Kashi
Amin Kashi, Dearborn, MI US
Patent application number | Description | Published |
---|---|---|
20110196592 | METHOD AND DEVICE FOR ASSISTING A LANE CHANGE OF A VEHICLE - A method for operating an automatic speed control system of an automotive vehicle. Initially, in a normal follow mode, a setpoint distance between the vehicle and a preceding vehicle is set to a first value d | 08-11-2011 |
Amin Kashi, Ann Arbor, MI US
Asaf Kashi, Bellevue, WA US
Patent application number | Description | Published |
---|---|---|
20090119500 | Managing software configuration using mapping and repeatable processes - The embodiments described herein generally relate to a method and system of injecting automated repeatable processes, or workflows, into software configuration management sequences. The benefits of such a system include the ability to delegate configurability change abilities to an IT administrator while still maintaining efficiency and management control over such changes. A request made by a system administrator to process configuration data may be subject to multiple phases of processing, such as, authentication, authorization, and action. A declarative mapping associates workflows, or meaningful repeatable processes, with the configuration process request criteria and processing phase. The mapping may be created by, or at the direction of, management through the application of the processing concept in API or UI. Upon a triggering event, e.g., receiving a configuration processing request, a stored mapping based on the attributes of the principal and request type may be consulted to determine the workflows which may then execute. | 05-07-2009 |
20130198618 | EDUCATING USERS AND ENFORCING DATA DISSEMINATION POLICIES - An authoring component determines the sensitivity of an authored document and generates a user interface conveying contextual educational information about data dissemination policies that apply to the document. The user interface also provides user input mechanisms that allow the user to provide inputs affect the enforcement of a given data dissemination policy on the document. | 08-01-2013 |
20150026763 | EDUCATING USERS AND ENFORCING DATA DISSEMINATION POLICIES - An authoring component determines the sensitivity of an authored document and generates a user interface conveying contextual educational information about data dissemination policies that apply to the document. The user interface also provides user input mechanisms that allow the user to provide inputs affect the enforcement of a given data dissemination policy on the document. | 01-22-2015 |
Avi Kashi, Marlboro, NJ US
Patent application number | Description | Published |
---|---|---|
20090167529 | Electronic fence using wireless mesh network - The current problem in protecting a secure area which can be a border between countries, Federal facility, Army deployment or even a house is that we are relying for the most part on a fence, cameras, electric fence, which takes a longer time to install. It is very expensive and cannot locate the point of entry. Sometime it is too late to react if someone cuts the fence and enters the secure area. My patent is to provide a very fast solution, early detection, identify the location of entry and all wireless systems which will allow implementing this idea in any location even in enemy fields where you wish to protect troops, army facilities and more. | 07-02-2009 |
Kamran Kashi, Centreville, VA US
Patent application number | Description | Published |
---|---|---|
20120059899 | Communications-Network Data Processing Methods, Communications-Network Data Processing Systems, Computer-Readable Storage Media, Communications-Network Data Presentation Methods, and Communications-Network Data Presentation Systems - Communications-network data processing methods include receiving a request to perform an action involving data associated with a configuration of a communications network or a behavior of the communications network and in response to the receiving of the request, performing the action. Communications-network data presentation methods include receiving information indicating a source of data characterizing a communications network and a desired presentation format of the data, accessing the source to obtain the data characterizing the communications network, and presenting the data according to the desired presentation format. | 03-08-2012 |
Kamran Kashi, Melbourne Beach, FL US
Patent application number | Description | Published |
---|---|---|
