtattatgg 4440ttgataagct gctggaactg gcgaaactgg
agttcaattt gtttcactcg ctgcaacaga 4500ccgagctgaa acacgtttcc cgttggtgga
aggatagcgg ctttagccag ctgaccttca 4560cgcgtcatcg tcacgtggag ttttacaccc
tggctagctg tattgcaatt gaaccgaaac 4620attctgcgtt tcgtttgggt ttcgcgaagg
tctgctacct gggcattgtg ctggacgata 4680tctatgacac gttcggtaaa atgaaagaac
tggagttatt cacggcggca atcaagcgtt 4740gggacccgag cacgaccgag tgcctgcctg
agtatatgaa aggtgtctac atggcgtttt 4800acaactgcgt taatgaactg gcgctgcaag
ccgagaaaac ccagggccgt gacatgttga 4860actatgcacg taaggcgtgg gaagccctgt
tcgatgcgtt cctggaagaa gcgaagtgga 4920ttagctccgg ctatctgccg acctttgagg
aatacctgga gaacggcaaa gtgtccttcg 4980gttatcgtgc tgccactctg cagccaatcc
tgaccctgga cattccgttg ccgctgcaca 5040tcttgcagca gatcgatttc ccgagccgct
ttaatgacct ggccagctca attttgcgtc 5100tgcgcggtga tatctgcggt tatcaagccg
agcgttctcg tggcgaagag gcgagcagca 5160ttagctgcta catgaaggac aatccgggtt
ccaccgagga agatgcgctg agccacatta 5220acgcgatgat ttcggacaac atcaacgaac
tgaattggga gctgctgaag ccgaacagca 5280atgttccaat cagcagcaaa aagcacgctt
tcgatatcct gcgtgcgttt taccatctct 5340ataagtaccg tgatggtttt agcattgcga
agattgaaac gaagaacctg gtgatgcgca 5400ccgtcctgga gccggtcccg atgtaagaat
tc 5432905453DNAArtificial
SequenceSaCP10374-CPRm-PaAFS, synthetic operon encoding for
SaCP10374, CPRm and an alpha-farnesene synthase 90catatggcac tgctgctggc
tgtcttttgg agcgcactga ttattctgac ccgcaaacgc 60cgcaaaggtc cgggtctgcc
accgggtccg cgtgcgtacc cgattattgg caatctgcac 120atgatgggcc agctgccaca
ccacaatttg cgtgagctgg cacgtgagta tggtccgatt 180atgagcatgc gcctgggtct
ggtgccggca atcgtggtta gctctcctga ggctgcgcag 240ctgttcctca agacgcatga
taccgttttc gcgagccgtc caaagaccga gactgccaaa 300tacttccatt acggtatcaa
aggtctgatc ctgaccgagt atggcccgta ctggcgcaat 360attcgtcgtt tgagcaccgt
taagctgttg aatgccgcga aaatcgatag cttcgcggct 420atgcgtagaa gcgaagttga
acgcctggtc gcgtccgttc gtggttcggc ggttcgtcgt 480gaggttgtgg acgtcagcag
caaagtggcg gaagctatgg agaatatggt ctgccagatg 540gttatcggcc gttcaggtga
cgatcgtttt aagctgaaag aaacctttca agagggcacc 600caactggcag gcgcgttcaa
ttttggtgag tttgtgccgt ttctgctgcc gctggacttg 660caaggtatta cccgtcgcat
caaagaagtc agcactcgtt tcaataagat tttggacctg 720atcgttgacg agcacattcg
cgatgccgct ggtaccaaaa acagcggcgg tcgtgatagc 780gacaattttc tggatgttct
gctgtccttg atgaacacct ctattagcga tagcaatgac 840acgggtgaca acaaccgtaa
caacgtgatc gagcgtgata acattaaagc gatcctgacg 900gacatgctgg gtgcagcgat
ggacacgagc gcgagcacgg tcgagtggac gatctccgaa 960ctgtttcgcc acccgaaaac
catgcagaag ctgcaagcag aaatccgtgg tgtcgtgggc 1020ccgacccgca atgtgagcga
agatgacttg ccgaagctga cctatctgga catggtcgtt 1080aaggaaggca tgcgtttgca
tccggccgtg ccgctgcttc tgccgcatga gtctctggaa 1140gaagccacga tcgatggcta
ctacattccg aagggttccc gcattctgat caacgtctgg 1200gcgattggtc gcgacccgaa
ggcctggccg gatcgtcctg aagagttcat cccggagcgt 1260ttcgagaaaa gcaacgtgga
