41st week of 2013 patent applcation highlights part 32 |
Patent application number | Title | Published |
20130266453 | OFFSHORE WIND TURBINE FOUNDATION, CORRESPONDING OFFSHORE WIND TURBINE AND METHOD FOR THEIR INSTALLATION ON SITE - An offshore wind turbine foundation comprising a platform carrying a support for the wind turbine tower in its central region, and a plurality of leg guides in its peripheral region; and a plurality of legs, each of which may be movable between a raised position for transport and lowered positions for resting on the seabed. Each leg is capable of freely sliding in its guide. | 2013-10-10 |
20130266454 | TURBINE AIRFOIL TIP SHELF AND SQUEALER POCKET COOLING - An airfoil comprises leading and trailing edges with pressure and suction surfaces defining a chord length therebetween. The pressure and suction surfaces extend from a root section of the airfoil to a tip section. A tip shelf is formed along the tip section between the pressure surface and a tip shelf wall spaced between the pressure surface and the suction surface. A squealer pocket is formed along the tip section between the tip shelf wall and a squealer tip wall extending from the suction surface. The tip shelf extends from within 10% of the cord length measured from the leading edge to within 10% of the chord length measured from the trailing edge. The squealer pocket extends from within 10% of the chord length measured from the leading edge to terminate between 10% and 25% of the chord length measured from the trailing edge. | 2013-10-10 |
20130266455 | Air Compressor With Shut-Off Mechanism - A compressor system is disclosed, comprising a first pump driven by a D/C motor, a second pump driven by an A/C motor, and a switch which allows a user to manually selectively engage of one of the D/C motor or A/C motor, including a gauge having a user settable shut-off mechanism which interrupts power to at least one of D/C or A/C motors. Also disclosed is a gauge configured to display system pressure independent of the user settable shut-off mechanism. A gauge having a rotatable bezel with a needle stop comprising a first needle rotatably coupled to a gauge shaft, and a second needle fixable coupled to the gauge shaft, and a spring disposed between the first and second needles, the spring configured to bias the first needle into the second needle so changes in pressure causes rotation of both is also disclosed. | 2013-10-10 |
20130266456 | Housing Directed Buoyant Force Pump - A buoyant force pump and surge apparatus is disclosed. A material which is buoyant relative to a non-solid material is used to cause a movable surface to move thereby causing the non-solid material to be pumped in surges. One use of the device is to create water surges in aquariums through the use of conventional low pressure, low volume air pumps and without the need for mechanical pumps or control electronics. A second use of the device is to move non-solid material in hazardous conditions. | 2013-10-10 |
20130266457 | SQUARE SHOULDER METERING ROD - A metering rod assembly for a pressure sensitive droop flow pump is provided. The assembly includes a metering rod having a first section with a first diameter and a second section with a section diameter, the second diameter larger than the first diameter. A shoulder is formed at a junction of the first section and second section, the shoulder extending radially perpendicular to the first section. | 2013-10-10 |
20130266458 | SEALED COMPRESSOR - A sealed compressor comprises a sealed container: an electric component provided inside of the sealed container; a compression component actuated by the electric component; a suction pipe provided inside of the sealed container to suction a refrigerant gas from outside to inside of the sealed container; and a suction muffler having an inner space; wherein the suction muffler includes: an inlet pipe, one end portion of which opens inside of the sealed container and the other end of which has an outlet opening portion which opens in the inner space of the suction muffler; an outlet pipe, one end portion of which has an inlet opening portion which opens in the inner space of the suction muffler and the other end portion of which communicates with a compression chamber of the compression component; wherein the outlet opening portion of the inlet pipe and the inlet opening portion of the outlet pipe are disposed so as to face each other, and an opening area of the inlet opening portion of the outlet pipe is smaller than an opening area of the outlet opening portion of the inlet pipe. | 2013-10-10 |
20130266459 | SEALED COMPRESSOR - A sealed compressor comprises an electric component; a compression component actuated by the electric component; a sealed container accommodating the electric component and the compression component; a suction pipe provided to suction a refrigerant into the sealed container; and a suction muffler having an inner space communicating with a compression chamber of the compression component and a suction port through which the refrigerant is suctioned into the inner space; a communicating passage for providing communication between the suction port of the suction muffler and the suction pipe, the communicating passage being made of a flexible material; and at least one cut portion provided in an end portion of the communicating passage at the suction pipe side such that the cut portion cuts a portion of the end portion. | 2013-10-10 |
20130266460 | Methods and Systems for Applying Charge to a Piezoelectric Element - Methods and systems for applying charge to a piezoelectric element include and/or facilitate implementation of processes including cyclical multi-stage processes for: providing a piezoelectric element with an accumulated charge; providing one or more charge holding elements with a scavenged charge from the piezoelectric element; substantially removing or discharging a remaining charge from the piezoelectric element; and applying the scavenged charge to the piezoelectric element with an opposite polarity in relation to the polarity of the remaining charge. | 2013-10-10 |
20130266461 | ACTUATOR SUPPORT STRUCTURE AND PUMP DEVICE - A piezoelectric pump includes a leaf spring including a disc portion defining an actuator, an outer frame portion defining a housing, and an elastic support portion. The actuator flexurally vibrates from a center portion of a principal surface thereof to an outer periphery thereof. The elastic support portion includes a beam portion and connection portions and elastically supports the disc portion on the outer frame portion. The beam portion extends in a gap between the disc portion and the outer frame portion in a direction along an outer periphery of the disc portion. A first of the connection portions connects the beam portion to the disc portion. Second and third connection portions are offset from the first connection portion and connect the beam portion to the outer frame portion. | 2013-10-10 |
20130266462 | Pump Having an Integrated Electronically Commutated Direct Current Motor - A pump with an integral, electronically commutated, direct-current motor ( | 2013-10-10 |
20130266463 | FAN MOTOR - A fan motor includes a static body, a rotating body that has a shaft, a hub encircling a first end of the shaft and joined with the first end, and a blade joined around an outer periphery of the hub, a sleeve that retains thereinside a portion of the shaft at a second end side, a rotating flange which encircles the sleeve and which rotates together with the hub, a static flange which is disposed in an area at a side of the first end of the shaft, and which is joined with the static body so as to overlap the rotating flange in a radial direction, a dynamic pressure generating groove provided in either one of surfaces of the static body and the rotating body facing with each other in the axial direction, and a lubricant present between the static body and the rotating body. | 2013-10-10 |