20130150074 | Crime Investigation Methods, Evidence Generation Methods, And Wireless Communications System Analysis Methods - Crime investigation methods, evidence generation methods, and wireless communications system analysis methods are described. According to one aspect, a crime investigation method includes receiving information regarding a commission of a crime at a time period of interest and at a geographic location of interest, after the receiving and using wireless communications analysis equipment, measuring cellular signals in a geographic area which includes the geographic location of interest during the time period of interest, as a result of the measuring, generating measurement data which is indicative of a parameter of the cellular signals in the geographic area, using the measurement data, calculating a wireless coverage representation for the geographic area and which includes the geographic location of interest, accessing cellular communications records which are indicative of communications via the cellular signals in the geographic area, and using the cellular communications records and the wireless coverage representation, providing information regarding the crime. | 06-13-2013 |
Keiwan Kashi, Duesseldorf DE
Patent application number | Description | Published |
---|---|---|
20150096826 | METHOD OF CONTROLLING AN ELECTRIC MOTOR OF A POWER STEERING SYSTEM, AND POWER STEERING SYSTEM - A method of controlling an electric motor of a power steering system having at least three windings is described, wherein a control unit applies a current to the windings of the electric motor to generate a total torque having a value which is ascertained by the control unit from a set-point torque for steering assistance and a set-point torque for damping. A damping set-point circuit ascertains the set-point torque for damping and a steering assist set-point circuit ascertains the set-point torque for steering assistance. A monitoring circuit monitors the function of the windings of the electric motor. In the event of a malfunction of any of the windings, the monitoring circuit outputs an error signal, upon which the set-point torque for steering assistance is reduced. | 04-09-2015 |
Keiwan Kashi, Dusseldorf DE
Patent application number | Description | Published |
---|---|---|
20120091679 | Active Chassis Stabilization System - The invention relates to an active chassis stabilization system including a hydraulic actuator, a pump for acting upon the actuator with a hydraulic pressure, a reservoir for receiving hydraulic fluid, and a return line for a fluid flow from the actuator to the reservoir. Provided in the return line is a check valve which blocks the fluid flow from the reservoir to the actuator and allows the fluid flow from the actuator to the reservoir as of a predeterminable return pressure. | 04-19-2012 |
Mieko Kashi, Kanagawa JP
Patent application number | Description | Published |
---|---|---|
20090165824 | Cleaning apparatus for cleaning component part of magnetic disk drive and cleaning method of cleaning component part of magnetic disk drive - Embodiments of the present invention improve the efficiency of a cleaning process for cleaning a component part of a magnetic disk drive in a magnetic disk drive manufacturing line. According to one embodiment, a magnetic disk part cleaning apparatus is included in a head stack assembly (HSA) cleaning line for cleaning head stack assemblies of magnetic disk drives included in a magnetic disk drive manufacturing line. The magnetic disk part cleaning apparatus is disposed between a HSA assembly line for assembling a head stack assembly, and head disk assembly (HDA) assembly line for assembling a head disk assembly including the head stack assembly and is connected directly to at least either of the HSA assembly line and the HDA assembly line. | 07-02-2009 |
Mieko Kashi, Yokohama JP
Patent application number | Description | Published |
---|---|---|
20090011597 | MASS PRODUCTION METHOD OF SEMICONDUCTOR INTEGRATED CIRCUIT DEVICE AND MANUFACTURING METHOD OF ELECTRONIC DEVICE - In order to prevent the contamination of wafers made of a transition metal in a semiconductor mass production process, the mass production method of a semiconductor integrated circuit device of the invention comprises the steps of depositing an Ru film on individual wafers passing through a wafer process, removing the Ru film from outer edge portions of a device side and a back side of individual wafers, on which said Ru film has been deposited, by means of an aqueous solution containing orthoperiodic acid and nitric acid, and subjecting said individual wafers, from which said Ru film has been removed, to a lithographic step, an inspection step or a thermal treating step that is in common use relation with a plurality of wafers belonging to lower layer steps (an initial element formation step and a wiring step prior to the formation of a gate insulating film). | 01-08-2009 |