tgtgctgggc cgtgacttcc agctgctgcc gtttggttcg 1320ggtcgtcgcg gttgtgcagg
cattcgcctg ggcctgatct tcgtacgtct ggttctggca 1380cagttagttc actgtttcga
ctgggaactg gcgcgcaaca tggcgagcag cccggagaag 1440ttggatatgg aagagaagtt
cggcctggcg gtgcatcgtg tcaaccacct gaaagccctg 1500ccgacgtatc gtctggagtg
ctaagtcgac taactttaag aaggagatat atccatggaa 1560cctagctctc agaaactgtc
tccgttggaa tttgttgctg ctatcctgaa gggcgactac 1620agcagcggtc aggttgaagg
tggtccaccg ccaggtctgg cagctatgtt gatggaaaat 1680aaggatttgg tgatggttct
gacgacgtcc gtggcagtcc tgatcggctg tgtcgtggtc 1740ctggcatggc gtcgtgcggc
aggtagcggt aagtacaagc aacctgaact gcctaaactg 1800gtggtcccga aagcagccga
accggaggag gcagaggatg ataaaaccaa gatcagcgtg 1860tttttcggca cccaaaccgg
tacggcagaa ggtttcgcga aggcttttgt tgaagaggcc 1920aaggcgcgtt atcagcaggc
ccgtttcaaa gttatcgacc tggacgacta tgcggcagac 1980gatgacgagt acgaagagaa
actgaagaag gaaaacttgg cattcttctt cttggcgtcc 2040tacggtgacg gcgagccgac
ggacaacgcg gcacgctttt acaaatggtt tacggagggt 2100aaggaccgtg gtgaatggct
gaacaatctg cagtacggcg tttttggtct gggtaaccgt 2160caatatgagc atttcaataa
gatcgccatt gtcgtcgatg atctgatctt cgagcaaggt 2220ggcaagaagc tggttccggt
gggtctgggt gacgatgacc agtgcattga ggatgatttt 2280gcggcgtggc gtgaactggt
ctggccggaa ctggataaac tgctgcgtaa cgaagacgac 2340gctaccgtgg caaccccgta
cagcgccgct gtgctgcaat accgcgtggt tttccacgat 2400cacattgacg gcctgattag
cgaaaacggt agcccgaacg gtcatgctaa tggcaatacc 2460gtgtacgatg cgcaacaccc
gtgccgtagc aacgtcgcgg tcaagaagga attgcatact 2520ccggcgagcg atcgcagctg
cacccacctg gaatttaaca ttagcggtac cggcctgatg 2580tacgagacgg gtgaccacgt
cggtgtgtat tgcgagaacc tgttggaaac cgtggaggag 2640gccgagaagt tgttgaacct
gagcccgcag acgtacttct ccgttcacac cgacaacgag 2700gacggtacgc cgttgagcgg
cagcagcctg ccgccaccgt ttccgccgtg caccttgcgc 2760acggcattga ccaaatacgc
agacttgact tctgcaccga aaaagtcggt gctggtggcg 2820ctggccgagt acgcatctga
ccagggtgaa gcggatcgtt tgcgtttctt ggcgagcccg 2880agcggcaaag aggaatatgc
acagtacatc ttggcaagcc agcgcacgct gctggaggtc 2940atggcggagt tcccgtcggc
gaaaccgccg ctgggtgtct ttttcgcggg tgtcgctccg 3000cgcctgcagc cgcgtttcta
ttccattagc tctagcccga agatcgcacc gttccgtatt 3060cacgtgacct gcgccctggt
ttatgacaaa tcccctaccg gtcgcgttca taagggcatc 3120tgtagcacgt ggatgaaaaa
tgcggtcccg ctggaagaaa gcaacgattg ttcctgggct 3180ccgatcttcg tccgcaacag
caacttcaag ctgccgaccg acccgaaggt tccgattatc 3240atgattggtc cgggtaccgg
tctggcccct tttcgtggct ttttgcaaga gcgcttggcg 3300ttgaaagaga gcggtgctga
attgggtccg gcgatcttgt tctttggttg ccgtaaccgt 3360aaaatggact ttatttacga
ggatgaactg aatgatttcg tcaaagcggg cgttgtcagc 3420gagctgatcg tcgcttttag
ccgcgaaggc ccgatgaaag aatacgtgca acacaaaatg 3480agccaacgtg cctccgatgt
gtggaacatc attagcgacg gtggttatgt ttatgtttgc 3540ggtgacgcga agggtatggc
tcgtgatgtt caccgtaccc tgcataccat cgcacaggag 3600caaggtagca tgtccagctc