20130266464 | PUMP DISPENSER WITH FLEXIBLE VALVES - The invention relates to a pump chamber ( | 2013-10-10 |
20130266465 | HIGH-PRESSURE PUMP - A high-pressure pump includes a plunger capable of reciprocating, and a housing having a pressurizing chamber in which fuel is pressurized by the plunger, and a fuel chamber through which the fuel flows toward and from the pressurizing chamber. The pump includes a spring that biases the plunger so as to increase the volume of the pressurizing chamber, and a spring seat that is fixed to the housing and is in contact with one end of the spring. A first space that communicates with the fuel chamber via a fuel passage is provided between the bottom of the spring seat and the housing, and a top face of the bottom exposed to the first space is covered with a heating insulating member. | 2013-10-10 |
20130266466 | Blade-Type Fluid Transmission Device - A blade-type fluid transmission device includes a rotor eccentrically located in the room of a stator and the outer periphery of the rotor is tangent to the inner periphery of the room. At least one blade is pivotably connected to stator and movably inserted in at least one slot of the rotor. The distal end of the at least one blade is in contact with the inner periphery of the room so as to form a space for receiving fluid between the outer periphery of the rotor and the inner periphery of the room. The contact between the at least one blade and the inner periphery of the room increases the efficiency for transmitting fluid which enters into the stator from an inlet and leaves from the stator from an outlet. | 2013-10-10 |
20130266467 | Providing Plastic Zone Extrusion - Plastic zone extrusion may be provided. First, a compressor may generate frictional heat in stock to place the stock in a plastic zone of the stock. Then, a conveyer may receive the stock in its plastic zone from the compressor and transport the stock in its plastic zone from the compressor. Next, a die may receive the stock in its plastic zone from the conveyer and extrude the stock to form a wire. | 2013-10-10 |
20130266468 | Method of Preparing Silver-Based Oxide Electrical Contact Materials with Fiber-like Arrangement - A method of preparing silver-based oxide electrical contact materials with fiber-like arrangement, includes the following steps of: (1) uniformly mixing the silver-metal alloy powders and graphite powders and then ball-milling; (2) internally oxidizing the ball-milled powders; (3) sieving; (4) placing the sieved powders and the matrix powders into the powder mixer for mixing; (5) cold-isostatically pressing; (6) sintering; (7) hot-pressing; and (8) hot-extruding, thereby obtaining the silver-based oxide electrical contact material with fiber-like arrangement. The method of the present invention can obtain the silver-based oxide electrical contact material having neat fiber-like arrangement with no specific requirement on processing deformation, plasticity and ductility of the reinforcing phase. The production process in this method is simple and is easy to operate. Besides, there is no particular requirement on the equipment. The method greatly improves the performance of contact materials in aspects of resistance to welding and arc erosion, conductivity, and processing performance | 2013-10-10 |
20130266469 | METHOD FOR NEAR NET SHAPE MANUFACTURING OF HIGH-TEMPERATURE RESISTANT ENGINE COMPONENTS - For near net shape manufacturing of a high-temperature resistant component of complex design a high melting-point part of an intermetallic phase provided as a metal powder is mixed with a binder, and from the feedstock such formed a green compact substantially matching the final contour is produced by metal injection moulding, into the pores of said compact that remain after removal of the binder the low melting-point part of the intermetallic phase is infiltrated. The brown compact thereby created is mechanically processed, if required, and subjected to a specific heat treatment depending on the metallic phases used in order to create the intermetallic phase. This permits engine components consisting of intermetallic phases and having a geometrically complex structure to be manufactured cost-efficiently. | 2013-10-10 |
20130266470 | METHOD FOR THE MANUFACTURING HIGH-TEMPERATURE RESISTANT ENGINE COMPONENTS - For near net shape manufacturing of high-temperature resistant engine components of geometrically complex design consisting of an intermetallic phase, a low melting-point metallic phase in the molten state or in a temperature range near the molten state is mixed with a high melting-point metallic phase provided as a metal powder, and the mixture is mechanically treated under the effect of kneading and shear forces, thereby heating it up and reducing its viscosity. In a subsequent injection moulding process the engine component substantially matching the final contour is formed and mechanically finish-machined, if required, and afterwards subjected to a heat treatment for creating an intermetallic phase. | 2013-10-10 |
20130266471 | Vibration Machines for Powder Coating - A method of making a permanent magnet includes a step of forming a coating on an alloy powder by physical vapor deposition. The alloy powder includes neodymium, iron, boron and other metals. The coating includes a component selected from the group consisting of dysprosium, terbium, iron, and the alloys thereof. The alloy powder is vibrated during formation of the coating. Finally, a permanent magnet is formed from the coated powder, the permanent magnet having a non-uniform distribution of dysprosium and/or terbium. A method of making a permanent magnet using a vibrating transport belt is also provided. | 2013-10-10 |
20130266472 | Method of Coating Metal Powder with Chemical Vapor Deposition for Making Permanent Magnets - A method of making a permanent magnet includes a step of contacting a powder with a metal-containing vapor to form a coating on the powder. The alloy powder includes neodymium, iron, and boron. The metal-containing vapor includes a component selected from the group consisting of dysprosium, terbium, iron and alloys thereof. A permanent magnet is formed from the coated powder by compaction, sintering and subsequent heat treatment. | 2013-10-10 |
20130266473 | Method of Producing Sintered Magnets with Controlled Structures and Composition Distribution - A method of making a permanent magnet includes a step of providing an alloy powder comprising at least one rare earth element. The alloy powder is shaped and then exposed to microwave radiation or a pulsed electric current to form a sintered magnet. | 2013-10-10 |
20130266474 | METHOD FOR PRODUCING MAGNETIC GREEN COMPACTS, MAGNETIC GREEN COMPACT, AND SINTERED BODY - A method is provided for producing magnetic green compacts. Material powder including a rare earth alloy and containing not less than 15 mass % of fine particles with particle diameter of not more than 2 μm is filled into a compacting mold, then compacted and compressed, and subjected to magnetic fields to give a green compact. A powder compact having a packing density 1.05 to 1.2 times the bulk density is subjected to a weak magnetic field of 1 to 2 T to give a compact. The magnetic field strength is increased to not less than 3 T at an excitation rate of 0.01 to 0.15 T/sec, and the strong magnetic field of not less than 3 T is applied to the compact by a high-temperature superconducting coil. The magnetic field is applied by the high-temperature superconducting coil in a direction opposite to a direction applied by a normal conducting coil. | 2013-10-10 |
20130266475 | METHOD FOR PURIFICATION OF 225AC FROM IRRADIATED 226RA-TARGETS - The present invention describes a method for purification of | 2013-10-10 |