20120009800 | MASS PRODUCTION METHOD OF SEMICONDUCTOR INTEGRATED CIRCUIT DEVICE AND MANUFACTURING METHOD OF ELECTRONIC DEVICE - In order to prevent the contamination of wafers made of a transition metal in a semiconductor mass production process, the mass production method of a semiconductor integrated circuit device of the invention comprises the steps of depositing an Ru film on individual wafers passing through a wafer process, removing the Ru film from outer edge portions of a device side and a back side of individual wafers, on which said Ru film has been deposited, by means of an aqueous solution containing orthoperiodic acid and nitric acid, and subjecting said individual wafers, from which said Ru film has been removed, to a lithographic step, an inspection step or a thermal treating step that is in common use relation with a plurality of wafers belonging to lower layer steps (an initial element formation step and a wiring step prior to the formation of a gate insulating film). | 01-12-2012 |
Mostafa Kashi, Sunnyvale, CA US
Patent application number | Description | Published |
---|---|---|
20100057970 | METHOD AND APPARATUS TO COMBINE POWER AND CONTROL SIGNALS IN A MOBILE COMPUTING DEVICE - A mobile computing device is described that includes multiple device components, a power supply and a power line connected to each device component. The power supply is operative to provide power signals to the device components over the power lines. The mobile computing device also includes a processor operative to generate a control signal for one or more device components. A power line communications control module is connected to the power supply and the processor, the power line communications control module is operative to receive a power signal and a control signal for a device component, combine the power signal and control data from the control signal to form a power data signal, and send the power data signal to the device component over a corresponding power line. Other embodiments are described and claimed. | 03-04-2010 |
20120202375 | SMALL FORM FACTOR COMPUTING DEVICE WITH CONNECTOR ASSEMBLY TO INTERCONNECT SLIDING HOUSING SEGMENTS - A mobile computing device is disclosed. The mobile computing device comprises two housing segments that each contains a set of electrical components. The housing segments are slideably coupled to each other to move between a first position and a second position. The mobile computing device also comprises a cable connector that connects the sets of electrical components together. The cable connector is configured to include three connector structures that are each configured to mate with a connector. A first connector structure is configured to mate with a first connector of the first housing segment in connecting to the first set of electrical components. Similarly, a second connector structure is configured to mate with a first connector of the second housing segment in connecting to a first portion of the second set of electrical components. The third connector structure is configured to mate with a second connector of the second housing segment in connecting to a second portion of the second set of electrical components. | 08-09-2012 |
Naoki Kashi, Hyogo JP
Patent application number | Description | Published |
---|---|---|
20120177550 | CATALYTIC REACTOR - A catalytic reactor includes a pair of plates arranged in parallel at a predetermined interval so as to form a path in which fluid flows; a channel member bonded to the plates in the path to divide the path into channels; and a catalyst carrier inserted into each of the channels and extending along the each of the channels. At least one of the pair of plates serves as a first heat-transfer surface when contacting a temperature medium having a temperature zone different from a temperature zone in the path and exchanging heat with the temperature medium. Each of the channels has a cross section for which an aspect ratio (W/H) of a width to a height is equal to or less than 1, and the catalyst carrier includes a wave-shaped base having a single piece structure, and a catalyst formed on a surface of the base. | 07-12-2012 |
Ori Kashi, Seattle, WA US
Patent application number | Description | Published |
---|---|---|