ggaggccgaa ggtatggtca aaaacctgca aaccaccggt 3660cgttacctgc gtgatgtgtg
gtaataaaag cttaggaggt aaaaatggat ctggcagtgg 3720aaatcgcaat ggacctggca
gtggatgatg ttgaacgccg tgtgggtgac tatcattcca 3780atctgtggga cgacgacttc
atccaaagcc tgagcacccc gtatggcgcc agctcttacc 3840gcgagcgtgc ggagcgcttg
gtcggcgagg tcaaagaaat gtttacgagc atcagcatcg 3900aggatggtga gctgacctct
gacttgcttc aacgcctgtg gatggttgac aacgttgagc 3960gcctgggcat tagccgtcac
ttcgagaatg aaatcaaggc tgcaattgat tacgtctaca 4020gctattggtc cgacaagggt
attgtccgtg gtagagatag cgccgtgccg gatctgaaca 4080gcattgctct gggtttccgt
acgttgcgtc tgcatggtta caccgttagc agcgatgttt 4140tcaaggtctt tcaagaccgc
aaaggtgagt ttgcatgtag cgcgattccg acggaaggtg 4200acatcaaagg cgtactgaat
ctgctgcgtg caagctacat cgcgttccct ggtgagaaag 4260tgatggagaa agcgcagacc
tttgccgcaa cttatctgaa agaagcactg cagaagatcc 4320aagtgtctag cctgagccgc
gagatcgaat acgttctgga gtatggctgg ctgaccaatt 4380ttccgcgcct ggaagcgcgt
aactacatcg acgttttcgg tgaggaaatt tgtccgtact 4440tcaagaaacc gtgtattatg
gttgataagc tgctggaact ggcgaaactg gagttcaatt 4500tgtttcactc gctgcaacag
accgagctga aacacgtttc ccgttggtgg aaggatagcg 4560gctttagcca gctgaccttc
acgcgtcatc gtcacgtgga gttttacacc ctggctagct 4620gtattgcaat tgaaccgaaa
cattctgcgt ttcgtttggg tttcgcgaag gtctgctacc 4680tgggcattgt gctggacgat
atctatgaca cgttcggtaa aatgaaagaa ctggagttat 4740tcacggcggc aatcaagcgt
tgggacccga gcacgaccga gtgcctgcct gagtatatga 4800aaggtgtcta catggcgttt
tacaactgcg ttaatgaact ggcgctgcaa gccgagaaaa 4860cccagggccg tgacatgttg
aactatgcac gtaaggcgtg ggaagccctg ttcgatgcgt 4920tcctggaaga agcgaagtgg
attagctccg gctatctgcc gacctttgag gaatacctgg 4980agaacggcaa agtgtccttc
ggttatcgtg ctgccactct gcagccaatc ctgaccctgg 5040acattccgtt gccgctgcac
atcttgcagc agatcgattt cccgagccgc tttaatgacc 5100tggccagctc aattttgcgt
ctgcgcggtg atatctgcgg ttatcaagcc gagcgttctc 5160gtggcgaaga ggcgagcagc
attagctgct acatgaagga caatccgggt tccaccgagg 5220aagatgcgct gagccacatt
aacgcgatga tttcggacaa catcaacgaa ctgaattggg 5280agctgctgaa gccgaacagc
aatgttccaa tcagcagcaa aaagcacgct ttcgatatcc 5340tgcgtgcgtt ttaccatctc
tataagtacc gtgatggttt tagcattgcg aagattgaaa 5400cgaagaacct ggtgatgcgc
accgtcctgg agccggtccc gatgtaagaa ttc 5453915370DNAArtificial
SequenceSaCP10374-CPRm-ClTps2, synthetic operon encoding for
SaCP10374, CPRm and an alpha-santalene synthase 91catatggcac tgctgctggc
tgtcttttgg agcgcactga ttattctgac ccgcaaacgc 60cgcaaaggtc cgggtctgcc
accgggtccg cgtgcgtacc cgattattgg caatctgcac 120atgatgggcc agctgccaca
ccacaatttg cgtgagctgg cacgtgagta tggtccgatt 180atgagcatgc gcctgggtct
ggtgccggca atcgtggtta gctctcctga ggctgcgcag 240ctgttcctca agacgcatga
taccgttttc gcgagccgtc caaagaccga gactgccaaa 300tacttccatt acggtatcaa
aggtctgatc ctgaccgagt atggcccgta ctggcgcaat 360attcgtcgtt tgagcaccgt
taagctgttg aatgccgcga aaatcgatag cttcgcggct 420atgcgtagaa gcgaagttga