20130266476 | ANTI-VEINING ADDITIVE FOR THE PRODUCTION OF CASTING MOLDS AND CORES - The present invention belongs to the field of the additives for molding sands used in the manufacture of casting molds and cores. More specifically, the present invention relates to an additive to prevent veining in the manufacture of metal parts, to a molding sand comprising said additive, to a core or mold prepared from said molding sand and to a metal part prepared by means of using one of said cores or molds. | 2013-10-10 |
20130266477 | Alumina Forming Iron Base Superalloy - An austenitic stainless steel alloy, consists essentially of, in weight percent 2.5 to 4 Al; 25 to 35 Ni; 12 to 19 Cr; at least 1, up to 4 total of at least one element selected from the group consisting of Nb and Ta; 0.5 to 3 Ti; less than 0.5 V; 0.1 to 1 of at least on element selected from the group consisting of Zr and Hf; 0.03 to 0.2 C; 0.005 to 0.1 B; and base Fe. The weight percent Fe is greater than the weight percent Ni. The alloy forms an external continuous scale including alumina, and contains coherent precipitates of γ′—Ni | 2013-10-10 |
20130266478 | Calibrator For A Sensor - A calibrator, for calibrating a sensor, has a calibration chamber for containing a calibration liquid. The liquid comprises water or an aqueous solution of an analyte to be sensed. A hydrogen peroxide-quenching material is provided exposed to the interior of the calibration chamber. The hydrogen peroxide-quenching material contacts the calibration liquid. After the calibration chamber containing the calibration liquid is sterilized by irradiation with gamma radiation, the hydrogen peroxide-quenching material decomposes any hydrogen peroxide formed in the calibration liquid to avoid adverse effects on a sensor placed in contact with the calibration liquid. | 2013-10-10 |
20130266479 | Microfluidic Separation Device - A microfluidic separation device is provided that includes a first sample channel region and a second sample channel region, where the first sample channel region has an array of channels that are smaller than the second channel region, a first detection region and a second detection region located at the interface of the first sample channel region, a detection channel, an illuminating electric field, Raman-scattering nanoparticles having surface plasmon resonances for detection when illuminated by the electric field, where the resonances create an enhanced local electric field along specific directions resulting in an enhanced Raman response, and a nanoparticle input channel disposed to input the nanoparticles into the second sample channel region, where the nanoparticles are larger than the cross-section of the first sample channel region and the cross-section of the second detection region, where the nanoparticles collect in the first detection region to form region of densely packed nanoparticles. | 2013-10-10 |
20130266480 | ASSAY CHIP - An assay chip includes fluidic-channel member composed of a light-transmissive lower member and an upper member, forming a fluidic-channel therebetween, and a cover member fitted with the fluidic-channel member from the upper-member-side thereof. An inlet for injecting a sample solution into the fluidic-channel and a suction opening for sucking, from the downstream side, the injected sample solution, both communicating with the fluidic-channel, are formed on the upper surface of the upper member. A pot for carrying out predetermined pre-processing on the sample solution, a pot for first-reaction processing to bind a photoresponsive labeling substance to an analyte in the sample solution, an inlet insertion-hole for inserting the inlet, and a suction-opening insertion-hole for inserting the suction opening are linearly arranged on the upper surface of the cover member. | 2013-10-10 |
20130266481 | BLOOD GLUCOSE TEST STRIP - The present invention provides a blood glucose test strip for use in a six-pin blood glucose meter, including: a substrate; a first conductive lead disposed on a surface of the substrate; a second conductive lead disposed on the surface of the substrate; and a third conductive lead disposed on the surface of the substrate; wherein a portion of each of the first conductive lead, the second conductive lead, and the third conductive lead resides within a blood sample chamber disposed on the surface of the substrate; and wherein blood glucose testing is initiated by the blood glucose meter only when blood in the blood sample chamber electrically couples the first conductive lead and the third conductive lead. | 2013-10-10 |
20130266482 | BIOLOGICAL SAMPLE MEASURING DEVICE - This biological sample measuring device comprises a mounting portion ( | 2013-10-10 |
20130266483 | Microchip - A microchip including a fluid circuit therein and a specimen inlet for introducing a specimen containing a first component and a second component different in specific gravity from each other into the fluid circuit is provided, in which the fluid circuit includes a specimen measurement unit connected to the specimen inlet and having a prescribed volume for measuring the specimen introduced through the specimen inlet and a separation unit which is a site connected to the specimen measurement unit and having a capacity capable of storing the total amount of the measured specimen, for storing the total amount of the measured specimen and separating the first component and the second component in the stored specimen from each other. | 2013-10-10 |
20130266484 | AUTOMATIC ANALYZER - Realized is an automatic analyzer that allows appropriate setting of analytical parameters which incorporate batch-to-batch variations in characteristics of reagents. The analytical parameters 35, consisting of fixed parameters 37 and variable parameters 38, are stored into a storage unit of the automatic analyzer. The fixed parameters 37 include a reagent-dispensing quantity, a sample-dispensing quantity, measuring wavelength, and the like, each of which becomes a pivot for measurement of a sample, and parameters to be used are selected from an item code and bottle code assigned to a reagent bottle 36. The variable parameters 38 include a linearity check value, a prozone check value, reaction limit absorbance, technical limits, first standard solution absorbance, variation allowable absorbance, and the like, each of which is associated with sample-measurement result checks. The variable parameters 38 have a plurality of versions, and the automatic analyzer has a control unit, which reads bar code information from the reagent bottle and adopts variable parameters of a corresponding version with the item code, the bottle code, and batch information relating to the reagent, as a key. | 2013-10-10 |
20130266485 | APPARATUS FOR HCL SYNTHESIS WITH STEAM RAISING - An apparatus for synthesizing hydrogen chloride from chlorine and hydrogen or from chlorine and hydrocarbons with integrated heat recovery. The combustion chamber and the heat exchanger are arranged in the steam drum of a shell boiler that works according to the waste heat boiler principle. | 2013-10-10 |
20130266486 | AIR FRESHENER - An air freshener of the invention comprises a head having a receiving portion and a socket portion, a clip, having a ball portion rotatably and detachably mounting in the socket portion of the head, to mount the air freshener on an air vent and a scent portion received in the receiving portion of the head for diffusing fragrance. | 2013-10-10 |
20130266487 | SHIELDING COLLAR - A shield collar ( | 2013-10-10 |
20130266488 | CASSETTE FOR RADIOACTIVE ISOTOPE HANDLING APPARATUS, RADIOACTIVE ISOTOPE HANDLING APPARATUS, AND RADIOACTIVE ISOTOPE HANDLING SYSTEM - A cassette for a radioactive isotope handling apparatus includes a substrate including a plurality of holders capable of attaching piping; and piping attached to the substrate by some of the plurality of holders. The substrate may be provided with a plurality of through holes for opening and closing the piping. The plurality of holders have a plurality of first holders capable of attaching the piping along a first direction; and a plurality of second holders capable of attaching the piping along a second direction intersecting the first direction. | 2013-10-10 |