20140019423 | DATA LINEAGE ACROSS MULTIPLE MARKETPLACES - Tracking lineage of data. A method may be practiced in a network computing environment including a plurality of interconnected systems where data is shared between the systems. A method includes accessing a dataset. The dataset is associated with lineage metadata. The lineage metadata includes data indicating the original source of the data, one or more intermediary entities that have performed operations on the dataset, and the nature of operations performed on the dataset. A first entity performs an operation on the dataset. As a result of performing a first operation on the dataset, the method includes updating the lineage metadata to indicate that the first entity performed the operation on the dataset. The method further includes providing functionality for determining if the lineage metadata has been compromised in that the lineage metadata has been at least one of removed from association with the dataset, is corrupted, or is incomplete. | 01-16-2014 |
Rajanikanth Nagaraj Kashi, Bangalore IN
Patent application number | Description | Published |
---|---|---|
20140067171 | SYSTEMS AND METHODS FOR GRAPHICALLY INDICATING AIRCRAFT ASCENT AND DESCENT CAPABILITIES - Systems and methods are operable to present graphical information indicating capability of an aircraft to change altitude. An exemplary embodiment determines an altitude change capability of the aircraft; determines an altitude change capability icon based on the determined altitude change capability of the aircraft, wherein the altitude change capability icon is defined by at least a leading portion, a trailing portion, a top portion, and a bottom portion, wherein a slope of the leading portion of the altitude change capability icon corresponds to the determined altitude change capability of the aircraft, and wherein the leading portion and the trailing portion are separated by at least the top portion and the bottom portion; and communicates the altitude change capability icon to a display for presentation to the crew of the aircraft. | 03-06-2014 |
Ramanujan Kashi, Magarpatta City IN
Patent application number | Description | Published |
---|---|---|
20110103567 | Customer Service Agent Assisted Social Networks - The present invention comprises a method for: (i) receiving information from a caller C | 05-05-2011 |
20110103568 | Teleconference Scheduling and Activity Reporting Method - A teleconference system is disclosed that monitors the activity levels of one or more attendees of a teleconference and, based on that monitoring, provides information about attendees who are active participants and attendees who are passive listeners. The information includes evaluative feedback or a conference roster that is ordered based on the activity levels of the attendees, or both. Furthermore, the teleconference system takes into account that the potential invitees to a teleconference being scheduled can be different from one another in terms of their importance to a teleconference being scheduled, or in terms of the relevance of the teleconference to those invitees. The system is also able to consider the activity levels that are reported for a teleconference in progress when the system schedules a new teleconference. | 05-05-2011 |
20110140904 | Detecting Patterns with Proximity Sensors - A method and system are disclosed for displaying a message on a display. The present subject matter takes into account the movement pattern of an object while displaying the message. | 06-16-2011 |
Ramanujan Kashi, Pune IN
Patent application number | Description | Published |
---|---|---|
20090049544 | Habit-Based Authentication - A method for authentication is disclosed. During use, the observed usage of the device is compared to an expected pattern of usage of the device. Deviation between the observed and expected usage indicates that the user might not be authorized to use the device. If the deviation exceeds a threshold, a credential is required from the user to authenticate itself as the authorized user. | 02-19-2009 |
20110320958 | CONFERENCE RECAP AND RECORDING - A method, system, and device are provided for presenting event views via a calendaring application or the like. In particular, the event view is alterable depending upon whether or not the event currently being viewed is a past event or not. Past events may posses additional attributes not possessed by other events and, therefore, the presentation of a past event and the information related thereto may differ from the presentation of other events. | 12-29-2011 |
Ramanujan Kashi, Thalaghattapura IN
Patent application number | Description | Published |
---|---|---|
20140314226 | EXTERNAL CONTACT CENTER DATA COLLECTION AND MEASUREMENT - External queue monitoring of contact center queues is provided as a means that may better service the customer and measure service level objectives. External queue monitoring provides the opportunity for real-time monitoring of the queue and modification of contact center operations, such as devices routing queue members, in response to queuing or enqueued customers. | 10-23-2014 |
Ramanujan Kashi, Bangalore IN