acgcctggtc gcgtccgttc gtggttcggc ggttcgtcgt 480gaggttgtgg acgtcagcag
caaagtggcg gaagctatgg agaatatggt ctgccagatg 540gttatcggcc gttcaggtga
cgatcgtttt aagctgaaag aaacctttca agagggcacc 600caactggcag gcgcgttcaa
ttttggtgag tttgtgccgt ttctgctgcc gctggacttg 660caaggtatta cccgtcgcat
caaagaagtc agcactcgtt tcaataagat tttggacctg 720atcgttgacg agcacattcg
cgatgccgct ggtaccaaaa acagcggcgg tcgtgatagc 780gacaattttc tggatgttct
gctgtccttg atgaacacct ctattagcga tagcaatgac 840acgggtgaca acaaccgtaa
caacgtgatc gagcgtgata acattaaagc gatcctgacg 900gacatgctgg gtgcagcgat
ggacacgagc gcgagcacgg tcgagtggac gatctccgaa 960ctgtttcgcc acccgaaaac
catgcagaag ctgcaagcag aaatccgtgg tgtcgtgggc 1020ccgacccgca atgtgagcga
agatgacttg ccgaagctga cctatctgga catggtcgtt 1080aaggaaggca tgcgtttgca
tccggccgtg ccgctgcttc tgccgcatga gtctctggaa 1140gaagccacga tcgatggcta
ctacattccg aagggttccc gcattctgat caacgtctgg 1200gcgattggtc gcgacccgaa
ggcctggccg gatcgtcctg aagagttcat cccggagcgt 1260ttcgagaaaa gcaacgtgga
tgtgctgggc cgtgacttcc agctgctgcc gtttggttcg 1320ggtcgtcgcg gttgtgcagg
cattcgcctg ggcctgatct tcgtacgtct ggttctggca 1380cagttagttc actgtttcga
ctgggaactg gcgcgcaaca tggcgagcag cccggagaag 1440ttggatatgg aagagaagtt
cggcctggcg gtgcatcgtg tcaaccacct gaaagccctg 1500ccgacgtatc gtctggagtg
ctaagtcgac taactttaag aaggagatat atccatggaa 1560cctagctctc agaaactgtc
tccgttggaa tttgttgctg ctatcctgaa gggcgactac 1620agcagcggtc aggttgaagg
tggtccaccg ccaggtctgg cagctatgtt gatggaaaat 1680aaggatttgg tgatggttct
gacgacgtcc gtggcagtcc tgatcggctg tgtcgtggtc 1740ctggcatggc gtcgtgcggc
aggtagcggt aagtacaagc aacctgaact gcctaaactg 1800gtggtcccga aagcagccga
accggaggag gcagaggatg ataaaaccaa gatcagcgtg 1860tttttcggca cccaaaccgg
tacggcagaa ggtttcgcga aggcttttgt tgaagaggcc 1920aaggcgcgtt atcagcaggc
ccgtttcaaa gttatcgacc tggacgacta tgcggcagac 1980gatgacgagt acgaagagaa
actgaagaag gaaaacttgg cattcttctt cttggcgtcc 2040tacggtgacg gcgagccgac
ggacaacgcg gcacgctttt acaaatggtt tacggagggt 2100aaggaccgtg gtgaatggct
gaacaatctg cagtacggcg tttttggtct gggtaaccgt 2160caatatgagc atttcaataa
gatcgccatt gtcgtcgatg atctgatctt cgagcaaggt 2220ggcaagaagc tggttccggt
gggtctgggt gacgatgacc agtgcattga ggatgatttt 2280gcggcgtggc gtgaactggt
ctggccggaa ctggataaac tgctgcgtaa cgaagacgac 2340gctaccgtgg caaccccgta
cagcgccgct gtgctgcaat accgcgtggt tttccacgat 2400cacattgacg gcctgattag
cgaaaacggt agcccgaacg gtcatgctaa tggcaatacc 2460gtgtacgatg cgcaacaccc
gtgccgtagc aacgtcgcgg tcaagaagga attgcatact 2520ccggcgagcg atcgcagctg
cacccacctg gaatttaaca ttagcggtac cggcctgatg 2580tacgagacgg gtgaccacgt
cggtgtgtat tgcgagaacc tgttggaaac cgtggaggag 2640gccgagaagt tgttgaacct
gagcccgcag acgtacttct ccgttcacac cgacaacgag 2700gacggtacgc cgttgagcgg
cagcagcctg ccgccaccgt ttccgccgtg caccttgcgc 2760acggcattga ccaaatacgc