20130266489 | Vial for Test Strips - A diagnostic test strip vial has a container, a lid, and a plurality of diagnostic test strips. The container has a generally annular wall that terminates at a base and at an open mouth at an end that is opposite the base. The annular wall is cut at an oblique angle creating a wall that has a high side and a low side at the open mouth. The low side of the annular wall of the container is shorter in length than a diagnostic test strip that enclosed in the vial when the lid is closed with the container. | 2013-10-10 |
20130266490 | HIGH-DENSITY ION TRANSPORT MEASUREMENT BIOCHIP DEVICES AND METHODS - The present invention includes biochips for the measurement of cellular ion channels and methods of use and manufacture. The biochips of the present invention have enhanced sealing capabilities provided in part by chemically modifying the surface of the biochip surface or substrate or by exposure to an ionized gas. The present invention also includes novel cartridges for biochips. | 2013-10-10 |
20130266491 | CHIP FOR ANALYSIS OF SOLUTION OF INTEREST - The present invention provides a chip which can be used for preventing the contamination in the inside of a measurement device, and comprises: a contact hole that is in contact with a solution of interest and that is formed on an outer surface of the chip for the purpose of introducing blood that makes contact with the contact hole into the inside of the chip; a first hydrophobic region that is substantially in contact with at least a part of an opening edge of the contact hole and that is formed on the outer surface of the chip from a contact hole toward the chip insertion side; and a first hydrophilic region that is located adjacent to the first hydrophobic region and that is formed on the outer surface of the chip from the first hydrophobic region toward the chip insertion side. | 2013-10-10 |
20130266492 | TURRET COMPONENT FOR A REAGENT VESSEL - A turret component for a reagent vessel includes at least one vessel structure into which at least one liquid and/or pulverized material is pourable. The at least one vessel is formed on the turret component, and the turret component has at least one predetermined breaking point on at least one vessel base of the at least one vessel structure. A reagent vessel insertion part for a reagent vessel for a centrifuge and/or for a pressure varying apparatus includes the turret component and also includes an insertion part housing configured to enable insertion of the reagent vessel insertion part into a reagent vessel for a centrifuge and/or a pressure varying apparatus. | 2013-10-10 |
20130266493 | METHOD FOR SEPARATING NICKEL FROM MATERIAL WITH LOW NICKEL CONTENT - The invention relates to a method for separating nickel and other valuable metalsparticularly from material having low nickel content, which contains iron and magnesium in addition to nickel and other valuable metals. The material havinglow nickel content is subjected to pulpingand atmospheric leaching in acidic and oxidising conditions, in which the majority of the metals in themate-rialdissolve and the iron is partially precipitated. The precipitated iron is sepa-rated from the solution, after which nickel and the other dissolved valuable metalsare precipitated as sulphides. | 2013-10-10 |
20130266494 | UPGRADING OF TITANIFEROUS MATERIAL - A method of upgrading a titaniferous material includes nitriding and reducing a titaniferous material which includes TiO | 2013-10-10 |
20130266495 | MANUFACTURING METHOD AND MANUFACTURING DEVICE FOR MULTIPLE OXIDE - A method for manufacturing a multiple oxide includes: a solution preparing step of adding to iron and steel pickling waste liquid, a lithium compound soluble in acidic aqueous solution and an oxoanion raw-material compound to prepare a mixed solution; a roasting step of introducing the mixed solution into a roasting furnace to roast the mixed solution; and a collecting step of collecting the multiple oxide obtained in the roasting step. | 2013-10-10 |
20130266496 | HIGH-EFFICIENCY CATALYTIC CONVERTERS FOR TREATING EXHAUST GASES - Several embodiments of high-efficiency catalytic converters and associated systems and methods are disclosed. In one embodiment, a catalytic converter for treating a flow of exhaust gas comprising a reaction chamber, a heating enclosure enclosing at least a portion of the reaction chamber, and an optional coolant channel encasing the heating enclosure. The reaction chamber can have a first end section through which the exhaust gas flows into the reaction chamber and a second end section from which the exhaust gas exits the reaction chamber. The heating enclosure is configured to contain heated gas along the exterior of the reaction chamber, and the optional coolant channel is configured to contain a flow of coolant around the heating enclosure. The catalytic converter can further include a catalytic element in the reaction chamber. | 2013-10-10 |
20130266497 | COPPER/CHABAZITE-BASED CATALYST WITH IMPROVED CATALYTIC ACTIVITY FOR REDUCTION OF NITROGEN OXIDES - The present invention relates to a process for improving the catalytic activity of a copper-promoted zeolitic catalyst with chabazite structure, to a copper-promoted zeolitic catalyst with chabazite structure and to a process for reducing nitrogen oxides in an offgas stream. | 2013-10-10 |
20130266498 | Systems and Methods for Removing Components of a Gas Mixture - A system for removing components of a gaseous mixture is provided comprising: a reactor fluid containing vessel having conduits extending therefrom, aqueous fluid within the reactor, the fluid containing a ligand and a metal, and at least one reactive surface within the vessel coupled to a power source. A method for removing a component from a gaseous mixture is provided comprising exposing the gaseous mixture to a fluid containing a ligand and a reactive metal, the exposing chemically binding the component of the gaseous mixture to the ligand. A method of capturing a component of a gaseous mixture is provided comprising: exposing the gaseous mixture to a fluid containing a ligand and a reactive metal, the exposing chemically binding the component of the gaseous mixture to the ligand, altering the oxidation state of the metal, the altering unbinding the component from the ligand, and capturing the component. | 2013-10-10 |
20130266499 | BORIDE HAVING CHEMICAL COMPOSITION Na-Si-B, AND POLYCRYSTALLINE REACTION SINTERED PRODUCT OF BORIDE AND PROCESS FOR PRODUCTION THEREOF - Provided are: a novel bonds useful as a highly-functional material; and a novel production method for a polycrystalline sintered product of a bonds, of which the energy cost is low, which does not require a sintering promoter, which enables the product to be worked into complicated forms and which enables a development to a polynary boride. | 2013-10-10 |
20130266500 | SILICON OXIDE MATERIAL FOR NONAQUEOUS ELECTROLYTE SECONDARY BATTERY NEGATIVE ELECTRODE MATERIAL, MAKING METHOD, NEGATIVE ELECTRODE, LITHIUM ION SECONDARY BATTERY, AND ELECTROCHEMICAL CAPACITOR - A silicon oxide material is obtained by cooling and precipitating a gaseous mixture of SiO gas and silicon-containing gas and has an oxygen content of 20-35 wt %. Using the silicon oxide material as a negative electrode active material, a nonaqueous electrolyte secondary battery is constructed that exhibits a high 1st cycle charge/discharge efficiency and improved cycle performance while maintaining the high battery capacity and low volume expansion of silicon oxide. | 2013-10-10 |