Patent application number | Description | Published |
---|---|---|
20140372908 | SYSTEMS AND METHODS FOR ENHANCED CONFERENCE SESSION INTERACTION - Disclosed herein are systems, methods, and non-transitory computer-readable storage media for enhancing presenter and participant interaction in a presentation. A system configured to practice the method can receive, from a viewer of an electronic presentation, a submission of a question and a selection of a communication mode for the question. The system can identify a portion of the presentation to which the question is directed, and update the portion of the electronic presentation to incorporate the question based on the communication mode. The electronic presentation can be a slide show, such as a PowerPoint™ presentation. The system can optionally notify a presenter in the electronic presentation that the portion has been updated. | 12-18-2014 |
Ramanujan S. Kashi, Bangalore IN
Patent application number | Description | Published |
---|---|---|
20140092140 | SCREEN RESIZE FOR REDUCING POWER CONSUMPTION - Embodiments disclosed herein provide systems, methods, and software for dynamically managing power consumption of a device capable of operating on battery power, or other power. In particular, the size of the viewable area of the display may be dynamically controlled to reduce the number of activated pixels to reduce power consumption. The resizing of the viewable area of a screen may also reduce the number of applications running, thereby reducing power consumption. An indication of the amount of operation time, battery indicator, and/or energy left in the battery may be presented, based at least in part on the dynamic resize of the display. | 04-03-2014 |
20140156768 | METHODS AND SYSTEMS FOR REAL-TIME PAGING - The present disclosure is directed to methods for sending a real-time message to a recipient, where the sending is accomplished using a pre-existing communication system in communication with at least one of multiple application gateways or multiple networks, and systems including a paging engine; a first application gateway; and an administrative portal; where the paging engine, the first application gateway, and the administrative portal are configured to send a real-time message to a recipient, where the sending is accomplished a pre-existing communication system in communication with at least one of multiple application gateways or multiple networks. | 06-05-2014 |
20140232814 | SYSTEM AND METHOD FOR MANAGING A PRESENTATION - The system and method capture an image of a presenter of a presentation. The image of the presenter may be a still image or a video stream. In one embodiment, the image of the presenter has the background removed. An image of the presentation is captured. The image of the presentation may be a still image or a video stream. A transition, such as a gesture or movement of the presenter is detected. In response to the detection of the transition, an image of the presenter is superimposed on the image of the presentation to create a combined image. Alternatively, in response to the transition, the image of the presenter is removed from the presentation. The combined image or the image of the presentation with the image of the presenter removed is then sent to participants viewing the presentation. | 08-21-2014 |
Ramesh Kashi, Walnut, CA US
Patent application number | Description | Published |
---|---|---|
20120083446 | NOVEL ALBUMIN-FREE FACTOR VIII FORMULATIONS - An albumin-free Factor VIII formulation comprising, 4% to 10% of a bulking agent selected from the group consisting of mannitol, glycine and alanine; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; 100 mM to 300 mM NaCl; and a buffering agent Alternatively, the formulation can comprise 2% to 6% hydroxyethyl starch; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; 100 mM to 300 mM NaCl; and a buffering agent. In a further embodiment, the formulation can comprise: 300 mM to 500 mM NaCl; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; and a buffering agent. | 04-05-2012 |
20130184216 | NOVEL ALBUMIN-FREE FACTOR VIII FORMULATIONS - A Factor VIII composition formulated without albumin, comprising the following formulation excipients in addition to Factor VIII: 4% to 10% of a bulking agent selected from the group consisting of mannitol, glycine and alanine; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; 100 mM to 300 mM NaCl; and a buffering agent for maintaining a pH of approximately between 6 and 8. Alternatively, the formulation can comprise 2% to 6% hydroxyethyl starch; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; 100 mM to 300 mM NaCl; and a buffering agent for maintaining a pH of approximately between 6 and 8. In a further embodiment, the formulation can comprise: 300 mM to 500 mM NaCl; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; and a buffering agent. | 07-18-2013 |