agacttgact tctgcaccga aaaagtcggt gctggtggcg 2820ctggccgagt acgcatctga
ccagggtgaa gcggatcgtt tgcgtttctt ggcgagcccg 2880agcggcaaag aggaatatgc
acagtacatc ttggcaagcc agcgcacgct gctggaggtc 2940atggcggagt tcccgtcggc
gaaaccgccg ctgggtgtct ttttcgcggg tgtcgctccg 3000cgcctgcagc cgcgtttcta
ttccattagc tctagcccga agatcgcacc gttccgtatt 3060cacgtgacct gcgccctggt
ttatgacaaa tcccctaccg gtcgcgttca taagggcatc 3120tgtagcacgt ggatgaaaaa
tgcggtcccg ctggaagaaa gcaacgattg ttcctgggct 3180ccgatcttcg tccgcaacag
caacttcaag ctgccgaccg acccgaaggt tccgattatc 3240atgattggtc cgggtaccgg
tctggcccct tttcgtggct ttttgcaaga gcgcttggcg 3300ttgaaagaga gcggtgctga
attgggtccg gcgatcttgt tctttggttg ccgtaaccgt 3360aaaatggact ttatttacga
ggatgaactg aatgatttcg tcaaagcggg cgttgtcagc 3420gagctgatcg tcgcttttag
ccgcgaaggc ccgatgaaag aatacgtgca acacaaaatg 3480agccaacgtg cctccgatgt
gtggaacatc attagcgacg gtggttatgt ttatgtttgc 3540ggtgacgcga agggtatggc
tcgtgatgtt caccgtaccc tgcataccat cgcacaggag 3600caaggtagca tgtccagctc
ggaggccgaa ggtatggtca aaaacctgca aaccaccggt 3660cgttacctgc gtgatgtgtg
gtaataaaag cttgaaggag atatactaat gtctacccag 3720caggttagct ccgagaatat
cgttcgcaac gcggcgaact tccacccgaa tatctggggt 3780aatcatttct tgacgtgtcc
aagccagacg atcgattctt ggacgcaaca acaccataaa 3840gagctgaaag aagaggtccg
caagatgatg gtgagcgacg caaacaaacc ggcacaacgt 3900ctgcgtctga ttgacaccgt
tcaacgtttg ggcgtggcgt atcatttcga aaaagaaatc 3960gatgacgctc tggaaaagat
cggtcacgat ccgtttgacg ataaggatga cctgtatatc 4020gttagcctgt gttttcgcct
gctgcgtcag catggcatca agattagctg cgatgttttt 4080gagaagttca aagacgacga
tggcaagttt aaggcttccc tgatgaatga tgtccaaggt 4140atgctgtcgt tgtatgaagc
ggcccacctg gcaattcatg gcgaggacat cctggatgag 4200gctattgtct ttacgaccac
ccacctgaag agcaccgttt ctaactcccc ggtcaattcc 4260acctttgcgg aacagattcg
ccacagcctg cgtgtgccgc tgcgtaaggc agtcccgcgt 4320ttggagagcc gctacttcct
ggatatctat agccgtgacg acctgcacga caagactctg 4380ctgaactttg ccaaactgga
cttcaacatc ctgcaggcga tgcaccagaa agaggcaagc 4440gagatgaccc gttggtggcg
tgatttcgat ttcctgaaga agctgccgta cattcgtgat 4500cgcgtggttg aactgtactt
ttggattttg gtcggtgtga gctaccaacc gaaattcagc 4560acgggtcgta tctttttgag
caagattatc tgtctggaaa ccctggtgga cgacacgttt 4620gatgcgtacg gtactttcga
cgaactggcc attttcaccg aggccgttac gcgttgggac 4680ctgggtcatc gcgacgcgct
gcctgagtac atgaaattca ttttcaagac cctgattgat 4740gtgtacagcg aggcggaaca
agagctggca aaagagggcc gctcctatag cattcactat 4800gcgatccgta gcttccagga
gttggtcatg aagtactttt gcgaggcgaa atggctgaat 4860aagggttatg ttccgagcct
ggatgactac aagagcgtca gcctgcgcag catcggcttc 4920ctgccgatcg ccgtggcttc
ttttgttttc atgggcgaca ttgctacgaa agaggttttt 4980gagtgggaaa tgaataaccc
gaaaatcatc atcgcagccg aaaccatttt ccgctttctg 5040gatgacattg caggtcatcg
cttcgaacaa aaacgtgagc acagcccgag cgcaatcgag 5100tgctacaaaa accaacatgg