20130266501 | Direct Production of Large and Highly Conductive Low-Oxygen Graphene Sheets and Monodispersed Low-Oxygen Graphene Nanosheets - Method for making graphene sheets exfoliated by oxidation from graphite by mixing graphite powder with a solution of concentrated sulfuric acid and nitric acid and subjecting the resultant mixture to microware irradiation until a finely dispersed suspension graphene sheets is formed in the solution. Graphene sheets exfoliated by oxidation from graphite are also disclosed. | 2013-10-10 |
20130266502 | METHODS AND APPARATUS FOR GAS-PHASE REDUCTION/OXIDATION PROCESSES - A method and apparatus for gas-phase reduction/oxidation is disclosed. The apparatus includes a reactor including at least one reactor tube or containment vessel with active redox material within the reactor tube or containment vessel, a first reactant gas or vacuum for reducing the active redox material, and a second reactant gas for oxidizing the active redox material. The method may be run under substantially isothermal conditions and/or energy supplied to the apparatus may include solar energy, which may be concentrated. | 2013-10-10 |
20130266503 | APPARATUS AND METHOD FOR EXFOLIATION OF GRAPHENE - Provided is an apparatus and method for exfoliation of graphene, comprising a chamber which has a through-hole formed at one surface thereof; a cylinder which receives graphite and a volatile material to be vaporized at room temperature and has an opening to be corresponding to the through-hole of the chamber, and which is disposed at an outside of the chamber; a clamp which is disposed in the chamber to pass through the through-hole of the chamber and thus selectively seal the opening of the cylinder; and an operation mechanism which is connected with the clamp and moves the clamp so that the opening of the cylinder is selectively sealed by the clamp. Therefore, it is not necessary to use an acid like sulfuric acid, and it is also not necessary to perform a thermal treatment process for removing sulfuric acid. | 2013-10-10 |
20130266504 | Methods and Materials for the Thermochemical Production of Hydrogen From Water - The present invention is directed to a method of thermochemical forming H | 2013-10-10 |
20130266505 | HYDROGEN GENERATION BY HYDROGENATED POLYSILANES FOR OPERATING FUEL CELLS - A fuel cell supply device that generates hydrogen for fuel cells in an aircraft includes a reaction chamber which reacts hydrogenated polysilanes or mixtures thereof with water; a feed device that feeds at least one reactant into the reaction chamber; and a discharge device that leads hydrogen formed in the reaction to a fuel cell. | 2013-10-10 |
20130266506 | METHOD OF PRODUCING HYDROGEN FROM AMMONIA - In a method by which hydrogen supplied as a combustion aid to an ammonia combustion engine is produced from ammonia, the filling amount of a decomposition catalyst in an ammonia decomposition apparatus is reduced. The method includes an ammonia decomposition apparatus that produces hydrogen as a combustion aid and an ammonia oxidation apparatus that allows a part of introduced ammonia to react with oxygen for combustion by action of an oxidation catalyst in order to supply the heat needed for the ammonia decomposition reaction, wherein the amount of ammonia and the amount of air introduced into the oxidation apparatus are controlled in accordance with the entrance temperature of an ammonia oxidation catalyst layer, so as to set the ammonia decomposition ratio in the ammonia decomposition apparatus to be 40 to 60% at all times. | 2013-10-10 |
20130266507 | MECHANOCHEMICAL PRODUCTION OF ZEOLITES - The subject of the invention is a method for the synthesis of zeolites, comprising the following steps: a) providing a silicon source; b) providing an aluminium source; c) optionally providing at least one template; d) mixing the silicon source, aluminium source and optional template in order to produce a synthesis gel; e) grinding the synthesis gel; f) treating the ground synthesis gel under hydrothermal conditions in order to produce crystalline zeolite, as well as zeolites that can be obtained according to this method. The products obtained according to the method can be used as catalysts or catalyst supports. | 2013-10-10 |
20130266508 | THERMOSENSITIVE HYDROGEL FOR COATING RADIOISOTOPE AND CHEMOTHERAPEUTIC AGENT TO TREAT CANCER AND METHOD FOR PREPARING THE SAME - A thermosensitive hydrogel for coating radioisotopes and chemotherapeutic agents to treat cancer and a method for preparing the same are revealed. The anticancer drugs such as radiopharmaceuticals or chemotherapeutic agents are coated with the hydrogel formed by PCL-PEG-PCL. By the feature of the hydrogel body that changes from liquid phase at low storage temperature to gel form at body temperature, not only the anticancer drugs can be injected into the human body and reaching the treatment site smoothly but the treatment time of brachytherapy is also extended. Thus the side effects of cancer therapy are significantly reduced. | 2013-10-10 |
20130266509 | METHOD FOR COATING AND FUNCTIONALIZING NANOPARTICLES BY MEANS OF A MICHAEL REACTION - The present invention relates to a method for coating nanoparticles to achieve stable dispersions of said particles in a liquid medium and the surface functionalization thereof with groups that have physical activity such as luminescence, chemical activity such as catalytic capacity and/or biological activity such as a capacity for selectively binding with a biological entity. | 2013-10-10 |
20130266510 | COMPOSITIONS AND METHODS FOR TREATMENT OF DRUG RESISTANT MULTIPLE MYELOMA - This invention relates to a novel target for production of immune and non-immune based therapeutics and for disease diagnosis. More particularly, the invention provides therapeutic antibodies against TMEM154 antigens, which are differentially expressed in cancer, and diagnostic and therapeutic usages, wherein the cancer is relates to multiple myeloma, including multiple myeloma precursor diseases. This invention further relates to extracellular domains of TMEM154 proteins and variants, and therapeutic usages thereof. | 2013-10-10 |
20130266511 | NOVEL ANTIGEN ASSOCIATED WITH THE NEOVASCULATURE OF TUMOUR METASTASES - The invention relates to a binding member that binds the Extra Domain-A (ED-A) isoform of fibronectin for the treatment of tumour metastases. | 2013-10-10 |
20130266512 | Tetrazine-trans-cyclooctene Ligation for the Rapid Construction of Radionuclide Labeled Probes - A Diels-Alder adduct of a trans-cyclooctene with a tetrazine is provided, wherein the adduct bears a substituent labeled with a radionuclide. A method of producing a PET or other image of an organ in an animal or human includes forming the Diels-Alder adduct in the animal or human. Trans-cyclooctenes and tetrazines suitable for preparing the adducts are provided. | 2013-10-10 |
20130266513 | IMAGING OF MENINGIOMAS USING PHINGYLBENZOTHIAZOLE, STILBENE, OR BIPHENYLALKYNE DERIVATIVES - Methods for detecting or ruling out a meningioma in a patient using a phenylbenzothiazole derivative or a stilbene derivative or a biphenylalkyne derivative, and a medical imaging technique such as positron emission tomography/computed tomography are disclosed. In one version of the method, the phenylbenzothiazole derivative is a compound of formula (V): | 2013-10-10 |
20130266514 | Method of Providing Disease-Specific Binding Molecules and Targets - Provided are novel specific binding molecules, particularly human antibodies as well as fragments, derivatives and variants thereof that recognize neoepitopes of disease-associated proteins which derive from native endogenous proteins but are prevalent in the body of a patient in a variant form and/or out of their normal physiological context. In addition, pharmaceutical compositions comprising such binding molecules, antibodies and mimics thereof and methods of screening for novel binding molecules, which may or may not be antibodies as well as targets in the treatment of neurological disorders such as Alzheimer's disease are described. | 2013-10-10 |