20150025010 | NOVEL ALBUMIN-FREE FACTOR VIII FORMULATIONS - A Factor VIII composition formulated without albumin, comprising the following formulation excipients in addition to Factor VIII: 4% to 10% of a bulking agent selected from the group consisting of mannitol, glycine and alanine; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; 100 mM to 300 mM NaCl; and a buffering agent for maintaining a pH of approximately between 6 and 8. Alternatively, the formulation can comprise 2% to 6% hydroxyethyl starch; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; 100 mM to 300 mM NaCl; and a buffering agent for maintaining a pH of approximately between 6 and 8. In a further embodiment, the formulation can comprise: 300 mM to 500 mM NaCl; 1% to 4% of a stabilizing agent selected from the group consisting of sucrose, trehalose, raffinose, and arginine; 1 mM to 5 mM calcium salt; and a buffering agent. | 01-22-2015 |
Ramesh Kashi, Andover, MA US
Patent application number | Description | Published |
---|---|---|
20100105870 | Method Of Complexing A Protein By The Use Of A Dispersed System And Proteins Thereof - The present invention relates to methods for complexing a protein in a dispersed medium. Also disclosed are associated proteins produced by the methods of complexing of the present invention. Pharmaceutically effective stabilized protein dosages are also disclosed. The present invention also relates to a method for associating AHF protein in a dispersed medium. | 04-29-2010 |
Ramesh Kashi US
Patent application number | Description | Published |
---|---|---|
20150307606 | LYOPHILIZED SPHERICAL PELLETS OF ANTI-IL-23 ANTIBODIES - Methods for preparing lyophilized pellets of antibodies that specifically bind to human IL-23 are described. The pellets have a substantially spherical shape and are prepared by freezing droplets of a liquid composition of a desired biological material on a flat, solid surface, in particular, a surface that does not have any cavities, followed by lyophilizing the frozen droplets. These methods are useful for preparing lyophilized pellets having a high concentration of anti-IL-23 antibody, and which have a faster reconstitution time than lyophilized powder cakes prepared in vials. Also provided are improved formulations for use in preparing lyophilized forms of antibodies that specifically bind to human IL-23. | 10-29-2015 |
Ramesh Kashi, Warren, NJ US
Patent application number | Description | Published |
---|---|---|
20150307606 | LYOPHILIZED SPHERICAL PELLETS OF ANTI-IL-23 ANTIBODIES - Methods for preparing lyophilized pellets of antibodies that specifically bind to human IL-23 are described. The pellets have a substantially spherical shape and are prepared by freezing droplets of a liquid composition of a desired biological material on a flat, solid surface, in particular, a surface that does not have any cavities, followed by lyophilizing the frozen droplets. These methods are useful for preparing lyophilized pellets having a high concentration of anti-IL-23 antibody, and which have a faster reconstitution time than lyophilized powder cakes prepared in vials. Also provided are improved formulations for use in preparing lyophilized forms of antibodies that specifically bind to human IL-23. | 10-29-2015 |
Ramesh S. Kashi, Andover, MA US
Patent application number | Description | Published |
---|---|---|
20110059041 | Vaccine for treatment and prevention of herpes simplex virus infection - The present invention relates to methods and compositions for the prevention and treatment of herpes virus infections. The invention provides antigenic peptides, and pharmaceutical compositions comprising complexes of antigenic peptides and adjuvants that can activate an immune response against herpes viruses. The invention also provides methods of making the antigenic peptides and complexes of antigenic peptides and adjuvants. Methods of use of the pharmaceutical compositions are also provided. | 03-10-2011 |
Ramesh S. Kashi, Warren, NJ US
Patent application number | Description | Published |
---|---|---|
20110229490 | Lyophilized Formulations of Engineered Anti-IL-23p19 Antibodies - The present invention provides lyophilized formulations of antibodies, such as antibodies that specifically bind to human interleukin-23 p19 (IL-23p19), or antigen binding fragments thereof. | 09-22-2011 |