tgtctcggaa gaagaggcag tgaaagcgct gagcttggag 5160gtcgccaatt cgtggaaaga
cattaacgaa gagctgctgc tgaaccctat ggcaattcca 5220ctgccgttgc tgcaggtgat
cctggatttg agccgtagcg cggacttcat gtacggtaat 5280gcgcaggacc gtttcacgca
ctccaccatg atgaaagatc aagttgacct ggttctgaaa 5340gatccggtga aactggacga
ttaagaattc 5370925423DNAArtificial
SequenceSaCP10374-CPRm-SaTps8201, synthetic operon encoding for
SaCP10374, CPRm and an alpha-/beta-santalene synthase 92catatggcac
tgctgctggc tgtcttttgg agcgcactga ttattctgac ccgcaaacgc 60cgcaaaggtc
cgggtctgcc accgggtccg cgtgcgtacc cgattattgg caatctgcac 120atgatgggcc
agctgccaca ccacaatttg cgtgagctgg cacgtgagta tggtccgatt 180atgagcatgc
gcctgggtct ggtgccggca atcgtggtta gctctcctga ggctgcgcag 240ctgttcctca
agacgcatga taccgttttc gcgagccgtc caaagaccga gactgccaaa 300tacttccatt
acggtatcaa aggtctgatc ctgaccgagt atggcccgta ctggcgcaat 360attcgtcgtt
tgagcaccgt taagctgttg aatgccgcga aaatcgatag cttcgcggct 420atgcgtagaa
gcgaagttga acgcctggtc gcgtccgttc gtggttcggc ggttcgtcgt 480gaggttgtgg
acgtcagcag caaagtggcg gaagctatgg agaatatggt ctgccagatg 540gttatcggcc
gttcaggtga cgatcgtttt aagctgaaag aaacctttca agagggcacc 600caactggcag
gcgcgttcaa ttttggtgag tttgtgccgt ttctgctgcc gctggacttg 660caaggtatta
cccgtcgcat caaagaagtc agcactcgtt tcaataagat tttggacctg 720atcgttgacg
agcacattcg cgatgccgct ggtaccaaaa acagcggcgg tcgtgatagc 780gacaattttc
tggatgttct gctgtccttg atgaacacct ctattagcga tagcaatgac 840acgggtgaca
acaaccgtaa caacgtgatc gagcgtgata acattaaagc gatcctgacg 900gacatgctgg
gtgcagcgat ggacacgagc gcgagcacgg tcgagtggac gatctccgaa 960ctgtttcgcc
acccgaaaac catgcagaag ctgcaagcag aaatccgtgg tgtcgtgggc 1020ccgacccgca
atgtgagcga agatgacttg ccgaagctga cctatctgga catggtcgtt 1080aaggaaggca
tgcgtttgca tccggccgtg ccgctgcttc tgccgcatga gtctctggaa 1140gaagccacga
tcgatggcta ctacattccg aagggttccc gcattctgat caacgtctgg 1200gcgattggtc
gcgacccgaa ggcctggccg gatcgtcctg aagagttcat cccggagcgt 1260ttcgagaaaa
gcaacgtgga tgtgctgggc cgtgacttcc agctgctgcc gtttggttcg 1320ggtcgtcgcg
gttgtgcagg cattcgcctg ggcctgatct tcgtacgtct ggttctggca 1380cagttagttc
actgtttcga ctgggaactg gcgcgcaaca tggcgagcag cccggagaag 1440ttggatatgg
aagagaagtt cggcctggcg gtgcatcgtg tcaaccacct gaaagccctg 1500ccgacgtatc
gtctggagtg ctaagtcgac taactttaag aaggagatat atccatggaa 1560cctagctctc
agaaactgtc tccgttggaa tttgttgctg ctatcctgaa gggcgactac 1620agcagcggtc
aggttgaagg tggtccaccg ccaggtctgg cagctatgtt gatggaaaat 1680aaggatttgg
tgatggttct gacgacgtcc gtggcagtcc tgatcggctg tgtcgtggtc 1740ctggcatggc
gtcgtgcggc aggtagcggt aagtacaagc aacctgaact gcctaaactg 1800gtggtcccga
aagcagccga accggaggag gcagaggatg ataaaaccaa gatcagcgtg 1860tttttcggca
cccaaaccgg tacggcagaa ggtttcgcga aggcttttgt tgaagaggcc 1920aaggcgcgtt
atcagcaggc ccgtttcaaa gttatcgacc tggacgacta tgcggcagac 1980gatgacgagt
acgaagagaa actgaagaag gaaaacttgg cattcttctt cttggcgtcc 2040tacggtgacg