20130266515 | Specific Ligand for Annexin 2 - The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2. | 2013-10-10 |
20130266516 | LAR Protein-Specific Ligand - The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein. | 2013-10-10 |
20130266517 | Humanized Antibodies That Recognize Alpha-Synuclein - The present application discloses humanized 1H7 antibodies. The antibodies bind to human alpha synuclein and can be used for treatment and diagnosis of Lewy body disease. | 2013-10-10 |
20130266518 | Methods and Compositions for Using Bleomycin-Derivatized Microbubbles - Methods and compositions for using tumor targeting compounds bound to microbubbles to facilitate drug delivery and diagnostic imaging at tumor sites. | 2013-10-10 |
20130266519 | TARGETING VECTOR-PHOSPHOLIPID CONJUGATES - Peptide vectors having high KDR binding affinity and processes for making such vectors are provided. The peptide vectors may be conjugated to phospholipids and included in ultrasound contrast agent compositions. Such ultrasound contrast agents are particularly useful in therapeutic and diagnostic methods, such as in imaging KDR-containing tissue and in the evaluation and treatment of angiogenic processes associated with neoplastic conditions. The present invention also provides processes for the large scale production of highly pure dimeric and monomeric peptide phospholipid conjugates as well as precursor materials used to form the conjugates. The present invention further provides processes for the large scale production of highly pure peptide phospholipid conjugates which contain very low levels of TFA. | 2013-10-10 |
20130266520 | ORAL FILM DOSAGE FORM HAVING PHYSICAL-CHEMICAL IDENTIFIER THEREON - The present invention relates to rapidly dissolving edible film dosage form incorporating a physical-chemical identifier and/or indicia. The physical-chemical identifier and/or indicia may correspond to an active ingredient that may be evenly distributed throughout the film. The physical-chemical identifier and/or indicia may be associated with at least one section of the film composition and/or associated with a sealed pouch or package containing the film composition and provide information to the consumer, practitioner, producer or regulator that is relevant to the edible film dosage form. | 2013-10-10 |
20130266521 | Oral Compositions Comprising Propolis - Oral compositions are provided that comprise a propolis extract; an oral care active compound chosen from: a cationic antibacterial agent, an anti-attachment agent, a biofilm disruption agent, and an anti-inflammatory agent; and a source of fluoride ions. Further, in certain embodiments, the oral composition comprises an anionic polymeric linear polycarboxylate. The oral composition can be in a form of a mouth rinse, a dentifrice, a confectionary, a medicament, or a film. Methods of making and using the oral compositions are also provided. | 2013-10-10 |
20130266522 | ALGAL EXTRACT-BASED COMPOSITION FOR ORO-DENTAL USE - An algal extract-based composition for oro-dental use is provided. This composition comprising a mixture of algae with at least | 2013-10-10 |
20130266523 | Oral Compositions and Method for Producing Thereof - Methods of preparing a dentifrice comprising polymer matrix film with menthol therein are disclosed. The methods comprise combining a polymer matrix film that comprises hydrophobic additives and is free of a low solubility flavorant such as menthol with a dentifrice base comprising a low solubility flavorant such as menthol and maintaining the combined polymer matrix film with the dentifrice base comprising low solubility flavorant for an amount of time sufficient for an amount of a low solubility flavorant to transfer from the dentifrice base comprising low solubility flavorant to the polymer matrix film and establish an equilibrium of menthol concentration between the polymer matrix film and the dentifrice base. Products comprising low solubility flavorant-free polymer matrix film in a dentifrice base comprising low solubility flavorant are also disclosed. | 2013-10-10 |
20130266524 | Oral Compositions - Described herein, are films, compositions containing the films and methods of preparing a dentifrice comprising the films, wherein the films contain a low solubility flavorant. | 2013-10-10 |
20130266525 | HIGH PROTECTION UVA/UVB COMPOSITION AND TOPICAL COSMETIC COMPOSITION - The present invention relates to a high protection UVA/UVB composition comprising (a) about 16 to about 52% by weight of physical filter selected from the group comprising titanium dioxide particles, zinc oxide particles, an compound-based benzotriazole particles and mixtures thereof; (b) about 6 to about 10% by weight of a non-animal hectorite dispersion; and (c) optionally, about 2 to about 20% by weight of a sensory modifier selected from the group comprising: silicones, esters, silica and mixtures thereof, wherein all percentages are based on the total weight of the high protection UVA/UVB composition. | 2013-10-10 |
20130266526 | DIHYDROXYFUMARIC ACID DERIVATIVES AND THE USE THEREOF FOR SKIN LIGHTENING - The present invention relates to the use of dihydroxyfumaric acid derivatives for the lightening of the skin, for the inhibition of tyrosinase and for the prophylaxis, treatment and/or progress control of pigment defects of the skin, and to cosmetic and dermatological preparations and medicaments comprising dihydroxyfumaric acid derivatives and to novel dihydroxyfumaric acid derivatives. | 2013-10-10 |
20130266527 | HIGH SPF SUNSCREEN COMPOSITION - The invention relates to a high SPF sunscreen composition. There exists a need for a personal care composition comprising sunscreen agents in low concentrations that are able to provide much higher SPF as compared to known sunscreen compositions comprising such low levels of sunscreen agents. The present applicants have been working on solving this problem and have surprisingly found that cosmetic compositions comprising dibenzoylmethane or its derivative in combination with an oil soluble UV-B sunscreen when incorporated in a sunscreen composition along with a non-ionic surfactant of a select class meeting certain HLB requirements, provide the enhanced SPF benefits when applied on the substrate of interest. | 2013-10-10 |
20130266528 | SKIN LIGHTENING COMPOSITION - The invention relates to a skin lightening composition; especially to a cream that provides faster kinetics of skin lightening as compared to conventional compositions. The present inventors have found that inclusion of a very selective salt of a dicarboxylic acid viz. disodium fumarate in such a cream base along with selective non-ionic surfactants provides for desired fast skin lightening kinetics without compromising on the desired sensorials afforded by vanishing cream bases. | 2013-10-10 |
20130266529 | PROCESS FOR STRIPPING KERATIN FIBRES USING A COMPOSITION COMPRISING A SULFINIC ACID DERIVATIVE AND AN ACIDIC AQUEOUS COMPOSITION - The present invention relates to a process for stripping keratin fibres, and in particular human keratin fibres such as the hair, dyed with oxidation dyes and/or direct dyes, using a composition obtained by extemporaneous mixing of an anhydrous or aqueous composition (A) comprising at least one suitably selected sulfinic acid derivative and an aqueous composition (B) with a pH of less than (5), comprising at least one organic acid other than the compounds of formula (I), with a pKa of less than or equal to (4) when the composition (A) is aqueous, the pH of the mixture of the two compositions (A) and (B) being less than or equal to (5). The invention also relates to a composition for stripping the artificial colour from keratin fibres, comprising at least one suitably selected sulfinic acid derivative and at least one thickener chosen from anionic polymers and nonionic polymers. The compositions used in the context of the invention afford efficient stripping, especially in terms of power, of the artificial colour of keratin fibres dyed with a wide range of oxidation dyes and/or direct dyes. They do not induce lightening of the natural base of the keratin fibres and limit the sensitization of the keratin fibres. They apply well to the hair, uniformly, which makes it possible to obtain regular stripping of the colour along the entire fibre. | 2013-10-10 |