20140105854 | VACCINE FOR TREATMENT AND PREVENTION OF HERPES SIMPLEX VIRUS INFECTION - The present invention relates to methods and compositions for the prevention and treatment of herpes virus infections. The invention provides antigenic peptides, and pharmaceutical compositions comprising complexes of antigenic peptides and adjuvants that can activate an immune response against herpes viruses. The invention also provides methods of making the antigenic peptides and complexes of antigenic peptides and adjuvants. Methods of use of the pharmaceutical compositions are also provided. | 04-17-2014 |
20150147337 | CRYSTALLINE ANTI-HUMAN IL-23 ANTIBODIES - Crystalline forms of antibodies to human IL-23, such as antibodies to human IL-23p19, are provided, as well as methods of producing such crystalline forms, and uses of such crystalline forms, e.g. in treatment of inflammatory, autoimmune, and proliferative disorders. In various embodiments, the anti-hulL-23 antibody crystals, such as anti-hulL-23p19 antibody crystals of the present invention are obtainable by batch crystallization methods, vapor diffusion methods, liquid-liquid diffusion methods, and dialysis. In other aspects, the invention relates to suspensions of the crystalline anti-hulL-23 antibodies of the present invention, including those at higher concentrations and lower viscosities than would be possible with a corresponding non-crystalline solution at the same concentration of antibody. In other embodiments, the anti-huiL-23 antibody crystals of the present invention have increased stability, i.e. they maintain biological activity of the anti-huiL-23 antibody, such as anti-huiL-23p 19 antibody, longer than corresponding solution formulations. | 05-28-2015 |
20150290325 | LIQUID FORMULATIONS FOR TNFR:Fc FUSION PROTEINS - The invention provides stable liquid formulations for a recombinant biopharmaceutical protein comprising a soluble form of the human p75 TNF receptor fused to an Fe domain of a human immunoglobulin protein (TNFR:Fc). Typically, biopharmaceutical proteins such as monoclonal antibodies (mAbs) and immunoglobulin fusion proteins (e.g., immunoadhesion proteins) are produced by recombinant DNA technology in mammalian cell expression systems. In order to guarantee the reproducible clinical performance of a biopharmaceutical product, manufacturers have to deliver a product of consistent and reproducible quality. | 10-15-2015 |
Ramesh S. Kashi, Kenilworth, NJ US
Patent application number | Description | Published |
---|---|---|
20150329632 | Solution Formulations of Engineered Anti-IL-23p19 Antibodies - The present invention provides high concentration solution formulations of anti-human interleukin-23 p19 (IL-23p19) antibody hum13B8-b, and their use in treating various disorders. | 11-19-2015 |
Rina Kashi, Alfai-Menashe IL
Patent application number | Description | Published |
---|---|---|
20140275215 | ANTI-CLUSTERIN MONOTHERAPY FOR CANCER TREATMENT - The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. | 09-18-2014 |
Satoshi Kashi, Tokyo JP
Patent application number | Description | Published |
---|---|---|
20150134400 | MAINTENANCE PARTS INVENTORY PLANNING SYSTEM, MAINTENANCE PARTS INVENTORY PLANNING SYSTEM SERVER, AND MAINTENANCE PARTS INVENTORY PLANNING SYSTEM CLIENT TERMINAL - A maintenance parts inventory planning system which creates a maintenance parts inventory planning of one or more industrial machines by computer ( | 05-14-2015 |
Shuntaro Kashi, Osaka JP
Patent application number | Description | Published |
---|---|---|
20120327304 | CONTENTS PROCESSING SYSTEM, CONTENTS PROCESSING APPARATUS, AND PROGRAM OF THE APPARATUS - Respective room output functions of an AV amplifier are set as respective devices. A controller receives device information about the devices from the AV amplifier, and can recognize the room output functions of the AV amplifier as different devices. As a result, the user can operate the room output functions of the AV amplifier individually through the controller. | 12-27-2012 |
20130079909 | AUDIO OUTPUTTING APPARATUS AND PROGRAM OF THE SAME - When a media player reproduces a content identical to a content being reproduced by a renderer, the media player obtains, from the media renderer, content information of the content being reproduced by the media renderer. The media player then obtains a content list from a server, and specifies a content having content information identical to content information received from the media renderer as well as its position in the content list. As a result, a user can specify the content being reproduced by the media renderer, and can start reproduction without operating the media player and searching for the content. | 03-28-2013 |
Shuntaro Kashi, Neyagawa-Shi JP
Patent application number | Description | Published |
---|---|---|