gcgagccgac ggacaacgcg gcacgctttt acaaatggtt tacggagggt 2100aaggaccgtg
gtgaatggct gaacaatctg cagtacggcg tttttggtct gggtaaccgt 2160caatatgagc
atttcaataa gatcgccatt gtcgtcgatg atctgatctt cgagcaaggt 2220ggcaagaagc
tggttccggt gggtctgggt gacgatgacc agtgcattga ggatgatttt 2280gcggcgtggc
gtgaactggt ctggccggaa ctggataaac tgctgcgtaa cgaagacgac 2340gctaccgtgg
caaccccgta cagcgccgct gtgctgcaat accgcgtggt tttccacgat 2400cacattgacg
gcctgattag cgaaaacggt agcccgaacg gtcatgctaa tggcaatacc 2460gtgtacgatg
cgcaacaccc gtgccgtagc aacgtcgcgg tcaagaagga attgcatact 2520ccggcgagcg
atcgcagctg cacccacctg gaatttaaca ttagcggtac cggcctgatg 2580tacgagacgg
gtgaccacgt cggtgtgtat tgcgagaacc tgttggaaac cgtggaggag 2640gccgagaagt
tgttgaacct gagcccgcag acgtacttct ccgttcacac cgacaacgag 2700gacggtacgc
cgttgagcgg cagcagcctg ccgccaccgt ttccgccgtg caccttgcgc 2760acggcattga
ccaaatacgc agacttgact tctgcaccga aaaagtcggt gctggtggcg 2820ctggccgagt
acgcatctga ccagggtgaa gcggatcgtt tgcgtttctt ggcgagcccg 2880agcggcaaag
aggaatatgc acagtacatc ttggcaagcc agcgcacgct gctggaggtc 2940atggcggagt
tcccgtcggc gaaaccgccg ctgggtgtct ttttcgcggg tgtcgctccg 3000cgcctgcagc
cgcgtttcta ttccattagc tctagcccga agatcgcacc gttccgtatt 3060cacgtgacct
gcgccctggt ttatgacaaa tcccctaccg gtcgcgttca taagggcatc 3120tgtagcacgt
ggatgaaaaa tgcggtcccg ctggaagaaa gcaacgattg ttcctgggct 3180ccgatcttcg
tccgcaacag caacttcaag ctgccgaccg acccgaaggt tccgattatc 3240atgattggtc
cgggtaccgg tctggcccct tttcgtggct ttttgcaaga gcgcttggcg 3300ttgaaagaga
gcggtgctga attgggtccg gcgatcttgt tctttggttg ccgtaaccgt 3360aaaatggact
ttatttacga ggatgaactg aatgatttcg tcaaagcggg cgttgtcagc 3420gagctgatcg
tcgcttttag ccgcgaaggc ccgatgaaag aatacgtgca acacaaaatg 3480agccaacgtg
cctccgatgt gtggaacatc attagcgacg gtggttatgt ttatgtttgc 3540ggtgacgcga
agggtatggc tcgtgatgtt caccgtaccc tgcataccat cgcacaggag 3600caaggtagca
tgtccagctc ggaggccgaa ggtatggtca aaaacctgca aaccaccggt 3660cgttacctgc
gtgatgtgtg gtaataaaag cttaggaggt aaaacatatg gacagcagca 3720ccgccaccgc
aatgaccgca ccattcatcg acccgacgga tcatgtgaat ctgaaaaccg 3780acacggatgc
gagcgaaaat cgtcgtatgg gtaactacaa gccgagcatt tggaactacg 3840attttctgca
gtccctggcg acgcaccaca acattgttga agagcgtcac ctgaagctgg 3900cagagaaact
gaaaggtcaa gtgaaattca tgttcggtgc gccgatggag ccattggcta 3960agttggagct
ggttgatgtg gtgcaacgct tgggtctgaa ccacctgttc gagactgaaa 4020tcaaagaagc
tctgttcagc atctacaaag atggcagcaa tggctggtgg tttggccatc 4080tgcatgctac
ctctttgcgc ttccgtctgt tgcgccaatg tggcctgttt atcccgcagg 4140acgttttcaa
aacctttcaa aacaagaccg gtgagtttga catgaagctg tgcgacaacg 4200ttaagggcct
gctgagcctg tacgaggcga gctacctggg ctggaagggc gagaacatct 4260tggatgaagc
aaaggcgttc acgaccaagt gcctgaagag cgcatgggag aacattagcg 4320agaagtggct
ggcgaagcgt gttaaacatg cgttggcgct gccgctgcac tggcgtgttc 4380cgcgtattga