20130266530 | METHOD OF COLOURING HAIR FIBRES - Hair colourant formulations fall into three main categories designated permanent, semi-permanent and temporary. Permanent hair colourant formulations are oxidative dye systems and generally contain paraphenylene diamine (PPD) and resorcinol, both of which have been shown to cause sensitisation and mutagenicity. Furthermore, severe oxidising conditions are required which in themselves cause skin irritation and sensitization as well as hair fibre damage. The inventive method addresses the aforementioned disadvantages by providing a method of colouring hair fibres, the method comprising the step of applying a hair colour composition, the hair colour composition comprising: (a) (+)-Catechin, (−)-catechin, (+)-epicatechin, (−)-epicatechin or mixtures thereof; (b) A hydrogen peroxide generator or hydrogen peroxide; and (c) A peroxidase and; wherein the composition has a pH of 4.5 to 7.0, preferably less than or equal to 6.0. | 2013-10-10 |
20130266531 | PERSONAL CARE COMPOSITIONS INCLUDING AQUEOUS COMPOSITIONS OF VISCOELASTIC SURFACTANTS AND HYDROPHOBICALLY MODIFIED POLYMERS - Personal care compositions, methods for making and uses thereof include an aqueous viscoelastic composition and a personal care active ingredient. The viscoelastic composition includes at least one surfactant and at least one hydrophobically-modified polymers with low molecular weights. | 2013-10-10 |
20130266532 | ORGANIC FERTILIZER COMPOSITION, AND METHOD FOR PREPARING SAME - An organic fertilizer composition which can be used as organic compost, and a method for preparing the composition. The organic fertilizer composition can be used as compost alone or together with well-known compost. The organic fertilizer composition is prepared by: a culturing step of mixing either grape sugar, starch syrup, brown sugar, or molasses, or a mixture thereof with plant leaves selected from among those of grass, vegetables, or herbs, or a mixture thereof, adding salt to the resultant mixture to obtain a first fermented mixture, and culturing the first fermented mixture at a temperature of 20 to 60° C. for 24 hours to 1 year; a propagation step of mixing together the first fermented mixture, water, and either grape sugar, starch syrup, brown sugar, or molasses, or a mixture thereof, adding salt to the resultant mixture to obtain a second fermented mixture, and propagating the second fermented mixture at a temperature of 20 to 40° C.; and a mass propagation step of mixing together the second fermented mixture, water, and either grape sugar, starch syrup, brown sugar, or molasses, or a mixture thereof, adding salt to the resultant mixture to obtain a third fermented mixture, and mass-propagating the third fermented mixture at a temperature of 20 to 40° C. for 1 to 12 hours, wherein said mass propagation step is optional. The organic fertilizer composition can be variously used as animal feed, a soil conditioner, a water quality improvement agent, livestock feed, a malodor scavenger, etc. | 2013-10-10 |
20130266533 | SULFONE POLYMER COMPOSITIONS - Sulfone-containing copolymers and copolymer networks and compositions including sulfone-containing copolymers and copolymer networks may be used to bind target ions, such as phosphorous-containing compounds in the gastrointestinal tract of animals. In some cases, sulfone-containing copolymers and copolymer networks may be derived from a multi-amine-monomer and a multifunctional sulfonyl-containing monomer comprising two or more amine-reactive groups. | 2013-10-10 |
20130266534 | METHOD FOR PRODUCING AND USING A COPOLYMER OF SODIUM CARBOXYMETHYL CELLULOSE AND GOSSYPOL - The invention relates to the field of organic chemistry, pharmacology and medicine and concerns a method for producing a copolymer of sodium carboxymethyl cellulose and gossypol having the formula (I), as well as the use thereof in a combined treatment for patients with autistic spectrum disorders and cognitive impairment. | 2013-10-10 |
20130266535 | METHYL SALICYLATE-BASED ATTRACTANTS FOR VECTORS OF CITRUS GREENING DISEASE - The present invention is directed to an insect attractant having an amount of methyl salicylate effective to attract a plurality of vectors of | 2013-10-10 |
20130266536 | METHOD OF USE OF STABILIZED PLANT-DERIVED GROWTH FACTOR IN SKIN CARE - Cosmetic and dermatologic compositions for skin care, containing a transgenic plant extract containing a growth factor, or a growth factor purified from transgenic plants, or a mixture of growth factors derived from transgenic plants as extracts or in purified form, for use in topical therapeutics, dermatology and cosmetics. Importantly this invention provides stabilized, safer growth factors available for use for cosmetic and topical treatment. Preferred composition comprises a plant-produced growth factor and hyaluronic acid. The skin-care/dermatological compositions with stabilized growth factor do not carry the risk of unwanted breakdown products and the resulting loss of activity of the composition. Furthermore, the composition is without contaminants and transmissible agents that can result from animals or animal or bacterial cell based expression systems. | 2013-10-10 |
20130266537 | MOESIN MODULATORS AND USES THEREOF - The present application provides compositions and methods useful for treating and diagnosing diseases and disorders associated with moesin activation. | 2013-10-10 |
20130266538 | Solid Forms of a Thiophosphoramidate Nucleotide Prodrug - The present application relates to solid state forms, for example, crystalline forms of 2′-C-methyluridine-5′-(O-phenyl-N—(S)-1-(isopropoxycarbonyl)ethyl)thiophosphoramidate, pharmaceutical compositions that can include one or more solid forms of 2′-C-methyluridine-5′-(O-phenyl-N—(S)-1-(isopropoxycarbonyl)ethyl)thiophosphoramidate, and methods of treating or ameliorating diseases and/or conditions with one or more solid forms of 2′-C-methyluridine-5′-(O-phenyl-N—(S)-1-(isopropoxycarbonyl)ethyl)thiophosphoramidate. Also disclosed herein are methods of treating diseases and/or conditions with one or more solid forms of 2′-C-methyluridine-5′-(O-phenyl-N—(S)-1-(isopropoxycarbonyl)ethyl)thiophosphoramidate in combination with one or more other agents. | 2013-10-10 |
20130266539 | PROBIOTIC RECOLONISATION THERAPY - The present invention relates to pharmaceutical compositions suitable for the treatment of chronic diseases associated with the presence of abnormal or an abnormal distribution of microflora in the gastrointestinal tract of a mammalian host, which compositions comprise viable non-pathogenic or attenuated pathogenic Clostridia. The compositions further comprise one or more additional viable non-pathogenic or attenuated pathogenic microorganisms selected from the group consisting of | 2013-10-10 |
20130266540 | MAPK INHIBITION BY H2 - A method of treating and protecting a subject from endotoxin shock by administering a composition including hydrogen, releasing hydrogen in the subject, and down-regulating production of TNF-α and IL-6. A method of treating inflammation in a subject. A method of suppressing hydroxyl radical in a subject. A method of treating inflammation in a subject. A method of reducing the basal level of phosphorylation of MAPKs in non-stimulated monocyte lineage cells in a subject. Methods of performing drug screen tests for compounds that can treat the above conditions. A diagnostic method for diagnosing patients with diseases caused by the MAPK pathway. | 2013-10-10 |
20130266541 | HUMAN INDUCED PLURIPOTENT STEM CELLS - The present invention relates generally to the field of stem cells and, more particularly, to reprogramming blood cells to pluripotent stem cells. In a specific embodiment, a method for producing an induced pluripotent stem cell from a human myeloid progenitor cell comprising the steps of (a) activating the human myeloid progenitor cell by incubation with hematopoietic growth factors; (b) transfecting the activated progenitor cells with a non-viral vector expressing one or more pluripotency factors; and (c) co-culturing the transfected cells with irradiated mesenchymal bone marrow stromal cells. | 2013-10-10 |
20130266542 | Compositions and Methods of Using Living and Non-Living Bioactive Devices with Components Derived From Self-Renewing Colony Forming Cells Cultured and Expanded In Vitro - The invention relates to methods and uses of cells for the prevention and treatment of a wide variety of diseases and disorders and the repair and regeneration of tissues and organs using low passage and extensively passaged in vitro cultured, self-renewing, colony forming somatic cells (CF-SC). For example, adult bone marrow-derived somatic cells (ABM-SC), or compositions produced by such cells, are useful alone or in combination with other components for treating, for example, cardiovascular, neurological, integumentary, dermatological, periodontal, and immune mediated diseases, disorders, pathologies, and injuries. | 2013-10-10 |
20130266543 | Multipotent Adult Stem Cell Population - The present invention relates to the identification, isolation, expansion and characterization of a specific type of adult stem cell. These adult stem cells are characterized in that they naturally express many of the markers of totipotency, which have hitherto generally been limited to embryonic cell populations. The cells of the invention display an unprecedented capacity for multi potency; they are able to differentiate into cell types of mesodermal, endodermal and ectodermal origin. These adult stem cells may be used as therapeutic agents including, without limitation, for the regeneration of tissue, particularly for regeneration of damaged cardiac tissue, such as myocardium. | 2013-10-10 |
20130266544 | Osteogenic Differentiation Of Bone Marrow Stem Cells And Mesenchymal Stem Cells Using A Combination Of Growth Factors - The invention relates to methods for osteogenic differentiation of human bone marrow stem cells (BMSC) or mesenchymal stem cells (MSC), in particular using human plasma or serum and FGF and TGFB growth factors. The invention also provides the so-obtained cells and cell populations, as well as further products comprising such and uses thereof in bone therapy. | 2013-10-10 |
20130266545 | METHODS FOR IMPROVED WOUND CLOSURE EMPLOYING OLIVAMINE AND HUMAN UMBILICAL VEIN ENDOTHELIAL CELLS - The present disclosure relates to compositions for and methods of improving wound healing, including compositions for and methods of treating chronic wounds, and compositions for the inhibition and treatment of necrosis and extended quiescence that result in cellular necrosis instead of normal proliferation. The methods for wound healing administer one or more compositions including hydroxytyrosol and oleuropein with cells derived from umbilical cord blood. | 2013-10-10 |
20130266546 | Compositions for Regenerating Defective or Absent Myocardium - Compositions of the invention for regenerating defective or absent myocardium comprise an emulsified or injectable extracellular matrix composition. The composition may also include an extracellular matrix scaffold component of any formulation, and further include added cells, proteins, or other components to optimize the regenerative process and restore cardiac function. | 2013-10-10 |
20130266547 | Compositions for Regenerating Defective or Absent Myocardium - Compositions of the invention for regenerating defective or absent myocardium comprise an emulsified or injectable extracellular matrix composition. The composition may also include an extracellular matrix scaffold component of any formulation, and further include added cells, proteins, or other components to optimize the regenerative process and restore cardiac function. | 2013-10-10 |
20130266548 | Compositions for Regenerating Defective or Absent Myocardium - Compositions of the invention for regenerating defective or absent myocardium comprise an emulsified or injectable extracellular matrix composition. The composition may also include an extracellular matrix scaffold component of any formulation, and further include added cells, proteins, or other components to optimize the regenerative process and restore cardiac function. | 2013-10-10 |
20130266549 | HIGHLY BIOCOMPATIBLE DUAL THERMOGELLING CHITOSAN/GLUCOSAMINE SALT COMPOSITION - The present disclosure relates to a chitosan solution neutralized with amino-sugar carbonate buffering solution or amino-sugar phosphate buffering solution or phosphorylated aminosugar buffering solution. The resulting themogelling chitosan composition is highly biocompatible, isotonic and has the ability to rapidly turn into gel upon heating to the body temperature. It provides a novel chitosan-based composition to suitable for drug delivery, cell delivery and repair or regeneration of tissues and organs as well as other clinical treatment. | 2013-10-10 |
20130266550 | DIAGNOSTIC METHOD FOR CONNECTIVE TISSUE AND ITS APPLICATION - The present invention relates to medicine and is used to evaluate conditions and to detect connective tissue pathology (and/or organ) by clonal analysis. The present invention relates to aesthetic medicine and is used for correction of aging skin changes. The method includes: cultivation of substrate-dependent cell colonies of analyzed tissue and/or organ, at conditions which provide formation of discrete colonies applicable for visualization, statistically reliable analysis of derived colonies, determination of at least one parameter which characterizes regenerative potential of population of substrate dependent cells, determination of at least one parameter which characterizes proliferative potential of population of substrate dependent cells, and processing of obtained results which allows to evaluate regenerative ability of patient's tissue and/or organ. The method provides objective qualitative characteristics of both the proliferative and regenerative potential which allows evaluating the regenerative potential of primary tissue (and/or organ) without complex and expensive instrumental studies. A computer based system for performing the present method is also provided. | 2013-10-10 |
20130266551 | CHIMERIC RECEPTORS WITH 4-1BB STIMULATORY SIGNALING DOMAIN - The present invention relates to a chimeric receptor capable of signaling both a primary and a co-stimulatory pathway, thus allowing activation of the co-stimulatory pathway without binding to the natural ligand. The cytoplasmic domain of the receptor contains a portion of the 4-1BB signaling domain. Embodiments of the invention relate to polynucleotides that encode the receptor, vectors and host cells encoding a chimeric receptor, particularly including T cells and natural killer (NK) cells and methods of use. | 2013-10-10 |
20130266552 | LIQUID SURFACTANT PREPARATION CONTAINING LIPASE AND PHOSPHONATE - A liquid surfactant preparation comprises a phosphonate and has an advantageous lipolytic activity. This is achieved by using a lipase that is naturally present in a microorganism, the microorganism being | 2013-10-10 |