20110142259 | VOLUME CONTROL APPARATUS AND PROGRAM OF VOLUME CONTROL APPARATUS - A volume control apparatus that is connectable to a controller and controls a volume value of a sound signal based on an instruction from the controller, comprises: a receiving section for, when a controller-side volume setting value settable in the controller is changed by a user's operation, receiving the changed controller-side volume setting value from the controller; a first difference value calculating section for calculating a first difference value as a difference value between the changed controller-side volume setting value and the controller-side volume setting value before change; a second difference value calculating section for calculating a second difference value as a difference value between a maximum volume value controllable by the controller and a current volume value; and an increase value calculating section for multiplying the second difference value by a ratio of the first difference value to (a maximum value of the controller-side volume setting value−a minimum value of the controller-side volume setting value)) (or to (the maximum value of the controller-side volume setting value−the controller-side volume setting value before change)) so as to calculate an increase value of the volume value. | 06-16-2011 |
20110246771 | CONTENT REPRODUCING APPARATUS AND PROGRAM OF THE SAME - When continuously reproducing a plurality of contents, a content reproducing apparatus determines whether or not a remaining time of an expiration date of a session key is shorter than a total reproduction time of the plurality of contents to be continuously content. When it is determined that the remaining time of the expiration date of the session key is shorter than the total reproduction time of the plurality of contents to be continuously reproduced, a new session key is acquired from a server, and then the plurality of contents are continuously reproduced, using the new session key. When it is determined that the remaining time of the expiration date of the session key is not shorter than the total reproduction time of the plurality of contents to be continuously reproduced, the plurality of contents are continuously reproduced, using the current session key without acquiring the new session key from the server. This can prevent the continuous reproduction of the plurality of contents from being stopped due to the acquisition processing of the session key when the plurality of contents are continuously reproduced. | 10-06-2011 |
Takaharu Kashi, Imizu-Shi JP
Patent application number | Description | Published |
---|---|---|
20140023740 | PRESS-FORMING MOLD AND METHOD FOR MANUFACTURING PROTECTIVE FILM FOR PRESS-FORMING MOLD - A press-forming mold has a protective film for preventing seizing during press-forming formed on at least a forming surface that comes into contact with a formed body. The protective film is formed by PVD. An arbitrary selection section extracted from the surface of the protective film is divided into a plurality of individual sections; and, when the gradient of the surface at the n | 01-23-2014 |
Yechezkei Kashi, Haifa IL
Patent application number | Description | Published |
---|---|---|
20090181028 | B-CELL EPITOPE PEPTIDES OF HSP 65, NOVEL AMINO ACID SEQUENCES, DNA ENCODING THE AMINO ACID SEQUENCES OF SAID PEPTIDES, ANTIBODIES DIRECTED AGAINST SAID PEPTIDES AND DIFFERENT USES THEREOF IN THE TREATMENT OF INFLAMMATORY AND AUTOIMMUNE DISEASES - B-cell epitope peptides of HSP 65, particularly the peptides comprising the amino acid sequence substantially as denoted by SEQ ID: NOs. 1-5 and their biologically functional homologues and derivatives thereof. Also included are polyclonal and monoclonal antibodies directed against them and their compositions for passive immunization against inflammatory and autoimmune diseases and in the treatment of inflammatory and autoimmune diseases. Also encompassed are diagnostic uses of these antibodies, for identifying people at risk of developing arthritis or diabetes, and a method of monitoring progress of the disease conditions and disease prognosis. | 07-16-2009 |
Yechezkel Kashi, Moshav Hayogev - D.n. Megiddo IL
Patent application number | Description | Published |
---|---|---|
20100143964 | COMPOSITIONS AND METHODS FOR CONCENTRATING AND DEPLETING MICROORGANISMS - Methods for concentrating microorganisms in a liquid sample or depleting microorganisms therefrom, utilizing polymeric compounds having affinity to microbial cells that are composed of a plurality of positively charged amino acid residues and two or more hydrophobic moieties are disclosed. Also disclosed are devices for concentrating and methods for detection and identification microorganisms in a liquid sample. | 06-10-2010 |