agcacgctgg tttatcgagg cctacgaaca agaggccaat atgaatccga 4440cgctgctgaa
actggcgaaa ctggacttca acatggtcca aagcattcac cagaaagaaa 4500tcggtgaact
ggcccgctgg tgggttacta ccggcctgga caagctggcg ttcgcacgca 4560acaatctgtt
gcagtcttat atgtggagct gcgccatcgc gtccgacccg aaattcaaac 4620tggcgcgtga
aaccattgtc gagatcggtt ccgtgttgac ggttgtcgac gacggctatg 4680atgtgtacgg
ttctatcgat gagctggacc tgtacaccag ctcggtggag cgttggtcct 4740gtgtcgagat
tgacaagctg cctaatacgc tgaagctgat ctttatgtct atgttcaaca 4800aaaccaacga
ggtgggtctg cgtgttcaac acgagcgtgg ttacaatagc atcccgacct 4860tcattaaggc
gtgggtggaa cagtgtaaga gctatcaaaa agaggcgcgt tggtttcatg 4920gtggtcacac
gcctccgctg gaagaataca gcctgaacgg tctggtcagc attggttttc 4980cgctgttgct
gatcaccggc tatgttgcga ttgctgagaa tgaagcagcc ctggataaag 5040tccacccgct
gccggacctg ctgcattatt ccagcttgct gagccgtctg attaatgata 5100tcggcactag
cccggatgaa atggcgcgtg gtgacaatct gaagagcatt cactgctata 5160tgaatgaaac
cggtgccagc gaagaggtcg cacgcgagca catcaaaggc gtcatcgaag 5220agaattggaa
aattctgaac cagtgttgct ttgaccagtc ccagttccag gagccgttca 5280tcacgtttaa
cctgaacagc gtgcgcggct cgcatttctt ctatgaattt ggtgatggtt 5340ttggtgttac
cgacagctgg accaaggtgg atatgaaaag cgtcctgatt gatccgattc 5400cgctgggtga
agagtaagaa ttc
54239353DNAArtificial Sequencemutagenesis reverse primer
AV8-L358-revmisc_feature(22)..(22)n is a, c, g, or t 93cacgcggcat
caccagcgga vncggcggat gcaggcgcag ggtttcttta atc
539440DNAArtificial Sequenceprimer AV8-pcw-fw 94catcgatgct taggaggtca
tatggctctg ttattagcag 409525DNAArtificial
Sequenceprimer AV8-L358-fw 95tccgctggtg atgccgcgtg agtgc
259638DNAArtificial Sequenceprimer AV8-CPR-rev
96atatatctcc ttcttaaagt tagtcgactc attaggtg
389765DNAArtificial Sequencefoward primer CPRm_aaBFS_Inf1 97ttacctgcgt
gatgtgtggt aataaaagct taggaggtaa aaatgtctac cctgccaatt 60tcttc
659863DNAArtificial Sequencereverse primer AaBFS_Inf2 98atgtttgaca
gcttatcatc gataagctga attcttacac aaccatcggg tgcacaaaga 60atg
639965DNAArtificial Sequencefoward primer CPRm_PaAFS_Inf1 99ttacctgcgt
gatgtgtggt aataaaagct taggaggtaa aaatggatct ggcagtggaa 60atcgc
6510066DNAArtificial Sequencereverse primer PaAFS_Inf2 100ctcatgtttg
acagcttatc atcgataagc tgaattctta catcgggacc ggctccagga 60cggtgc
6610160DNAArtificial Sequenceprimer foward CPRm_Tps647_inf1 101gcgtgatgtg
tggtaataaa agcttaggag gtaaaaatgg cgaccgttgt ggatgattct
6010253DNAArtificial Sequenceprimer reverse Tps647_Inf2 102gcttatcatc
gataagctga attcttactc ttcatccagg gtaatcgggt gga
5310358DNAArtificial Sequenceprimer foward CPRm_Tps30_Inf1 103gcgtgatgtg
tggtaataaa agcttaggag gtaaaaatgg acgcattcgc aacgagcc
5810459DNAArtificial Sequenceprimer reverse Tps30_Inf2 104gtgatgtgtg
gtaataaaaa gctgaattct tagtcctctt cattcagcgg gatcgggtg 59
User Contributions:
Comment about this patent or add new information about this topic: